HOMOGENEOUS POLYSACCHARIDE WITH IMMUNOREGULATION ACTIVITY AND PREPARATION METHOD THEREOF
20190077886 ยท 2019-03-14
Inventors
Cpc classification
C08B37/0009
CHEMISTRY; METALLURGY
C08B37/0003
CHEMISTRY; METALLURGY
C13K13/007
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a homogeneous polysaccharide with an immunoregulation activity and a preparation method thereof. The homogeneous polysaccharide with the immunoregulation activity is a single chromatographic peak and has a molecular weight of 688050 Da and an optical rotation value of 158.40.5. An infrared spectrum has an -configuration sugar characteristic absorption peak at 847.6 cm.sup.1. Hydrogen-proton characteristic chemical shifts in hydrogen spectra of the polysaccharide are 5.40, 3.95, 3.84 and 3.61. Carbon signal characteristic chemical shifts in carbon spectra are 99.6, 76.6, 73.3, 71.5, 71.1 and 60.4. The homogeneous polysaccharide has an effect of enhancing body immunity, can achieve excellent anti-tumor, antiviral and anti-infection effects and the like in regulation of immunity-related diseases, and has potential development values in drug and health care product industries for treatment and prevention of the diseases.
Claims
1. A homogeneous polysaccharide with immunoregulation activity, the homogeneous polysaccharide being a single chromatographic peak, wherein the homogeneous polysaccharide has a molecular weight of 688050 Da and an optical rotation value of 158.40.5; an infrared spectrum has a characteristic absorption peak at 847.6 cm.sup.1; hydrogen-proton characteristic chemical shifts in hydrogen spectra of the polysaccharide are 5.40 (brs), 3.95 (t, J=7.2 Hz), 3.84(m) and 3.61(m); and carbon signal characteristic chemical shifts in carbon spectra are 99.6, 76.6, 73.3, 71.5, 71.1 and 60.4.
2. The homogeneous polysaccharide with immunoregulation activity according to claim 1, wherein a polysaccharide mass content in the homogeneous polysaccharide is 92-98%; Agilent1200 liquid chromatography is adopted, a refractive index detector RID is used for analyzing, a chromatographic column is TSK-GEL G4000 PWxL, a mobile phase is ultrapure water, a flow velocity is 0.3-1 ml/min, a detector temperature is 30-40 C., a column temperature is 30-50 C., chromatographic analysis is made by a single peak, and retention time is 10-30 min.
3. The homogeneous polysaccharide with immunoregulation activity according to claim 1, wherein a monosaccharide composition in the homogeneous polysaccharide is -D-glucopyranosyl, and the homogeneous polysaccharide has an -configuration and a connection manner of 1.fwdarw.4.
4. The homogeneous polysaccharide with immunoregulation activity according to claim 1, wherein one of a fluorescence labeled product, a carboxymethylation product, a hydroxymethylation product, a hydroxypropylation product, an ethylene glycol product, a propylene glycol product and a polyethylene glycol product is added into the homogeneous polysaccharide.
5. A preparation method of the homogeneous polysaccharide with the immunoregulation activity according to claim 1, comprising the following steps: step 1: performing water heating and extraction, and performing alcohol precipitation to prepare total polysaccharides; grinding a polyperus medicinal material, adding 3 L of deionized water into 300 g of the polyperus, soaking at room temperature for 1 hour, and heating at 100 C. and performing reflux extraction twice, extracting for 1 h each time, filtering, merging filtrates, concentrating to 600 ml, centrifuging at 3000 rpm for 10 min, regulating an ethanol ratio in a supernatant to be greater than 80%, standing overnight at 4 C., filtering the supernatant, precipitating and performing freeze-drying to obtain a crude polysaccharide, adding purified water into the crude polysaccharide to prepare a solution of 25-35 mgmL.sup.1; step 2: removing crude polysaccharide protein by a Sevag method; preparing sugar liquor, chloroform and n-butyl alcohol according to a ratio of 25:4:1, adding a reagent, pouring the above components into a separating funnel, fully shaking for 3 min, standing, layering, removing an organic layer and precipitates, repeatedly removing the protein until a white precipitate is not produced, collecting the supernatant, concentrating to an appropriate volume by using a rotary evaporator, transferring, and performing freeze-drying to obtain a crude polysaccharide without the protein; step 3: performing depigmentation by DEAF-52 cellulose; respectively adding a small amount of deionized water into crude polyperus polysaccharides without proteins in step 2 and dissolving, discoloring using a pretreated DEAE-52 cellulose column of 35X3 cm, eluting with 1 mL/min of ultrapure water and 0.1-0.5% of sodium chloride solution, eluting until any sugar is not detected in effluent by using a phenol-dense sulfuric acid method, collecting the eluant on a peak section, concentrating by using the rotary evaporator, performing freeze-drying, and desalting to obtain a white loose powdered pure polysaccharide; and step 4: refining by a Sephadex G-100 gel column; dissolving the pure polysaccharide prepared in step 3 into distilled water, adding the Sephadex G-100 gel column, eluting with pure water and 0.1-0.5% of sodium chloride solution, controlling flow velocity to 1 ml/min, collecting every 10 mL of the eluant into a tube, and tracking and monitoring by the phenol-dense sulfuric acid method; taking numbers of detection tubes as a horizontal coordinate and taking optical density as a vertical coordinate to draw a polysaccharide elution curve, collecting the eluant on the peak section, performing freeze-drying, and desalting to obtain the homogeneous polysaccharide.
6. The preparation method of the homogeneous polysaccharide with the immunoregulation activity according to claim 5, wherein a pretreatment method of the DEAF-52 cellulose column in the step 3 comprises the following steps: step 1: soaking the cellulose of dried powder in distilled water for 2-5 h, removing impurities and then draining; step 2: soaking the drained cellulose without the impurities in step 1 by using a 0.5 mol/L of HCL solution for 1-3 h, washing with deionized water, regulating a pH to be neutral, and draining; and step 3: soaking the drained cellulose in step 2 in a 0.5 mol/L of NaOH solution for 1-3 h, washing with the deionized water, regulating the pH to be neutral, and draining.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0025] The present invention is further described below in combination with drawings and embodiments.
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
DETAILED DESCRIPTION
[0042] The present invention is further described in detail in combination with drawings. These drawings are simplified schematic diagrams. A basic structure of the present invention is described in a schematic manner only. Therefore, a composition related to the present invention is shown only.
[0043] In the present application, the homogeneous polysaccharide may be extracted from the polyperus, may also be separated from other fungi and plants, or can be obtained by microbial fermentation, artificial synthesis and other means as long as the homogeneous polysaccharide has the molecular weight and physic-chemical spectral characteristics. Achieved effects include effects of obviously promoting NO secretion of macrophage, obviously increasing expressions of macrophages of IL-1, IL-6 and TNF- as well as genes of iNOS and proteins of iNOS and COX-2 and increasing expressions of macrophage membrane surface receptors of CD11b, CD16/32, CD40, CD14, CD284 and CD282 as well as expressions of P-P38 and P-P65 protein tyrosine phosphorylation. The homogeneous polysaccharide has potential development values in drug and health care products for treatment and prevention of the diseases. The homogeneous polysaccharide may be developed and prepared into any formulation in pharmacy and is used for preventing and treating autoimmunity-related diseases in a single or composite medication form, including anti-aging, anti-tumor, anti-infection, antiviral and autoimmune diseases. The homogeneous polysaccharide in the present application can be used for regulations of all activated nitric oxide synthaes and NO expressions and activated CD14/TRL4/P38 and TRL2/NF-kB path-related anti-tumor, antiviral, anti-infection and immunity related diseases.
[0044] The homogeneous polysaccharide is a single chromatographic peak and has a molecular weight of 688050 Da and an optical rotation value of 158.40.5. An infrared spectrum has a characteristic absorption peak at 847.6 cm1. Hydrogen-proton characteristic chemical shifts in hydrogen spectra of the polysaccharide are 5.40brs, 3.95t, J=7.2 Hz, 3.84m and 3.61m. Carbon signal characteristic chemical shifts in carbon spectra are 99.6, 76.6, 73.3, 71.5, 71.1 and 60.4.
[0045] A polysaccharide mass content in the homogeneous polysaccharide is 92-98%; Agilent1200 liquid chromatography is adopted, a refractive index detector RID is used for analyzing, a chromatographic column is TSK-GEL G4000 PWxL, a mobile phase is ultrapure water, a flow velocity is 0.3-1 ml/min, a detector temperature is 30-40 C., a column temperature is 30-50 C., chromatographic analysis is a single peak, and retention time is 10-30 min. A monosaccharide composition in the homogeneous polysaccharide is -D-glucopyranosyl, and the homogeneous polysaccharide has an -configuration and a connection manner of 1.fwdarw.4. One of a fluorescence labeled product, a carboxymethylation product, a hydroxymethylation product, a hydroxypropylation product, an ethylene glycol product, a propylene glycol product and a polyethylene glycol product is added into the homogeneous polysaccharide.
[0046] A preparation method of the homogeneous polysaccharide with the immunoregulation activity includes the following steps: step 1: performing water heating and extraction, and performing alcohol precipitation to prepare total polysaccharides; grinding the polyperus medicinal material, adding 3 L of deionized water into 300 g of the polyperus, soaking at room temperature for 1 hour, and heating at 100 C. and performing reflux extraction twice, extracting for 1 h each time, filtering, merging filtrates, concentrating to 600 ml, centrifuging at 3000 rpm for 10 min, regulating an ethanol ratio in a supernatant to be greater than 80%, standing overnight at 4 C., filtering the supernatant, precipitating and performing freeze-drying to obtain a crude polysaccharide, adding purified water into the crude polysaccharide to prepare a solution of 30 mgmL.sup.1; step 2: removing crude polysaccharide protein by a Sevag method; preparing sugar liquor, chloroform and n-butyl alcohol according to a ratio of 25:4:1, adding a reagent, pouring into a separating funnel, fully shaking for 3 min, standing, layering, removing an organic layer and precipitates, repeatedly removing the protein until a white precipitate is not produced, collecting the supernatant, concentrating to an appropriate volume by using a rotary evaporator, transferring, and performing freeze-drying to obtain a crude polysaccharide without the protein; step 3: performing depigmentation by DEAE-52 cellulose; respectively adding a small amount of water into crude polyperus polysaccharides without proteins and dissolving, discoloring using a pretreated DEAE-52 cellulose column of 353 cm, eluting with 1 mL/min of ultrapure water and 0.1-0.5% of sodium chloride solution, eluting until any sugar is not detected in effluent by using a phenol-dense sulfuric acid method, collecting eluant on a peak section, concentrating by using the rotary evaporator, performing freeze-drying, and desalting to obtain a white loose powdered pure polysaccharide; and step 4: refining by a Sephadex G-100 gel column; dissolving an appropriate amount of the pure polysaccharide into distilled water, adding the Sephadex G-100 gel column, eluting with pure water and 0.1-0.5% of sodium chloride solution, controlling flow velocity to 1 ml/min, collecting every 10 mL of the eluant into a tube, and tracking and monitoring by the phenol-dense sulfuric acid method; taking numbers of detection tubes as a horizontal coordinate and taking optical density as a vertical coordinate to draw a polysaccharide elution curve, collecting the eluant on the peak section, performing freeze-drying, and desalting to obtain the homogeneous polysaccharide.
[0047] A pretreatment method of the DEAE-52 cellulose column in the step 3 includes the following steps: step 11: soaking the cellulose of the dried powder in distilled water for 2-5 hours, removing impurities and draining; step 22: soaking with a 0.5 mol/L of HCL solution for 1-3 hours, washing with deionized water, regulating a pH to be neutral, and draining; and step 33: soaking the drained cellulose in a 0.5 mol/L of NaOH solution for 1-3 hours, washing with the deionized water, regulating the pH to be neutral, and draining.
[0048] By detecting the polyperus polysaccharide prepared by the above method, the polysaccharide content is 96.73%. As shown in
[0049] Molecular-weight determination and structural identification of the polyperus polysaccharide are as follows:
[0050] The molecular weight and monosaccharide composition of the separated and prepared polyperus polysaccharide are determined by an entrusted third-party detection institution. As shown in
[0051] Attribution of 1H-NMR (400 MHz, D2O): 5.40 ppm is a D-galactopyranose terminal hydrogen proton signal. A chemical shift value is greater than 5.0, and a broad single peak indicates that a connection manner of glucoside bonds is an configuration; and a characteristic absorption peak exists at 847.6 cm.sup.1 in the infrared (IR) spectrum and a determined optical rotation value is a great specific rotation positive number (25 D=+158.40.5 (c=2.5, H.sub.2O)). All of the above may be further confirmed. Other hydrogen chemical shift intervals on the polysaccharide are in a range of 3.61-3.98 and are other proton signals on saccharide ring carbon, and the chemical shift values are all less than 4.0, which indicates that the polysaccharide does not have any other sugar residue anomeric hydrogen signal. Six main carbon signals are shown in a 13C-NMR (100 MHz, D2O) spectrum, and chemical position values of the carbon signals are respectively 99.6, 76.6, 73.3, 71.5, 71.1 and 60.4. In combination with a DEPT 135 spectrum, only 60.4 is a methylene functional group, and others are all methyne functional groups. It is hinted that, the monosaccharide composition of the polysaccharide is glucopyranose, and the methylene at the position 6 is not substituted. Through further combination of HSQC, HMBC and 1H-1H-COSY correlation-spectra analysis, carbon and hydrogen signals in the monosaccharide unit of the main composition of the PPS are subjected to complete attribution, wherein 99.6 is attributable to an anomeric carbon signal of glucose residues, 71.5, 71.1 and 73.3 are respectively glucose-unsubstituted C-2, 3, 5 carbon signals, 76.6 is a substituted C-4 resonance signal, 60.4 is an unsubstituted C-6 carbon signal, and the monosaccharide composition only contains -D-glucopyranosyl, which is consistent with the above GC-MS and IR analysis result. The movement of chemical positions C-1( 99.6) and C-4( 76.6) to a low field shows that, hydroxyls at 1 and 4 positions of the monosaccharide are substituted, a connection manner between the monosaccharides is -1.fwdarw.4 connection, which may be further confirmed by distant correlation of H-1( 5.40) and C-4( 76.6) as well as H-4( 3.61) and C-1( 99.6) in the HMBC spectrum. Other carbon signals with the chemical shift values of 99.7, 76.8, 72.8, 72.6, 71.6 and 69.3 may also be detected in the carbon spectrum, wherein the 69.3 is a substituted C-6 signal which indicates that a branched chain appears at a position O-6, while the 99.7, 76.8, 72.8, 72.6 and 71.6 are branched 1,4,6--D-glucopyranosyl C1-5 carbon signals. However, these signals have low intensity, which indicates that the position O-6 of the PPS has few branches. The above analysis shows that, the polyperus polysaccharide PPS has a main connection manner of 1,4-, and partial branched chains or terminal glycosylated branched chains appear at the position O-6. Main signal values in the 1H-NMR and 13C-NMR spectrums of the PPS are basically consistent with signals in hydrogen and carbon spectra shown in
[0052] Multiple experiments are made on immunomodulatory effects of the PPS by the present applicant. Specific experiments are as follows:
[0053] preparing reagents and materials:
[0054] cells: a murine macrophage cell line RAW264.7, cell line T24 ATCC of human bladder transitional cell carcinoma, preserved and provided by an inventor;
[0055] a high-glucose DMEM medium is purchased from Hyclone Company (batch number: SH3024.01B); Australian fetal calf serum, FBS (Hyclone, USA, batch number:SH30406.02E) double-antibody (GIBCO, USA); a PBS buffer solution (Hyclone, USA, batch number:SH30028.01B); IFN- interferon (Peprotech, USA); Trizol (Invitrogen, USA); a reverse transcription kit Revert Aid First Strand cDNA Synthesis Kit (Thermo, USA); and fluorescent quantitative PCR dye SYBR Green kit (Roche, USA);
[0056] cell culture
[0057] performing conventional culture on the murine macrophage cell line RAW264.7 in DMEM containing 100 ml/L of fetal calf serum and 1% of double-antibody, placing at 37 C., and culturing in a 5% of CO.sub.2 incubator;
[0058] preparation of tumor cell culture supernatant T24
[0059] culturing the cells of the human bladder transitional cell carcinoma cell line T24 in a DMED medium containing 10% of fetal calf serum and 100 U/ml of penicillin streptomycin, and placing in a 5% of CO.sub.2 incubator at 37 C.; culturing T24 cells in logarithmic growth in a culture dish at cell population of 3.510.sup.7 cells/well, adding 18 ml of culture solution, culturing for 48 h until the cells grow to confluence of 90%, and collecting a culture supernatant for later use; and filtering the collected culture supernatant by a filter of 0.22 m, and cryopreserving the filtered culture supernatant in a refrigerator at 80 C. and preserving for later use;
[0060] co-culture of T24 cells and RAW264.7 cells
[0061] culturing the cells in the murine macrophage cell line RAW264.7 in the DMED medium containing 10% of fetal calf serum and 100 U/ml of penicillin streptomycin, and placing in a 5% of CO.sub.2 incubator at 37 C.; and performing co-culture on the RAW264.7 cells in a logarithmic growth period and the T24 supernatant, wherein a culture solution of 40% is the T24 tumor cell culture supernatant.
[0062] An influence of the polyperus polysaccharide PPS on a survival rate of the RAW264.7 cells is tested as follows:
[0063] inoculating RAW264.7 cell suspension into a 96-well plate at a density of 104 cells/well, culturing for 24 h, and then removing old liquid; respectively adding culture media of the PPS with a series of concentrations of 3.09625, 7.8125, 15.625, 31.25, 62.5, 125, 250, 500 and 1000 g/mL; culturing for 24 h; adding 20 L of 50 g.Math.L-1 MTT solution into each well, continuously incubating for 4 h, removing the supernatant, adding 200 L of DMSO into each well, dissolving at room temperature, shaking for 10 min, and then determining an optical density (OD) value at a wavelength of 490 nm in an ELISA analyzer. Each drug concentration is repeated in every 4 wells. A relative survival rate of the cells is calculated, and a formula is as follows: the relative survival rate of the cells=OD490(medication)/OD490(control), wherein the OD490(medication) and the OD490(control) are respectively adsorption values of a cell sample in a medication group and a cell sample in a control group at 490 nm in an MTT experiment. An influence of the PPS on the survival rate of the RAW264.7 macrophages is shown in
[0064] An influence of the PPS on a RAW264.7 macrophage membrane surface molecule in a co-culture system of T24 and RAW264.7 cell is tested as follows:
[0065] performing conventional culture on the murine macrophage cell line RAW264.7 in a DMEM culture solution containing 100 ml/L of fetal calf serum; selecting cells in a logarithmic growth period, performing digestion passage, counting and adjusting cell density, inoculating the cells into a 12-well cell culture plate according to 2.510.sup.5 cells per well, and adding 1 ml of DMEM medium into each well; culturing for 24 h until the cells are completely adherent; removing 0.5 mL of the medium, and adding 0.5 mL of T24 supernatant; after 3 h, respectively adding an IFN- solution with a final concentration of 100 ng/mL and 1, 10 and 100 g/mL of the PPS to act for 24 h; digesting and collecting the cells in a flow tube, adding 2 mL of PBS for washing for 3 times, and centrifuging by 1000 revolutions to remove the supernatant; sequentially adding corresponding flow antibodies of CD16/32-FITC, CD40-PE and CD11b-APC by 5 uL respectively, and taking a corresponding isotype antibody as negative control; keeping in dark at 4 C., incubating for 30 min, washing with PBS, and centrifuging to wash a free flow antibody; and resuspending the cells with 500 uL of PBS and detecting a positive expression rate of an associated membrane surface molecule by a flow cytometer. Results are shown in
[0066] Influences of the polyperus polysaccharide PPS on NO actor secretion and the expression quantity of IL-1, IL-6, TNF- and iNOS mRNA in macrophages RAW264.7 are tested as follows:
[0067] taking macrophages RAW264.7 in a good growing status, performing digestion passage, counting and adjusting cell density, inoculating the cells into a 12-well cell culture plate, adding 1 ml of cell suspension; adding 2.510.sup.5 RAW264.7 cells into each well, culturing in a 5% of CO.sub.2 incubator at 37 C. for 24 h, then adding an IFN- solution with a final concentration of 100 ng/mL into a positive group, and respectively adding PPS with concentrations of 3.09625, 7.8125, 15.625, 31.25, 62.5, 125, 250, 500 and 1000 g/mL into medication groups and culturing for 24 h; culturing the cells in a co-culture group for 24 h, then removing 40% of the supernatant, adding 40% of T24 supernatant, totally culturing for 3 hours, then adding the IFN- solution with the final concentration of 100 ng/mL into the positive group, and respectively adding the PPS with concentrations of 3.09625, 7.8125, 15.625, 31.25, 62.5, 125, 250, 500 and 1000 g/mL into each of the medication groups and culturing for 24 h; and collecting the cell supernatant, and detecting the secretion quantity of the NO cell factor by a Griess method. Experimental results are shown in
[0068] inoculating 2.510.sup.5 cells into the 12-well cell culture plate, culturing for 24 h, removing 40% of the supernatant, adding 40% of the T24 supernatant, culturing for 3 hours, then adding the IFN- solution with the final concentration of 100 ng/mL and the PPS of 1, 10, 100 g/mL and culturing for 24 h; removing the cell supernatant, adding 600 L of Trizol lysate into each well, and collecting the cells; and detecting the expression quantity of genes IL-1, IL-6, TNF- and INOS by an RT-PCR method. Experimental results are shown in
TABLE-US-00001 TABLE1 Primersequences Sense Antisense strand strand Gene (5-3) (5-3) IL-6 TACTCGGCAAACCTAGTGCG GTGTCCCAACATTCATATTG TCAGT INOS CGGCAAACATGACTTCAGGC GCACATCAAAGCGGCCATAG TNF-a GGGGATTATGGCTCAGGGTC CGAGGCTCCAGTGAATTCGG IL-1 CCATGGAATCCGTGTCTTCC GTCTTGGCCGAGGACTAAGG T GAPDH TTTGTCAAGCTCATTTCCTG TGGGATAGGGCCTCTTGC GTATG
[0069] Influences of the polyperus polysaccharide PPS on protein expressions of COX2 and INOS in a co-culture system of T24 and RAW264.7 cells are tested as follows:
[0070] performing conventional culture on the macrophage cell line RAW264.7 in a DMEM culture solution containing 100 ml/L of fetal calf serum; selecting cells in a logarithmic growth period and inoculating in a 6-well cell culture plate; removing 0.8 mL of the medium within 24 h after complete adherence, adding 0.8 mL of a T24 supernatant, and totally culturing for 3 h; and adding the IFN- solution with the final concentration of 100 ng/mL and the PPS of 1, 10, 100 g/mL to act for 24 h. It can be seen from Western-blot data analysis, compared with the control group, the PPS of 1, 10, 100 g/mL respectively has an effect of obviously increasing INOS and COX2 protein tyrosine phosphorylation expressions (
[0071] Study on mechanisms of the PPS that activates macrophage CD14/TRL4/P38MAPK and TRL2/NF-kB related paths:
[0072] performing conventional culture on the murine macrophage cell line RAW264.7 in a DMEM culture solution containing 100 ml/L of fetal calf serum; selecting cells in a logarithmic growth period, performing digestion passage, counting and adjusting cell density, inoculating the cells into a 6-well cell culture plate according to 110.sup.6 cells/well; culturing for 24 h until the cells are completely adherent; removing 0.8 mL of the medium, adding 0.8 mL of T24 supernatant, and culturing for 3 h; respectively adding an IFN- solution with a final concentration of 100 ng/mL and 1, 10 and 100 g/mL of the PPS to act for 24 h; removing the supernatant, adding a pre-cooled PBS buffer solution to wash twice, then adding an appropriate amount of RIPA lysate (adding a phosphatase inhibitor and a protease inhibitor), scraping the cells on ice, centrifuging by 15000g for 15 min, and taking the supernatant, i.e., a total cell protein solution; adding loading buffer and ultrapure water at 100 C. for 10 min. It can be seen from Western-blot data analysis, compared with the control group, the PPS of the 1, 10, 100 g/mL has effects of obviously activating expressions of receptors CD14, CD284(TLR4) and CD282(TLR2) and increasing P-P38 and P-P65 protein tyrosine phosphorylation expressions (
[0073] In conclusion, the polyperus polysaccharide PPS has an important bioregulation activity. The CD11b, CD16/32 and CD40 are all membrane marker proteins for polarizing the macrophages into M1. In the present experiment, after interfering with the macrophages, the polyperus polysaccharide PPS can obviously increase expressions of membrane molecules, such as CD11b, CD16/32, CD40 and the like, in the macrophages RAW264.7, which indicates that the PPS can activate the macrophages in the tumor microenvironment. The NO extensively participates in multi-system physiological and pathological processes of a body that generates immune response and inflammatory response and can adjust immunologic functions of the macrophages, T lymphocytes, B lymphocytes, NK cells and the like. The NO produced by the activated macrophages is used as a specific effect factor and can kill or inhibit growth of multiple pathogenic microorganisms, and mainly kill pathogens in the cells. The present experimental study discovers that (the purified polyperus polysaccharide) PPS can promote NO secretion of the macrophages, and at a lower dosage of 3.90625 g/mL, the NO secretion is close to that of the IFN-(100 ng/mL). The NO secretion of the macrophages can be promoted in the bladder carcinoma tumor microenvironment, and the NO secretion at the lower dosage of 3.90625 g/mL is higher than that of the IFN-(100 ng/mL) in a positive control group, which indicates that the PPS can increase non-specific immune response of the body at the lower dosage regardless of a co-culture environment or a non-co-culture environment, thereby enhancing the immunologic function of the body.
[0074] Signal paths p38 MAPK and NF-kB are two important immune inflammatory paths. Our experimental study discovers that, after actions of the PPS, the expressions of the CD14, TRL4 and pp38 proteins are increased in the bladder carcinoma tumor microenvironment, which indicates that the polyperus polysaccharide PPS may activate the macrophages by activating a signal path axis of CD14/TRL4/P38. Meanwhile, the TRL2 and PP65 protein expressions of the macrophages after the actions of the PPS are increased in the tumor microenvironment, which indicates that TRL2/NF-kB may also be one of the paths for promoting activation of the macrophages by the PPS.
[0075] Interferon (IFN-) is an important cellular immune factor and achieves an anti-tumor effect by regulating immunity of the body. The IFN- can activate the macrophages, secrete the NO, enhance the capability produced by antigen presenting cell WWII type molecules in the macrophages and enhance presenting capability to antigens. In addition, the IFN- can enhance the capability of killing the macrophages and NK cells, increase the expressions of cell surface antigens and receptors and inhibiting functions of B cells, thereby lowering a level of blocking antibodies on tumor cell surfaces. The present experimental study discovers that (the purified polyperus polysaccharide) PPS can secrete the NO in a non-tumor microenvironment and the bladder carcinoma tumor microenvironment, which indicates that the PPS has effects of activating the macrophages and regulating the immunologic functions. The IFN- is also a broad-spectrum antiviral drug. Effects of the PPS in the non-tumor microenvironment and the bladder carcinoma tumor microenvironment are similar to those of the IFN-. The secreted NO can inhibit replication of viruses in vivo. Meanwhile, the IFN- is an anti-tumor drugs and can secrete TNF- to directly kill tumor cells and secrete IL-6 and IL-1 to regulate an inflammatory microenvironment, thereby enhancing immunosurveillance on the tumor cells.
[0076] Safety is a key point of drug evaluation. Biomacromolecule antigens are clinically used for treating tumors and other diseases, but may cause many severe side effects, such as marrow suppression, decrease of peripheral blood leucocytes and blood platelets, influenza-like syndromes, renal damage and the like. At present, any adverse reaction of polyperus in a clinical application is not reported, while the PPS is a macromolecular component extracted from a relatively safe traditional Chinese medicine polyperus in clinical medication and is safer than the IFN-. Therefore, it is indicated that, the PPS has potential development values in drug and health care products for treatment and prevention of the diseases.
[0077] By taking the above ideal embodiments of the present invention as revelation, related staff may completely make diversified changes and modifications on premise of not deviating from a scope of a technical idea of the present invention by virtue of the above description. A technical scope of the present invention is not limited to contents in the description, and must be determined according to a scope of claims.