Nitrite-degrading and TSNA-degrading bacteria and methods of making and using
10226064 ยท 2019-03-12
Assignee
Inventors
- Ujwala Warek (Chester, VA, US)
- Mark T. Nielsen (Nicholasville, KY, US)
- Dongmei Xu (Glen Allen, VA)
- Mingwu Cui (Lexington, KY, US)
- Xue Luo (Richmond, VA, US)
- Xiaohong Jin (Glen Allen, VA, US)
- Elisabeth Miller (Chesterfield, VA, US)
- Kwang Choi (Glen Allen, VA, US)
Cpc classification
International classification
Abstract
Provided herein are bacterial strains that are capable of degrading nitrite and/or TSNAs. Also provided herein are methods of using such bacterial strains to degrade nitrite and/or TSNAs.
Claims
1. A method of reducing the amount of nitrites in strong extract liquor (SEL), comprising contacting SEL with the isolated bacterial strain Myroides odoratus M20 (ATCC Patent Deposit Designation PTA-125147) under conditions in which the amount of nitrite is reduced in the SEL, thereby producing a reduced-nitrite SEL, wherein the bacterial strain comprises the 16S rDNA sequence having the sequence shown in SEQ ID NO: 1.
2. The method of claim 1, wherein the amount of nitrite in the SEL is reduced by at least 50%, compared to the amount of nitrite in the SEL prior to the contacting step.
3. The method of claim 1, wherein the amount of nitrite in the SEL is reduced by at least 75%, compared to the amount of nitrite in the SEL prior to the contacting step.
4. The method of claim 1, wherein the SEL is contacted with the isolated bacterial strain at a temperature of 26 C. to 37 C.
5. The method of claim 1, wherein the SEL is contacted with the isolated bacterial strain at a temperature of 37 C.
6. The method of claim 1, wherein the SEL is contacted with the isolated bacterial strain at a pH of 7.
7. The method of claim 1, wherein the SEL is contacted with the isolated bacterial strain for less than 2 hours.
8. The method of claim 1, wherein the SEL is contacted with the isolated bacterial strain for less than 10 hours.
9. The method of claim 1, wherein the SEL is contacted with the isolated bacterial strain for less than 24 hours.
10. The method of claim 1, wherein the SEL is contacted a second time with the isolated bacterial strain.
11. The method of claim 1, further comprising processing the SEL to produce concentrated extract liquor (CEL).
12. The method of claim 1, wherein the amount of nitrite in the SEL is reduced by at least 75%, compared to the amount of nitrite in the SEL prior to the contacting step.
13. The method of claim 1, wherein the amount of nitrite in the SEL is reduced by at least 95%, compared to the amount of nitrite in the SEL prior to the contacting step.
14. The method of claim 1, wherein the SEL is contacted with the isolated bacterial strain for less than 1 hour.
Description
DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11) Like reference symbols in the various drawings indicate like elements.
DETAILED DESCRIPTION
(12) TSNA are produced during curing and are formed by the reaction between alkaloids and nitrite-derived nitrosating species such as NO2, N2O3 and N2O4. Nitrite may accumulate as a result of nitrate reduction by bacteria, and TSNAs are formed by chemical reactions between nitrite (source of nitrosating species) and alkaloids. TSNAs are known in the art and include, for example, N-nitrosonornicotine (NNN), 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanone (NNK), N-nitrosoanatabine (NAT), N-nitrosoanabasine (NAB), and 4-(methylnitrosoamino)-1-(3-pyridyl)-1-butanal (NNAL). Methods are described herein for identifying and characterizing bacteria that are able to degrade nitrite and/or TSNAs. In addition, methods are described herein for using bacteria to reduce nitrite and/or TSNAs in a number of tobacco-related products.
(13) Methods of Screening for Nitrite- and/or TSNA-Reducing Bacteria
(14) This disclosure describes a method of screening for bacteria that have the ability to degrade nitrite and/or one or more TSNAs. Bacteria that can be screened for the desired activity can be obtained from any source. For example, a variety of bacterial microorganisms can be obtained from any number of collections around the world (e.g., American Type Culture Collection (ATCC; Manassas, Va., USA); Microbial Culture Collection (Pune, India)) and screened for the desired characteristics. In addition, bacterial organisms residing on or within plant material (e.g., tobacco material) can be screened for the desired characteristics.
(15) One or more candidate bacterial strains (e.g., from a collection, from tobacco material) are inoculated into culture medium. Conditions under which microorganisms are cultured are well known and routinely used in the art, and can include, for example, a temperature between 25 C and 45 C and shaking at about 50 RPM to about 240 RPM. For purposes of the methods herein, the culture medium should contain nitrite and/or one or more TSNAs. Nitrite and/or one or more TSNAs can be found naturally in the media, they can be added exogenously, or a combination thereof. Nitrite and/or one or more TSNAs can be added to the media directly (e.g., Sigma-Aldrich Chemical Co., St. Louis, Mo.), and/or via tobacco material (e.g., tobacco extract, tobacco dust or debris, tobacco stems).
(16) Bacterial growth can be determined and monitored using methods that are well known to those skilled in the art. For example, one of the most common is a turbidity measurement, which relies upon the optical density (OD) of bacteria in suspension and uses a spectrophotometer. In addition, physical measurements (e.g., dry weight of cells following centrifugation) or chemical measurements (e.g., rate of oxygen consumption, nitrogen, protein or DNA content) can be used to determine and/or monitor bacterial growth in a culture. Obviously, plating to determine colony forming units (CFUs) also is a standard method for determining and/or monitoring bacterial growth in a culture.
(17) The amount of nitrite and/or one or more TSNAs in a culture can be determined (e.g., measured) using, for example, chromatography methods (e.g., gas chromatography/thermal energy analysis (GC/TEA), liquid chromatography/mass spectrometry (LC/MS), and ion chromatography (IC)). In some instances, the amount of nitrite and/or one or more TSNAs present in the culture can be determined over time (e.g., at various time points). Additionally or alternatively, nitrite and/or one or more TSNAs can be determined in a culture and compared to a control culture (e.g., a culture lacking the candidate bacterial strain).
(18) Once it has been determined that a candidate bacterial strain has the ability to degrade nitrite and/or one or more TSNAs, a number of methods can be used to identify the genus and/or species to which the bacterial strain belongs. For example, differential culturing methods (e.g., use of different media, use of different carbon sources) can be used to identify or eliminate various genus and/or species. Additionally or alternatively, molecular techniques such as, without limitation, 16s rDNA sequencing or RFLP analysis can be used to identify the genus and/or species of the bacterial strain.
(19) As an alternative to screening for a bacterial strain that possesses the desired activity (i.e., nitrite- and/or TSNA-degrading activity), one or more bacterial strains can be conditioned (e.g., selectively conditioned) to degrade nitrite and/or one or more TSNAs. For example, one or more bacterial strains can be cultured in medium that contains, initially, a low amount of nitrite and/or TSNA (e.g., about 10 ppm up to about 50 ppm in total) and also contains at least one other carbon and/or nitrogen source. As the bacterial strains are serially cultured, the amount of nitrite and/or TSNA is progressively increased (e.g., up to about 100 ppm-500 ppm in total) while the other carbon and/or nitrogen sources are progressively reduced until, eventually, the nitrite and/or TSNA is the sole carbon and nitrogen source in the culture. This eliminates bacterial strains that are sensitive to nitrite and/or TSNA, and ultimately results in the selection of bacterial strains that are able to metabolize (i.e., degrade) nitrite and/or TSNA.
(20) Nitrite- and/or TSNA-Degrading Bacteria
(21) Using the methods described herein, several different bacterial strains were identified that possess the ability to degrade nitrites and/or TSNAs. One of the bacterial strains, designated M20, was identified based on its ability to efficiently degrade nitrites. The 16S rDNA sequence from M20 was obtained and, based on that sequence, M20 was determined to belong to the genus, Myroides. Twenty-five vials of the bacterial strain Myroides odoratus M20 were deposited with American Type Culture Collection under ATCC Patent Deposit Designation PTA-125147. Based on experimental evidence, it was determined that the M20 bacteria prefers a pH of 7, has optimum activity at 26 C. to 37 C., is able to be inoculated at a high CFU/ml, can survive agitation of up to about 225 RPM, and exhibits maximum activity between 20 minutes and 2 hours.
(22) The rDNA sequence of M20 was determined and is shown in SEQ ID NO:1. It would be appreciated that M20 bacterial strains having rDNA sequences with at least 98% sequence identity or at least 99% sequence identity to SEQ ID NO:1 also are provided. To calculate the percent sequence identity of two sequences, the first and second sequences are aligned and the number of identical matches of nucleotides or amino acid residues between the two sequences is determined. The number of identical matches is divided by the length of the aligned region (i.e., the number of aligned nucleotides or amino acid residues) and multiplied by 100 to arrive at a percent sequence identity value. It will be appreciated that the length of the aligned region can be a portion of one or both sequences up to the full-length size of the shortest sequence. It also will be appreciated that a single sequence can align differently with other sequences and hence, can have different percent sequence identity values over each aligned region. Two sequences can be aligned to determine percent sequence identity using the algorithm described by Altschul et al. (1997, Nucleic Acids Res., 25:3389-3402), which is incorporated into BLAST (basic local alignment search tool) programs available at ncbi.nlm.nih.gov on the World Wide Web.
(23) Another bacterial strain, designated M21, was identified based on its ability to efficiently degrade TSNAs. Based on microbial characterization techniques and preliminary results of molecular sequencing, the M21 bacterial strain was determined to belong to the Microbacterium genus. A third bacterial composition, designated M30, was identified based on its ability to efficiently degrade NNK. Based on microbial characterization techniques and preliminary results of molecular sequencing, the M30 bacterial composition was determined to be a bacteria belonging to the genus Pseudomonas.
(24) The M20 and M21 bacterial strains were isolated, as were the bacterial strains within the M30 bacterial composition. Isolated, with respect to bacteria, generally refers to a population (e.g., a culture) in which at least about 70% (e.g., about 75%, 80%, 85%, 90%, 95%, 99% or 100%) of the bacteria are the nitrite- and/or TSNA-degrading bacteria described herein. When referring to a bacterial strain, isolated refers to a population (e.g., a culture) in which at least about 70% (e.g., about 75%, 80%, 85%, 90%, 95%, 99% or 100%) of the bacteria is a genetically-identical bacterial strain.
(25) The bacteria described herein can be provided in a composition. In addition to bacteria, a composition also can include media, buffers, one or more nutrients, one or more minerals, one or more co-factors, or any other component that is necessary to maintain viability of the bacteria. Additionally, components that are not related to the viability of the bacteria may be desirable in a composition such as, without limitation, a dye or color marker. In addition, methods of storing bacteria are known in the art, and typically include protecting the bacteria with a glycerol-based media and storage at very low temperatures (e.g., 80 C).
(26) Methods of Using Nitrite- and/or TSNA-Reducing Bacteria
(27) A) In Reconstituted Leaf
(28) Reconstituted leaf is a sheet-like material made from tobacco by-products (e.g., recycled tobacco fines, tobacco stems, tobacco particles (e.g., particles less than 30 mesh in size)). Reconstituted leaf is made be extracting the soluble chemicals in the tobacco by-products, processing the remaining tobacco fibers into a paper-like sheet, and reapplying the extracted soluble chemicals in concentrated form into the paper-like sheet. The initial extract is typically referred to as strong extract liquor (SEL), while the concentrated form is referred to as concentrated extract liquor (CEL).
(29) During production, the SEL typically is held in a SEL tank for about 4 hours or less at temperatures that range from 51 C to 77 C. Conditions in a typical SEL tank include, without limitation, a starting pH of 5.4 and a temperature that ranges from about 51 C to about 76 C. A typical SEL tank contains about 10.sup.3 CFU/ml to about 10.sup.4 CFU/ml natural microflora, and can have a nitrite content that ranges from about 5 ppm up to about 130 ppm. During processing, a SEL tank is typically agitated at about 60 RPM to about 75 RPM (e.g., about 65 RPM to about 70 RPM, about 67 RPM). The SEL then is processed through evaporators to produce the CEL, which is held in a CEL tank for 0 to 3 hours at temperatures that can range from 70 F to 120 F (e.g., 70 F to 80 F, 90 F to 100 F, 110 F to 120 F). Crystallizing the CEL produces a Denitrified Extract Liquor (DNCEL), which is stored in a DNCEL tank for no more than 48 hours (e.g., from 0 hours up to 48 hours) at temperatures of 40 F to 50 F. The DNCEL is then poured onto the tobacco fibers to ultimately form the reconstituted leaf.
(30) The M20 bacterial strain described herein has been shown to be effective in reducing nitrites in SEL. While the rate of nitrite degradation by M20 will depend on the volume of SEL and the number of bacteria that are inoculated into the SEL, the data presented herein would indicated that the M20 bacterial strain can degrade at least 50% of the nitrite (e.g., at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% of the nitrite) within 24 hours (e.g., within 20 hours, 18 hours, 16 hours, 14 hours, 12 hours, 10 hours, 8 hours, 6 hours, 4 hours, 2 hours, 1 hour, or less than 1 hour). For example, it is a characteristic of M20 that, in 300 ml SEL (pH 7) at a temperature of 45 C with shaking at 225 RPM, M20, inoculated at a ratio of 1:1 into the SEL, degraded greater than 99% (e.g., essentially 100%) of the nitrite within 20 minutes after inoculation. See
(31) The M20 bacterial strain, therefore, can be used to reduce the level of nitrite in SEL. The resulting reduced-nitrite SEL then can be used in the process of making reconstituted leaf. The reduced-nitrite reconstituted leaf can be used in combustible smoking products, resulting in reduced-nitrite combustible smoking products.
(32) B) In Tobacco and Tobacco Products
(33) The tobacco material treated with a nitrite- and/or TSNA-degrading bacterial strain can be freshly harvested (green) tobacco or the tobacco material can be cured, fermented, conditioned, or any combination thereof. For example, after harvesting, tobacco typically is cured using conventional means, e.g., air curing, fire curing, barn curing, sun curing. See, for example, Tso (1999, Chapter I in Tobacco, Production, Chemistry and Technology, Davis & Nielsen, Eds., Blackwell Publishing, Oxford). Optionally, cured tobacco then can be conditioned and/or fermented. Conditioning includes, for example, a heating, sweating or pasteurization step as described in U.S. Publication Nos. 2004/0118422 or 2005/0178398. Fermenting typically is characterized by high initial moisture content, heat generation, and a 10 to 20% loss of dry weight. See, for example, U.S. Pat. Nos. 4,528,993; 4,660,577; 4,848,373; and 5,372,149. Cured or cured and fermented tobacco then can be further processed (e.g., cut, expanded, blended, milled or comminuted) for use in any number of tobacco products.
(34) The entire tobacco plant or any portion thereof can be contacted with a nitrite- and/or TSNA-degrading bacterial strain. For example, in dark tobacco, TSNA concentration is highest near the base and center of the leaf, particularly along the midvein of the leaf (referred to herein as the stem). See, for example, Burton et al. (J. Agric. Food Chem., 40:1050-5 (1992)); in dark tobacco, the stem can account for about 30% of the dry weight of a leaf, but can contain up to 75% of the total TSNAs in the leaf. Therefore, in certain instances, the tobacco stems can be separated from other tobacco parts (e.g., the lamina) by any method including, without limitation, by hand, and contacted with a nitrite- and/or TSNA-degrading bacterial strain as described herein. For example, tobacco material that contains at least 50% w/w stems (e.g., 60%, 70%, 80%, 90%, 95%, 99% or 100%) can be contacted with a nitrite- and/or TSNA-degrading bacterial strain.
(35) One or more nitrite- and/or TSNA-degrading bacterial strains can be applied to tobacco material as an aqueous solution or in a dry form (e.g., lyophilized). Any suitable method, such as mixing or spraying can be used to apply an aqueous solution including one or more nitrite- and/or TSNA-degrading bacterial strains onto tobacco. One or more nitrite- and/or TSNA-degrading bacterial strains can be applied to a particular part of the tobacco (e.g., to stems that have been separated from other tobacco parts), or one or more nitrite- and/or TSNA-degrading bacterial strains can be applied to tobacco leaves (e.g., primed leaves, stalk cut leaves, or stalk-cut leaves attached to the tobacco stalk) or to the entire tobacco plant.
(36) Irrespective of how the one or more nitrite- and/or TSNA-degrading bacterial strains are applied to the tobacco, the conditions under which nitrite and/or TSNAs are reduced can be adjusted to favor the ability of any given bacterial strain or combination of strains to degrade nitrite and/or TSNAs. Suitable conditions generally include maintaining the tobacco or tobacco product and the nitrite- and/or TSNA-degrading bacterial strain(s) at a moisture content of from about 45% to about 75% by weight (e.g., about 50% to about 70%, about 55% to about 65%, about 60%) and a temperature of from about 20 C. to about 45 C. (e.g., about 20 C., about 25 C., about 30 C., about 32 C., about 35 C., about 37 C., about 40 C, about 42 C, or about 45 C). In addition, suitable conditions also can include a pH of about 5 to about 8 (e.g., about 6 to about 8, about 6.5 to about 7.5, about 6.5 to about 8, or about 7).
(37) The tobacco and the at least one nitrite- and/or TSNA-degrading bacterial strains can be incubated together in, for example, a rotating drum, which can be rotated or tumbled, for example, to provide aeration. It would be understood by those skilled in the art that additional components (e.g., buffers, salts, minerals, or other ingredients present) can be added to the tobacco and nitrite- and/or TSNA-degrading bacteria mixture to affect the rate and/or degree at which one or more nitrites and/or TSNAs are degraded.
(38) The amount of nitrite and/or TSNA is considered to be reduced when the reduction in the amount of nitrite and/or TSNAs is statistically significant when compared to the amount of nitrite and/or TSNAs in corresponding control tobacco. As used herein, corresponding control tobacco refers to the same portion (e.g., stem, lamina or entire leaf) of the same tobacco variety, which was grown, harvested and otherwise treated (e.g., cured, or fermented) in the same manner as the tobacco contacted with the nitrite- and/or TSNA-reducing bacteria. A statistically significant reduction in nitrite and/or TSNAs refers to a p-value of less than 0.10, e.g., a p-value of less than 0.05, a p-value of less than 0.025 or a p-value of less than 0.01, using an appropriate parametric or non-parametric statistic, e.g., Chi-square test, Student's t-test, Mann-Whitney test, or F-test.
(39) Using the methods described herein, nitrite and/or TSNA content in tobacco or a tobacco-related product can be reduced by about 40% to about 99% (e.g., by about 40% to about 50%, by about 40% to about 60%, by about 40% to about 70%, by about 40% to about 80%, by about 45% to about 60%, by about 45% to about 70%, by about 45% to about 90%, by about 50% to about 65%, by about 50% to about 75%, by about 50% to about 95%, by about 60% to about 75%, by about 60% to about 95%, by about 75% to about 95%, by about 75% to about 99%, by about 80% to about 95%, by about 90% to about 99%, or by about 95% to about 99%). In some cases, nitrite and/or TSNAs can be reduced to undetectable levels.
(40) Reduced-nitrite and/or -TSNA tobacco can be used alone or blended with non-reduced-nitrite and/or -TSNA tobacco. As used herein, blends refer to combinations of tobaccos that have 1%-99% of one or more of the reduced-nitrite and/or -TSNA tobaccos described herein (e.g., 1%-10%, 5%-20%, 10%-25%, 15%-30%, 20%-40%, 25%-45%, 30%-50%, 40%-55%, 50%-60%, 55%-65%, 60%-70%, 75%-85%, 80%-85%, 80%-90%, 85%-95%, 90%-99%, or 95%-99% of the reduced-nitrite and/or -TSNA tobaccos described herein). The reduced-nitrite and/or -TSNA tobacco can be from the same variety or a different variety of tobacco than that of the control tobacco.
(41) In some embodiments, reduced-nitrite and/or -TSNA tobacco can be conditioned and/or fermented. Conditioning includes, for example, a heating, sweating or pasteurization step as described in US 2004/0118422 or US 2005/0178398. Fermenting typically is characterized by high initial moisture content, heat generation, and a 10 to 20% loss of dry weight. See, e.g., U.S. Pat. Nos. 4,528,993; 4,660,577; 4,848,373; and 5,372,149. Cured, or cured and fermented, reduced-nitrite and/or -TSNA tobacco as described herein also can be further processed (e.g., cut, expanded, blended, milled or comminuted).
(42) Reduced-nitrite and/or -TSNA tobacco or a blend of tobacco that includes such reduced-nitrite and/or -TSNA tobacco can be used in any number of adult-consumer tobacco products. Without limitation, adult-consumer tobacco products include smokeless tobacco products, cigarette products, cigar products, loose tobacco, and tobacco-derived nicotine products. Representative smokeless tobacco products include, for example, chewing tobacco, snus, pouches, films, tablets, sticks, rods, and the like. See, for example, US 2005/0244521, US 2006/0191548, US 2012/0024301, US 2012/0031414, and US 2012/0031416 for examples of tobacco products.
(43) In addition to tobacco treated with a nitrite- and/or TSNA-degrading bacterial strain, adult-consumer tobacco products described herein can include other ingredients such as binders, plasticizers, stabilizers, and/or flavorings. For example, edible films typically include ingredients that are known in the art including, without limitation, film forming agents, surfactants, plasticizers, flavoring agents, fillers, colorants, emulsifiers, binding agents, fragrances, lubricants, or preservatives. It will be appreciated that the ingredients can be adjusted to achieve the desired properties of the product. For example, the amount of a plasticizer can be adjusted to modify the brittleness of the product, or a filler can be added to modify the texture of the product.
(44) In accordance with the present invention, there may be employed conventional molecular biology, microbiology, biochemical, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. The invention will be further described in the following examples, which do not limit the scope of the methods and compositions of matter described in the claims.
EXAMPLES
Example 1Screening for Nitrite- and/or TSNA-Reducing Bacteria
(45) Cured tobacco leaves or soil containing tobacco debris were added to culture media and cultured under standard conditions (e.g., 37 C, 180 RPM). Isolates that thrived in the culture were purified via single colony isolation and characterized further.
(46) As described below, the bacterial strains obtained from the screenings were characterized for rate and extent of nitrite and/or TSNA degradation in a culture environment, and those isolates that exhibited degradation activity were identified using existing molecular techniques.
Example 2Characterization of Nitrite- and/or TSNA-Reducing Bacteria
(47) A primary culture of 20 ml of TSG media (i.e., TSB media+glucose) and 20 ml of filter-sterilized SEL was inoculated with the bacterial strain and cultured at 28 C while shaking at 225 rpm.
(48) A full culture of TSG was prepared and inoculated with the primary culture above. About 200 ml of SEL (pH 7.0) was filter sterilized, spiked with NNN and NNK to a final concentration of 25 ppm, and added to the TSG media. The OD of the culture was immediately determined to obtain a 0 hr reading, and a 0 hr sample was plated on TSB media.
(49) Samples were taken at 6 to 7 hrs after inoculation, at 1 day after inoculation, and at 2 days after inoculation. The amount of nitrite, nitrate, and TSNAs in the media was measured (in triplicate). At each time point, a sample also was plated on TSB media.
Example 3Bacterial Isolates
(50) Three bacterial isolates were identified that had nitrite and/or TSNA-degrading activity. The first strain, designated M20, was identified as having nitrite-degrading activity. Sequence analysis of the 16S rDNA determined that M20 was a member of the genus, Myroides. The sequence of the 16s rDNA is shown in SEQ ID NO:1.
(51) TABLE-US-00001 (SEQIDNO:1) AGAGTTTGATCCTGGCTCAGGATGAACGCTAGCGGCAGGCCTAACACATG CAAGTCGAGGGGTATAGAGAGCTTGCTTTCTAGAGACCGGCGGATGGGTG AGTAACGCGTATGCAACCTACCTTTTACAGGGGAATAGCCCGGAGAAATT CGGATTAATGCTCCATGGTTTATATGAATGGCATCATTTATATAATAAAG ATTTATCGGTAAAAGATGGGCATGCGTATCATTAGCTAGTTGGTGTGGTA ACGGCATACCAAGGCGACGATGATTAGGGGTCCTGAGAGGGAGATCCCCC ACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGG AATATTGGTCAATGGAGGCAACTCTGAACCAGCCATGCCGCGTGCAGGAT GACGGTCCTATGGATTGTAAACTGCTTTTGTACGGGAAGAAATGTAATTA CGTGTAATTATTTGACGGTACCGTAAGAATAAGGATCGGCTAACTCCGTG CCAGCAGCCGCGGTAATACGGAGGATCCGAGCGTTATCCGGAATTATTGG GTTTAAAGGGTTCGTAGGCGGTTTAGTAAGTCAGTGGTGAAATCTTATAG CTTAACTATAAAATTGCCGTTGATACTGCTAGACTTGAATAGTATGGAAG TAATTAGAATATGTAGTGTAGCGGTGAAATGCTTAGATATTACATGGAAT ACCAATTGCGAAGGCAGATTACTACGTACTTATTGACGCTGATGAACGAA AGCGTGGGTAGCGAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAAC GATGGATACTAGCTGTTCGGTTTTCGGACTGAGTGGCTAAGCGAAAGTGA TAAGTATCCACCTGGGGAGTACGTTCGCAAGAATGAAACTCAAAGGAATT GACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGATACG CGAGGAACCTTACCAAGGCTTAAATGTAGATTGACAGGTTTAGAGATAGA CTTTTCTTCGGACAATTTACAAGGTGCTGCATGGTTGTCGTCAGCTCGTG CCGTGAGGTGTCAGGTTAAGTCCTATAACGAGCGCAACCCCTATTGTTAG TTGCCAGCGGGTCATGCCGGGAACTCTAACAAGACTGCCGGTGCAAACCG TGAGGAAGGTGGGGATGACGTCAAATCATCACGGCCCTTACGTCTTGGGC TACACACGTGCTACAATGGCCAGTACAGAAAGCAGCTACCAGGCAACTGG ATGCGAATCTCAAAAACTGGTCTCAGTTCGGATTGGAGTCTGCAACTCGA CTCCATGAAGCTGGAATCGCTAGTAATCGGATATCAGCCATGATCCGGTG AATACGTTCCCGGGCCTTGTACACACCGCCCGTCAAGCCATGGAAGCTGG GGGTACCTGAAGTCGGTCGCCGCAAGGAGCTGCCTAGGGTAAAACTGGTA ACTAGGGCTAAGTCGTAACAAGGTAGCCGTA
(52) The second strain, designated M21, was identified as a TSNA-degrading microorganism. Sequencing of the 16S rDNA indicated that M21 is a member of the genus Microbacterium. The third strain, designated M30, is identified as one that degrades NNK. Molecular analysis of the 16S rDNA indicated that M30 was a bacterial strain belonging to the genus Pseudomonas.
Example 4Use of M20 in the Bioremediation of Reconstituted Leaf
(53) M20 was grown to mid-log phase, pelleted by centrifugation, and re-suspended in sterile saline. The bacteria were then added to the SEL.
(54) As can be seen in
(55) TABLE-US-00002 TABLE 1 Specific Activity of M20 Temperature Sterile* Native* 54 C. 2.20 2.05 45 C. 9.32 7.43 37 C. 8.08 8.26 26 C. 4.02 5.01
(56) To determine how the concentration of M20 microorganisms in the SEL affected nitrite degradation, M20 was inoculated into SEL (pH 7) at a 1:1 M20:SEL ratio, a 1:2 M20:SEL ratio, or a 1:3 M20:SEL ratio. The culture was incubated at 45 C with agitation at 225 RPM and grown in the presence of 200 ppm added NO2- (
(57) TABLE-US-00003 TABLE 2 Effects of Varying Amounts of Bacteria Ratio of % Reduction after 60 min % Reduction after 60 min M20:SEL (w/added NO2) (w/out added NO2) 1:1 98 83 1:2 76 89 1:3 57 68
(58)
Example 5Laboratory and Commercial Scale-Up
(59) To ensure that the methods described herein can be repeated at a commercial level, the methods were scaled-up.
(60) Following the laboratory scale-up experiments, a commercial-pilot experiment was performed using over 900 L of SEL. M20 was grown to mid-log phase, concentrated by filtration, and re-suspended in sterile saline. M20 was inoculated at a 1:3 ratio of M20:SEL. The SEL was treated for 4 hours with slow agitation at 37 C, pH 5.4. Sterile saline was inoculated into the SEL at a 1:3 ratio of saline:SEL for the control.
(61) The first run showed a 95% reduction of nitrite in the SEL after 4 hours (
Example 6TSNA-Reducing Bacterial Strains and the Reduction of TSNAs in Tobacco Stems
(62) Bacterial strains designated A4M and M21 were identified as capable of degrading TSNAs. Using 16S rDNA sequencing, bacterial strain A4M was determined to be a mixture of Arthrobacter and Microbacterium spp., while bacterial strain M21 was determined to be from the Microbacterium genus.
(63) Bacterial isolates A4M and M21 were used to inoculate compositions that include tobacco stem having a moisture content of 40% to 60% by weight. The compositions were incubated in a drum with agitation for three weeks and the TSNA content was measured weekly. The results for A4M are shown in
Example 7Additional Nitrite- and/or TSNA-Reducing Bacterial Strains
(64) Using the screening methods described herein, several additional nitrite- and/or TSNA-reducing bacterial strains were identified. For example, a bacterial strain designated 7M was identified based on its ability to degrade NNK and was determined to be a Paracoccus spp. A bacterial strain designated 7U was able to degrade NNK (and also nicotine) and was identified as Arthrobacter nicotianae. Several bacterial isolates, designated Colt 317, Colt 32, and M31, were able to degrade NNN, NAT, and NNK; all three strains were identified as Microbacterium spp.
(65)
(66) It is to be understood that, while the methods and compositions of matter have been described herein in conjunction with a number of different aspects, the foregoing description of the various aspects is intended to illustrate and not limit the scope of the methods and compositions of matter. Other aspects, advantages, and modifications are within the scope of the following claims.
(67) Disclosed are methods and compositions that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that combinations, subsets, interactions, groups, etc. of these methods and compositions are disclosed. That is, while specific reference to each various individual and collective combinations and permutations of these compositions and methods may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a particular composition of matter or a particular method is disclosed and discussed and a number of compositions or methods are discussed, each and every combination and permutation of the compositions and the methods are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed.
DEPOSIT INFORMATION
(68) A deposit of the proprietary Myroides odoratus M20 bacterial line disclosed above and recited in the appended claims have been made with American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Va. 20110, USA. The date of deposit for Myroides odoratus M20 was Jul. 20, 2018. The deposits of 25 vials of cells was taken from the same deposits maintained since prior to the filing date of this application. Upon issuance of a patent, all restrictions upon the deposits will be irrevocably removed, and the deposits are intended by applicant to meet all of the requirements of 37 C.F.R. 1.801 1.809. ATCC has issued the accession number: ATCC Accession No. PTA-125147 for Myroides odoratus M20. This deposit will be maintained in the depository for a period of 30 years, or 5 years after the last request, or for the effective life of the patent, whichever is longer, and will be replaced as necessary during that period. Applicant does not waive any infringement of their rights granted under this patent or under the plant variety protection act (7 U.S.C. 2321 et seq.).