Modified parvovirus useful for gene silencing

10227609 ยท 2019-03-12

Assignee

Inventors

Cpc classification

International classification

Abstract

Described are methods for efficiently down regulating the expression of a gene of interest in a cell by use of a modified rodent parvovirus that contains an expressible target specific nucleic acid, preferably an shRNA expression cassette. Also described are cells or organisms comprising said parvovirus.

Claims

1. A modified parvovirus having a modified H-1 parvoviral genome comprising a non-coding region downstream of a parvovirus VP gene, wherein the modified H-1 parvoviral genome comprises the nucleotide sequence of SEQ ID NO:15 comprising the following mutations: (i) a deletion of nucleotides 2022-2135 of SEQ ID NO:15; and (ii) an insertion within the non-coding region downstream of the parvovirus VP gene, wherein the insertion is a nucleic acid molecule encoding a short hairpin RNA (shRNA) transcript under the control of a RNA polymerase III H1 promoter, wherein the shRNA is specific to a target gene, and wherein the modified parvovirus is capable of replicating and propagating in a cell autonomously.

2. The modified parvovirus of claim 1, wherein the target gene is a disease-causing gene.

3. The modified parvovirus of claim 2, wherein the disease-causing gene is a pathogenic animal virus gene, a cancer-related gene, an oncogene, anti-apoptotic gene, a gene critical for tumour cell growth, metastasis, angiogenesis or chemioresistance, an immunomodulatory gene, or a gene encoding a cytokine, growth factor, enzyme or transcription factor.

4. A composition comprising the modified parvovirus of claim 1, further comprising a solvent suitable for intravenous (i.v.), intratumoral or endobronchial administration.

5. A cell containing the modified parvovirus of claim 1.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: Schematic representation of pH-1PV silencer containing an shRNA expression cassette

(2) The RNAi cassette consisting of the RNA polymerase III H1 promoter was inserted into the non-coding region of the genome downstream the VP gene encoding for the VP1 and VP2 capsid proteins. Unique BamHI and Not I restriction enzymes were inserted for shRNA cloning. Parvoviral P4 and P38 promoters are also illustrated. ITR, inverted terminal repeat. Figure not drawn to scale.

(3) FIG. 2: Efficient gene silencing achieved by using the pH-1PV silencer vector

(4) HEK 293T cells were transfected with the indicated DNAs. After 12 h the cells were infected with Ad5-GFP and grown for additional 48 h before to be analyzed by fluorescence microscopy for GFP intensity. The bars represent the mean value of a typical experiment performed in triplicate with relative standard deviation. GFP intensity was quantified using the ImageJ software using five different images each containing at least 200 cells (23).

(5) FIG. 3: Production of H-1PV silencer

(6) (A) Virus production. Viruses were produced according to the protocol described in Example 1. After viral purification, virus titers were quantified by real time qPCR and plaque assays.

(7) (B) Example of viral amplification through infection. NB324K cells were infected with the indicated viruses. After 5 days, cells were lysed, viruses purified from cell extracts and virus titres quantified by real time qPCR and plaque assays.

(8) (C) Example of plaque assay using the H-1PV wt and H-1PV-sil-GFP.

(9) FIG. 4: Intrinsic H-1PV cytotoxicity is not impaired after the insertion of the RNAi cassette

(10) NB324K cells were tested for their sensitivity to virus infection by LDH assay. Viruses were used at MOI 1, 5 and 10 for the infection. LDH measurement was performed after 72 h from infection.

(11) FIG. 5: Efficient gene silencing achieved by using H-1PV silencer

(12) (A) shRNA content. shRNAs were extracted from virus infected or plasmid transfected cells and detected using the mirVana miRNA Detection Kit according to the instruction manual. +=positive control: cells transfected with pSilencer 3.1-GFP; =negative control: cells transfected with pSilencer3.1-control.

(13) (B) qRT-PCR. Isolation of total RNAs from virus infected cells and cDNA synthesis were performed according to the protocols described in Example 1. qRT-PCRs were performed using EGFP and GAPDH (used as housekeeping gene) specific primer sets.

(14) (C) Fluorescence microscopy analysis: example of a representative image. Cells were infected with H-1-sil-GFP and H-1-sil-control and then super-infected with Ad-GFP. After 72 hours cells were analyzed by fluorescence microscopy GFP signal. Hoechst staining was used for nuclei visualization.

(15) (D) Western blotting analysis. NB324K cells were infected with H-1-sil-GFP and H-1-sil-control at the indicated MOIs. 12 hours later, cells were super-infected with Ad-GFP. EGFP protein content was analyzed by SDS-PAGE on total cellular extracts from these cell cultures. -tubulin was used as a loading control.

(16) Thus, the present invention provides a rodent parvovirus for down regulating the expression of a target gene in a cell characterized in that it contains a target specific nucleic acid in an untranslated region of the parvovirus genome under the control of a promoter or promoter region recognizable by an RNA polymerase in the cell, wherein the transcript of said target specific nucleic acid is an RNAi.

(17) The target specific nucleic acid is inserted in such a way that viral replication and cytotoxicity are not affected.

(18) Preferably, the target specific nucleic acid is inserted downstream of the parvovirus VP gene encoding the capsid proteins of the parvovirus.

(19) The term parvovirus as used herein comprises wild-type viruses, replicating viruses and modified replication-competent derivatives thereof, CPG-armed viruses as well as related viruses or vectors based on such viruses or derivatives. Suitable parvoviruses, derivatives, etc. which are useful for therapy, are readily determinable within the skill of the art based on the disclosure herein, without undue empirical effort. Viruses that are capable of replicating and propagating in the host cell are preferred for the present invention.

(20) The term target gene as used herein is taken to refer to any nucleic acid of interest which is present in a cell of an animal, fungus or protist. The target gene may be transcribed into a biologically active RNA or it may be part of a larger RNA molecule of which other parts are transcribed into a biologically active RNA. The target gene may be an endogenous gene, it may be a transgene that was introduced through human intervention in the ancestors of the cell, or it may be a gene introduced into the cell by an infectious or pathogenic organism. The target gene may also be of viral origin. Furthermore, the sequence that is targeted may be selected from translated or non-translated regions or intron or preferably exon regions, that is, the coding region, or the 5UTR or 3UTR, or a combination of any or all of these.

(21) The target gene used in the present invention may cause a disease in an organism or be involved in causing the disease and is a gene where reduction of the particular gene expression is required to prevent or alleviate the disease. The biological processes affected by the disease that may be reversed by down-regulation of the specific gene target include cell proliferation, cell migration or metastasis, apoptosis, stress signalling, and cell attachment. The target gene (s) may encode enzymes, transcription factors, cytokines, growth factors, cell adhesion or motility factors, cell cycle factors, tumour suppressors, or cell cycle inhibitors.

(22) The term target specific nucleic acid as used herein refers to a nucleic acid comprising at least 15, 20, 25, 50, 100 or 200 consecutive nt having at least about 75%, particularly at least about 80%, more particularly at least about 85%, quite particularly about 90%, especially about 95% sequence identity with the complement of a transcribed nucleotide sequence of the target gene.

(23) In the present invention a target gene can be down regulated in an in vivo cell or an in vitro cell. The cell may be a primary cell or a cell that has been cultured for a period of time or the cells may be comprised of a cultured cell line. The cell may be a diseased cell, such a cancer cell or tumor or a cell infected by a virus. The cell may be a stem cell which gives rise to progenitor cells, more mature, and fully mature cells of all the hematopoietic cell lineages, a progenitor cell which gives rise to mature cells of all the hematopoietic cell lineages, a committed progenitor cell which gives rise to a specific hematopoietic lineage, a T lymphocyte progenitor cell, an immature T lymphocyte, a mature T lymphocyte, a myeloid progenitor cell, or a monocyte/macrophage cell. The cell may be a stem cell or embryonic stem cell that is omnipotent or totipotent. The cell maybe a nerve cell, neural cell, epithelial cell, muscle cell, cardiac cell, liver cell, kidney cell, stem cell, embryonic or foetal stem cell or fertilised egg cell.

(24) Thus, in a preferred embodiment of the present invention, the target gene is a disease causing gene, e.g., a pathogenic animal virus gene, a cancer-related gene, an oncogene, anti-apoptotic gene, a gene critical for tumour cell growth, metastasis, angiogenesis or chemioresistance, an immunomodulatory gene, or a gene encoding a cytokine, growth factor, enzyme or transcription factor.

(25) The target gene may be, e.g., a gene from a pathogenic animal virus, for example human immunodeficiency virus (HIV), herpes simplex virus-1 (HSV-1), HSV-2, cytomegalovirus (CMV), a hepatitis virus such as hepatitis B, hepatitis C or hepatitis D viruses, papillomaviruses, RNA viruses such as polio viruses, VSV, Influenza virus, morbillivirus, or a double-stranded RNA virus such as a reovirus. The virus may be pathogenic to animals other than humans, for example Foot and Mouth Virus, Rinderpest virus, Blue tongue virus, Swine Fever virus, Porcine circa virus, Capripox virus, West Nile Virus, Henipah virus, Marek's Disease Virus, Chicken Aneamia Virus, Newcastle Disease Virus, Avian Influenza virus, Infectious Bursal Disease Virus, Aquaculture viruses such as iridoviruses, paramyxoviruses or White Spot Syndrome Virus.

(26) Preferably, said rodent parvovirus is formulated as a pharmaceutical composition, wherein the parvovirus is present in an effective dose and combined with a pharmaceutically acceptable carrier. Pharmaceutically acceptable is meant to encompass any carrier which does not interfere with the effectiveness of the biological activity of the active ingredients and that is not toxic to the patient to whom it is administered. Examples of suitable pharmaceutical carriers are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions etc. Additional pharmaceutically compatible carriers can include gels, bioasorbable matrix materials, implantation elements containing the parvovirus (therapeutic agent), or any other suitable vehicle, delivery or dispensing means or material(s). Such carriers can be formulated by conventional methods and can be administered to the subject at an effective dose.

(27) An effective dose refers to amounts of the active ingredients that are sufficient to effect treatment. An effective dose may be determined using methods known to one skilled in the art (see for example, Fingl et al., The Pharmocological Basis of Therapeutics, Goodman and Gilman, eds. Macmillan Publishing Co., New York, pp. 1-46 ((1975)).

(28) Administration of the parvovirus may be effected by different ways, e.g. by intravenous, intratumoral, intraperetoneal, subcutaneous, intramuscular, topical or intradermal administration. The route of administration, of course, depends on the kind of therapy. Preferred routes of administration are intravenous (i.v.), intratumoral or endobronchial administration. If infectious virus particles are used which have the capacity to penetrate through the blood-brain barrier, treatment could be performed or at least initiated by intravenous injection of, e.g., H1 virus.

(29) The dosage regimen of the parvovirus is readily determinable within the skill of the art, by the attending physician based an patient data, observations and other clinical factors, including for example the patient's size, body surface area, age, sex, the particular modified parvovirus etc. to be administered, the time and route of administration, the type of mesenchymal tumor, general health of the patient, and other drug therapies to which the patient is being subjected.

(30) As another specific administration technique, the parvovirus can be administered to the patient from a source implanted in the patient. For example, a catheter, e.g., of silicone or other biocompatible material, can be connected to a small subcutaneous reservoir (Rickham reservoir) installed in the patient, e.g., during tumor removal, or by a separate procedure, to permit the parvovirus to be injected locally at various times without further surgical intervention. The parvovirus can also be injected into a tumor by stereotactic surgical techniques or by neuronavigation targeting techniques.

(31) Administration of the parvovirus can also be performed by continuous infusion of viral particles or fluids containing viral particles through implanted catheters at low flow rates using suitable pump systems, e.g., peristaltic infusion pumps or convection enhanced delivery (CED) pumps.

(32) As yet another method of administration of the parvovirus is from an implanted device constructed and arranged to dispense the parvovirus to the desired tissue. For example, wafers can be employed that have been impregnated with the parvovirus, e.g., parvovirus H1, wherein the wafer is attached to the edges of the resection cavity at the conclusion of surgical tumor removal. Multiple wafers can be employed in such therapeutic intervention. Cells that actively produce the parvovirus, e.g., parvovirus H1, can be injected into the tumor, or into the tumor cavity after tumor removal.

(33) In a further preferred embodiment of the present invention, the rodent parvovirus is parvovirus H1 (H1PV) or a related parvovirus such as LuIII, Mouse minute virus (MMV), Mouse parvovirus (MPV), Rat minute virus (RMV), Rat parvovirus (RPV) or Rat virus (RV).

(34) In a particularly preferred embodiment of the present invention, the target specific nucleic acid is inserted at nucleotide 4683 of the wild type H-1PV genome. However the insertion of the cassette in other regions of parvovirus genome is also considered as well as other RNAi triggering molecules such as microRNAs and/or antisense oligonucleotides. In a further particularly preferred embodiment of the present invention, the promoter or promoter region recognizable by RNA polymerases is a RNA-polymerase II (Pol II) promoters such as for instance CMV and human ubiquitin C or RNA-polymerase III (Pol III) promoters such as U6, H1, 7SK and tRNA. An example of a particularly preferred RNA-polymerase III (Pol III) promoter is the RNA-polymerase III H1 promoter.

(35) In a further particularly preferred embodiment of the present invention, the target specific nucleic acid is an shRNA. An shRNA is a small hairpin RNA or short hairpin RNA that is a sequence of RNA that makes a tight hairpin turn that can be used to silence gene expression via RNA interference. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which is then bound to the RNA-induced silencing complex (RISC). This complex binds to and cleaves mRNAs which match the shRNA that is bound to it.

(36) In a further particularly preferred embodiment of the present invention, the target specific nucleic acid, e.g., shRNA, has a length of at least 15 nucleotides.

(37) The present invention also relates to a rodent parvovirus as characterized above for use in treating a disease caused by a pathogenic animal virus gene, a cancer-related gene, an oncogene, anti-apoptotic gene, a gene critical for tumour cell growth, metastasis, angiogenesis or chemioresistance, or a disease associated with the aberrant expression of an immunomodulatory gene or a gene encoding a cytokine, growth factor, enzyme or transcription factor.

(38) In a preferred embodiment, said parvovirus can be used for treating a tumour, preferably for treating a brain tumor.

(39) In a further preferred embodiment, said parvovirus can be used for the treatment of a tumour characterized in that the cells of said tumour are resistant to chemotherapy and/or radiotherapy.

(40) Patients treatable by the parvovirus according to the invention include humans as well as non-human animals. Examples of the latter include, without limitation, animals such as cows, sheep, pigs, horses, dogs, and cats.

(41) The present invention also provides a cell of an animal, fungus or protist comprising a parvovirus as hereinbefore described. In an embodiment, the cell is in vitro. The cell is preferably an animal cell, an isolated human cell, an in vitro human cell, a non-human vertebrate cell, a non-human mammalian cell, fish cell, cattle cell, goat cell, pig cell, sheep cell, rodent cell, hamster cell, mouse cell, rat cell, guinea pig cell, rabbit cell, non-human primate cell, nematode cell, shellfish cell, prawn cell, crab cell, lobster cell, insect cell, fruit fly cell, Coleapteran insect cell, Dipteran insect cell, Lepidopteran insect cell or Homeopteran insect cell.

(42) Finally, the present invention also provides a transgenic, non-human animal, fungus or protist comprising a parvovirus as hereinbefore described. Transgenic animals can be produced by the injection of the parvovirus into the pronucleus of a fertilized oocyte, by transplantation of cells, preferably uindifferentiated cells into a developing embryo to produce a chimeric embryo, transplantation of a nucleus from a recombinant cell into an enucleated embryo or activated oocyte and the like. Methods for the production of trangenic animals are well established in the art and, e.g., described in U.S. Pat. No. 4,873,191.

(43) The below examples explain the invention in more detail.

EXAMPLE 1

Materials and Methods

(44) (A) Cell Culture

(45) NB324K and HEK293T cells were grown in Minimum Essential Medium (MEM) and Dulbecco's Modified Eagle Medium (DMEM) (Sigma-Aldrich, Munich, Germany) respectively, supplemented with 5 (MEM) or 10% (DMEM) Foetal Calf Serum, 100 units/ml penicillin, 100 g/ml streptomycin and 2 mM L-Glutamine (all from Gibco, Invitrogen, Karlsruhe, Germany). All cells were kept at 37 C. in a 5% CO.sub.2 atmosphere, 95% humidity.

(46) (B) Plasmid Construction

(47) The Pol III H1 shRNA expression cassette was cloned into the pSR19 (19) and pSR19 (20) plasmids. The former contains the entire H-1PV wt genome and the latter a deleted version lacking the nucleotides 2022-2135 (encoding for the C-terminus region of parvoviral NS2 protein). The HPAI restriction enyzme site (nucleotides 4687-4693 according to the NCBI reference sequence NC_001358.1) was used for the cloning. The cassette was amplified by PCR using as template DNA the pSilencer 3.1 vector (Ambion, Life Technologies, Grand Island, N.Y., USA) and the following primers For H1 POL III 5-GTTAACGAATTCATATTTGCATGT-3-(SEQ ID NO: 1) and REV H1 POL III 5-GTTAACGCGGCCGCGGATCCGAGTGGTCTCATACAGAAC-3 (SEQ ID NO. 2). The cassette contains the BamH1-NotI unique restriction sites for an easy cloning of the shRNAs into the plasmid. The two plasmids were named pH-1PV-silencer 1 and pH-1PV-silencer 2. For the cloning of the shRNA the following pairs of oligonucleotides were used: shRNA EGFP Top strand 5-GATCCGCTGGAGTACAACTACAACTTCAAGAGAGTTGTAGTTGTACT CCAGCTTTTTTGGAAGC-3 (SEQ ID NO: 3) and shRNA-EGFP bottom strand 5-GGCCGCTTCCAAAAAAGCTGGAGTACAACTACAACTCTCTTGAAGTTGTAGT TGTACTCCAG CG-3(SEQ ID NO: 4); shRNA negative control top strand 5-GATCCACAGCAGAGCAGATCGTTCTTCAAGAGAGAACGATCTGCTCTGCTGT TTTTGGAAGC-3 (SEQ ID NO: 5)and shRNA negative control bottom strand 5 GGCCGCTTCCAAAAACAGCAGAGCAGATCGTTCTCTCTTGAAGAACGATCTG CTCTGCTGTG-3(SEQ ID NO: 6). Oligonucleotides were annealed at 96 C. and directly cloned into previously digested BamH1-NotI pH-1PV silencer 1 and 2 plasmids. A similar approach was also used for the cloning of the shRNAs into the pSilencer 3.1-H1 puro vector (Ambion). In this case the BamHI/HindIII restriction sites and the following overlapping oligonucleotides were used: shRNA-EGFP Ambion top strand: 5-GATCCGCTGGAGTACAACTACAACTTCAAGAGAGTT GTAGTTGTACTCCAGCTTTTTTGGAAA-3 (SEQ ID NO: 7) and shRNA-EGFP Ambion bottom strand 5-AGCTTTTCCAAAAAAGCTGGAGTACAACTACAACTCTCTTGAAGTTGTAGTTG TACTCCAGCG-3(SEQ ID No: 8); shRNA negative control top strand Ambion 5-GATCCACAGCAGAGCAGATCGTTCTTCAAGAGAGAACGATCTGCTCTGCTGT TTTTGGAAA-3 (SEQ ID NO: 9)and shRNA negative control bottom strand Ambion 5-AGCTTTTCCAAAAACAGCAGAGCAGATCGTTCTCTCTTGAAGAACGATCTG CTCTGCTGTG-3 (SEQ ID NO: 10). All clones were propagated in Escherichia coli strain SURE (Invitrogen, Darmstadt, Germany) and DNA verified by sequencing.

(48) (C) Virus Production and Titration

(49) All viruses were produced in HEK293T cells. The cells were cultivated in T75 culture flasks and transiently transfected at 12.5% confluency with 4-10 g/flask of viral plasmid. After 4 days, cells were harvested within their medium and lysed by 3 freeze-and-thaw cycles and cellular debris was removed by centrifugation. Produced viruses were further amplified by infecting NB324K cells and purified through iodixanol gradient centrifugation (21). Viral titration was performed by qPCR and plaque assay according to (22) and expressed either as viral genome (Vg) or plaque-forming unit (PFU) per ml.

(50) (D) Viral Plasmid Transfection

(51) For the experiment described in FIG. 2, HEK293T cells were grown in a 10 cm dish and transfected at approximately 40% confluence using FuGENE HD (Roche, Mannheim, Germany) according to the manufacturer's instructions. 2 g of DNA were diluted in serum-free medium to a final concentration of 20 ng/ l and then 7.5 l of Fugene were added to the mixture. After 30 min of incubation at room temperature, the mixture was added drop-wise to the cells.

(52) (E) Virus Infection

(53) For the experiments described in FIG. 4, 1.510.sup.5 of NB324K cells were seeded in 6-well plates and incubated overnight before to be infected with H-1PV wt, H-1PV-silencer-GFP or H-1PV-silencer-control, if not differently specified, at the MOI 5 (PFU/cell). 12 hours after infection, cells were super infected with adenovirus, expressing EGFP protein used at MOI 80 green fluorescent transduction units (GFU)/cell and grown for additional 72 hours before to be processed.

(54) (F) LDH Assay

(55) Virus lytic activity was determined by LDH assay (CytoTox 96; Promega, Mannheim, Germany) according to the manufacturer's instructions. NB324K cells were seeded in 96-well plates (2,500 cells/well) in 50 l of medium. After 24 h, cells were infected by adding additional 50 l of medium containing the virus at the MOI 5 (pfu/cell). At 72 h post infection, cells were processed for determination of LDH release. Colirimetric changes were measured by using a microtiter reader at 492 nm.

(56) (G) shRNA Extraction and Detection

(57) shRNA extraction from parvovirus infected NB324K cells was carried out using the mirVana miRNA Isolation Kit (Ambion, Life technologies, Darmstadt, Germany), according to the manufacturer's protocol. Detection of shRNAs was performed using the mirVana miRNA Detection Kit (Ambion) as described in the instruction manual.

(58) (H) RNA Extraction and cDNA Preparation

(59) Total RNA was isolated from cells using the RNeasy Mini RNA purification kit (Qiagen, Hilden, Germany). cDNA synthesis was performed using the QuantiTect Probe RT-PCR Kit (Qiagen) according to the manufacturer's protocol using random hexamer primers (Promega), with (+RT) or without (RT) addition of HotStarTaq DNA Polymerase.

(60) (I) Quantitative Real-Time PCR (qRT-PCR)

(61) QRT-PCR was performed using a TaqMan ABI Prism 7600 Sequence detection system (Applied Biosystems, Germany) using Power SYBR Green PCR Master Mix (Applied Biosystems, Germany). To normalize each sample for RNA control, the house keeping gene GAPDH was used as a control gene. PCRs were performed using the following primers: GapdhFor5-AGCAACTCCCACTCTTCCACCTT-3 (SEQ ID NO: 11), GapdhRev 5-ACCCTGTTGCTGTAGCCGTATTCAT-3 (SEQ ID NO: 12), EGFPFor 5-CCACTACCTGAGCACCCAGTC-3 (SEQ ID NO: 13), EGFPRev 5-CACGAACTCCAGCAGGACCA-3 (SEQ ID NO: 14).

(62) (J) Western Blotting

(63) Cells infected with H-1PV-sil-GFP, H-1PV-sil-control and H-1PV wild type were trypsinized and washed twice with PBS. The cell pellet was lysed in 500 l of lysis buffer consisting of 50 mM Tris-HCl pH 8, 200 mM NaCl, 0.5% NP-40, 1 mM DTT, 10% glycerol and a mix of protease inhibitors (Roche Diagnostics, Mannheim Germany)) and kept on ice for 20 min. After centrifugation (10,000 rpm10 min) the supernatant was collected and the protein amount was measured by BCA assay (Perkin Elmer) according to the manufacture's manual. Total cellular extracts (30 g) were loaded and separated on 12% SDS gels and transferred onto Hypbond-P membrane (GE Healthcare) by wet blotting (Invitrogen, X-Cell Sure Lock). The membranes were blocked in PBS, 0.05% Tween 20, 5% nonfat dry milk for 1 h at RT. The blots were incubated with the following primary antibodies over night at 4 C.: GFP rabbit (Santa Cruz Biotechnologies, Heidelberg, Germany), -Tubulin mouse (Sigma Life Science, Hamburg, Germany). After membrane washing the peroxidase-conjugated goat anti-rabbit or goat anti-mouse antibody (Santa Cruz Biotechnology, Heidelberg, Germany).) was added for 1 h at room temperature. Membranes were then washed and visualized with the Western Lightning Plus-ECL detection kit (Perkin Elmer, Rodgan, Germany).

(64) (K) Fluorescent Microscopy

(65) NB324K cells were grown in 6-well plates and then infected as described above. After 72 h, cells were washed twice with 1PBS, fixed with 4% paraformaldehyde (PFA) at 4 C. and washed again with PBS. Nuclei staining was performed using the Hoechst 33342 dye. Fixed cells were examined with Leica DMIL fluorescent microscope. GFP intensity was quantified using the ImageJ software (23).

EXAMPLE 2

Construction of Replication Competent H-1PV for the Delivery and Expression of shRNAs

(66) A strategy to generate replication-competent H-1PV virus harbouring a shRNA expression cassette was conceived. For shRNAs expression the RNA-polymerase III H1 promoter (total size of 170-180 bases) was employed because of the limiting DNA packaging capacity of PVs (max. 300 bp) that would most likely not tolerate the insertion of other cassettes. In order to avoid that the insertion would disrupt any viral ORFS, it was decided to incorporate the cassette into the H-1PV untranslated region downstream of the VP gene (encoding for the capsid proteins), namely at nucleotide 4683 (HpaI restriction enzyme site within the parvovirus genome). Unique restriction sites were introduced to facilitate the shRNAs cloning into the cassette by using annealed oligonucleotides with appropriate overhangs (FIG. 1). Two different parvovirus backbones were used for the insertion of the cassette, the pSR19 containing the full length H-1PV genome (19) and the H-1 dr containing a deletion encompassing the nucleotides 2022-2135 (20). This deletion does not interfere with parvovirus replication and infection of human cells and therefore provides a bit larger genetic space for the insertion of a foreign transgene. The new plasmids were named pH-1PV Silencer 1 and pH-1PV Silencer 2. The results presented here refer to the pH-1PV Silencer 2 (hereafter abbreviated in pH-1sil) but similar results were also obtained using the other plasmid. In order to test the efficacy of the new plasmid to induce gene silencing, shRNAs directed against the gene encoding for the Enhanced Green Fluorescent Protein (EGFP) (pH-1sil-GFP) and control shRNA (a scrambled shRNA sequence that does not recognize any known gene sequence) (pH-1sil-control) were introduced and the two plasmids transiently transfected in HEK293T cells. As positive and negative controls a commercially available plasmid was used, namely the pSilencer 3.1 (Ambion, Austin, Tex., USA) carrying the same EGFP or scrambled shRNAs. 16 hours after transfection, cells were infected with recombinant Ad 5 virus carrying the EGFP gene. Cells were then analyzed under a fluorescence microscope. Similarly to the pSilencer 3.1 plasmid, pH-1sil-GFP was very efficient in silencing EGFP, reducing its expression by more than 60% (FIG. 2).

(67) The two pH-1sil plasmids were used for parvovirus production in comparison with the parental H-1PV plasmid (wt) (pSR19) according to the procedure described in Example 1. Wt and mutant H-1PV viruses were produced at similar titers indicating that the insertion of the cassette did not interfere with the overall fitness of the virus (FIG. 3A). Plaque and LDH assays on NB324K cells confirmed the capacity of the shRNA-containing viruses to replicate and induce cell lysis (FIG. 3B-C and FIG. 4). The new viruses were named H-1PV-sil-GFP and H-1PV-sil-control.

EXAMPLE 3

H-1PV-sil Virus Expresses shRNAs

(68) Next, the ability of H-1PV-sil virus to express shRNAs was demonstrated. NB324K cells were infected with H-1PV-sil-GFP and H-1PV wt (used as a negative control). As a positive control for shRNA expression the cells were transfected with pSilencer 3.1 shRNA-EGFP vector. After 72 hours the cells were analyzed for shRNA-GFP content. High levels of shRNAs were detected in H-1PV-sil-GFP infected cells (FIG. 5A).

EXAMPLE 4

H-1PV-sil Virus is Capable of Knocking down EGFP Expression

(69) Next, the ability of H-1PV-silencer to knock-down the EGFP expression was examined. NB324K cells were infected with H-1PV-sil-GFP or H-1PV-sil-control viruses and 12 hours later super-infected with Ad5 expressing EGFP protein. Cells were grown for additional 72 h before to be processed for RNA extraction. Quantitative real-time PCR showed that expression of EGFP in cells infected with H-1-sil-GFP was dramatically reduced by more than 80% in comparison with the expression found in control viruses (FIG. 5B).

(70) A similar experiment was performed for checking silencing efficiency at the protein level. Immuno fluorescence and Western blot analyses both confirmed that H-1PV-silencer-GFP, but not control virus, was very efficient in silencing EGFP expression and it does in a dose dependent manner (FIGS. 5C and D).

(71) All together these results provide proof of concept that H-1PV or its derivatives can be used as vehicle for the delivery of shRNAs.

LIST OF REFERENCES

(72) 1. Petrocca F & Lieberman J J Clin Oncol 29, 747-754. 2. Wang Z, Rao D D, Senzer N, & Nemunaitis J Pharm Res. 3. Gartel A L & Kandel E S (2006) Biomol Eng 23, 17-34. 4. Takeshita F & Ochiya T (2006) Cancer Sci 97, 689-696. 5. Pecot C V, Calin G A, Coleman R L, Lopez-Berestein G, & Sood A K Nat Rev Cancer 11, 59-67. 6. Snove O, Jr. & Rossi J J (2006) Nat Methods 3, 689-695. 7. Sliva K & Schnierle B S Virol J 7, 248. 8. Grimm D, Pandey K, & Kay M A (2005) Methods Enzymol 392, 381-405. 9. Grimm D & Kay M A (2007) Hematology Am Soc Hematol Educ Program, 473-481. 10. Power A T & Bell J C (2007) Mol Ther 15, 660-665. 11. Rommelaere J, Geletneky K, Angelova A L, Daeffler L, Dinsart C, Kiprianova I, Schlehofer J R, & Raykov Z (2010) Cytokine Growth Factor Rev 21, 185-195. 12. Cotmore S F & Tattersall P (2007) Adv Virus Res 70, 183-232. 13. Cornelis J J, Lang S I, Stroh-Dege A Y, Balboni G, Dinsart C, & Rommelaere J (2004) Curr Gene Ther 4, 249-261. 14. Ohshima T, Iwama M, Ueno Y, Sugiyama F, Nakajima T, Fukamizu A, & Yagami K (1998) J Gen Virol 79 (Pt 12), 3067-3071. 15. Rayet B, Lopez-Guerrero J A, Rommelaere J, & Dinsart C (1998) J Virol 72, 8893-8903. 16. Ueno Y, Harada T, Iseki H, Ohshima T, Sugiyama F, & Yagami K (2001) J Virol 75, 3965-3970. 17. Ran Z, Rayet B, Rommelaere J, & Faisst S (1999) Virus Res 65, 161-174. 18. Di Piazza M, Mader C, Geletneky K, Herrero Y C M, Weber E, Schlehofer J, Deleu L, & Rommelaere J (2007) J Virol 81, 4186-4198. 19. Kestler J, Neeb B, Struyf S, Van Damme J, Cotmore S F, D'Abramo A, Tattersall P, Rommelaere J, Dinsart C, & Cornelis J J (1999) Hum Gene Ther 10, 1619-1632. 20. Faisst S, Faisst S R, Dupressoir T, Plaza S, Pujol A, Jauniaux J C, Rhode S L, & Rommelaere J (1995) J Virol 69, 4538-4543. 21. Zolotukhin S, Byrne B J, Mason E, Zolotukhin I, Potter M, Chesnut K, Summerford C, Samulski R J, & Muzyczka N (1999) Gene Ther 6, 973-985. 22. El-Andaloussi N, Endele M, Leuchs B, Bonifati S, Kleinschmidt J, Rommelaere J, & Marchini A (2011) Cancer Gene Ther 18, 240-249. 23. Rasband W S (1997-2011.) U.S. National Institutes of Health, Bethesda, Md., USA, http://imagej.nih.gov/ij/. 24. Abbas-Terki, T., Blanco-Bose, W., Dglon, N., Prlaong, W., Aebischer, P., (2002), Human Gene Therapy 13, 2197-2201 25. Maxwell, I. H., Spitzer, A. L., Long, C. J., Maxwell, F., (1996), Gene Therapy 3, No. 1, 28-36