Plant synthesizing hypoallergenic paucimannose type N-glycan and uses thereof

Abstract

The present invention relates to a plant for producing a protein containing a humanized low-mannose N-glycan, and a method for producing a protein containing a customized humanized low-mannose N-glycan using the aforementioned plant.

Claims

1. A quadruple mutant (qm) Arabidopsis plant having mutations that knock_out each of four endogenous genes and expressing a gene encoding an 1,6-fucosyltransferase (FUT8) protein consisting of SEQ ID NO: 10 to produce a protein containing a paucimannose-type-N-glycan that does not include 1,3-fucose and 1,2-xylose residues, but include an 1,6-fucose reside, wherein the four endogenous genes are: the 1,3-fucosyltransferase A (FucTA) gene encoding an 1,3-fucosyltransferase A (FucTA) consisting of SEQ ID NO: 2; the 1,3-fucosyltransferase B (FucTB) gene encoding an 1,3-fucosyltransferase B (FucTB) consisting of SEQ ID NO: 4; the 1,2-xylosyltransferase (XylT) gene encoding a 1,2-xylosyltransferase (XylT) consisting of SEQ ID NO: 6; and the 1,2-N-acetylglucosaminyltransferase II (GnTII) gene encoding a 1,2-N-acetylglucosaminyltransferase II (GnTII) consisting of SEQ ID NO: 8.

2. The quadruple mutant Arabidopsis plant of claim 1, wherein a part or all of each nucleotide sequence of the FucTA gene, the FucTB gene, the XylT gene, and the GnTII gene is deleted, or a T-DNA is inserted into each nucleotide sequence of the FucTA gene, the FucTB gene, the XylT gene, and the GnTII gene of the quadruple mutant Arabidopsis plant.

3. The quadruple mutant (qm) Arabidopsis plant of claim 1, wherein the mutations of the FucTA gene, the FucTB gene, the XylT gene, and the GnTII gene are achieved by one or more selected from the group consisting of genome modification, gene deletion, gene insertion, T-DNA insertion, homologous recombination, and transposon tagging.

4. The quadruple mutant Arabidopsis plant of claim 1, wherein the FucTA protein is encoded by a cDNA having the nucleotide sequence represented by SEQ ID NO: 1; the FucTB protein is encoded by a cDNA having the nucleotide sequence represented by SEQ ID NO: 3; the XylT protein is encoded by a cDNA having the nucleotide sequence represented by SEQ ID NO: 5; and the GnTII protein is encoded by a cDNA having the nucleotide sequence represented by SEQ ID NO: 7.

5. The quadruple mutant Arabidopsis plant of claim 1 being a transgenic plant, in which a transgene encoding the 1,6-fucosyltransferase (FUT8) protein is incorporated into the genome of the quadruple mutant Arabidopsis plant of claim 1.

6. The transgenic plant of claim 5, wherein the paucimannose-type N-glycan is Man.sub.3GlcNAc[Fuc(1,6)]GlcNAc.

7. The transgenic plant of claim 5, wherein the incorporation of the gene encoding the 1,6-fucosyltransferase (FUT8) protein is carried out by transforming with a recombinant vector which comprises the gene encoding the 1,6-fucosyltransferase (FUT8) protein consisting of the amino acid sequence of SEQ ID NO: 10.

8. The transgenic plant of claim 7, wherein the recombinant vector comprises a polynucleotide having an Arabidopsis thaliana ubiquitin 1 promoter operably linked to a nucleic acid encoding the 1,6-fucosyltransferase (FUT8) protein consisting of the amino acid sequence of SEQ ID NO: 10, and an Arabidopsis thaliana ubiquitin 1 polyadenylation signal operably linked to the nucleic acid.

9. The transgenic plant of claim 5, wherein the transgenic plant is selected from the group consisting of rice, wheat, barley, corn, soybean, potato, red bean, oat, sorghum, Arabidopsis thaliana, Chinese cabbage, daikon, pepper, strawberry, tomato, watermelon, cucumber, cabbage, oriental melon, zucchini, scallion, onion, carrot, ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, wild sesame, peanut, canola, apple, pear, jujube, peach, kiwi, grape, tangerine, persimmon, plum, apricot, banana, rose, gladiolus, gerbera, carnation, chrysanthemum, lily, tulip, rye grass, red clover, orchard grass, alfalfa, tall fescue, and perennial grass.

10. A callus of the transgenic plant of claim 5.

11. A seed of the transgenic plant of claim 5 wherein said seed comprises said transgene.

12. A method for producing a transgenic Arabidopsis plant for production of a protein containing a paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues but includes an 1,6-fucose residue, the method comprising: preparing a quadruple mutant (qm) Arabidopsis plant having mutations that knock_out each of four endogenous genes to produce a protein containing a paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues; and transforming the quadruple mutant Arabidopsis plant with a recombinant vector containing a transgene encoding the 1,6-fucosyltransferase (FUT8) consisting of SEQ ID NO: 10 to overexpress the FUT8 gene wherein the four endogenous genes are: the 1,3-fucosyltransferase A (FucTA) gene encoding an 1,3-fucosyltransferase A (FucTA) consisting of SEQ ID NO: 2; the 1,3-fucosyltransferase B (FucTB) gene encoding an 1,3-fucosyltransferase B (FucTB) consisting of SEQ ID NO: 4; the 1,2-xylosyltransferase (XylT) gene encoding a 1,2-xylosyltransferase (XylT) consisting of SEQ ID NO: 6; and the 1,2-N-acetylglucosaminyltransferase II (GnTII) gene encoding a 1,2-N-acetylglucosaminyltransferase II (GnTII) consisting of SEQ ID NO: 8.

13. The method of claim 12, wherein preparation of the quadruple mutant (qm) Arabidopsis plant comprises crossing independent mutants, each having a mutation that knocks out a separate one of the four endogenous genes, and selecting a plant for producing the protein containing a paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues.

14. A method of using the transgenic plant of claim 5 for producing a protein containing the paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues but includes the 1,6-fucose residue, the method comprising expressing a gene encoding the protein in the transgenic plant of claim 5.

15. The method of claim 14, wherein the expression of the gene is carried out by transforming the plant with a recombinant vector comprising the gene encoding the protein.

16. The method of claim 14, further comprising purifying the expressed protein.

17. The method of claim 16, wherein the purification of the protein is carried out by one or more selected from the group consisting of salting-out, dialysis, chromatography, electrophoresis, and ultracentrifuge.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 show a schematic diagram illustrating the process for producing a plant (qmF) which mainly produces hypoallergenic paucimannose-type N-glycan with Man.sub.3GlcNAc[Fuc(1,6)]GlcNAc structure. Mutants in which T-DNA is inserted to genes of core 1,3-fucosyltransferase A (FucTA), core 1,3-fucosyltransferase B (FucTB), 1,2-xylosyltransferase (XylT), and 1,2-N-acetylglucosaminyltransferase II (GnTII), respectively, were selected to impair their functions. The mutants were crossed to produce a quadruple mutant (qm) which does not contain 1,2-xylose and 1,3-fucose residues that are absent in animal N-glycan but can produce a paucimannose-type N-glycan. A plant (qmF) mainly producing hypoallergenic paucimannose-type N-glycan with Man.sub.3GlcNAc[Fuc(1,6)]GlcNAc structure was produced by introducing human-derived 1,6-fucosyltransferase (FUT8) gene to the qm plant.

(2) FIG. 2 shows Ubiquitin 1 promoter (Ubi1P): front side small letters 700-nt, 1,6-fucosyltransferase (FUT8) gene: middle capital letters 1,728-nt, and Ubiquitin 1 polyadenylation signal (Ubi1 polyA): back side small letters 370-nt sequence (SEQ ID NO: 30) of the gene construct in which human-derived 1,6-fucosyltransferase (FUT8) gene is constantly expressed under regulation of Arabidopsis thaliana Ubiquitin 1 promoter (Ubi1P).

(3) FIG. 3 shows a gene map and restriction enzyme sites of a binary vector for introducing human-derived FUT8 gene to the qm plant.

(4) FIGS. 4A, 4B, and 4C show a quadruple mutant (qm) having completely lost or severely suppressed gene functions due to insertion of T-DNA into Arabidopsis thaliana FucTA, FucTB, XylT and GnTII genes, and a qmF plant in which human-derived FUT8 gene is introduced into the qm plant to express 1,6-fucosyltransferase (FUT8) activity. In FIG. 4A, Col-0, widely-used wild type (WT) of Arabidopsis thaliana, and the phenotypes of qm and qmF plants are shown. In FIG. 4B, Mutations and homozygosities of the FucTA, FucTB, XylT, GnTII genes are shown according to genotyping. Polymerase Chain Reaction (PCR) is performed by using a primer pair specific to the sequences of FucTA, FucTB, XylT, GnTII genes and T-DNA. Genomic DNA of WT, qm and qmF plants were used as templates. In FIG. 4C, expression of the FucTA, FucTB, XylT, GnTII gene and human-derived FUT8 gene were confirmed by reverse transcription PCR. RNA isolated from WT, qm and qmF plants is used as a template.

(5) FIG. 5 N-glycan structure of WT, qm and qmF plants were analyzed by using immunoblotting and affinoblotting analysis; CBB: Coomassie brilliant blue (CBB) stain, Anti-HRP: immunoblotting using horseradish peroxidase (HRP: specifically binds to peptide which has an N-glycan containing 1,3-fucose and 1,2-xylose residues) antibody, Anti-fucose: immunoblotting using an antibody specific to a peptide which has an N-glycan containing 1,3-fucose residue, Anti-xylose: immunoblotting using an antibody specific to a peptide which has an N-glycan containing 1,2-xylose residue, ConA: affinoblotting using Concanavalin A (ConA: lectin specific to a peptide which has an N-glycan containing mannose or glucose residue in the middle or at non-reducing terminal), GSII: affinoblotting using lectin isolated from a seed of Griffonia simplicifolia, which is tropical African legume plant (lectin specifically binds to a peptide which has an N-glycan containing - or -GlcNAc residue at non-reducing terminal), and LCA: affinoblotting using Lens Culinaris Agglutinin (LCA: strongly binds to a peptide which has an N-glycan containing a non-reducing terminal -mannose residue and a core 1,6-fucose residue).

(6) FIG. 6 N-glycan structure of a wild type (WT) plant was analyzed by using MALDI-TOF mass spectrometry. It was found that the proteins isolated from the WT plant mainly contain a high-mannose type N-glycan with Man.sub.5GlcNAc2 (m/z 1579.44850) structure and paucimannose-type N-glycan with Man.sub.3XylFucGlcNAc.sub.2 (m/z 1505.4685) structure containing plant-specific 1,2-xylose and 1,3-fucose residues.

(7) FIG. 7 N-glycan structure of a qm plant was analyzed by using MALDI-TOF mass spectrometry. It was found that the proteins isolated from qm plant mainly contain paucimannose-type N-glycan with Man.sub.3GlcNAc.sub.2 (m/z 1171.3641) structure in which plant-specific 1,2-xylose and 1,3-fucose residue are absent, and contain high-mannose type N-glycan with Man.sub.5GlcNAc.sub.2 (m/z 1579.4537) structure.

(8) FIG. 8 N-glycan structure of a qmF plant was analyzed by using MALDI-TOF mass spectrometry. It was found that the proteins isolated from qmF plant mainly contain hypoallergenic paucimannose-type N-glycan with Man.sub.3GlcNAc[Fuc(1,6)]GlcNAc (m/z 1345.4059) structure containing 1,6-fucose residue and high-mannose type N-glycan with Man.sub.5GlcNAc.sub.2 (m/z 1579.4623) structure, while N-glycan containing plant-specific 1,2-xylose and 1,3-fucose residue is absent.

(9) FIG. 9 shows the relative amount (area ratio: peak area %) of N-glycan of each structure present in the WT, qm and qmF plants.

DETAILED DESCRIPTION

(10) To achieve the object of the present invention, the present invention provides a quadruple mutant (qm) plant which is deficient of the function of core 1,3-fucosyltransferase A (FucTA), core 1,3-fucosyltransferase B (FucTB), 1,2-xylosyltransferase (XylT), and 1,2-N-acetylglucosaminyltransferase II (GnTII) to produce a protein containing hypoallergenic paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues.

(11) The quadruple mutant plant which is deficient of the function of FucTA, FucTB, XylT and GnTII is characterized in that part or whole nucleotide sequence of each of FucTA, FucTB, XylT and GnTII gene is removed or foreign genes including T-DNA is inserted thereto.

(12) As for the method for deleting the function of FucTA, FucTB, XylT and GnTII, it can be a method well known in the pertinent art, namely, genome modification, gene deletion, gene insertion, T-DNA insertion, homologous recombination, transposon tagging, or the like. Preferably, it may be a method of deleting the function of the above proteins by eliminating the gene expression of FucTA, FucTB, XylT and GnTII gene in a transgenic plant group inserted with T-DNA.

(13) Included in the scope of the FucTA, FucTB, XylT and GnTII proteins are the protein having an amino acid sequence represented by SEQ ID NOS: 2, 4, 6 and 8, respectively, and functional equivalents of the protein. As described herein, the expression functional equivalents means a protein which has, as a result of addition, substitution, or deletion of an amino acid, at least 70%, preferably at least 80%, more preferably at least 90%, and even more preferably at least 95% sequence homology with the amino acid sequence represented by SEQ ID NOS: 2, 4, 6 and 8, and it indicates a protein which exhibits substantially the same physiological activity as the protein represented by SEQ ID NOS: 2, 4, 6 and 8.

(14) Furthermore, the genes encoding the FucTA, FucTB, XylT and GnTII proteins include both the genomic DNA and cDNA. Preferably, cDNA sequence of FucTA, FucTB, XylT and GnTII gene may contain a nucleotide sequence which is represented by SEQ ID NOS: 1, 3, 5 and 7, respectively. Furthermore, homologues of the nucleotide sequence are also within the scope of the present invention. Specifically, each of FucTA, FucTB, XylT and GnTII gene may comprise a nucleotide sequence which has preferably at least 70%, more preferably at least 80%, still more preferably at least 90%, and most preferably at least 95% homology with the nucleotide sequence of SEQ ID NOS: 1, 3, 5 and 7. The sequence homology % for a certain polynucleotide is identified by comparing a comparative region with two sequences that are optimally aligned. In this regard, a part of the polynucleotide in comparative region may comprise an addition or a deletion (i.e., a gap) compared to a reference sequence (without any addition or deletion) relative to the optimized alignment of the two sequences.

(15) The deficiency of FucTA, FucTB, XylT and GnTII function according to one embodiment of the present invention can be achieved by inserting T-DNA to each of FucTA, FucTB, XylT and GnTII gene, but it is not limited thereto.

(16) The present invention further provides a transgenic plant for producing a protein containing hypoallergenic paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues but includes 1,6-fucose residue, in which the gene encoding human-derived 1,6-fucosyltransferase (FUT8) protein is inserted to the above quadruple mutant plant.

(17) With regard to the plant according to one embodiment of the present invention, the modified N-glycan may be a paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues but contains 1,6-fucose residue, and it is preferably Man.sub.3GlcNAc[Fuc(1,6)]GlcNAc.

(18) Insertion of FUT8 gene can be carried out by transformation with a recombinant vector which contains a gene encoding the human-derived 1,6-fucosyltransferase (FUT8) protein consisting of an amino acid sequence of SEQ ID NO: 10.

(19) The above FUT8 gene includes both the genomic DNA and cDNA. Preferably, the cDNA sequence of FUT8 gene may contain a nucleotide sequence consisting of SEQ ID NO: 9.

(20) The term recombinant used in the present invention indicates a cell which replicates a heterogeneous nucleotide or expresses above-mentioned nucleotide, or a peptide, a heterogeneous peptide, or a protein encoded by a heterogeneous nucleotide. Recombinant cell can express a gene or a gene fragment in the form of a sense or antisense, which are not found in natural state of cell. In addition, a recombinant cell can express a gene that is found in natural state, provided that above-mentioned gene is modified and re-introduced into the cell by an artificial means.

(21) The term vector is used herein to refer DNA fragment (s) and nucleotide molecules that are delivered to a cell. Vector can replicate DNA and be independently reproduced in a host cell. The terms delivery system and vector are often interchangeably used. The term expression vector means a recombinant DNA molecule comprising a desired coding sequence and other appropriate nucleotide sequences that are essential for the expression of the operatively-linked coding sequence in a specific host organism. Promoter, enhancer, termination codon and polyadenylation signal that can be used for a eukaryotic cell are well known in the pertinent art.

(22) The recombinant vector is preferably a recombinant plant expression vector.

(23) A preferred example of plant expression vector is Ti-plasmid vector which can transfer a part of itself, i.e., so called T-region, to a plant cell when the vector is present in an appropriate host such as Agrobacterium tumefaciens. Other types of Ti-plasmid vector (see, EP 0 116 718 B1) are currently used for transferring a hybrid DNA to protoplasts that can produce a new plant by appropriately inserting a plant cell or hybrid DNA to a genome of a plant. Especially preferred form of Ti-plasmid vector is a so called binary vector which has been disclosed in EP 0 120 516 B1 and U.S. Pat. No. 4,940,838. Other vector that can be used for introducing the DNA of the present invention to a host plant can be selected from a double-stranded plant virus (e.g., CaMV), a single-stranded plant virus, and a viral vector which can be originated from Gemini virus, etc., for example a non-complete plant viral vector. Use of above-mentioned vector can be advantageous especially when a plant host cannot be appropriately transformed.

(24) Expression vector would preferably comprise at least one selective marker. Above-mentioned selective marker is a nucleotide sequence having a property based on that it can be selected by a common chemical method. Every gene which can be used for the differentiation of transformed cells from non-transformed cell can be a selective marker. Example includes, a gene resistant to herbicide such as glyphosate and phosphintricin, and a gene resistant to antibiotics such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol, and toxoflavin, but not limited thereto.

(25) For the plant expression vector according to the present invention, the promoter can be any of CaMV 35S, actin, ubiquitin, pEMU, MAS or histone promoter, but not limited thereto. The term promoter means a DNA molecule to which RNA polymerase binds in order to initiate its transcription, and it corresponds to a DNA region upstream of a structural gene. The term plant promoter indicates a promoter which can initiate transcription in a plant cell. The term constitutive promoter indicates a promoter which is active in most of environmental conditions and development states or cell differentiation states. Since a transformant can be selected with various mechanisms at various stages, a constitutive promoter can be preferable for the present invention. Therefore, a possibility for choosing a constitutive promoter is not limited herein.

(26) For the plant expression vector of the present invention, any conventional terminator can be used. Example includes, nopaline synthase (NOS), rice -amylase RAmy1 A terminator, phaseoline terminator, a terminator for optopine gene of Agrobacterium tumefaciens, and E. coli rm B1/B2 terminator, etc., but are not limited thereto. Regarding the necessity of terminator, it is generally known that such region can increase a reliability and an efficiency of transcription in plant cells. Therefore, the use of terminator is highly preferable in view of the contexts of the present invention.

(27) As for the method for delivering the vector of the present invention to inside of a host cell, it can be carried out by a microinjection method, a calcium phosphate precipitation method, an electroporation method, a liposome-mediated transfection, a DEAE-dextran treatment method, a gene bombardment, or the like.

(28) The recombinant vector according to one embodiment of the present invention is characterized in that it comprises a polynucleotide (SEQ ID NO: 30) having Arabidopsis thaliana ubiquitin 1 promoter, a gene encoding human-derived 1,6-fucosyltransferase (FUT8) protein which consists of an amino acid sequence of SEQ ID NO: 10, and an Arabidopsis thaliana ubiquitin 1 polyadenylation signal.

(29) The plant of the present invention can be food crops, vegetable crops, special crops, fruit plants, flowers, or feed crops, and it is preferably a plant selected from the group consisting of rice, wheat, barley, corn, soybean, potato, red bean, oat, sorghum, Arabidopsis thaliana, Chinese cabbage, daikon, pepper, strawberry, tomato, watermelon, cucumber, cabbage, oriental melon, zucchini, scallion, onion, carrot, ginseng, tobacco, cotton, sesame, sugar cane, sugar beet, wild sesame, peanut, canola, apple, pear, jujube, peach, kiwi, grape, tangerine, persimmon, plum, apricot, banana, rose, gladiolus, gerbera, carnation, chrysanthemum, lily, tulip, rye grass, red clover, orchard grass, alfalfa, tall fescue, and perennial grass, but it is not limited thereto. More preferably, it is a dicot plant and even more preferably Arabidopsis thaliana.

(30) According to one embodiment of the present invention, selection is made for Arabidopsis thaliana in which expression of human-derived FUT8 gene is introduced for exhibiting its activity in a qm plant of which expression of FucTA, FucTB, XylT and GnTII gene is removed.

(31) The present invention further provides a callus and a seed of the above-mentioned transgenic plant.

(32) The present invention further provides a method for producing a transgenic plant for the production of a protein containing hypoallergenic paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues but includes 1,6-fucose residue, above-mentioned method being characterized in that it includes the following steps of: (1) preparing a quadruple mutant (qm) plant which is deficient of the functions of FucTA, FucTB, XylT and GnTII proteins and can produce a protein containing hypoallergenic paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues, and (2) transforming the quadruple mutant (qm) plant prepared in the above step (1) with a recombinant vector containing a gene encoding the human-derived 1,6-fucosyltransferase (FUT8) protein followed by overexpression of FUT8 gene, and selecting a transgenic plant which is deficient of the functions of FucTA, FucTB, XylT and GnTII proteins.

(33) The quadruple mutant (qm) plant of the above step (1) is characterized in that it is produced by crossing the independent mutants, each deficient of the function of FucTA, FucTB, XylT and GnTII proteins and selecting a plant which produces a protein containing hypoallergenic paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues.

(34) As for the method for determining the plant deficient of the function of FucTA, FucTB, XylT and GnTII in the above step (1) according to one embodiment of the present invention, to select a line in which expression of the FucTA, FucTB, XylT or GnTII gene is eliminated or significantly suppressed due to insertion of one T-DNA specifically to the FucTA, FucTB, XylT or GnTII gene, a plant inserted with T-DNA can be selected by a method in which segregation ratio of herbicide or antibiotics resistance is analyzed on a selection medium, or presence of a mutant gene in a genomic DNA of a transgenic plant or insertion of T-DNA is analyzed based on PCR using a primer pair specific to FucTA, FucTB, XylT and GnTII gene and T-DNA. Furthermore, based on gene expression analysis using reverse transcription (RT) PCR, a homozygote line of Arabidopsis thaliana in which T-DNA is inserted into both sets of the homologous chromosomes of a transformant can be selected.

(35) Furthermore, with regard to the method for determining a plant which exhibits the activity of 1,6-fucosyltransferase (FUT8) according to insertion of human-derived FUT8 gene in the above step (2) of one embodiment of the present invention, it is also possible that, to select a line exhibiting the expression of FUT8 gene, segregation ratio of herbicide or antibiotics resistance on a selection medium can be analyzed, or insertion of FUT8 gene present in a genomic DNA of a transgenic plant can be analyzed by using a primer pair specific to FUT8 gene, and thus a transgenic plant can be selected. Furthermore, expression of the above gene can be also analyzed by RT-PCR.

(36) The present invention further provides a transgenic plant prepared by the aforementioned method to produce proteins containing hypoallergenic paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues but includes 1,6-fucose residue.

(37) As for the method for analyzing N-glycan based on deficient function of FucTA, FucTB, XylT and GnTII and expression of FUT8 gene in the transgenic plant according to one embodiment of the present invention, immunoblotting and affinoblotting analysis can be included. Function of FucTA, FucTB, XylT, GnTII and FUT8 can be analyzed by any method which is well known in the art, and preferably, the analysis can be made by performing immunoblotting for detecting peptides containing plant-specific monosaccharides and complex type N-glycan using 1,3-fucose, 1,2-xylose antibodies (each diluted at 1:10000, Agrisera), HRP (horseradish peroxidase) antibody (diluted at 1:10000, Sigma) or affinoblotting for detecting mannose type N-glycan using ConA (Concanavalin A) (Sigma), for detecting N-acetylglucosamine type (GlcNAc type) N-glycan using GS-II (Griffonia simplicifolia) (Molecular probes) lectins, and for detecting N-glycan containing 1,6-fucose using LCA (Lens culinaris) (USBiological) lectin. Alternatively, the analysis can be made by whole N-glycan profiling based on MALDI-TOF mass analysis after digesting the whole N-glycan by peptide: N-glycanase A (PNGase A).

(38) For the above immunoblotting and affinoblotting, enzymes like horseradish peroxidase (HRP), alkali phosphatase, -galactosidase, urease, catalase, glucooxidase, lactic acid dehydrognease, amylase, biotin-avidin complex, or the like can be used. For fluorescent immunoassay, a fluorescent material or a fluorophore like fluorescein isothiocyanate, tetramethyl rhodaimine isothiocyanate, substituted rhodaimine isothiocyanate, dichlorotriazine isothiocyanate, Alexa, and AlexaFluoro can be used. For radioactive immunoassay, a radioisotope such as tritium, iodine, phosphorus, or sulfur can be used. For luminescent immunoassay, a luciferase method, a lumunol peroxidase POD method, and the like can be used with a luminescent material like dioxetan compound. Like the case of using an avidin-biotin method or streptoavidin-biotin method, an antibody may be conjugated to a labeling material, if necessary. For conjugation between a labeling material and an antibody, a glutaraldehyde method, a maleimide method, a pyridyl sulfide method, or a periodic acid method can be used in case of an enzyme-linked immunoassay. For radioactive immunoassay, a chloramine T method, a Bolton-Hunter method, or the like can be used.

(39) Examples of the immunoassay method include, in addition to the above four kinds of the method, an immunoprecipitation method, an immunoturbidimetric method, a Western blotting method, an immunostaining method, an immunodiffusion method or the like. However, it is not limited to them, any immunoblotting method that is generally used in the pertinent art is included.

(40) The method for purifying and analyzing the aforementioned protein having N-glycan can be confirmed by a method well known in the art. Examples of the well-known method include any method which is well known in the art like chromatography, electrophoresis, and mass analysis. It preferably includes HPLC (high performance liquid chromatography) profiling and MALDI-TOF (matrix-assisted laser desorption/ionization) mass analysis, but not limited thereto.

(41) The present invention further provides a method for producing a protein containing hypoallergenic paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues but includes 1,6-fucose residue, including a step of expressing a gene encoding an exogenous glycoprotein in the aforementioned plants.

(42) Expression of a gene encoding a foreign glycoprotein in the above-mentioned plant can be carried out by transforming a plant with a recombinant vector which comprises gene encoding a foreign glycoprotein.

(43) Examples of the foreign glycoprotein include human -glucocerebrosidase, erythropoietin (EPO), human growth hormone (hGH), hepatitis B vaccine, insulin, interleukin, interferon, platelet derived growth factor, hemoglobin, elastin, collagen, fibroblast growth factor, human growth factor, human serum albumin, colony simulation factor (CSFs), and an antibody, but it is not limited thereto.

(44) The aforementioned method for producing glycoproteins includes steps of expressing a protein having hypoallergenic paucimannose-type N-glycan in a tissue or a cell of a plant and isolating and purifying the expressed foreign glycoproteins. However, the method is not limited to them, and a method well known in the art is also included.

(45) Purification of the expressed foreign glycoproteins can be carried out by using salting-out, dialysis, chromatography, electrophoresis, or ultracentrifuge. In case of high handling scale, a method of separating proteins with different solubility by centrifugational process after modifying salt concentration or pH is generally used (i.e., salting-out). Furthermore, it is also possible to have ion chromatography which utilizes a difference in electrostatic interaction in proteins, filtration chromatography in which separation is made based on size or shape of protein molecules, affinity chromatography in which specific intermolecular interaction is utilized, or ultracentrifuge in which biomaterials are separated based on density gradient of sugar or the like in a solution by utilizing a difference in precipitation rate against centrifugal force. However, the method is not limited to them, and any common methods that are well known in the art are all included.

(46) The present invention further provides a protein containing hypoallergenic paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues but includes 1,6-fucose residue. Above-mentioned protein can be produced by the aforementioned method.

(47) The present invention still further provides a pharmaceutical composition comprising the aforementioned protein as an active ingredient. The pharmaceutical composition has a meaning which is similar to that of biopharmaceuticals, and it indicates a pharmaceutical product including protein, a hormone, a vaccine or the like that is produced by a living cell using a recombinant DNA technique and used for diagnosis, prophylaxis, and therapeutics.

(48) Herein below, the present invention is explained in greater detail in view of the Examples. However, it is evident that the following Examples are given only for exemplification of the present invention and, by no means, the present invention is limited to the following Examples.

EXAMPLES

Example 1. Construction of Binary Vector for Expression of Human-Derived FUT8 Gene

(49) To introduce FUT8 gene for the 1,6-fucosyltransferase (FUT8) activity, cDNA encoding FUT8 gene was isolated from human cDNA library based on a PCR method using the primers of SEQ ID NOS: 26 and 27 (see, Table 2), and the nucleotide sequence was analyzed by sequencing. The FUT8 gene was used to prepare a gene construct that constitutively express the FUT8 under the regulation of Ubiquitin 1 promoter (Ubi1P). Furthermore, by introducing the gene construct to a binary vector which includes toxoflavin lyase (tfJA) gene as a toxoflavin resistant selection marker was used to make FUT8 expression construct. The results are shown in FIG. 2 and FIG. 3.

Example 2. Preparation of Plant Quadruple Mutant (Qm) which is Deficient of Function of Arabidopsis thaliana FucTA, FucTB, XylT, GnTII Gene by T-DNA Insertion and qmF Plant Introduced with Human-Derived FUT8 Gene

(50) 1. Plant Materials and Growth Conditions

(51) Sterilized seeds of Arabidopsis thaliana WT (Arabidopsis thaliana Col-0), qm and qmF plants were grown on a MS medium containing salt mixture supplemented with 3% sucrose and 0.25% gelatin gum. They were cultivated at 22 C. and 70% humidity conditions in a growth chamber having supplemental lighting (dark period for 8 hours/light period for 16 hours; 120 mol m.sup.2 sec.sup.1). A difference in the phenotype of the above plants is shown in FIG. 4A.

(52) 2. Preparation of qmF Plant by Introducing FUT8 Gene

(53) The binary vector constructed in Example 1 was introduced into the qm plant by using Agrobacterium tumefaciens. The transformed heterozygous qmF plant was selected by utilizing the toxoflavin resistance which is exhibited by tflA gene included in the binary vector. Transgenic plants containing a single copy of the transgene were confirmed by Mendel's segregation ratio based on toxoflavin resistance. The results are shown in the following Table 1.

(54) TABLE-US-00001 TABLE 1 Line Total Resistance Sensitivity .sup.2 4 100 74 23 0.05 6 100 82 18 2.61

(55) As shown in Table 1, the ratio of daughter plants of the heterozygous qmF plant line was determined on a medium containing toxoflavin. Based on a .sup.2 test, copy number of T-DNA insertion was determined, and the significance level of .sup.2 test for Line 4 and Line 6 was 0.05 and 2.61, respectively. The daughter plants obtained from the qmF plant line which has been confirmed to have a single copy of FUT8 gene was again subjected to the resistance test using a medium containing toxoflavin. Accordingly, a homozygous qmF plant was obtained.

(56) 3. Genotyping of Inserted Sequence

(57) Seeds of each of Arabidopsis thaliana having T-DNA insertion in the FucTA, FucTB, XylT, and GnTII gene were obtained from T-DNA insertion mutant collection of Arabidopsis Biological Resource Center. To select homozygous Arabidopsis thaliana line, in which T-DNA is inserted into both sets of the homologous chromosomes, PCR and reverse transcription polymerase chain reaction (RT-PCR) using the primer pairs of Table 2 were carried out. Each of the selected homozygous mutant was used to make a quadruple (i.e., FucTA, FucTB, XylT, and GnTII genes) mutant by crossing. Based on genotyping, a homozygous quadruple mutant (qm) plant in which a T-DNA is inserted into the FucTA, FucTB, XylT, GnTII genes, respectively, was selected. The results are shown in FIG. 4B.

(58) For the genotyping, genomic DNA was extracted from the leaves of Arabidopsis thaliana by using phenol-chloroform. Based on PCR using a combination of primers specific to each gene (see, Table 2), insertion site of T-DNA and homozygous property were determined. PCR conditions are as follows; 1 cycle, 2 minutes at 95 C. (denaturation); 30 cycles, 20 seconds at 95 C. (denaturation), 40 seconds at 58 C. (annealing), 1 minute at 72 C. (elongation); and 1 cycle, 5 minutes at 72 C. The PCR was performed by using e-Taq DNA polymerase mixture (SolGent).

(59) 4. Expression Analysis of FucTA, FucTB, XylT, GnTII and FUT8 Gene Using Reverse Transcription Polymerase Chain Reaction

(60) Total RNAs were extracted from leaf tissues of Arabidopsis thaliana according to the protocols of NucleoSpin RNA Plant Kit (Macherey-Nagel). Extracted total RNA was used to prepare cDNA by using ReverTraAce-a kit (Toyobo). 1 l of single stranded cDNA was used as a template for subsequent PCR. To determine the expression of each of FucTA, FucTB, XylT, GnTII and FUT8 gene, forward primers and reverse primers that are described in Table 2 were used. Tubulin primer was used as a control of RNA content. PCR conditions are as follows; 1 cycle, 2 minutes at 95 C. (denaturation); 30 cycles, 20 seconds at 95 C. (denaturation), 40 seconds at 58 C. (annealing), 1 minute at 72 C. (elongation); and 1 cycle, 5 minutes at 72 C. The PCR was performed by using e-Taq DNA polymerase mixture (SolGent).

(61) TABLE-US-00002 TABLE2 Primersusedinthepresentinvention Primer Nucleotidesequence(5.fwdarw.3) Use FucTA-F GAGGAGGCAAAAATTACATGTATATGC Genotyping TCATCC(SEQIDNO:11) FucTA-R CAGCGACTAGAGATTGGAAGAACTTCT Genotyping, CTGTG(SEQIDNO:11) RT-PCR FucTB-F TGTCTCCGGTACAGCCAAAAACTGAGA Genotyping, G(SEQIDNO:13) RT-PCR FucTB-R AAGCAGCAGGGTTAGCTGCGAGATACT Genotyping, T(SEQIDNO:14) RT-PCR XylT-F CACAGAGAGGAATGATGGAATCTTCAG Genotyping CTT(SEQIDNO:15) XylT-R ATTCAACATCTCATCATTCACCAGCCG Genotyping, (SEQIDNO:16) RT-PCR GnTII-F GGTGGATGATGAACACTGTATGGGATG Genotyping G(SEQIDNO:17) GnTII-R TCATGGAGATGCACTGCTACTGCTGTA Genotyping, AC(SEQIDNO:18) RT-PCR FucTA-LB GCGTGGACCGCTTGCTGCAACT Genotyping (SEQIDNO:19) FucTB-LB CCCATTTGGACGTGAATGTAGACAC Genotyping (SEQIDNO:20) XylT-LB GCCTTTTCAGAAATGGATAAATAGCCT Genotyping TGCTTC(SEQIDNO:21) GnTII-LB TGTGCCAGGTGCCCACGGAATAG Genotyping (SEQIDNO:22) FucTA-RTF ATGGGTGTTTTCTCCAATCTTCGAGGT RT-PCR (SEQIDNO:23) XylT-RTF ATGAGTAAACGGAATCCGAAGATTCTG RT-PCR AA(SEQIDNO:24) GnTII-RTF ATGGCAAATCTTTGGAAGAAGCAGA RT-PCR (SEQIDNO:25) FUT8-F CCATGGCAATTACTGTCTCATTAGTGA RT-PCR ACAAT(SEQIDNO:26) FUT8-R ACTAGTTATTTCTCAGCCTCAGGATAT Cloning, GTGGG(SEQIDNO:27) RT-PCR Tubulin-F ATCGATTCCGTTCTCGATGT Cloning, (SEQIDNO:28) RT-PCR Tubulin-R ATCCAGTTCCTCCTCCCAAC RT-PCR (SEQIDNO:29)

Example 3. Analysis and Determination of N-Glycan of WT, Qm and qmF Plants Using Immunoblotting and Affinoblotting

(62) For immunoblotting and affinoblotting analyses, total proteins were extracted from 3-week old WT, qm and qmF plants. Total proteins extract were separated by 10% SDS-PAGE, and transferred to a nitrocellulose membrane (Hybond-ECL, Amersham). To determine the N-glycan having plant-specific sugar residues by immunoblotting, the membrane was labeled with an antibody against 1,3-fucose, 1,2-xylose (Agrisera) or HRP (Sigma). Furthermore, to measure the N-glycan of high-mannose type and N-glycan with GlcNAc terminal by affinoblotting, ConA (Sigma) and GS-II lectin (Molecular Probes) were used, respectively. Furthermore, to determine the N-glycan having 1,6-fucose sugar residue by affinoblotting, LCA lectin (USBiological), which mainly recognizes a peptide having N-glycan including mannose residue but shows significantly increased affinity when the N-glycan includes 1,6-fucose residue, was used.

(63) In order to confirm whether or not the Arabidopsis thaliana qm plant produces a protein containing customized paucimannose-type N-glycan that does not include 1,3-fucose and 1,2-xylose residues and to see whether or not the qmF plant produces a protein containing customized paucimannose-type N-glycan which includes humanized 1,6-fucose sugar residue, the inventors of the present invention conducted immunoblotting using anti-HRP, anti-fucose, and anti-xylose antibodies and affinoblotting analysis using ConA, GS-II, and LCA. The results are shown in FIG. 5.

(64) As shown in FIG. 5, anti-HRP, anti-fucose, and anti-xylose antibodies show a response only to the protein derived from the WT plant, and show no response to the protein derived from the qm and qmF plant. These results indicate that paucimannose-type and complex type N-glycan including 1,3-fucose and 1,2-xylose residues are not synthesized in the qm and qmF plant. On the contrary, ConA showed a strong response to the protein isolated from the qm and qmF plant but showed a weak response to the protein isolated from the WT. In the case of GS-II, almost the same response was shown in the wild type, the qm and qmF plant. These results indicate that the amount of mannose type N-glycan is increased in the qm and qmF plant.

(65) Furthermore, in the case of LCA which mainly recognizes a peptide having N-glycan including mannose residue but shows significantly increased affinity when N-glycan includes 1,6-fucose residue, a weak response to the protein isolated from the WT and qm plant was shown, while a particularly strong response to the qmF plant was shown. These results indicate that the amount of customized hypoallergenic paucimannose-type N-glycan including humanized 1,6-fucose residue is specifically increased in the qmF plant.

Example 4. Analysis and Determination of N-Glycan of WT, Qm and qmF Plant Using Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS)

(66) 1. Separation, Purification, and Permethylation of N-Glycan

(67) Proteins for purification of N-glycan were extracted from the WT, qm and qmF plant by using the method of Bakker, et. al. (Bakker et. al., 2006, Proc. Natl. Acad. Sci. USA, 103:7577-7582). The proteins were degraded by using trypsin, and fixed N-glycan was released by using PNGase A (Peptide N-Glycosidase A) (Prozyme, USA). The sample was allowed to pass through a C18 Sep-Pak cartridge followed by freeze drying. The carbohydrate fractions were dissolved in dimethyl sulfoxide (DMSO) and subjected to permethylation according to the method of Anumula and Taylor (Anumula and Taylor, 1992, Aanl. Biochem. 203:101-108).

(68) 2. Matrix-Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS) Analysis

(69) MALDI-TOF MS was carried out by the inventors of the present invention, in which the analysis was performed in a reflector positive ion mode by using 20 mg m.sup.1 dihydroxybenzoic acid (DHBA) in a 50% (v/v) methanol solution. The spectrum was obtained by using LTQ XL (Thermo Fisher Scientific Inc.).

(70) To obtain quantitative and structure comparative information, the glycoproteins extracted from the plant were used for MALDI-TOF MS. The results are shown in FIG. 6 to FIG. 9.

(71) The mass spectrum of the N-glycan obtained from the WT shows that high-mannose type N-glycan and N-glycan with various structures including 1,3-fucose and 1,2-xylose residues are produced in the WT (FIG. 6). The mass spectrum of the N-glycan obtained from the qm plant shows that paucimannose and complex type N-glycan including 1,3-fucose and 1,2-xylose residues are not produced in the qm plant, while paucimannose-type and high-mannose type N-glycan not including 1,3-fucose and 1,2-xylose are mainly produced therein (FIG. 7). Meanwhile, the mass spectrum of the N-glycan obtained from the qmF plant shows that paucimannose-type and high-mannose type N-glycan including 1,6-fucose residue are mainly produced while plant-specific paucimannose-type N-glycan including 1,3-fucose and 1,2-xylose residues is not produced (FIG. 8).

(72) TABLE-US-00003 TABLE3 Measured N-glycan WT qm qmF m/z structure (%) (%) (%) 1171.3928 Man.sub.3GlcNAc.sub.2 0.64 26.57 12.22 1331.4238 Man.sub.3XylGlcNAc.sub.2 3.50 ND ND 1345.4227 Man.sub.3FucGlcNAc.sub.2 0.54.sup.a ND 23.32.sup.b 1375.4401 Man.sub.4GlcNAc.sub.2 0.53 1.64 1.61 1416.4695 GlcNAcMan.sub.3GlcNAc.sub.2 0.35 17.57 6.15 1505.4685 Man.sub.3XylFucGlcNAc.sub.2 19.15 ND ND 1535.4751 Man.sub.4XylGlcNAc.sub.2 1.54 ND ND 1576.4882 GlcNAcMan.sub.3XylGlc 1.97 ND ND NAc.sub.2 1579.4950 Man.sub.5GlcNAc.sub.2 21.90 24.54 19.72 1590.4923 GlcNAcMan.sub.3FucGlc 0.51.sup.c ND 12.54.sup.d NAc.sub.2 1750.5334 GlcNAcMan.sub.3XylFuc 9.64 ND ND GlcNAc.sub.2 1783.5295 Man.sub.6GlcNAc.sub.2 9.43 9.36 8.10 1987.5796 Man.sub.7GlcNAc.sub.2 7.93 8.22 6.89 1995.5853 GlcNAc.sub.2Man.sub.3XylFuc 10.40 ND ND GlcNAc.sub.2 2191.6177 Man.sub.8GlcNAc.sub.2 6.11 6.50 4.82 2395.6563 Man.sub.9GlcNAc.sub.2 5.86 5.60 4.63 Total 100 100 100 .sup.aMan.sub.3FucGlcNAc.sub.2 = Man.sub.3GlcNAc[Fuc(1,3)]GlcNAc, .sup.bMan.sub.3FucGlcNAc.sub.2 = Man.sub.3GlcNAc[Fuc(1,6)]GlcNAc, .sup.cGlcNAcMan.sub.3FucGlcNAc.sub.2 = GlcNAcMan.sub.3GlcNAc[Fuc(1,3)]GlcNAc, .sup.dGlcNAcMan.sub.3FucGlcNAc.sub.2 = GlcNAcMan.sub.3GlcNAc[Fuc(1,6)]GlcNAc; ND, not detected; Man, mannose; Xyl, xylose; GlcNAc, N-acetylglycosamine; Fuc, fucose; Gal, galactose

(73) The above Table 3 shows the MALDI-TOF MS analysis result of the N-glycan which has been obtained from the WT, qm and qmF plants. The above numerical values indicate the relative amount of N-glycan with each structure (area ratio: peak area %). The results are shown in FIG. 9.

(74) As a quantitative analysis of N-glycan obtained from the WT, qm and qmF plants, MALDI-TOF mass analysis was carried out by using the N-glycan which has been produced as a derivative according to the permethylation before the analysis. To obtain favorable ion statistics, the provided spectrum was generated from various spectrums of 100 laser shots. The integrated peak area of the whole radioisotope element group was measured based on relative quantitative analysis.

(75) Taken together the above test results, it was confirmed by the inventors of the present invention that deficient function of core 1,3-fucosyltransferase A (FucTA), core 1,3-fucosyltransferase B (FucTB), 1,2-xylosyltransferase (XylT), and j1,2-N-acetylglucosaminyltransferase II (GnTII) in Arabidopsis thaliana enables complete inhibition of the production of plant-specific N-glycan in the Golgi complex, and a defect in the production of plant-specific N-glycan leads to accumulation of paucimannose-type N-glycan with Man.sub.3GlcNAc.sub.2 structure. Furthermore, by introducing human-derived 1,6-fucosyltransferase (FUT8) gene into the qm plant and having continuous expression of the gene therein, it was confirmed that customized hypoallergenic paucimannose-type N-glycan (Man.sub.3GlcNAc[Fuc(1,6)]GlcNAc) having 1,6-fucose is accumulated as a main product.