Thermocycling of a Block Comprising Multiple Sample

Abstract

The present invention relates to the field of high throughput analysis of samples. In particular, the present invention is directed to a device, a System and a method for simultaneous tempering of multiple samples. More particular, the invention relates to the simultaneous thermocycling of multiple samples to perform PCR in a microtiter plate format.

Claims

1-50. (canceled)

51. A method for simultaneous thermocycling of multiple samples, the method comprising: a) providing a device comprising a thermal block, a heat sink, a first liquid-vapor equalization thermal base, a second liquid-vapor equalization thermal base, a computer, and at least one thermoelectric based heat pump actively controlled by the computer, wherein the device is configured such that the first thermal base is in thermal contact with and sandwiched directly in-between the heat pump and the heat sink and the second thermal base in thermal contact with and sandwiched directly in-between the thermal block and the heat pump; b) performing a thermocycling protocol with the computer, said performing comprising actively controlling the heat pump to alternatively heat and cool the thermal block and at the same time to reverse direction of heat transfer through the first and second thermal bases, and independently varying the heat conducting properties of the first thermal base and the second thermal base during the thermocycling protocol.

52. The method according to claim 51, comprising controlling the power supply to the at least one heat pump and the independently varying the first and second switches with the computer.

53. The method according to claim 1, wherein independently varying is effectuated via a first switch on the first thermal base and a second switch on the second thermal base.

54. The method according to claim 51 comprising independently varying the heat conducting properties of the first thermal base via the first switch by changing volume and/or flow rate within the first thermal base.

55. The method according to claim 1 comprising independently varying the heat conducting properties of the second thermal base via the second switch by changing volume and/or flow rate within the second thermal base.

56. The method according to claim 1 wherein the thermocycling protocol comprises nucleic acid amplification.

57. The method according to claim 51, wherein the first thermal base, the second thermal base, the heat sink, and the thermal block each have a cross section area, the cross section area of the first thermal base being less than 20% larger than the cross section area of the heat sink, wherein the cross section area of the second thermal base is larger than the cross section area of the thermal block, wherein the cross section areas are in parallel to respective contact areas, such that heat transfer to and from the first and second thermal bases comprises homogenous heat transfer across the cross-sectional areas of the heat sink and thermal block, respectively.

58. A method for the simultaneous thermocycling of multiple samples comprising the steps: a) providing a thermal block with multiple recesses, at least one heat pump, a first thermal base comprising a vapor chamber device for transporting and distributing heat, a second thermal base, a heat sink, and a control unit, arranged such that the first thermal base is between and in thermal contact with the heat sink and at least one heat pump, the at least one heat pump is situated between the first thermal base and the second thermal base, the second thermal base being in thermal contact with the thermal block, wherein thermal contact is effectuated by one or more of a paste having a high thermal conductance, a thermally conductive foil, and a mechanical force; c) placing the multiple samples within the recesses of the thermal block; and d) performing a thermocycling protocol with the control unit, wherein the control unit actively controls the heat pump and independently controls a heat conducting property of the first thermal base and a heat conducting property of the second thermal bases.

59. The method according to claim 58, wherein the first thermal base is substantially planar and free of recesses.

60. The method according to claim 59, wherein the cross sectional area of the first thermal base is less than 20% larger or smaller than the cross sectional area of the heat sink, and wherein the cross-sectional area of the first thermal base is larger than the cross sectional area of the thermal block and said cross sectional areas aligned parallel to the respective contact areas.

61. The method according to claim 58 wherein the second thermal base is substantially planar and free of recesses.

62. The method according to claim 58 wherein the thermocycling protocol comprises nucleic acid amplification.

63. A device for simultaneous thermocycling of multiple samples in a polymerase chain reaction (PCR) thermocycling protocol, the device comprising: a thermal block; a heat sink; at least one actively controlled thermoelectric based heat pump; a liquid-vapor equalization based first thermal base in thermal contact with and sandwiched directly in-between the heat pump and the heat sink; a liquid-vapor equalization based second thermal base in thermal contact with and sandwiched directly in-between the thermal block and the heat pump; a first switch configured to vary at least one heat conducting property of the first thermal base during a thermocycling protocol; a second switch configured to vary at least one heat conducting property of the second thermal base during a thermocycling protocol; and a computer operationally configured to control power supply to the at least one heat pump and to control the first switch and the second switch to independently vary the heat conducting properties of the first and the second thermal bases; wherein the at least one thermoelectric based heat pump is in thermal contact with and directly adjacent the second surface of the second thermal base and the first surface of the first thermal base.

Description

DESCRIPTION OF THE FIGURES

[0174] FIG. 1 Schematic pictures of several embodiments of the device according to the present invention.

[0175] FIG. 2 Heat pictures of the thermal block during a heating procedure of the thermal block.

[0176] FIG. 3 Heat pictures of the thermal block during a cooling procedure of the thermal block.

[0177] FIG. 4 Graph illustrating several temperatures associated with the thermal block as a function of time during the term of a thermocycling protocol comprising 6 cycles.

[0178] FIG. 5 Detailed graph illustrating several temperatures associated with the thermal block as a function of time during the term of one thermocycling cycle.

[0179] FIG. 6 Real-time amplification curves of a Parvovirus B19 fragment. Five different target concentrations were analysed by real-time PCR and each concentration is represented by five different wells of the plate. (a: 10.sup.6 copies; b: 10.sup.5 copies; c: 10.sup.4 copies; d: 10.sup.3 copies; e: 10.sup.2 copies).

[0180] FIG. 7 Real-time amplification curves of a Parvovirus B19 fragment. 96 real-time amplification curves recorder in 96 different wells of a plate, each containing 10.sup.4 copies of the target sequence.

EXAMPLE 1

[0181] A device according to the present invention for the thermocycling of a 384 multiwell plate comprises a homemade thermal block out of the aluminum alloy AlMgSi 0.5. An aluminum block with the dimension 109739.1 mm was used to form 384 recesses by drilling, each conic recess has a top diameter of 3.44 mm (angle 17) and a depth of 6.8 mm.

[0182] Below said thermal block 6 Peltier elements are arranged, whereas the thermal contact is enhanced via a thermal conductive graphite foil. The used Peltier elements are suitable for multiple thermocycling procedures and can heat up to 130 C. Additionally, each of them has a cooling capacity of 75 W.

[0183] Via a second thermal conductive graphite foil, the 6 Peltier elements are arranged on a thermal base. The used thermal base is customized production of Thermacore and has the dimension of 2481985 mm. The vessel wall is made out of copper and the working fluid is water.

[0184] The used heat sink is commercially available from Webra (product number W-209) and is made out of the aluminum alloy AlMgSi 0.5 with the dimension 25020075 mm. Between the heat sink and the thermal base a commercial thermal grease is applied in order to enhance the thermal contact.

[0185] All four components of the device are fixed together by 17 screws and springs and the dissipative process is enhanced by four fans circulation air at the heat sink.

EXAMPLE 2

[0186] Heat pictures of the thermal block of a device as described in Example 1 were recorded with an IR-camera (commercially available at the company FLIR) during a heating procedure (FIG. 2) and a cooling procedure (FIG. 3).

[0187] The heating procedure (FIG. 2) started at a temperature of 55 C. with a heating rate of 4 C./s until 95 C. were reached, whereas the cooling procedure (FIG. 3) started at a temperature of 95 C. with a cooling rate of 2 C./s until 55 C. were reached. The pictures were taking at different times during the heating procedure and cooling procedure, respectively.

EXAMPLE 3

[0188] In FIG. 4 different characteristic temperatures of 6 successive temperature cycles of the following thermocycling protocol are plotted as a function of time:

TABLE-US-00001 step temp ramp hold time number PreCycle 40 C. 2.0 C./s 120 sec 1 MainCycle 95 C. 4.4 C./s 10 sec 6 55 C. 2.0 C./s 10 sec 72 C. 4.4 C./s 10 sec
7 different temperature profiles are included in the figure, the temperature profile of the thermocycling protocol (Soll Temp), the theoretical temperature of the thermal block (Soll Ist), the measured temperature of the thermal block (Ist Temp), the mean temperature measured within 9 recesses of the thermal block (Mean), the minimal measured temperature of said 9 recesses of the thermal block (Min), the maximal measured temperature of said 9 recesses of the thermal block (Max) and the homogeneity of the 9 recess measurements (Hom; homogeneity=maximal recess temperatureminimal recess temperature).

[0189] A standard multiwell plate was arranged in the recesses of the thermal block and 9 wells distributed across the cross section of the thermal block were filled with oil (Type Applied Biosystems, Nujol Nineral Oil, Part No. 0186-2302). The temperature was measured using a thermocouple (Thermocouples Omega 5TC-TT-36-72) for each recess. The temperature of the thermal block was measured with an internal temperature sensor within the thermal block.

[0190] In FIG. 5 a magnification of the last cycle of the sequence is plotted to illustrate the different profiles in more detail.

EXAMPLE 4

[0191] To further demonstrate the validity of the invention, real-time PCR amplifications of different target concentrations with a detection based on fluorescent-dye labelled hybridisation probes were performed using the apparatus described in Example 1. As a test system the real-time PCR amplification of a 177 bp fragment of the Parvovirus B19 (SEQ ID NO:1) was chosen. As fluorescent probe the HybridisationProbe pair (SEQ ID NO:4 and SEQ ID NO:5) of the LightCycler-Parvovirus B19 Quantification Kit (Roche Applied Science, Article No. 3 246 809) or SybrGreen was used. Results are displayed in FIG. 6 (HybridisationProbe pair) and FIG. 7 (SybrGreen).

[0192] PCR

[0193] A partial fragment of the parvovirus B19 sequence was cloned into a pCR 2.1 plasmid vector (Invitrogen). Parvovirus B19 plasmid DNA dilutions were prepared in 10 mM Tris-HCl, pH 8.3. Per PCR reaction 10.sup.6 to 100 copies of the plasmid target were used for amplification.

[0194] For PCR amplification the LightCycler-Parvovirus B19 Quantification Kit (Roche Applied Science, Article No. 3 246 809) was used. A typical PCR assay consisted of 10.sup.6 to 100 copies of Parvovirus B19 plasmid, reaction buffer, detection buffer and 1 U of FastStart Taq DNA polymerase according to manufacturer's instructions. The PCR protocol consisted of an initial denaturation step at 95 C. for 10 min, followed by 40 cycles of amplification at 95 C. for 10 s, 60 C. for 15 s and 72 C. for 10 s. Ramp rates were 4.8 C. for heating and 2.4 C. for cooling, respectively. PCR reactions were run in a total volume of 20 l in a white 384-well microtiter plate (custom-made product of Treff, Switzerland).

[0195] Fluorescence emission was detected in each cycle at the end of the annealing step at 60 C. using a CCD camera coupled to an optical system comprising a telecentric lens in order to measure the fluorescence signals of all wells of the plate simultaneously. The used optical system is described in the European patent application EP 05000863.0 (filed Jan. 18, 2005). The HybridisationProbe pair was excited at 480 nm, whereas emission was measured at 640 nm. SybrGreen was excited at 470 nm, whereas emission was measured at 530 nm. Exposure time was set to 1000 ms.

[0196] In FIG. 6 amplification curves of 5 different target concentrations are plotted, whereas each target concentration is represented by 5 different wells (distributed across the 384 well plate). The groups of amplification curves based on the same target concentration are labelled with (a) 10.sup.6 copies (medium C.sub.p (elbow value) 16.6; SD 0.033), (b) 10.sup.5 copies (medium C.sub.p 20.1; SD 0.043), (c) 10.sup.4 copies (medium C.sub.p 23.5; SD 0.029), (d) 10.sup.4 copies (medium C.sub.p 26.9; SD 0.020), (e) 10.sup.2 copies (medium C.sub.p 30.4; SD 0.2).

[0197] FIG. 7 comprises 96 real-time amplification curves recorder in 96 different wells of one 384 well plate, each containing 10.sup.4 copies of the target sequence. The 96 amplification reactions had an average C.sub.p-value of 23.7 with a standard deviation of 0.08.

TABLE-US-00002 SequenceinformationoftheParvovirusB19(positionsoftheprimersare underlined)SEQIDNO:1: 1 cagaggttgtgccatttaatgggaagggaactaaggctagcataaagtttcaaactatgg 61 taaactggctgtgtgaaaacagagtgtttacagaggataagtggaaactagttgacttta 121 accagtacactttactaagcagtagtcacagtggaagttttcaaattcaaagtgcactaa 181 aactagcaatttataaagcaactaatttagtgcctactagcgcatttttattgcatacag 241 actttgagcaggttatgtgtattaaagacaataaaattgttaaattgttactttgtcaaa 301 actatgaccccctattggtggggcagcatgtgttaaagtggattgataaaaaatgtggca 361 agaaaaatacactgtggttttatgggccgccaagtacaggaaaaacaaacttggcaatgg 421 ccattgctaaaagtgttccagtatatggcatggttaactggaataatgaaaactttccat 481 ttaatgatgtagcaggaaaaagcttggtggtctgggatgaaggtattattaagtctacaa 541 ttgtagaagctgcaaaagctattttaggcgggcaacccaccagggtagattaaaaaatgc 601 gtggaagtgtagctgtgcctggagtacctgtggttataaccagcaatggtgacattactt 661 ttgttgtaagcgggaacactacaacaactgtacatgcttaagccttaaaagagcgaatgg 721 taaagttaaactttactgtaag SequencesofPCRprimersandprobes: PCR-primersense(SEQIDNO:2): 5-GGGGCAGCATGTGTTAAAGTGG-3 PCR-primerantisense(SEQIDNO:3): 5-CCTGCTACATCATTAAATGGAAAG-3 Acceptorprobe(SEQIDNO:4): 5-LCRed640-TTGGCGGCCCATAAAACCACA GTGTAT-phosphate-3 Donorprobe(SEQIDNO:5): 5-TGGCCATTGCCAAGTTTGTTTTTCCTG T-Fluorescein-3 Sequenceofamplifiedfragment: 5-ggggcagcatgtgttaaagtggattgataaaaaatgtggcaagaaaaatacactgtggttt tatgggccgccaagtacaggaaaaacaaacttggcaatggccattgctaaaagtgttcca gtatatggcatggttaactggaataatgaaaactttccatttaatgatgtagcagg-3