PHARMACOLOGICALLY ACTIVE PEPTIDE COMPOUND, PROCESS FOR THE PREPARATION AND USE THEREOF

Abstract

Object of the invention is a synthetic peptide, in particular a synthetic peptide to be used as medicament, in particular to be used in the treatment of neurodegenerative diseases and Amyotrophic Lateral Sclerosis (ALS), and compositions comprising such synthetic peptide. Furthermore, the invention concerns processes for the preparation of said synthetic peptide.

Claims

1. Synthetic peptide having sequence IAAQLLAYYFT (SEQ. ID NO. 1).

2. The synthetic peptide according to claim 1, wherein said synthetic peptide includes an amino acid sequence having a sequence identity with the sequence IAAQLLAYYFT (SEQ. ID NO. 1) that lies within a range of 90%-95%.

3. The synthetic peptide according to claim 1, wherein said synthetic peptide has a length ranging from 11 to 21 amino acids.

4. The synthetic peptide according to claim 3, wherein said synthetic peptide has a length ranging from 11 to 15 amino acids.

5. The synthetic peptide according to claim 1, wherein said synthetic peptide is coupled to a detectable molecule.

6. A process for the synthesis of the peptide according to claim 1, said process comprising at least elongating said peptide in a direction from C-terminus to N-terminus.

7. A process for the synthesis of the peptide according to claim 1, said process comprising at least inserting at least one expression vector comprising a nucleotide sequence encoding said peptide, in at least one cell.

8. Pharmaceutical composition comprising the synthetic peptide according to claim 1.

9. (canceled)

10. (canceled)

11. (canceled)

12. (canceled)

13. A medicament comprising the synthetic peptide according to claim 1.

14. A method for treatment and therapy of neurodegenerative diseases comprising administering, to a subject in need thereof, a therapeutically effective amount of the synthetic peptide according to claim 1.

15. The method as in claim 14, wherein the method comprises a method for treatment and therapy of the neurodegenerative disease comprising Parkinson's disease (PD).

16. The method as in claim 14, wherein the method comprises a method for treatment and therapy of the neurodegenerative disease comprising Alzheimer's (AD).

17. A method for treatment and therapy of amyotrophic lateral sclerosis (ALS) comprising administering, to a subject in need thereof, a therapeutically effective amount of the synthetic peptide according to claim 1.

18. A method for treatment and therapy of cancer comprising administering, to a subject in need thereof, a therapeutically effective amount of the synthetic peptide according to claim 1.

Description

[0068] The experimental results are detailed in the attached Figures.

[0069] FIG. 1 shows an immunoblotting experiment of an interaction assay performed between magnetic beads bearing VDAC1 molecules interacting with SOD1-G93A (mutant SOD1 G93A) or SOD1WT (wild type phenotype). B: SOD1 bound to VDAC1; U: SOD1 not bound to VDAC1.

[0070] FIG. 2 shows an immunoblotting experiment of an interaction assay performed between magnetic beads bearing VDAC1 molecules interacting with SOD1-G93A in the presence of the peptide NHK1, i.e. the said synthetic peptide object of the invention and with the sequence IAAQLLAYYFT (SEQ. ID NO. 1). B: SOD1 bound to VDAC1; U: SOD1 not bound to VDAC1.

[0071] FIG. 3 shows a representative (n=3) electrophysiological trace of VDAC1 incorporated in an artificial planar lipid bilayer with applied voltage +25 mV in 1 M KCl, before and after addition of peptide NHK1. Upon voltage application, VDAC1 conductance is low (closed state); the addition of the said synthetic peptide object of the invention (NHK1) causes a meaningful instability of the channel conductance, that opens and closes with different events of various sizes.

[0072] FIG. 4 shows an immunoblotting experiment of an interaction assay performed between mitochondria isolated from NSC34 cells with SOD1-G93A, in the presence of 60 M peptide NHK1, i.e. the said synthetic peptide object of the invention with the sequence IAAQLLAYYFT (SEQ. ID NO. 1). In the presence of synthetic peptide, SOD1-G93A binds mitochondria at a much lesser extent. S: supernatant fraction, i.e. the fraction containing molecules not bound to mitochondria; M: mitochondrial fraction, i.e. the fraction containing mitochondria and the molecules bound to them.

[0073] FIG. 5 shows: Panel A) Representative images obtained by confocal microscopy of NSC34 cells over-expressing wt SOD1 (left side) or SOD1-G93A (right side), both fused with eGFP. Only SOD1-G93A induces formation of intracellular aggregates. Panel B) The over-expression of SOD1 impacts on the NSC34 cell vitality. In cell expressing SOD1WT, even at very high levels, there is no special change. On the contrary, in cell expressing the SOD1-G93A, 24 h after transfection, the cell vitality is about 20% reduced (in comparison with control).

[0074] FIG. 6 shows the cell vitality modifications in NSC34-SOD1WT or SOD1-G93A upon expression of the peptide NHK1 or a scramble peptide, used as a control peptide.

EXPERIMENTAL SECTION

Experiment 1Synthesis of Synthetic Peptide NHK1 (Method)

Experiment 1AChemical Synthesis of Synthetic Peptide NHK1

[0075] The synthetic peptide NHK1 of the present invention, with sequence NH.sub.2-IAAQLLAYYFT-COOH (SEQ. ID NO. 1), or Isoleucine-Alanine-Alanine-Glutamine-Leucine-Leucine-Alanine-Tyrosine-Tyrosine-Phenylalanine-Threonine, molecular weight 1,273.42, pI=5.50, has been synthesized by the standard chemical method of solid phase peptide synthesis (SPPS) in an automated synthesizer. At a variance from the natural synthesis in ribosome, the SPPS synthesizes the peptide in the direction from the C-terminus towards the N-terminus. Therefore, the synthesis of NHK1 peptide occurs from the C-terminal amino acid Threonine (Thr or T) towards the N-terminal amino acid Isoleucine (Ile or I). The N-terminal of each amino acid to be added in the sequence is protected by the 9-Fluorenylmethyloxycarbonyl group (Fmoc). The peptide bond is formed between the N-terminal amino group of the peptide immobilized through its C-terminus to the solid phase (an insoluble resin) and the entering amino acid, whose N-terminal is protected by a Fmoc group. In the next step the Fmoc group is cleaved and the amino acid is deprotected and the new N-terminus becomes available for binding a new amino acid. For this reason, after each reaction, many washing steps with appropriate solvents are performed, aiming to completely remove reagents from the liquid phase and bioproducts of the coupling phase, while the growing peptide is covalently bound to the insoluble resin.

[0076] The SPPS is thus a cyclic process of repeated reactions in which: the amino acid bound to the growing peptide is deprotectedwashing stepsaddition and reaction of the entering (next) amino acid with the deprotected amino acid and elongation of the growing peptide by the new amino acidwashing steps.

[0077] These were the technical steps of SPPS synthesis of said peptide NHK1:

i) binding of the first Fmoc-protected amino acid (Fmoc-Threonine) to the 2-Chlorotrityl chloride resin (Cl-resin): the reagents used as activators of the amino acid coupling are Diisopropylcarbodiimide (DIC) e 1-Hydroxybenzotriazole (HOBt);
ii) deprotection of Fmoc group by 25% piperidine in N,N-Dimethylformamide (DMF);
iii) neutralization of the exposed amino group;
iv) binding of the next Fmoc-protected amino acid (Fmoc-AA) as in i). There is an exception: the peptide sequenceQLL (SEQ. ID NO. 11) requires the activation of the coupling reaction by N,N-Diisopropylethylamine (DIEA) and N-[(Dimethylamino)-1H-1,2,3-triazolo[4,5-b]pyridin-1-ylmethylene]-N methylmethanaminium hexafluorophosphate N-oxide (HATU), due to synthesis problems;
v) release of the Fmoc group;
vi) release of the peptide from the binding resin by trifluoroacetic acid (TFA) and deprotection of the lateral residues, also blocked.

[0078] Steps ii) to iv) are repeated as a cycle for each new amino acid introduced in the sequence. Steps v) and vi) are the final steps of the peptide synthesis, performed once the desired sequence is accomplished.

[0079] Step iii) neutralization of amino groups is carried on with triethylamine, preferably.

[0080] Neutralization of amino group transforms the protonated amine in a free amine, thus nucleophile, and able to attack the symmetric anhydride in the next reaction (step iv). In this way the synthetic peptide named NHK1, object of the present invention, with the sequence IAAQLLAYYFT (SEQ. Id NO. 1) was obtained.

Experiment 1BBiotechnological Synthesis of Synthetic Peptide NHK1 by Expression in Mammalian Cell

[0081] The said peptide NHK1, object of the present invention, with the sequence IAAQLLAYYFT (SEQ. Id NO. 1) was produced by expressing a plasmidic vector comprising the nucleotide sequence 5-ATCGCCGCGCAGCTCCTGGCCTATTACTTCACGTGA-3 (Seq. Id NO. 2) under the control of an eukaryotic promoter, in stable cell lines (in particular the stable cell lines HeLa and NSC-34).

[0082] In the first step two complementary oligonucleotides with the following sequences have been chemically synthesized:

TABLE-US-00001 (Seq.IdNO.3) 5-CTAGCATGATCGCCGCGCAGCTCCTGGCCTATTACTTCACGTGA G-3; (Seq.IdNO.4) 3-GTACTAGCGGCGCGTCGAGGACCGGATAATGAAGTGCACTCAGC T-5.

[0083] The oligonucleotides contain sequences compatible with restriction sites NdeI and SalI (underscored). The annealing between these two oligonucleotide sequences yielded a double strand DNA (dsDNA-NHK1) containing the sequence coding for the peptide NHK1 of the present invention, flanked by single strand sequences corresponding, respectively, to those obtained upon digestion of restriction sites NdeI and SalI.

[0084] Next, the sequence dsDNA-NHK1 was cloned in a plasmidic expression vector for eukaryotic cells pCMSmtRed, a modified pCMS-eGFP (Clontech), whose eGFP transfection marker was substituted with the Red Fluorescent Protein (RFP) sequence from Discosoma spp fused after the mitochondrial targeting sequence obtained from human Cytochrome c oxidase subunit VIII gene; this sequence expresses the fluorescent protein to the mitochondria and is a transfection marker [Tomasello F. et al., The voltage-dependent anion selective channel 1 (VDAC1) topography in the mitochondrial outer membrane as detected in intact cell. PLoS One 2013; 8:e81522.]. This construct has been named pCMSmtRed-NHK1.

[0085] In addition, a further version of the said peptide NHK1 object of the invention, carrying fused at its C-terminus the HemoAgglutinin sequence (HA-tag) (NHK1-HA) was produced. The HA sequence used as a tag, corresponds to the amino acid sequence 98-106 of the influenza virus HemoAgglutinin, a glycoprotein located on the virus surface and required for the viral infection. The nucleotide sequence of HA-tag is the following: 5-TACCCATACGATGTTCCAGATTACGCT-3 (SEQ. Id NO. 5); the corresponding amino acid sequence is the following: YPYDVPDYA (SEQ. Id NO. 6) (the amino acid sequence is in direction from the N-terminus (residue Y) towards the C-terminus (residue A)). It is well established that the addition of HA tag does not produce any interference with the activity or the targeting of the protein to which it is fused.

[0086] To provide the fusion protein NHK1-HA, a second pair of complementary oligonucleotides corresponding to the dsDNA coding the sequence NHK1 fused at its C-terminus with the sequence HA was synthesized. This dsDNA contain restriction sites NdeI and SalI, respectively, one at each extremity:

TABLE-US-00002 (SEQ.IdNO.7) 5CTAGCATGATCGCCGCGCAGCTCCTGGCCTATTACTTCACGTGATACC CATACGATGTTCCAGATTACGCTG-3 (SEQ.IdNO.8) 3GTACTAGCGGCGCGTCGAGGACCGGATAATGAAGTGCACTATGGGTAT GCTACAAGGTCTAATGCGACAGCT-5.

[0087] The oligonucleotides contain sequences compatible with restriction sites NdeI and SalI (underscored) and the sequence coding for HA tag (bold).

[0088] The annealing between these two oligonucleotide sequences yielded a double strand DNA (dsDNA-NHK1-HA). The sequence dsDNA-NHK1-HA was cloned at restriction sites NdeI and SalI of the plasmidic expression vector pCMS-mtDsRed and this construct was named pCMS-mtDsRed-NHK1-HA.

[0089] The action of the said NHK1 peptide upon the complex VDAC1/SOD1-G93A, i.e. the complex formed by the interaction between protein VDAC1 and the mutant enzyme SOD1 (exactly the mutant G93A, where the glycine 93 was replaced by alanine) was evaluated by in vitro and in cellulo experiments, i.e. in the NSC34 cell line. NSC34 is a hybrid cell line obtained by fusing mice motor neurons with neuroblastoma cells. The NSC34 cell line is widely recognized as cell model of motor neurons and, following its transfection with mutated SOD1, it is considered a reference model of ALS [Cashman N R et al. Neuroblastomaspinal cord (NSC) hybrid cell lines resemble developing motor neurons. Dev. Dyn. (1992) 194:209-21; Durham H D et al., Evaluation of the spinal cord neuronneuroblastoma hybrid cell line NSC-34 as a model for neurotoxicity testing. Neurotoxicology (1993) 14:387-395.].

Experiment 2Production and Purification of VDAC1, SOD1-G93A, SOD1WT

[0090] In in vitro experiments, the action of the peptide NHK1 has been directly assayed in test tubes against the complex VDAC1/SOD1-G93A formed by the interaction of recombinant and purified proteins. The human proteins VDAC1, SOD1-G93A and SOD1WT were preliminarily produced and purified. Human SOD1 (both mutant and wt) and human VDAC1 were expressed in Escherichia coli BL21 (DE3) fused at the C-terminus with the Strep-tag (SOD1-G93A and SOD1WT) or His-tag (VDAC1). Human SOD1 (both mutant SOD1 and SOD1WT, Gene ID: 6647) were first expressed cloned in pET52b(+) vector, producing the constructs pET-SOD1WT and pET-SOD1G93A. In the same way, the human VDAC1 sequence (Gene ID: 7461) was cloned in pET21a(+) vector, producing the construct pET-VDAC1.

[0091] SOD1-G93A and SOD1WT were purified by affinity chromatography with Strep-Tactin resin (Qiagen) and VDAC1 was purified by affinity chromatography with Ni-NTA resin (Qiagen).

[0092] Both purification procedures were performed following the manufacturers' protocols (Qiagen).

[0093] Purified VDAC1, a membrane protein, was refolded in a buffer solution containing 1% Lauryl-dimethyl-amine-N-Oxide (LDAO). The correct folding of recombinant VDAC1 was checked by electrophysiological characterization of its pore-forming features in a planar lipid bilayer (PLB) [Checchetto V. et al., Recombinant human Voltage Dependent Anion selective Channel isoform 3 (hVDAC3) forms pores with a very small conductance. Cell Physiol Biochem (2014) 34(3): 842-853.]. The experimental conditions in the PLB assay were as follows: membrane composition: diphytanoyl-phosphatidylcholine/n-decane; the membrane was bathed from both sides with 1 M KCl in water; the potential applied to the membrane was 10 mV; constant T=25 C.

[0094] In these in vitro experiments the interference action of the synthetic peptide NHK1 on the complex VDAC1/SOD1-G93A was evaluated.

Experiment 3VDAC1 Binding to SOD1-G93A and SOD1WT

[0095] The ability of SOD1-G93A and SOD1WT to bind VDAC1 was assayed in the following experimental conditions: 30 M purified and refolded VDAC1, in its native conformation, were incubated with 50 L of paramagnetic micro-beads coated with a Ni-NTA resin (nickel-nitrilotriacetic acid) from Qiagen. The resin specifically binds the 6His-tag located at the C-terminus of VDAC1, coating the beads with the VDAC1 protein itself. VDAC1 bound to the paramagnetic beads interacts with significant affinity with purified human SOD1-G93A, added to the VDAC1-coated micro-beads at a concentration 6.5 M. In the same conditions there is no binding of SOD1WT to the VDAC1-coated micro-beads (FIG. 1).

[0096] This result is in agreement with the literature, i.e. the specific ability of the mutant SOD1, but not of the SOD1WT, to interact with VDAC1 (in vivo) [Israelson A. et al., Misfolded Mutant SOD1 Directly Inhibits VDAC1 Conductance in a Mouse Model of Inherited ALS. Neuron (2010) Aug. 26; 67(4):575-587].

Experiment 4the Action of Synthetic Peptide NHK1 Against the Complex VDAC1/SOD1-G93A

[0097] The same experiment described as Experiment 3 was repeated in the presence of raising concentrations of synthetic peptide NHK1 (concentration range from 0 to 25 M). The peptide was added to VDAC1 at a concentration 30 M bound to 50 L of magnetic beads. Next, 6.5 M SOD1-G93A (or alternatively SOD1WT as a control) were added. The interaction was evaluated by immunoblotting with anti-SOD1 antibody after separation of the bound/unbound fractions. We have found that SOD1-G93A bound to VDAC1 decreased in parallel with the increase of the peptide NHK1 concentration and almost disappeared at the maximal applied peptide concentration (FIG. 2).

[0098] In particular, we noticed that SOD1-G93A bound to VDAC1 was 40% reduced in the presence of 10 M NHK1, and was 80% reduced in the presence of 25 M NHK1.

Experiment 5Effect of Synthetic Peptide NHK1 on the Conductance of VDAC1 Porine

[0099] In a single channel experiment of VDAC1 conductance recording, the pore-forming activity of VDAC1 was observed before and after the addition in the cuvette cis of the synthetic peptide NHK1 (Ben-Hail D, Shoshan-Barmatz V. Reconstitution of purified VDAC1 into a lipid bilayer and recording of channel conductance. Cold Spring Harb Protoc. 2014 Jan. 1; 2014(1):100-5. doi: 10.1101/pdb.prot073148. PubMed PMID: 24371316).

[0100] FIG. 3 shows a representative trace of VDAC1 conductance in 1 M KCl at a constant applied voltage +25 mV, before and after the addition of the synthetic peptide NHK1. At the applied voltage, the VDAC1 channel is present in the so-called (partially) closed state, as defined in the literature. Following the addition of 15 M synthetic peptide NHK1, the closed state was destabilized, showing fast fluctuations that range from reaching higher conductance levels and several different closed states.

Experiment 6Cell Localization of Synthetic Peptide NHK1

[0101] The localization of synthetic peptide NHK1 was evaluated by two different fluorescent probes in NSC34-G93A (i.e. NSC34 cell over-expressing the mutant SOD1-G93A) cell.

Experiment 6aSynthetic Peptide NHK1 Labelled with Biotin

[0102] The peptide NHK1 was synthesized modified by the labelling of its N-terminal amino group with a biotin. Following internalization of biotinylated peptide into NSC34-G93A cell driven by the transfection reagent Chariot (Active Motif), the localization of the biotinylated NHK1 peptide was visualized at the fluorescence microscope after the specific interaction of biotin with streptavidin labelled with the fluorescent probe Alexa594 (Molecular Probes-Thermo scientific). In this experiment, 6 L of the not cytotoxic transfection reagent Chariot were used to allow the uptake in the cell of the biotinylated synthetic peptide (100-400 ng peptide/per well). Chariot is a 2,843 da peptide able to form non covalent complexes with proteins or peptides: in this way it protects the peptide to be uptaken from degradative processes during the transfection process. Once inside the cell, the Chariot-peptide complex dissociates and the peptide can reach its target destination. The uptake is independent from the endosomal pathway, thus the peptide structure is not modified during the internalization.

[0103] Chariot experiment was carried out according to the manufacturer's instructions.

Experiment 6bSynthetic Peptide NHK1 Labelled with Fluorescein Isothiocyanate (FITC)

[0104] The peptide NHK1 was synthesized modified by the labelling of its N-terminal amino group with the fluorescent probe Fluorescein isothiocyanate (FITC). Following internalization of the modified peptide into NSC34-G93A cell driven by the transfection reagent Chariot (Active Motif), the localization of the NHK1-FITC peptide was directly visualized at the fluorescence microscope.

[0105] In experiment 6a the cellular localization of the peptide NHK1 was obtained by indirect immunofluorescence. In experiment 6b the visualization was obtained by direct immunofluorescence, since FITC is a fluorescent molecule.

[0106] Experiments 6a and 6b resulted in overlapping patterns of results: images were acquired by an epifluorescence microscope (Leica DM6000) and showed that both NHK1 peptides (labelled with biotin or with FITC), clearly localized to mitochondria (data not shown in Figures).

Experiment 7the Synthetic Peptide NHK1 Obstructs the Formation of the Complex VDAC1/SOD1-G93A In Vitro

[0107] The ability of the synthetic peptide NHK1 to obstruct the formation of the complex VDAC1/SOD1-G93A was verified with mitochondria purified from NSC34 cell. In such experiment, 2 g of SOD1-G93A (or SOD1WT as a control) were incubated with intact mitochondria obtained starting from 10 NSC34 cell. It was noticed that only SOD1-G93A was able to interact with the mitochondrial surface, at variance with SOD1WT, which was unable to interact with mitochondria (FIG. 4). In FIG. 4, S indicates the supernatant fraction, containing the SOD1 not bound to mitochondria, while M indicates the mitochondrial fraction, i.e. the presence of SOD1-G93A bound to the mitochondria.

[0108] In the same experiment, SOD1-G93A bound to mitochondria decreased of about 90% in comparison with the control sample, following the addition of 60 M NHK1 (FIG. 4).

Experiment 8the Action of Synthetic Peptide NHK1 in Cellulo

[0109] It has been established that protein aggregation is a typical feature of neurodegenerative diseases and, in particular, mutant SOD1 aggregates are toxic and directly associated with the ALS disease.

[0110] Preliminary experiments showed that, in NSC34 cell, the mutated SOD1-G93A induces the formation of intracellular toxic aggregation of proteins. On the contrary, the physiological form of SOD1 (SOD1WT) does not induce such toxic aggregates. FIG. 5A shows representative images, obtained at confocal microscopy, of NSC34 cell where SOD1WT (left side) or SOD1-G93A (right side) fused with eGFP were expressed. Strikingly, only SOD1-G93A expression is associated with the presence of intracellular aggregates, toxic for the cell life.

[0111] The action of the NHK1 peptide was assayed in NSC34-G93A cell, following transfection by Lipofectamine 3000 (Invitrogen) with plasmids pCMSmtRed-NHK1 or pCMSmtRed-NHK1-HA, previously defined. With this procedure it is possible to have larger amounts of peptide in the cell than with the direct peptide transfection. Furthermore, it is possible to follow the cell reaction to the transfection for a longer time (even for more days) than with the direct uptake of the peptide with Chariot. We noticed with the MTT assay [Mosmann T., Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods (1983) 65:55-63.] that NSC34 cell vitality upon transfection with SOD1WT-eGFP does not change in comparison with the same cell not transfected. On the contrary, after 24 hours, NSC34 cell vitality upon transfection with SOD1-G93A-eGFP drops about 20% in comparison with the same cell transfected with SOD1WT-eGFP (FIG. 5B). Data were normalized against NSC34 cell transfected with only the eGFP. The statistical analysis was performed with an ANOVA one-way test. In FIG. 5B, asterisk (*) means that the value has a significativity P<0.001 (0.00014005) with respect to SOD1WT. The experiment was performed at least three times with triplicate samples.

[0112] The action of NHK1 peptide was evaluated in NSC34 cell expressing SOD1-G93A or SOD1WT.

[0113] In this experiment we have indeed co-transfected NSC34 cell with identical concentrations of pET-SOD1G93A (or pET-SOD1WT in the control) together with pCMSmtRed-NHK1 (or pCMSmtRed-NHK1-HA); after 24 hours we performed the vitality MTT test.

[0114] The MTT assay is a colorimetric assay aimed to quantify the activity of dehydrogenase enzymes reducing 3-(4,5-dimethyltiazol-2-yl)-2,5-diphenyltetrazolium, yellow, to purple-blue formazan [Mosmann T., Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods (1983) 65:55-63.]. The reaction happens in mitochondria where the succinate dehydrogenase is active in living cells. The expression of the peptide NHK1 in NSC34-SOD1-G93A allows a vitality recover of about 50% (FIG. 6).

[0115] Cells were seeded on 24-wells plates at a density of 80,000 cells/well, incubated for 24 hours and then transiently transfected with plasmid pEGFP-N1 expressing SOD1WT or SOD1-G93A or a mock. The transfection reagent was Lipofectamine 3000 (Life Technologies). In each transfection 1 g of plasmidic DNA was used. The MTT assay was read after 24 hours incubation. The experiment was repeated in triplicate for at least four times.

[0116] The same vitality assay was repeated in the presence of the NHK1 peptide. NSC34 were co-transfected with plasmids pEGFP-N1+pCMS-mtDsRED-NHK1 or pEGFP-N1-SOD1WT+pCMS-mtDsRED-NHK1 (both as controls) or pEGFP-N1-SOD1G93A+pCMS-mtDsRED-NHK1. In each transfection 1 g of total plasmidic DNA was used. The MTT assay was read after 24 hours incubation. The experiment was repeated in six parallel samples for at least three times. Data were normalized against NSC34 cell transfected with SOD1-G93A-eGFP, which is considered the condition where there is the maximum drop of cell vitality (100%). It is thus concluded that, considering 100% the drop in NSC34 cell vitality due to the mutant SOD1-G93A, the peptide NHK1 is able to reduce the vitality drop by 42% in the same conditions, with a statistical significance of P<0.01 (0.003), as indicated in FIG. 6 with the asterisk (*). On the opposite, in control experiments, no significant loss of vitality was observed. In particular, and very important, co-transfection of eGFP with peptide NHK1 shows that the peptide is not toxic at all for the cell (FIG. 6).

[0117] No meaningful recovery of cell vitality drop was found when the NSC34-SOD1-G93A cell were co-transfected with a scramble peptide as a control (scramble in FIG. 6). The scramble peptide has sequence: FAQLTIALAYY (seq. ID NO. 12) (18% sequence identity with the NHK1 peptide seq. ID NO. 1). The statistical analysis was performed with an ANOVA one-way test.

[0118] The results from the experiments above described allow us to highlight experimentally the advantages of the present invention, respect to what is known. It has been observed that the synthetic peptide object of the present invention (synthetic peptide NHK1) is able to detach SOD1-G93A bound to VDAC1 or to mitochondria purified from NSC34 cell. Furthermore, experiments in NSC34-SOD1-G93A transgene cell showed that the synthetic peptide offers additional advantages to what is known in the technique and in state of the art: first, it is able to counteract the mortality associated with the expression of mutated SOD1-G93A in motor neurons; it further enhances the cell vitality acting on the mitochondrial function (as it is evident by the MTT assay, which is, at the end, a mitochondria activity assay)[Sanchez N S and Knigsberg M. Using Yeast to Easily Determine Mitochondrial Functionality with 1-(4,5-Dimethylthiazol-2-yl)-3,5-diphenyltetrazolium Bromide (MTT) Assay. Biochem Mol Biol Educ (2006) 34(3):209-212.; Kaneko I., Yamada N., Sakuraba Y. et al. Suppression of mitochondrial succinate dehydrogenase, a primary target of beta-amyloid, and its derivative racemized at Ser residue. J Neurochem (1995) 65(6):2585-93.]. A further advantage of synthetic peptide according to the present invention (synthetic peptide NHK1) is its tolerability by the cell, and this can be exploited in treatment of diseases with similar etiological mechanisms as, for example neurodegenerative diseases like ALS.

[0119] At the end, a further advantage of the peptide NHK1 and its tolerability by the cell, is in treatment of cancer, since it exherts a pro-apoptotic effect in stable tumor cell (i.e. HeLa cell).