Treatment of microbial infections

11512118 · 2022-11-29

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention is directed to improved microbial antigen vaccines, pharmaceutical compositions, immunogenic compositions and antibodies and their use in the treatment of microbial infections, particularly those of bacterial origin, including Staphylococcal origin. Ideally, the present invention is directed to a recombinant staphylococcal MSCRAMM or MSCRAMM-like proteins, or fragment thereof, with reduced binding to its host ligand, for use in therapy.

Claims

1. A vaccine composition comprising an immunologically effective amount of a recombinant fibrinogen binding-deficient mutant of staphylococcal clumping factor A (ClfA) or a fragment thereof dispersed or emulsified in a saline solution and/or pharmaceutically acceptable adjuvant for injection, said fragment comprising at least amino acid residues 221 to 531 of the fibrinogen binding region, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA or fragment thereof has at least one amino acid residue substitution or deletion at amino acid residue Ala254, Tyr256, Pro336, Tyr338, Ile387, Lys389, Glu526 and/or Val527, said recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA or fragment thereof having reduced ability or lacking the ability to non-covalently bind fibrinogen and stimulating a greater antibody immune response than a wild type ClfA protein.

2. The vaccine of claim 1, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA has a sequence according to SEQ ID No. 1 or a sequence with at least 85% sequence identity to the sequence of SEQ ID No. 1.

3. The vaccine of claim 1, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA comprises the fibrinogen binding region only or a fragment thereof.

4. The vaccine of claim 1, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA is derived from S. aureus, S. epidermidis and/or S. lugdunensis.

5. The vaccine of claim 1, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA comprises the amino acid sequence according to any of SEQ ID Nos. 4 to 14.

6. The vaccine of claim 1, wherein recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA amino acid residues Ala254, Tyr256, Pro336, Tyr338, Ile387, Lys389, Glu526 and/or Val527 are substituted with either Ala or Ser.

7. The vaccine of claim 1, wherein residue P336 and/or Y338 of the fibrinogen binding region (Region A) of ClfA is substituted with either serine or alanine to result in rClfAP336S Y338A or rClfAP336 A Y338S.

8. The vaccine of claim 1, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA has the amino acid sequence according to any of SEQ ID Nos. 1 to 3 wherein residue P336 and/or Y338 are substituted with either serine and/or alanine, or fragment thereof.

9. The vaccine of claim 1, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA comprises the fibrinogen binding protein, the fibrinogen binding region, the minimal fibrinogen binding region and/or a fragment thereof.

10. The vaccine of claim 1, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA fragment comprises at least part of the fibrinogen binding region to result in a recombinant fragment of the fibrinogen binding protein with reduced ability or lacking the ability to non-covalently bind fibrinogen.

11. The vaccine of claim 1, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA comprises a. Subregions N123, spanning amino acid residues 40 to 559 of the fibrinogen binding region (Region A); b. Subregions N23, spanning amino acid residues 221 to 559 of the fibrinogen binding region of ClfA (Region A); and/or c. Amino acid residues 221 to 531 of the fibrinogen binding region (Region A).

12. The vaccine of claim 1, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA comprises an isolated recombinant staphylococcal clumping factor A (ClfA).

13. The vaccine of claim 1, wherein said recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA or fragment thereof is dispersed in a sterile, isotonic saline solution.

14. A method of preparing a vaccine composition comprising an immunologically effective amount of a recombinant fibrinogen binding-deficient mutant of staphylococcal clumping factor A (ClfA) or fragment thereof, said method comprising formulating the recombinant fibrinogen-deficient mutant of staphylococcal ClfA or fragment thereof as a pharmaceutical composition for injection, by dispersing or emulsifying an immunologically effective amount of the recombinant fibrinogen-deficient mutant of staphylococcal ClfA or fragment thereof in a saline solution and/or pharmaceutically acceptable adjuvant, wherein said fragment comprises at least amino acid residues 221 to 531 of the fibrinogen binding region, wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA or fragment thereof has at least one amino acid residue substitution or deletion at amino acid residue Ala254, Tyr256, Pro336, Tyr338, Ile387, Lys389, Glu526 and/or Val527, and wherein the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA or fragment thereof has reduced ability or lacks the ability to non-covalently bind fibrinogen, and stimulates a greater antibody immune response than a wild type ClfA protein.

15. The method of claim 14, wherein the formulating comprises dispersing the immunologically effective amount of the recombinant fibrinogen binding-deficient mutant of staphylococcal ClfA or fragment thereof in a sterile, isotonic saline solution.

Description

(1) The present invention will now be described with reference to the following non-limiting figures and examples.

(2) FIGS. 1 to 15 show the results of Example 1.

(3) FIG. 1 shows the severity of arthritis (A), measured as arthritic index, and weight loss (B) in mice inoculated with S. aureus strain Newman, and clfAPYI, clfAPYII, and clfA null mutants. 3.2×10.sup.6-6.0×10.sup.6 cfu of S. aureus strains were inoculated. Data are presented as medians (squares or center lines), interquartile ranges (boxes), and 80% central ranges (whiskers). Data from three experiments are pooled. N.sub.Newman=27-30, N.sub.clfAPYI=30, N.sub.clfAPYII=10, and N.sub.clfA=16-20.

(4) FIG. 2 shows the bacterial growth in kidneys in mice 7-8 days after inoculation with 3.2×10.sup.6-6.0×10.sup.6 cfu of S. aureus strain Newman, and clfAPYI, clfAPYII, and clfA null mutants. Data are presented as cfu per kidney pair. Where no growth was detectable, the count was put to highest possible count according to what dilution was used. Data from three experiments are pooled. N.sub.Newman=26, N.sub.clfAPYI=30, N.sub.clfAPYII=10, and N.sub.clfA=15.

(5) FIG. 3 shows the survival of mice after inoculation with 5.2, 5.1 or 3.3×10.sup.7 cfu of S. aureus strain Newman, clfAPYI mutant or clfA null mutant, respectively. N=10 per group from start.

(6) FIG. 4 shows the survival of mice after inoculation with 9.4, 7.9, 10.7 or 9.8×10.sup.6 cfu of S. aureus strain LS-1, and clfAPYI, clfAPYII or clfA null mutants, respectively. N=15 per group from start.

(7) FIG. 5 shows the survival of mice immunized with BSA, recombinant ClfA or recombinant ClfAPY (i.e. ClfAPYI recombinant protein A domain) and inoculated with 2.3×10.sup.7 cfu of S. aureus Newman. N=15 per group from start.

(8) FIG. 6 shows the frequency of arthritic mice inoculated with 3.2×10.sup.6-6.0×10.sup.6 cfu of S. aureus strain Newman wild-type, and clfAPYI, clfAPYII, and clfA null mutants. Data from three experiments are pooled. N.sub.Newman=27-30, N.sub.clfAPYI=30, N.sub.clfAPYII=10, and N.sub.clfA=16-20.

(9) FIG. 7 shows the severity of arthritis measured as arthritic index in mice inoculated with 5.2, 5.1 or 3.3×10.sup.7 cfu of S. aureus strain Newman wild-type, clfAPYI mutant or clfA null mutant, respectively. Data are presented as medians (squares), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.Newman=0-10, N.sub.clfAPYI=9-10, and N.sub.clfA=0-10.

(10) FIG. 8 shows the weight loss in mice inoculated with 5.2, 5.1 or 3.3×10.sup.7 cfu of S. aureus strain Newman wild-type, clfAPYI mutant or clfA null mutant, respectively. Data are presented as medians (center line), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.Newman=0-10, N.sub.clfAPYI=9-10, and N.sub.clfA=0-10.

(11) FIG. 9 shows the severity of arthritis measured as arthritic index in mice immunized with BSA, recombinant ClfA or recombinant ClfAPY (i.e. ClfAPYI recombinant protein A domain) and inoculated with 4.0×10.sup.6 cfu of S. aureus Newman. Data are presented as medians (squares), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.BSA=14, N.sub.clfAPY=14, and N.sub.clfA=15 per group from start.

(12) FIG. 10 gives the nucleotide and amino acid sequence of wild-type ClfA A domain protein (rClfA), domains N123 only, with the residues highlighted which are altered in the following examples (P.sub.336 and Y.sub.338) to give rise to rClfAPYI/II (SEQ ID No.3). It is this recombinant protein A domain which was used in vaccination in the following examples.

(13) FIG. 11 shows an illustrative representation of the structure of FnBPA, ClfB, ClfA and SdrG proteins. Region A is the fibrinogen binding region, S is the signal sequence, W is the cell wall spanning domain, M is the membrane anchor including the LPXTG motif, + represent positively charged residues and R is the repeat region. In ClfA Region A comprises N123 (not shown). The BCD region of FnBPA (and the shorter CD region of FnBPB—not shown) binds fibronectin.

(14) FIG. 12 shows the specific antibody responses to recombinant ClfAPY40-559 in serum samples of mice immunized with bovine serum albumin (BSA), recombinant ClfA40-559 (rClfA), or recombinant ClfAPY40-559 (rClfAPY), 9 days after the second booster immunization, which was one day before infection with 2.3×10.sup.7 cfu/mouse of S. aureus strain Newman wildtype for induction of sepsis. Data are presented as medians (center lines), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.BSA=13-15, N.sub.rClfA=15, and N.sub.rClfAPY=15.

(15) FIG. 13 shows the specific antibody responses to recombinant ClfA40-559 in serum samples of mice immunized with bovine serum albumin (BSA), recombinant ClfA40-559 (rClfA), or recombinant ClfAPY40-559 (rClfAPY), 9 days after the second booster immunization, which was one day before infection with 2.3×10.sup.7 cfu/mouse of S. aureus strain Newman wildtype for induction of sepsis. Data are presented as medians (center lines), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.BSA=13-15, N.sub.rClfA=15, and N.sub.rClfAPY=15.

(16) FIG. 14 shows the specific antibody responses to recombinant ClfAPY40-559 in serum samples of mice immunized with bovine serum albumin (BSA), recombinant ClfA40-559 (rClfA), or recombinant ClfAPY40-559 (rClfAPY), 9 days after the second booster immunization, which was one day before infection with 4.0×10.sup.6 cfu/mouse of S. aureus strain Newman wildtype for induction of septic arthritis. Data are presented as medians (center lines), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.BSA=14-15, N.sub.rClfA=15, and N.sub.rClfAPY=15.

(17) FIG. 15 shows the specific antibody responses to recombinant ClfA40-559 in serum samples of mice immunized with bovine serum albumin (BSA), recombinant ClfA40-559 (rClfA), or recombinant ClfAPY40-559 (rClfAPY), 9 days after the second booster immunization, which was one day before infection with 4.0×10.sup.6 cfu/mouse of S. aureus strain Newman wildtype for induction of septic arthritis. Data are presented as medians (center lines), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.BSA=14-15, N.sub.rClfA=15, and N.sub.rClfAPY=15.

(18) FIG. 16 of Example 2 shows the specific antibody responses to recombinant ClfAPY221-559 in serum samples of mice immunized with bovine serum albumin (BSA), recombinant ClfA221-559 (rClfA221-559), or recombinant ClfAPY221-559 (rClfAPY221-559), 9 days after the second booster immunization. Data are presented as medians (center lines), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.BSA=15, N.sub.rClfA221-559=14-15, and N.sub.rClfAPY221-559=14-15.

(19) FIG. 17 of Example 2 shows the specific antibody responses to recombinant ClfA221-559 in serum samples of mice immunized with bovine serum albumin (BSA), recombinant ClfA221-559 (rClfA221-559), or recombinant ClfAPY221-559 (rClfAPY221-559), 9 days after the second booster immunization. Data are presented as medians (center lines), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.BSA=15, N.sub.rClfA221-539=14-15, and N.sub.rClfAPY221-559=14-15.

(20) FIG. 18 of Example 3 shows the specific antibody responses to recombinant ClfA221-531 in serum samples of mice immunized with recombinant ClfAPY221-531 (rClfAPY221-531), 9 days after the second booster immunization. Data are presented as medians (center lines), interquartile ranges (boxes), and 80% central ranges (whiskers). N.sub.rClfA221-531=14-15.

EXAMPLES

Example 1

(21) rClfA a Region Truncates Comprising N1, N2 and N3 (Amino Acids 40-559)

(22) Material and Methods

(23) Full details of the numeric references in brackets given in the Examples are provided at the end of this section.

(24) Mice

(25) NMRI mice were obtained from Scanbur BK (Sollentuna, Sweden) and were maintained in the animal facility of the Department of Rheumatology, University of Göteborg, Sweden. Göteborg animal experiment ethical board approved the experiments. They were housed up to 10 animals per cage with a 12 h light-dark cycle, and were fed standard laboratory chow and water ad libitum. The animals were 6 to 16 weeks old at the start of the experiments.

(26) Bacterial Strains

(27) For infection of animals the S. aureus wildtype strains Newman (14) and LS-1 (11) and constructed derivatives thereof were used. The clfA P.sub.336SY.sub.338A (clfAPYI) and clfA P.sub.336AY.sub.338S (clfAPYII) derivatives were constructed in strain Newman and transduced to strain LS-1 (see below). The deletion mutants Newman clfA2::Tn917 mutant DU5876 (3) and LS-1 clfA2::Tn917 mutant (J. R. Fitzgerald et al., unpublished) were also used. Bacteria were grown on blood agar plates for 48 h, harvested, and kept frozen at −20° C. in PBS containing 5% (wt/vol) BSA (Sigma Chemicals) and 10% (vol/vol) dimethyl sulfoxide. Before injection into animals, the bacterial suspensions were thawed, washed in PBS, and adjusted to appropriate cell concentrations. The number of viable bacteria was measured in conjunction with each challenge by cultivation on blood agar plates and counting colonies.

(28) Construction of clfAPYI and clfAPYII Mutations in S. aureus Newman and LS-1

(29) In this experiment, a full length ClfA A region truncate, comprising N1, N2 and N3, corresponding to amino acids 40 to 559, was used. In the following description and figures: ClfA may also be referred to as rClfA 40-559 (SEQ ID NO 3); ClfA P.sub.336SY.sub.338A may also be referred to as clfAPYI, rclfAPY or rclfAPYI (i.e clfAPYI 40-559) (SEQ ID NO 4); and ClfA P.sub.336AY.sub.338S may also be referred to as clfAPYII, rclfAPYII (i.e. clfAPYII 40-559) (SEQ ID NO 5).

(30) A 1.02 kb PstI-BamHI fragment of pCF77 PY (Loughman et al., 2005) containing the mutations P.sub.336S and Y.sub.338A in clfA was cloned into pBluescriptII SK- (Stratagene). This plasmid was linearised with HindIII and ligated to HindIII-cut pTSermC (J. Higgins, unpublished) to generate plasmid pARM, which is a temperature sensitive E. coli-S. aureus shuttle vector containing the P.sub.336S and Y.sub.338A substitutions.

(31) In order to reduce the risk of unknowingly generating a functional or immunoreactive epitope by substituting P.sub.336 and Y.sub.338, we generated a second mutant, in which the order of the substitutions was reversed, yielding P.sub.336A and Y.sub.338S. To generate this a plasmid pJH2, analogous to pARM but containing the P.sub.336A and Y.sub.338S substitutions, was generated. Overlap primer PCR was used with the same flanking primers used to make pCF77 PY (6), and a different pair of overlapping mutagenic primers:

(32) TABLE-US-00003 F3:  GCAACTTTGACCATGGCCGCTTCTATTGACCCTGAAAATG and R3:  CATTTTCAGGGTCAATAGAAGCGGCCATGGTCAAAGTTGC
(mutations in bold and underlined) to generate pCF77 PYII. The 1.02 kb PstI-HindIII fragment of this plasmid was used as described above to generate pJH2, a temperature sensitive E. coli-S. aureus shuttle vector containing the P.sub.336A and Y.sub.338S substitutions.

(33) Both pARM and pJH2 were transferred to RN4220 (15) by electroporation and subsequently transduced using phage 85 (16) to S. aureus Newman (14) and LS-1 (11). In these strains the plasmids were induced to insert into the chromosome and then excise, leaving the mutations in the chromosome of a proportion of transformants, generating Newman clfAPYI, Newman clfAPYII, LS-1 clfAPYI and LS-1 clfAPYII. Transformants were screened for loss of the plasmid and a loss of fibrinogen-binding activity. Integrity of the clfA gene was verified by Southern hybridisation using a clfA probe (data not shown). Expression of an immunoreactive protein (ClfAPY) was verified by Western immunoblotting using anti-ClfA region A polyclonal rabbit antiserum (data not shown). The mutations were verified by PCR across the KpnI-BamHI fragments from genomic DNA and commercial sequencing of the products. The about 700 bases of the clfA gene of strain LS-1 that were sequenced were identical to the corresponding bases in the Newman clfA gene of strain Newman.

(34) Production of Recombinant ClfA and ClfAPY

(35) His-tagged recombinant ClfA region A, domains N123 (amino acids 40-559), was produced from pCF40 as previously described (17), with an additional polishing step through an anion-exchange column. Plasmid pCF77 PY (6) was used as template to clone clfAPYI domains N123 into pQE30 to generate pCF40PY. Using this plasmid, recombinant ClfAPY was also produced by nickel affinity chromatography and anion exchange chromatograpy, as was described for rClfA. Eluates were dialysed against two changes of PBS before concentration and freeze-drying.

(36) Septic Arthritis and Sepsis Experiments

(37) In experiments 1-3 all the mice (n=10 per group) were infected with strain Newman to trigger arthritis. In experiments 4 and 5, the mice were infected with strain Newman and LS-1, respectively, to induce sepsis (n=10 per group).

(38) Experiment 1 Mice were infected by intravenous injection with 3.5×10.sup.6 cfu/mouse of S. aureus strain Newman or with 4.3×10.sup.6 cfu/mouse of Newman clfAPYI mutant, both in 200 μl PBS. Clinical arthritis and weight change was followed until day 7. Mice were sacrificed day 8, kidney growth of bacteria were assessed and serum IL-6 and total IgG levels were measured. Synovitis and bone destruction was studied histologically on the joints of fore and hind legs.

(39) Experiment 2 Mice were infected with 5.0×10.sup.6 cfu, 6.0×10.sup.6 cfu or 4.3×10.sup.6 cfu of S. aureus strain Newman, clfAPYI mutant or Newman clfA::Erm.sup.R (clfA null mutant), respectively. Clinical arthritis and weight change was followed until day 7. Mice were sacrificed day 7, kidney growth of bacteria were assessed and serum IL-6 and total IgG levels were measured. Synovitis and bone destruction was studied histologically on the joints of fore and hind legs.

(40) Experiment 3 Mice were infected with 4.7×10.sup.6 cfu, 3.2×10.sup.6 cfu, 3.9×10.sup.6 cfu or 4.8×10.sup.6 cfu of S. aureus strain Newman, clfAPYI mutant, Newman clfAPYII mutant or Newman clfA null mutant, respectively. Clinical arthritis and weight change was followed until day 7. Mice were sacrificed day 8 and kidney growth of bacteria were assessed.

(41) The outcome of the experiments 1-3 were very similar, so data were pooled and presented together.

(42) In Experiment 4 mice were injected intravenously with 5.2×10.sup.7 cfu, 5.1×10.sup.7 cfu or 3.3×10.sup.7 cfu of S. aureus strain Newman, clfAPYI mutant or clfA null mutant, respectively. Mortality, weight change and clinical arthritis were followed until day 10.

(43) In Experiment 5 mice were infected with 9.4×10.sup.6 cfu, 7.9×10.sup.6 cfu, 10.7×10.sup.6 cfu or 9.8×10.sup.6 cfu of S. aureus strain LS-1, LS-1 clfAPYI mutant, LS-1 clfAPYII mutant, or LS-1 clfA null mutant, respectively. Mortality, clinical arthritis and weight change was followed until day 16.

(44) Intra-Articular Injection of Bacteria

(45) One knee joint per mouse was injected with 2.4×10.sup.4 cfu, 2.4×10.sup.4 cfu, or 3.4×10.sup.4 cfu of strain Newman wildtype, clfAPYI mutant or clfA knockout mutant, respectively, in 20 μl PBS. N=10 per group. Mice were sacrificed 3 days later, and the knee joints were collected for histopathological examination.

(46) Vaccination with Wild-Type and Mutant Recombinant ClfA

(47) Purified rClfA40-559, rClfAPY40-559 (i.e. rClfAPYI) or BSA were dissolved in physiologic saline and emulsified 1:1 in Freund's complete adjuvant (Difco Laboratories). Two hundred μl of the emulsion containing 30 μg (=0.53 nmol) of protein was injected subcutaneously (s.c.) on day 0. First booster immunization with 30 μg of protein in physiologic saline in incomplete Freund's adjuvant was performed on day 11. Second booster immunization was done day 21. On day 30 the mice were bled and sera were frozen for later analysis of antibody responses.

(48) On day 31, 14-15 mice per group were infected by i.v. injection of 4.0×10.sup.6 cfu/mouse for induction of septic arthritis, or by 2.3×10.sup.7 cfu/mouse for induction of sepsis. Clinical arthritis, weight change and mortality were followed for 11 and 15 days, respectively. Bacterial growth in kidneys was assessed in the septic arthritis experiment.

(49) Clinical Evaluation of Infected Mice

(50) The clinical evaluation was performed in a blinded manner. Each limb was inspected visually. The inspection yielded a score of 0 to 3 (0, no swelling and erythema; 1, mild swelling and/or erythema; 2, moderate swelling and/or erythema; 3 marked swelling and/or erythema). The arthritic index was constructed by adding the scores from all four limbs of an animal. The overall condition of each mouse was also examined by assessing signs of systemic inflammation, i.e., weight decrease, reduced alertness, and ruffled coat. In cases of severe systemic infection, when a mouse was judged too ill to survive another 24 h, it was killed by cervical dislocation and considered dead due to sepsis.

(51) Histological Examination

(52) Histological examination of joints was performed using a modification (8) of a previously described method (18).

(53) Bacteriologic Examination of Infected Kidneys

(54) Kidneys were aseptically dissected, kept on ice, homogenised, serially diluted in PBS and spread on blood agar plates. After 24 h of incubation in 37° C. the number of cfu per kidney pair was determined.

(55) Measurement of Serum IgG

(56) Levels in serum of total IgG were measured by the radial immunodiffusion technique (19). Goat-Anti-Mouse-IgG and mouse IgG standard were purchased from Southern Biotech, Birmingham, Ala.

(57) Specific Antibodies—ELISA

(58) Serum samples from immunized mice were obtained 9 days after the second booster immunization. The serum specific antibody response against rClfA and rClfAPY was measured by ELISA. Microplates (96-well; Nunc) were coated with 5 μg/ml of recombinant protein in PBS. Blocking agent, serum samples, biotinylated antibodies, and ExtrAvidin-proxidase were all diluted in PBS. The assay was run according to a previous description (8). All serum samples were diluted 1:20000, and antibody response was monitored as absorbance at 405 nm.

(59) In a second run, to get a more accurate measure of the specific antibody responses in the different immunization groups, the responses were determined at several serum dilutions. Thus, all serum samples were diluted 1:5000, 1:20000, 1:80000 and 1:320000, and antibody response was monitored as absorbance at 405 nm.

(60) IL-6 Analysis

(61) Serum IL-6 was detected by a method previously described (20).

(62) Statistical Analysis Statistical evaluation was done by using the Mann-Whitney U test. P<0.05 was considered to be significant. Data are reported as medians, interquartile ranges, and 80% central ranges, unless otherwise mentioned.

(63) Results

(64) Exchange of two amino acids necessary for ClfA binding to fibrinogen hampers development of septic arthritis and sepsis

(65) Two amino acids (P336 and Y338) that are known to be required for fibrinogen binding by ClfA were altered by allelic exchange to create mutants of strains Newman and LS1 that expressed a non-fibrinogen-binding ClfA protein on the cell surface. The level of expression and integrity of the protein was measured by Western blotting which established that there was good expression of the mutant proteins on the bacterial surface and expressed protein was the right size.

(66) The ability of Newman wild-type and Newman clfA P.sub.336S Y.sub.338A (clfAPYI) to provoke septic arthritis was investigated. Septic arthritis was induced by intravenous inoculation of 3.5×10.sup.6 to 5.0×10.sup.6 colony-forming units (cfu) and 3.2×10.sup.6 to 6.0×10.sup.6 cfu of Newman wild-type and the clfAPYI mutant, respectively. The development of arthritis was studied clinically for 7 days. The clfAPYI mutant provoked significantly less severe arthritis than the wild-type strain over the entire experimental period (P>0.001, FIG. 1 A). The frequency of arthritis was lower for Newman clfAPYI at most time points (FIG. 6).

(67) Unexpectedly, it appears that the new amino acid composition in the ClfAPYI molecule fits for interaction with a host anti-bacterial defence. To check for this possibility, a new construct was made where different amino acids were substituted for P336 and Y338 (clfA P.sub.336A Y.sub.338S: clfAPYII). Mice that were inoculated with 3.9×10.sup.6 cfu of Newman clfAPYII developed arthritis to the same low extent as the clfAPYI mutant (FIG. 1 A), and with a similar frequency (FIG. 6). This outcome suggests strongly that the loss of fibrinogen binding is responsible for the reduced level of arthritis.

(68) It is possible that ClfA is involved in the development of arthritis by mechanisms that do not involve fibrinogen binding. To test this a ClfA deletion mutant lacking the ClfA protein was compared to mutants expressing the modified non-fibrinogen binding ClfA protein. However, mice that were infected with 4.3×10.sup.6 to 4.8×10.sup.6 cfu of clfA null mutant developed arthritis in a manner not different from the clfAPYI and clfAPYII mutant infected mice (FIG. 1 A). The frequency of arthritis was also indistinguishable (FIG. 6).

(69) Infected joints were also investigated histologically. The synovitis in Newman clfAPYI-infected mice was significantly milder than in wild-type infected mice in both experiment 1 and 2 (P=0.02 and 0.001, respectively). Bone destruction, a major cause of sequels in human septic arthritis, was almost absent in the Newman clfAPYI-infected samples (Experiment 2, P=0.001). The synovitis and bone destruction induced by the Newman clfA null mutant were also less pronounced compared to mice infected with Newman wild-type (P=0.003 and 0.006, respectively), but somewhat more severe than in the Newman clfAPYI group, although not significantly so.

(70) Next, the metabolic consequences of the clfA mutations for the infectious process were analysed. Mice infected with the Newman wild-type strain lost up to about 30% of their body weight during the experimental period. Mice that were infected with the fibrinogen binding-deficient mutants Newman clfAPYI and Newman clfAPYII lost hardly any weight at all (P>0.0001 versus wild-type). In contrast, the Newman clfA null mutant had an intermediate effect on the weight loss, causing significantly less than the wild-type strain, but significantly more than the clfAPYI and clfAPYII mutant strains (P≤0.02 in most cases, FIG. 1 B).

(71) The serum levels of IL-6, a measure of systemic inflammatory response, were analyzed at day 7-8 of infection. The pattern of IL-6 expression was similar to weight changes. Newman wild-type evoked high levels of serum IL-6 (4.8 (2.8, 5.7) ng/ml), the Newman clfAPYI mutant evoked considerably lower IL-6 (0.2 (0.07, 2.4) ng/ml, P<0.0001) while the Newman clfA null mutant gave rise to an intermediate response (2.5 (1.3, 3.2) ng/ml) with significant differences to both the wild-type and clfAPYI mutant group (P=0.009 and P=0.008, respectively) (median, interquartile range).

(72) The growth of bacteria in kidneys was significantly greater in Newman wild-type-infected mice, compared to both of the Newman clfAPY mutants and the Newman clfA null mutant (P<0.0001, P=0.011, and P=0.005, respectively; FIG. 2). The Newman clfA null mutant-infected mice had significantly more bacterial growth in kidneys than Newman clfAPYI-infected mice (P=0.0005, FIG. 2).

(73) Total IgG in sera was measured in mice on day 7-8 of infection. There was a significantly lower increase of IgG levels in both the Newman clfAPYI- and Newman clfA null mutant-infected groups as compared to mice infected with the wild-type strain (3.1 (1.2, 4.9); 2.3 (1.0, 2.6); and 6.4 (5.0, 11.0), respectively (median, interquartile range); P≤0.0003). There were no significant differences between the two mutant groups.

(74) The mortality was 17% in the Newman wild type-infected mice, 0% in the Newman clfAPYI and clfAPYII mutant groups and 30% in the Newman clfA null mutant group. There were significant differences in mortality between the wild-type and the clfAPYI groups, and between the clfAPYI and clfA null mutant groups (P<0.05 and P<0.01, respectively).

(75) It appears that direct and indirect signs of systemic inflammation are lower in mice infected with S. aureus expressing ClfA that is deficient in fibrinogen binding. Unexpectedly, the strain which lacked ClfA expression altogether induced more systemic inflammation than a ClfAPY mutant-expressing strain.

(76) Sepsis was induced in mice by increasing the inoculation dose of S. aureus. Mice were infected with 5.2×10.sup.7 cfu of Newman wild type, 5.1×10.sup.7 cfu of the Newman clfAPYI mutant and 3.3×10.sup.7 cfu of the Newman clfA null mutant. Within 5 days all wild-type infected mice were dead, but only one clfAPYI mutant mouse out of ten were dead after 10 days of infection (P<0.0001, FIG. 3). Mice infected with the clfA null mutant also survived a significantly shorter time than the clfAPYI mutant-infected mice (P<0.0001, FIG. 3). In this experiment the mice challenged with the clfA null mutant developed significantly more arthritis than the clfAPYI mutant group, while at the same time they lost significantly more weight (FIGS. 7 and 8). Thus, by analogy with the measures of systemic inflammation in the septic arthritis experiments, the survival of the mice is prolonged if the ClfA molecule is expressed, as long as it lacks fibrinogen binding properties.

(77) Injection of Bacteria into Joints

(78) To test if the inflammatory reaction in the joint is dependent on fibrinogen binding, Newman wild-type, Newman clfAPYI or Newman clfA null were injected directly into a knee joint of mice, thereby by-passing the systemic compartment. Synovitis, including polymorphonuclear infiltration of the joint cavity, and bone destruction was studied by histology 3 days later. The mice received 2.4×10.sup.4 cfu of wild-type, 2.4×10.sup.4 cfu of the clfA null mutant, or 3.4×10.sup.4 cfu of clfAPYI mutant in one knee. The synovitis and the polymorphonuclear infiltration histologic index in the joint cavity was 0.25 (0, 3.0) for knees infected with wild-type, 2.38 (0.25, 3.0) for the clfA null mutant and 0.25 (0, 0.25) for the clfAPYI mutant (median, interquartile range). The histologic index for destruction of bone was 0 (0, 1.0) for wild-type, 1.0 (0, 1.0) for the clfA null mutant, and 0 (0, 0) for the clfAPYI mutant (median, interquartile range; P=0.01 between the clfAPYI mutant and the clfA null mutant). Since the clfAPYI mutant evoked very little synovitis and destruction, despite the fact that 42% more of that strain was given to mice than the other strains, it is concluded that ClfA-promoted fibrinogen binding is needed for the maximal inflammatory response within the joint. Again, the absence of ClfA expression enhanced inflammation compared to the fibrinogen binding deficient ClfA mutant.

(79) PY Mutation in Strain LS-1

(80) To determine if the ability of ClfA to bind fibrinogen affects virulence of other strains of S. aureus, the clfAPYI, clfAPYII and clfA null mutations were transduced to the TSST-1 expressing S. aureus strain LS-1. Mice were challenged with 9.4×10.sup.6 cfu of LS-1 wild-type, 7.9×10.sup.6 cfu of LS-1 clfAPYI, 10.7×10.sup.6 cfu of LS-1 clfAPYII, or 9.4×10.sup.6 cfu of the LS-1 clfA null mutant. Sepsis was studied by following the survival rate. After 16 days only 40% of mice challenged with the wild-type strain were alive while 90% of the mice challenged with the clfAPYI mutant and clfA null mutant groups and 80% mice infected with the clfAPYII mutant were alive (FIG. 4). The clfAPYI mutants and the clfA null mutant of LS-1 were significantly less virulent (P=0.014, P=0.05 and P=0.03, respectively).

(81) Immunization with Recombinant ClfA Proteins

(82) The effect of vaccination with recombinant wild-type ClfA A domain protein (rClfA) and mutant ClfAPYI protein (rClfAPY) was studied in both the septic arthritis model and the sepsis model. Mice were sensitized and then boosted twice with control protein BSA, rClfA, or rClfAPY, and subsequently infected with 4.0×10.sup.6 cfu of S. aureus strain Newman to induce septic arthritis, or with 2.3×10.sup.7 cfu of strain Newman to induce sepsis. Immunization with rClfAPY (i.e. ClfAPYI recombinant protein A domain) protected significantly against septic death as compared to control mice (P=0.01, FIG. 5) while rClfA immunization did not achieve significant protection. One day before bacterial infection there was a much higher specific serum antibody response to both rClfAPY and rClfA in mice immunized with rClfAPY (A.sub.405=0.39 (0.33, 0.56) and 0.71 (0.52, 0.81)) as compared to mice immunized with rClfA (A.sub.405=0.13 (0.07, 0.17) and 0.15 (0.10, 0.24), P<0.0001 in both comparisons (median, interquartile range)). Control immunized animals had only background levels (A.sub.405 nm=0 and 0.01 (0, 0.01) (median, interquartile range)). The immunized mice which were to be infected with the lower, arthritic bacterial dose had similar antibody responses to rClfA and rClfAPY as the mice in which sepsis were induced (data not shown). Immunization with both rClfA and rClfAPY protected against the development of arthritis, although the protection was not significant (FIG. 9).

(83) During day 5 to 9 after infection the weight loss was significantly reduced in the rClfAPY and rClfA immunized mice, as compared to the control mice (data not shown).

(84) A trend to diminished bacterial growth in kidneys of mice immunized with rClfAPY or rClfA at day 11 after infection (BSA: 38 (3, 436); rClfAPY: 7 (2, 17); rClfA: 10 (7, 54)×10.sup.7 cfu/kidney pair) was observed.

(85) To get a more accurate measure of the specific antibody responses in the different immunization groups, the responses were determined at several serum dilutions (the second run). Data shows that there were very likely higher titers of specific antibodies in sera from rClfAPY immunized mice to both the rClfAPY and rClfA wildtype antigens, in both the mice which were to be infected with the septic and the arthritic bacterial dose, respectively, than in sera from rClfA wildtype immunized mice, since there was significantly higher antibody responses measured as absorbance in mice immunized with rClfAPY at each serum dilution in all comparisons (P<0.0001 to P=0.008, FIG. 12-15). BSA immunization evoked only a background antibody response.

(86) Conclusion

(87) The results strongly suggest that the ClfA-fibrinogen interaction is crucial for the bacterial virulence and disease outcome. The ability of ClfA to bind fibrinogen was associated with enhanced virulence in terms of the ability to cause septic death. In both staphylococcal strains tested, a clfAPY mutant induced less septic death than the wild-type. Also, the severity of arthritis was strongly reduced in mice infected with the non-fibrinogen binding clfAPY mutant.

(88) A likely mechanism for the promotion of virulence by the fibrinogen-bacterial cell surface interaction is inhibition of neutrophil phagocytosis (5). Neutrophils are crucial for the host defence in the early phase of S. aureus infection (13). Without neutrophils, bacterial growth is strongly augmented in blood and kidneys, and the frequency of arthritis and mortality increases. Fibrinogen mediated inhibition of neutrophil phagocytosis by ClfA could explain at least in part the more pronounced virulence of wildtype S. aureus compared to the clfAPY mutants. Binding of fibrinogen to ClfA could decrease opsonophagocytosis by neutrophils by reducing opsonin deposition or access to opsonins by neutrophil receptors. Alternatively bound fibrinogen might block the binding of an unknown protective host factor to S. aureus. Another option is that the fibrinogen-ClfA interaction promotes bacterial passage from blood vessel into the tissue or promotes colonization in tissues.

(89) Unexpectedly, our data also show the ClfA null mutant was more virulent than the clfAPY mutant strains. Possibly the ClfA protein has functions in vivo other than interacting with fibrinogen. This interaction is clearly disadvantageous for the host as shown in this study. Other functions of ClfA are presently not well mapped but non-fibrinogen dependent platelet aggregation exerted by ClfA might result in trapping of big amounts of S. aureus in circulation with subsequent elimination of the bacterial-platelet complexes through the reticuloendothelial system. Such platelet aggregation mediated elimination of staphylococci would readily occur in the wild-type and clfAPY mutated strains but not in the clfA knockout. Whereas in the wild-type strain the fibrinogen interaction would overshadow the other events, in the clfAPY mutants such bacterial elimination might be highly beneficial to the host.

(90) The clfA knockout mutant protected against septic death to the same degree as the clfAPY mutation in S. aureus strain LS-1, but protected less, if at all, in strain Newman. The overall impact of ClfA expression on bacterial virulence could differ between different S. aureus strains depending on the level of expression and the presence of other virulence factors.

(91) The issue whether the clfAPY mutant displays equal or lower virulence once in the joint cavity is of certain importance having in mind that in inflamed synovial fluid fibrinogen and fibrin are abundant. Our data suggest that the clfAPY mutant is less destructive for cartilage and bone.

(92) The protective effect of recombinant ClfA A domain non-fibrinogen binding P.sub.336Y.sub.338 mutant was greater than for wildtype rClfA. Immunization with ClfAPY very likely induced a better immune response since higher specific antibody responses were evoked against both the immunogen and the wildtype ClfA protein. More importantly, it induced a greater protective immune response against septic death than wildtype ClfA.

(93) In conclusion, our results show that rClfAPY is a better vaccine candidate than wild type recombinant ClfA. We hypothesize that binding of fibrinogen by wild-type ClfA protein during the immunization phase decreases antigen presentation due to hiding of important epitopes on the ClfA molecule and hence impairs specific antibody production.

Example 2

(94) rClfA a Region Truncate Comprising N2 and N3 (rClfA 221-559)

(95) Materials & Methods:

(96) The protocols outlined in Example 1 were followed in this example which utilized rClfA 221-559 (i.e. ClfA A region truncate comprising N2 and N3 corresponding to amino acids 220-559) rClfAPY221-559; and BSA.

(97) There were 15 female NMRI mice per group who were 8 weeks old at start of experiments. In this Example, the constructs used for immunization were ClfA wild type/native N2N3 truncate, ClfA N2N3 truncate with mutation PY as defined in Example 1. BSA was used as the control.

(98) Vaccination with Wild-Type and Mutant Recombinant ClfA

(99) The mice were immunized with rClfA 221-559, rClfAPY 221-559 or BSA in accordance with the protocol of Example 1.

(100) Purified rClfA221-559, rClfAPY221-559 (i.e. ClfAPYI recombinant protein A subdomains N2 and N3) or BSA were dissolved in PBS and emulsified 1:1 in Freund's complete adjuvant. Two hundred μl of the emulsion containing 30 μg (=0.79 nmol) of protein was injected s.c. on day 0. First booster immunization with 30 μg of protein in physiologic saline in incomplete Freund's adjuvant was performed on day 12. Second booster immunization was done day 22. On day 31 the mice were bled and sera were frozen for later analysis of antibody responses.

(101) Specific Antibodies—ELISA

(102) Serum samples from immunized mice were obtained 9 days after the second booster immunization. The serum specific antibody response against rClfA221-559 and rClfAPY221-559 was measured by ELISA. Microplates (96-well; Nunc) were coated with 5 μg/ml of recombinant protein in PBS. Blocking agent, serum samples, biotinylated antibodies, and ExtrAvidin-proxidase were all diluted in PBS. The assay was run according to a previous description (8). All serum samples were diluted 1:5000, 1:20000, 1:80000 and 1:320000, and antibody response was monitored as absorbance at 405 nm.

(103) Results:

(104) Specific Antibody Response:

(105) The antibody response was measured by absorbance in an ELISA-assay, as per Example 1, with four different serum dilutions. The data obtained was very similar to the data in the Example 1.

(106) It was found that rClfAPY221-559 immunization very likely gave rise to higher titers of specific antibodies to both native rClfA221-559 and rClfAPY221-559, as compared to native rClfA221-599 immunization, since there were significantly higher antibody responses measured as absorbance in mice immunized with rClfAPY221-559 at each serum dilution in all comparisons but one (P=0.001 to 0.025, see FIGS. 16 and 17). BSA immunization evoked only background levels of antibody response.

(107) Conclusion

(108) We found that immunization with a rClfAPY221-559 protein gave rise to significantly higher antibody responses to both the immunogen and the wildtype ClfA protein, than immunization with the native protein.

(109) Based on these findings, we conclude that PY-immunization, regardless if the PY protein comprises amino acids 40 to 550 as in Example 1 or amino acids 221 to 559 as in Example 2, induces a better immune response than immunization with native ClfA of the corresponding size.

Example 3

(110) ClfA a Region Truncate (6/Delta Latch Truncate)

(111) Materials & Methods:

(112) The protocols outlined in Example 1 were followed in this example which utilized the following construct: rClfA 221-531 (i.e. rClfA A region truncate comprising N2 and N3 amino acids 220-559 but without the latching peptide amino acids 532-538 and the subsequent proline-rich residues.

(113) There were 15 female NMRI mice in the group who were 8 weeks old at start of experiment. In this Example, the above construct was used for immunization. The mice were immunized with the above truncate in accordance with the protocol of Example 1.

(114) Vaccination with Wild-Type and Mutant Recombinant ClfA

(115) Purified rClfA221-531 was dissolved in PBS and emulsified 1:1 in Freund's complete adjuvant. Two hundred μl of the emulsion containing 0.79 nmol of protein was injected s.c. on day 0. First booster immunization with 0.79 nmol of protein in physiologic saline in incomplete Freund's adjuvant was performed on day 12. Second booster immunization was done day 22. On day 31 the mice were bled and sera were frozen for later analysis of antibody responses.

(116) Specific Antibodies—ELISA

(117) Serum samples from immunized mice were obtained 9 days after the second booster immunization. The serum levels of specific antibodies was measured by ELISA. Microplates (96-well; Nunc) were coated with 4.6 μg/ml of rClfA221-531 protein which is equimolar to 5 μg/ml of rClfA221-559 and rClfAPY221-559 from Examples 1 and 2. Blocking agent, serum samples, biotinylated antibodies, and ExtrAvidin-proxidase were all diluted in PBS. The assay was run according to a previous description (8). All serum samples were diluted 1:5000, 1:20000, 1:80000 and 1:320000, and antibody response was monitored as absorbance at 405 nm.

(118) Results:

(119) The antibody response was measured by absorbance in an ELISA-assay, as per Example 1. It was found that rClfA221-531 immunization gave rise to an immune response, measured as a specific antibody response (FIG. 18).

(120) Conclusion:

(121) We found that rClfA221-531 works as an immunogen, since the antigen evokes a specific antibody response.

REFERENCES

(122) 1. Peacock S J, Moore C E, Justice A, Kantzanou M, Story L, Mackie K, O'Neill G, Day N P J (2002) Virulent combinations of adhesin and toxin genes in natural populations of Staphylococcus aureus. Infect Immun 70:4987-4996. 2. McDevitt D, Nanavaty T, House-Pompeo K, Bell E, Turner N, McEntire L, Foster T, Höök M (1997) Characterization of the interaction between the Staphylococcus aureus clumping factor (ClfA) and fibrinogen. Eur J Biochem 247:416-424. 3. McDevitt D, Francois P, Vaudaux P, Foster T J (1994) Molecular characterization of the clumping factor (fibrinogen receptor) of Staphylococcus aureus. Mol Microbiol 11:237-248. 4. Palmqvist N, Patti J M, Tarkowski A, Josefsson E (2004) Expression of staphylococcal clumping factor A impedes macrophage phagocytosis. Microb Infect 6:188-195. 5. Higgins J, Loughman A, van Kessel K P M, van Strijp J A G, Foster T J (2006) Clumping factor A of Staphylococcus aureus inhibits phagocytosis by human polymorphonuclear leukocytes. FEMS Microbiol Lett 258:290-296. 6. Loughman A, Fitzgerald J R, Brennan M P, Higgins J, Downer R, Cox D, Foster T J (2005) Roles of fibrinogen, immunoglobulin and complement in platelet activation promoted by Staphylococcus aureus clumping factor A. Mol Microbiol 57:804-818. 7. O'Brien L, Kerrigan S W, Kaw G., Hogan M., Penadés J., Litt D., Fitzgerald D. J., Foster T. J. & Cox D. (2002) Multiple mechanisms for the activation of human platelet aggregation by Staphylococcus aureus: roles for the clumping factors ClfA and ClfB, the serine-aspartate repeat protein SdrE and protein A. Mol Microbiol 44, 1033-1044. 8. Josefsson E., Hartford O., O'Brien L, Patti J M, Foster T (2001) Protection against experimental Staphylococcus aureus arthritis by vaccination with clumping factor A, a novel virulence determinant. J Infect Dis 184:1572-1580. 9. Palmqvist N, Foster T, Fitzgerald R, Josefsson E, Tarkowski A (2005) Fibronectin-binding proteins and fibrinogen-binding clumping factors play distinct roles in staphylococcal arthritis and systemic inflammation. J Inf Dis 191:791-798. 10. Deivanayagam C C S, Wann E R, Chen W, Carson M, Rajashankar K R, Höök M, Narayana S V L (2002) A novel variant of the immunoglobulin fold in surface adhesins of Staphylococcus aureus: crystal structure of the fibrinogen-binding MSCRAMM, clumping factor A. The EMBO Journal 21:6660-6672. 11. Bremell T, Lange S, Yacoub A, Ryden C, Tarkowski A (1991) Experimental Staphylococcus aureus arthritis in mice. Infect Immun 59:2615-2623. 12. Sakiniene E, Bremell T, Tarkowski A (1996) Addition of corticosteroids to antibiotic treatment ameliorates the course of experimental Staphylococcus aureus arthritis. Arthritis Rheumatism 39:1596-1605. 13. Verdrengh M, Tarkowski A (1997) Role of neutrophils in experimental septicemia and septic arthritis induced by Staphylococcus aureus. Infect Immun 65:2517-2521. 14. Duthie E S, Lorenz L L (1952) Staphylococcal coagulase: mode of action and antigenicity. J Gen Microbiol 6:95-107. 15. Kreiswirth B N, Löfdahl S, Betley M J, O'Reilly M, Schlievert P M, Bergdoll M S, Novick R P (1983) The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305:709-712. 16. Foster T J (1998) in Methods in Microbiology Vol. 27: Bacterial Pathogenesis, eds Williams P, Ketley J, Salmond G (Academic Press, London), pp 433-454. 17. O'Connell D P, Nanavaty T, McDevitt D, Gurusiddappa S, Höök M, Foster T J (1998) The fibrinogen-binding MSCRAMM (clumping factor) of Staphylococcus aureus has a Ca.sup.2++-dependent inhibitory site. J Biol Chem 273:6821-6829. 18. Sakiniene E, Bremell T, Tarkowski A (1999) Complement depletion aggravates Staphylococcus aureus septicaemia and septic arthritis. Clin Exp Immunol 115:95-102. 19. Mancini G, Carbonara A O, Heremans J F (1965) Immunochemical quantitation of antigens by single radial immunodiffusion. Immunochemistry 2:235-254. 20. Bremell T, Abdelnour A, Tarkowski A (1992) Histopathological and serological progression of experimental Staphylococcus aureus arthritis. Infect Immun 60:2976-2985.