Microorganisms for production of O-succinyl homoserine and method for production of O-succinyl homoserine using the same

Abstract

The present invention relates to a polypeptide which is resistant to feedback inhibition by methionine and has an activity of homoserine O-succinyltransferase, a microorganism for producing O-succinylhomoserine which expresses the polypeptide, and a method for producing O-succinylhomoserine using the same.

Claims

1. An O-succinylhomoserine producing Escherichia sp. microorganism expressing a polypeptide, having a resistance to feedback inhibition by methionine and a homoserine O-succinyitransferase activity, wherein the polypeptide has an amino acid sequence represented by SEQ ID NO: 29, wherein the expression of said polypeptide results in increased production of O-succinylhomoserine compared to the same Escherichia sp. microorganism not expressing said polypeptide.

2. Escherichia sp. microorganism of claim 1, wherein the Escherichia sp. microorganism is Escherichia coli.

3. The Escherichia sp. microorganism of claim 1, wherein the metB gene encoding cystathionine gamma synthase is further deleted or weakened.

4. The Escherichia sp. microorganism of claim 1, wherein the thrB gene encoding homoserine kinase and the metA gene encoding homoserine O-succinyltransferase are further deleted or weakened.

5. The Escherichia sp. microorganism of claim 1, wherein phosphoenolpyruvate carboxylase, aspartate aminotransferase, and aspartate-semialdehyde dehydrogenase are further enhanced.

6. A method of producing O-succinylhomoserine, comprising: (a) culturing the microorganism of claim 1 in a medium; and (b) obtaining O-succinylhomoserine from the microorganism or the medium.

7. A method of producing O-succinylhomoserine, comprising: (a) culturing the microorganism of claim 2 in a medium; and (b) obtaining O-succinylhomoserine from the microorganism or the medium.

8. A method of producing O-succinylhomoserine, comprising: (a) culturing the microorganism of claim 3 in a medium; and (b) obtaining O-succinylhomoserine from the microorganism or the medium.

9. A method of producing O-succinylhomoserine, comprising: (a) culturing the microorganism of claim 4 in a medium; and (b) obtaining O-succinylhomoserine from the microorganism or the medium.

10. A method of producing O-succinylhomoserine, comprising: (a) culturing the microorganism of claim 5 in a medium; and (b) obtaining O-succinylhomoserine from the microorganism or the medium.

Description

DETAILED DESCRIPTION OF THE INVENTION

(1) Hereinafter, the present invention will be described in more detail with reference to the following Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.

EXAMPLE 1

Preparation of Threonine-Producing Strain Based Parent Strain

(2) (1) Deletion of metB Gene

(3) For the characterization of substrate specificity and activity of metX gene, a strain which can accumulate homoserine and has a deletion in utilization of acyl homoserine. The strain was constructed based on the FTR2533 (KCCM 10541), a threonine-producing strain disclosed in International Patent Publication No. WO 05/075625.

(4) The metB gene encoding cystathionine synthase in a threonine-producing strain, the FTR2533 (KCCM 10541) strain, was deleted by the FRT-one-step PCR deletion method (PNAS (2000) vol 97: P 6640-6645). A deletion cassette was constructed by PCR using the primers of SEQ ID NO: 1 and SEQ ID NO: 2, and the pKD3 vector (PNAS (2000) vol 97: P 6640-6645) as a template. The PCR was performed for 30 cycles under the following conditions: denaturation at 94? C. for 30 s, annealing at 55? C. for 30 s, and polymerization at 72? C. for 1 m.

(5) TABLE-US-00001 <SEQIDNO:1> 5 ttactctggtgcctgacatttcaccgacaaagcccaggga acttcatcacgtgtaggctggagctgcttc3 <SEQIDNO:2> 5 ttaccccttgtttgcagcccggaagccattttccaggtcg gcaattaaatcatatgaatatcctccttag3

(6) The resulting PCR product was electrophoresed in a 1.0% agarose gel and the 1.2 kbp DNA band obtained therefrom was purified. The recovered DNA fragment was electroporated into the FTR2533 strain, which was already transformed with the pKD46 vector (PNAS (2000) vol 97: P6640-6645).

(7) For the electroporation, the FTR2533 strain transformed with the pKD46 vector was cultured in LB medium containing 100 ?g/L ampicillin and 5 mM L-arabinose at 30? C. until OD600 reached 0.6. The resultant was washed twice with sterile distilled water and then washed once with 10% glycerol for use. The electroporation was performed at 2500V.

(8) The recovered strain was plated on LB plate medium containing 25 ?g/L chloramphenicol, cultured at 37? C. overnight, and the strain showing resistance to chloramphenicol was selected. The selected strain was subjected to PCR using the same primers while using the strain as a template, and the deletion of metB gene was confirmed by observing the presence of a 1.2 kb band of the gene in a 1.0% agarose gel. The thus-confirmed strain was transformed again with the pCP20 vector (PNAS (2000) vol 97: P6640-6645) and cultured in LB medium, and again the final strain with a deletion of metB gene having a reduced size of 150 bp, which was confirmed in a 1.0% agarose gel, was constructed by performing PCR under the same conditions and confirmed that the chloramphenicol marker was removed from the strain. The thus-constructed strain was named as CJMA1.

(9) (2) Deletion of thrB Gene

(10) The thrB gene encoding homoserine kinase was deleted in the thus-constructed CJMA1 strain using the FRT-one-step PCR deletion method, as in the case of metB gene deletion.

(11) A thrB deletion cassette was constructed by PCR using the primers of SEQ ID NO: 3 and SEQ ID NO: 4, and the pKD4 vector (PNAS (2000) vol 97: P 6640-6645) as a template. The PCR was performed for 30 cycles under the following conditions: denaturation at 94? C. for 30 s, annealing at 55? C. for 30 s, and extension at 72? C. for 1 m.

(12) TABLE-US-00002 <SEQIDNO:3> aaagaatatgccgatcggttcgggcttaggctccagtgcc tgttcggtgggtgtaggctggagctgcttc <SEQIDNO:4> agacaaccgacatcgctttcaacattggcgaccggagccg ggaaggcaaacatatgaatatcctccttag

(13) The resulting PCR product was electrophoresed in a 1.0% agarose gel and the 1.6 kbp DNA band obtained therefrom was purified. The recovered DNA fragment was electroporated into the CJMA1 strain, which was already transformed with the pKD46. The recovered strain was plated on LB plate medium containing 50 ?g/L kanamycin, cultured at 37? C. overnight, and the strain showing resistance to kanamycin was selected. The selected strain was subjected to PCR under the same conditions using the primers of SEQ ID NOS: 3 and 4, and the deletion of thrB gene was confirmed by observing the presence of a 1.6 kb band of the gene in a 1.0% agarose gel. The thus-confirmed strain was transformed again with the pCP20 vector and cultured in LB medium, and the final strain with a deletion of thrB gene having a reduced size of 150 bp, which was confirmed in a 1.0% agarose gel, was constructed by performing PCR under the same conditions and confirmed that the kanamycin marker was removed from the strain. The thus-constructed strain was named as CJMA2.

(14) (3) Deletion of metA Gene

(15) For the characterization of substrate specificity and activity of the metX gene derived from Chromobacterium Violaceum in the CJMA2 strain, the original metA gene on the chromosome was deleted based on the CJMA2 strain, in which metB and thrB genes are deleted, in the FTR2533 (KCCM 10541) strain. The metA gene was deleted by the FRT-one-step PCR deletion method.

(16) A metA deletion cassette was constructed by PCR using the primers of SEQ ID NOS: 5 and 6, and the pKD3 vector (PNAS (2000) vol 97: P6640-6645) as a template. The PCR was performed for 30 cycles under the following conditions: denaturation at 94? C. for 30 s, annealing at 55? C. for 30 s, and extension at 72? C. for 1 m.

(17) TABLE-US-00003 <SEQIDNO:5> caatttcttgcgtgaagaaaacgtctttgtgatgacaact tctcgtgcgtgtgtaggctggagctgcttc <SEQIDNO:6> aatccagcgttggattcatgtgccgtagatcgtatggcgt gatctggtagcatatgaatatcctccttag

(18) The resulting PCR product was electrophoresed in a 1.0% agarose gel and the 1.2 kbp DNA band obtained therefrom was purified. The recovered DNA fragment was electroporated into the CJMA2 strain, which was already transformed with the pKD46. The recovered strain was plated on LB plate medium containing chloramphenicol, cultured at 37? C. overnight, and the strain showing resistance to chloramphenicol was selected.

(19) The selected strain was subjected to PCR under the same conditions using the primers of SEQ ID NOS: 5 and 6, and the deletion of metA gene was confirmed by observing the presence of a 1.1 kb band of the gene in a 1.0% agarose gel. The thus-confirmed strain was transformed again with the pCP20 vector and cultured in LB medium, and the final strain with a deletion of thrB gene having a reduced size of 100 bp, which was confirmed in a 1.0% agarose gel, was constructed by performing PCR under the same conditions and was confirmed that the chloramphenicol marker was removed from the strain. The thus-constructed strain was named as CJM2.

(20) The CJM2 strain can accumulate an excessive amount of homoserine in the strain and can produce O-acetyl homoserine or O-succinylhomoserine according to the metX substrate specificity of the plasmid being introduced.

EXAMPLE 2

Selection of Polypeptides Having Novel O-Succinyltransferase Activity

(21) For securing the release and stability of feedback control of metA gene, 10 types of orthologues named as metX in KEGG website (//www.genome.jp/kegg/) were selected and cloned into the pCL1920_PCJ1 vector. The CJM2 strain prepared in Example 1 was transformed with the 10 different types of vectors.

(22) The thus-obtained 10 different kinds of strains were subjected to a flask evaluation using the flask culture method described in Example 5-(2) below. The CJM2 is a strain which can accumulate homoserine. When a homoserine succinyltransferase gene is introduced into the pCL1920, O-succinylhomoserine can be obtained as a final product, whereas when a homoserine acetyltransferase gene is introduced into the pCL1920, O-acetylhomoserine can be obtained as a final product. In this regard, a gene, which is a metX gene encoding homoserine succinyltransferase, was obtained among the 10 different types already evaluated. The gene is a Chromobacterium Violaceum-derived metX gene having the characteristic of producing O-succinylhomoserine with high yield (an amino acid sequence of SEQ ID NO: 29, and a nucleotide sequence of SEQ ID NO: 36), and the present inventors have confirmed that the above activity is a novel activity that has never been reported previously.

EXAMPLE 3

Plasmid Construction

(23) 3-1. Construction of a Plasmid Expressing metA Gene Derived from Wild-Type E. coli

(24) PCR was performed using the chromosome of E. coli W3110 (Accession No: ATCC 9637) purchased from the American Type Culture Collection (ATCC) as a template, along with the primers of SEQ ID NO: 7 and SEQ ID NO: 8, to amplify the metA gene encoding homoserine O-succinyltransferase.

(25) The primers used in the PCR were prepared based on the nucleotide sequence of E. coli chromosome (NC 000913) registered in the GenBank of the National Institutes of Health (NIH GenBank), and the primers of SEQ ID NO: 7 and SEQ ID NO: 8 have the EcoRV restriction site and the HindIII restriction site, respectively.

(26) TABLE-US-00004 <SEQIDNO:7> 5 AATTGATATCATGCCGATTCGTGTGCCGG3 <SEQIDNO:8> 5 AATTAAGCTTTTAATCCAGCGTTGGATTCATGTG3

(27) The PCR was performed by denaturation at 94? C. for 3 min; 30 cycles of denaturation at 94? C. for 30 s, annealing at 56? C. for 30 s, and polymerization at 68? C. for 2 m; and polymerization at 68? C. for 10 m.

(28) The pCL1920 plasmid including the thus-obtained PCR product and CJ1 promoter (Korean Pat. No. 0620092) was cloned after treating with EcoRV and HindIII, respectively. E. coli DH5? was transformed using the cloned plasmid and a plasmid was obtained by selecting the transformed E. coli DH5? from an LB plate containing spectinomycin (50 ?g/mL). The thus-obtained plasmid was named as pCL_Pcj1_metA (wt).

(29) 3-2. Construction of a Plasmid Expressing metA Gene Having a Feedback-Resistance

(30) A metA gene (metA #11) having a feedback resistance to methionine was constructed using a site-directed mutagenesis kit; Stratagene, USA) based on the pCL_Pcj1_metA (wt) prepared in Example 3-1 as a template.

(31) Specifically, according to the disclosure in International Patent Publication No. WO 2008/127240, the 29.sup.th amino acid, serine, was substituted with proline (S29P) using the primers of SEQ ID NO: 9 and SEQ ID NO: 10; the 114.sup.th amino acid, glutamic acid, was substituted with glycine (E114G) using the primers of SEQ ID NO: 11 and SEQ ID NO: 12; and the 140.sup.th amino acid, phenylalanine, was substituted with serine (F140S) using the primers of SEQ ID NO: 13 and SEQ ID NO: 14. The nucleotide sequences of the primers used are shown below.

(32) TABLE-US-00005 <SEQIDNO:9> 5 ATGACAACTTCTCGTGCGCCTGGTCAGGAAATTCG3 <SEQIDNO:10> 5 CGAATTTCCTGACCAGGCGCACGAGAAGTTGTCAT3 <SEQIDNO:11> 5 CGCCGCTGGGCCTGGTGGGGTTTAATGATGTCGCT3 <SEQIDNO:12> 5 AGCGACATCATTAAACCCCACCAGGCCCAGCGGCG3 <SEQIDNO:13> 5 CACGTCACCTCGACGCTGAGTGTCTGCTGGGCGGT3 <SEQIDNO:14> 5 ACCGCCCAGCAGACACTCAGCGTCGAGGTGACGTG3

(33) A plasmid including the metA (#11) gene, which is introduced with all three kinds of the modifications by sequential introduction, was constructed and named as pCL_Pcj1_metA #11.

(34) 3-3. Construction of a Plasmid Expressing metX Gene Derived from Deinococcus radiodurans

(35) PCR was performed using the chromosome of Deinococcus radiodurans (Accession No: ATCC BAA-816D) purchased from the American Type Culture Collection (ATCC) as a template, along with the primers of SEQ ID NO: 15 and SEQ ID NO: 16, to amplify the metX gene encoding homoserine 0-acetyl transferase.

(36) The primers used in the PCR were prepared based on the nucleotide sequence of chromosome (AE000513) registered in the GenBank of the National Institutes of Health (NIH GenBank), and the primers of SEQ ID NO: 15 and SEQ ID NO: 16 have the EcoRV restriction site and the HindIII restriction site, respectively.

(37) TABLE-US-00006 <SEQIDNO:15> 5 AATTGATATCATGACCGCCGTGCTCGC3 <SEQIDNO:16> 5 AATTAAGCTTTCAACTCCTGAGAAACGCCCC3

(38) The PCR was performed by denaturation at 94? C. for 3 min; 30 cycles of denaturation at 94? C. for 30 s, annealing at 56? C. for 30 s, and polymerization at 68? C. for 5 m; and polymerization at 68? C. for 7 m.

(39) The pCL1920 plasmid including the thus-obtained PCR product and CJ1 promoter (Korean Pat. No. 0620092) was cloned after treating with EcoRV and HindIII, respectively. E. coli DH5? was transformed using the cloned plasmid and a plasmid was obtained by selecting the transformed E. coli DH5? from an LB plate containing spectinomycin (50 ?g/mL). The thus-obtained plasmid was named as pCL_Pcj1_dra metX.

(40) 3-4. Construction of a Plasmid Expressing metX Gene Derived from Chromobacterium Violaceum

(41) PCR was performed using the chromosome of Chromobacterium Violaceum (Accession No: ATCC 12472) purchased from the American Type Culture Collection (ATCC) as a template, along with the primers of SEQ ID NO: 17 and SEQ ID NO: 18, to amplify the metX gene derived from Chromobacterium Violaceum.

(42) The primers used in the PCR were prepared based on the nucleotide sequence of Chromobacterium Violaceum chromosome (NC_005085) registered in the GenBank of the National Institutes of Health (NIH GenBank), and the primers of SEQ ID NO: 17 and SEQ ID NO: 18 have the EcoRV restriction site and the HindIII restriction site, respectively

(43) TABLE-US-00007 <SEQIDNO:17> 5 aattgatatcATGACCGACACCAACTGTTCGG3 <SEQIDNO:18> 5 aattaagcttTCATGCGTTCACCTCCTTGGC3

(44) The PCR was performed by denaturation at 94? C. for 3 min; 30 cycles of denaturation at 94? C. for 30 s, annealing at 56? C. for 30 s, and polymerization at 68? C. for 2 m; and polymerization at 68? C. for 10 m.

(45) The pCL1920 plasmid including the thus-obtained PCR product and CJ1 promoter (Korean Pat. No. 0620092) was cloned after treating with EcoRV and HindIII, respectively. E. coli DH5? was transformed using the cloned plasmid and a plasmid was obtained by selecting the transformed E. coli DH5? from an LB plate containing spectinomycin (50 ?g/mL). The thus-obtained plasmid was named as pCL_Pcj1_cvi metX.

(46) 3-5. A Plasmid for Construction of 2 Copy-Strain for Enhancing Biosynthesis Gene

(47) (1) Construction of pSG76c Vector for ppc Insertion

(48) In the present Example, pSG76c-2ppc, which is a vector for the insertion of E. coli chromosomal DNA including the ppc gene that encodes phosphoenolpyruvate carboxylase, was constructed.

(49) The nucleotide sequence information of the ppc gene was obtained based on the NIH GenBank database (NCBI Reg. No. gi: 89110074), and the primers (SEQ ID NO: 19 and SEQ ID NO: 20), which include the ppc ORF, and EcoRI- and SacI restriction sites from the position ?200 of the ppc gene, and the primers (SEQ ID NO: 21 and SEQ ID NO: 22), which include SacI- and KpnI restriction sites, were synthesized based on the information.

(50) TABLE-US-00008 <SEQIDNO:19> 5 gccggaattctgtcggatgcgatacttgcgc3 <SEQIDNO:20> 5 gaaggagctcagaaaaccctcgcgcaaaag3 <SEQIDNO:21> 5 gccggagctctgtcggatgcgatacttgcgc3 <SEQIDNO:22> 5 gaagggtaccagaaaaccctcgcgcaaaag3

(51) PCR was performed using the chromosome of E. coli W3110 as a template along with the primers of SEQ ID NOS: 19 and 20 and SEQ ID NOS: 21 and 22. PfuUltra? high-fidelity DNA polymerase (Stratagene) was used as polymerase, and the PCR was performed by denaturation at 94? C. for 3 min; 30 cycles of denaturation at 94? C. for 30 s, annealing at 56? C. for 30 s, and polymerization at 68? C. for 5 m; and polymerization at 68? C. for 7 m. As a result, the amplified ppc gene with a size of about 3.1 kb including EcoRI- and SacI restriction sites and the SacI- and KpnI restriction site was obtained.

(52) After treating the end of the ppc gene obtained by PCR with EcoRI and SacI, and SacI and KpnI, the resulting ppc gene was ligated to the pSG76c vector (J Bacteriol. 1997 July; 179 (13): 4426-8), which was already treated with EcoRI and KpnI, and finally the pSG76c-2ppc recombinant vector into which two copies of the ppc gene are cloned, was constructed.

(53) (2) Construction of pSG76c Vector for aspC Insertion

(54) In the present Example, pSG76c-2aspC, which is a vector for the insertion of E. coli chromosomal DNA including the aspC gene that encodes aspartate aminotransferase, was constructed.

(55) The nucleotide sequence information of the aspC gene was obtained based on the NIH GenBank database (NCBI Reg. No. gi: 85674274), and the primers (SEQ ID NO: 23 and SEQ ID NO: 24), which include the aspC ORF and SacI restriction site from the position ?200 of the aspC gene, were synthesized based on the information.

(56) TABLE-US-00009 <SEQIDNO:23> 5 tccgagctcataagcgtagcgcatcaggca3 <SEQIDNO:24> 5 tccgagctcgtccacctatgttgactacat3

(57) PCR was performed using the chromosome of E. coli W3110 as a template along with the primers of oligonucleotides of SEQ ID NOS: 23 and 24. PfuUltra? high-fidelity DNA polymerase (Stratagene) was used as polymerase, and the PCR was performed by denaturation at 94? C. for 3 min; 30 cycles of denaturation at 94? C. for 30 s, annealing at 56? C. for 30 s, and polymerization at 68? C. for 2 m; and polymerization at 68? C. for 7 m. As a result, the amplified aspC gene with a size of about 1.5 kb including BamHI restriction site was obtained.

(58) After treating the end of the aspC gene obtained by PCR with BamHI, the resulting aspC gene was ligated to the pSG76c vector (J Bacteriol. 1997 July; 179 (13): 4426-8), which was already treated with BamHI, and finally the pSG76c-2aspC recombinant vector, into which two copies of the aspC gene are cloned, was constructed.

(59) (3) Construction of pSG76c Vector for asd Insertion

(60) In the present Example, pSG76c-2asd, which is a vector for the insertion of E. coli chromosomal DNA including the asd gene that encodes aspartate-semialdehyde dehydrogenase, was constructed.

(61) The nucleotide sequence information of the asd gene was obtained based on the NIH GenBank database (NCBI Reg. No. gi: 89110578), and the primers (SEQ ID NO: 25 and SEQ ID NO: 26), which include the asd ORF, and EcoRI- and XbaI restriction sites from the position ?200 of the asd gene, and the primers (SEQ ID NO: 27 and SEQ ID NO: 28), which include XbaI- and EcoRI restriction sites, were synthesized based on the information.

(62) TABLE-US-00010 <SEQIDNO:25> 5 ccggaattcccaggagagcaataagca3 <SEQIDNO:26> 5 ctagtctagatgctctatttaactcccg3 <SEQIDNO:27> 5 ctagtctagaccaggagagcaataagca3 <SEQIDNO:28> 5 ccggaattctgctctatttaactcccg3

(63) PCR was performed using the chromosome of E. coli W3110 as a template along with the primers of oligonucleotides of SEQ ID NOS: 25 and 26 and SEQ ID NOS: 27 and 28. PfuUltra? high-fidelity DNA polymerase (Stratagene) was used as polymerase, and the PCR was performed for 30 cycles consisting of denaturation at 96? C. for 30 s, annealing at 50? C. for 30 s, and polymerization at 68? C. for 2 m. As a result, the amplified asd gene with a size of about 1.5 kb including EcoRI- and XbaI restriction sites and XbaI- and EcoRI restriction sites was obtained.

(64) After treating the end of the asd gene obtained by PCR with EcoRI and XbaI, the resulting asd gene was ligated to the pSG76c vector, which was already treated with EcoRI, and finally the pSG76c-2asd recombinant vector, into which two copies of the asd gene are cloned, was constructed.

EXAMPLE 4

Construction of a Wild-Type Based Parent Strain

(65) (1) Enhancement of ppc, aspC, and asd Genes

(66) E. coli W3110 (Accession No: ATCC 9637) purchased from the American Type Culture Collection (ATCC) was transformed with the pSG76c-2ppc, pSG76c-2aspC, pSG76c-2asd vectors prepared in Example 3-5, plated on LB-Cm (10 g/L of yeast extract, 5 g/L of NaCl, 10 g/L of tryptone, 25 ?g/L of chloramphenicol, and 15 g/L of agar) plate medium, and the colonies which showed a resistance to chloramphenicol were selected. The selected transformants are the strains, in which the pSG76c-2ppc vector was firstly inserted into the ppc part of the genome.

(67) The thus-obtained strain, in which 2 copies of the ppc gene are inserted, was transformed with the pST76-AsceP vector expressing I-SceI, which is a restriction enzyme digesting the I-SceI part present in the pSG76c vector, and plated on an LB-Ap (10 g/L of yeast extract, 5 g/L of NaCl, 10 g/L of tryptone, 100 ?g/L of ampicillin, and 15 g/L of agar) plate medium, and the strains growing at 30? C. were selected.

(68) The thus-grown strains may be in a state where the ppc gene was amplified to have 2 copies or may be returned to have a single copy. The strains with 2 copies of the ppc gene with an enlarged gene size of a 6.5 kb were selected in an 1% agarose gel electrophoresis after performing PCR using the primers of SEQ ID NO: 30 and SEQ ID NO: 31. As a result of the above process, the ppc gene becomes further inserted while the pSG76c vector is removed.

(69) According to the method described above, the W3110 strains with amplified copies of ppc, asd, and aspC genes were constructed sequentially using the pSG76c-2aspC and pSG76c-2asd vectors. During the process, the construction of the strain with 2 copies of aspC gene was confirmed by identifying the gene with an enlarged size of 3.2 kb in an 1% agarose gel electrophoresis after performing PCR using the primers of SEQ ID NO: 32 and SEQ ID NO: 33, whereas the construction of the strain with 2 copies of asd gene was confirmed by identifying the gene with an enlarged size of 3.2 kb in an 1% agarose gel electrophoresis after performing PCR using the primers of SEQ ID NO: 34 and SEQ ID NO: 35. The thus constructed strain was named as CJW2.

(70) TABLE-US-00011 <SEQIDNO:30> CTGGCTCAATTAATCAGGCTC <SEQIDNO:31> CGAGGGTGTTAGAACAGAAGT <SEQIDNO:32> TGGTGAACTACTTTGAAGTGG <SEQIDNO:33> TGCGGCACGAGCGCCTTATCC <SEQIDNO:34> GCTCGTAGGCTAAGAAATGCC <SEQIDNO:35> CAGGTAAGGCTGTGAATACTC
(2) Deletion of metB, thrB, and metA Genes

(71) The strain with deletion in metB, thrB, and metA genes was constructed in the same manner as in Example 3-1 using the CJW2 strain, and the strain was named as CJW2H. The CJW2H strain is a strain which can excessively accumulate homoserine within the strain and produce O-acetyl homoserine or O-succinylhomoserine depending on the metX substrate specificity of the plasmid being introduced.

EXAMPLE 5

Construction of Experimental Strains

(72) (1) Construction of Strains

(73) The E. coli strains CJM2 and CJW2H constructed in Examples 1-(3) and 4-(2), respectively, were prepared into competent cells and introduced via electroporation with four different kinds of plasmids, pCL_Pcj1_metA (wt), pCL_Pcj1_metA #11, pCL_Pcj1_dra metX, and pCL_Pcj1_cvi metX, constructed in Examples 3-1, 3-2, 3-3, and 3-4, respectively.

(74) (2) Flask Culture Experiment

(75) Then, a flask test was performed to compare the kinds of the methionine precursors and the amount of production produced by each of the strains, which were introduced with the four kinds of plasmids, respectively. The flask test was performed as follows: each strain was streaked on an LB plate, cultured in a 31? C. incubator for 16 hours, and single colonies were inoculated into 3 mL of LB medium, and cultured in a 31? C. incubator at a rate of 200 rpm for 16 hours.

(76) To a 250 mL flask was added 25 mL of a methionine precursor-producing medium shown in Table 1, and then added with 500 ?L each of the culture broths prepared previously, respectively. Then, the flask was incubated in a 31? C. incubator at a rate of 200 rpm for 40 hours, and the kinds and amount of methionine precursors obtained in each of the strains introduced with each of the plasmids were compared. The results are shown in Tables 2 and 3 below.

(77) TABLE-US-00012 TABLE 1 Concentration Composition (per Liter) Glucose 70 g Ammonium sulfate 25 g KH.sub.2PO.sub.4 1 g MgSO.sub.47H.sub.2O 0.5 g FeSO.sub.47H.sub.2O 5 mg MnSO.sub.48H.sub.2O 5 mg ZnSO.sub.4 5 mg Calcium carbonate 30 g Yeast extract 2 g Methionine 0.3 g Threonine 1.5 g

(78) TABLE-US-00013 TABLE 2 Glucose consump- Amount of tion Product product Strain OD (g/L) (g/L) (g/L) CJM2 18.8 58.2 O-succinylhomoserine 1.2 pCL_Pcj1_metA (wt) CJM2 18.5 68.0 O-succinylhomoserine 16.5 pCL_Pcj1_metA #11 CJM2 18.3 68.5 O-acetylhomoserine 13.0 pCL_Pcj1_dra metX CJM2 18.5 67.8 O-succinylhomoserine 17.2 pCL_Pcj1_cvi metX

(79) TABLE-US-00014 TABLE 3 Glucose consump- Amount of tion Product product Strain OD (g/L) (g/L) (g/L) CJW2H 42.3 67.7 O-succinylhomoserine 0.9 pCL_Pcj1_metA (wt) CJW2H 45.3 70.0 O-succinylhomoserine 6.5 pCL_Pcj1_metA #11 CJW2H 44.2 70.0 O-acetylhomoserine 4.2 pCL_Pcj1_dra metX CJW2H 43.8 70.0 O-succinylhomoserine 6.2 pCL_Pcj1_cvi metX

(80) As a result, according to Tables 2 and 3, it was confirmed that CJM2 pCL_Pcj1_metA (wt), CJM2 pCL_Pcj1_metA#11, CJW2H pCL_Pcj1_metA (wt), and CJW2H pCL_Pcj1_metA #11 strains, which respectively includes E. coli wild type metA gene and metA#11 gene, which has a feedback resistance, produced O-succinylhomoserine, whereas CJM2 pCL_Pcj1_dra metX and CJW2H pCL_Pcj1_dra metX strains, which respectively includes metX gene derived from Deinococcus radiodurans, produced O-acetylhomoserine.

(81) In the case of the metX gene derived from Chromobacterium Violaceum, the gene has high homology with other metX homologous genes (orthologues) compared to that of metA gene. However, regarding substrate specificity, the gene is homoserine succinyltransferase that produces succinylhomoserine, unlike the metX gene reported in general.

(82) Additionally, in the case when the E. coli wild type metA(wt) gene was introduced, O-succinylhomoserine is produced about 1 g/L due to the phenomenon of feedback inhibition by methionine being added at a concentration of 0.3 g/L to the medium, whereas, in the case when metX gene derived from Chromobacterium Violaceum was introduced, O-succinylhomoserine was produced without the phenomenon of feedback inhibition by methionine added to the medium, even by the wild type itself without any introduction of gene modification.

(83) The CJM2 strain introduced with pCL_Pcj1_cvi metX (CJM2 pCL_Pcj1_cvi metX) was deposited at the Korean Culture Center of Microorganisms (KCCM) located at 361-221, Hongje-1-dong, Seodaemun-gu, Seoul, Korea, which is a subsidiary of the Korean Federation of Culture Collections (KFCC), recognized as an international depositary authority under the Budapest Treaty, on Jun. 20, 2013 under the Accession Number KCCM11433P.

(84) (3) Large Fermenter Culture Experiment

(85) For large-scale production of O-succinylhomoserine, a methionine precursor, using CJM2 pCL_Pcj1_cvi metX and CJW2H pCL_Pcj1_cvi metX strains, a culture was performed in a 5 L fermenter.

(86) An LB plate medium containing a spectinomycin antibiotic was inoculated with CJM2 pCL_Pcj1_cvi metX and CJW2H pCL_Pcj1_cvi metX strains and cultured at 31? C. overnight. Then, single colonies were inoculated into an 10 mL LB medium containing spectinomycin, cultured at 31? C. for 5 hours, and 2 mL of the culture was again inoculated into a 1000 mL Erlenmeyer flask containing 200 mL of a seed medium. Subsequently, the resultant was cultured in a 31? C. incubator at a rate of 200 rpm for 3 hours to 10 hours, and 255 mL of the seed culture was inoculated into 1.7 L of main medium of the 5 L fermenter to consume 1.3 L of the seed medium by fed batch method, and cultured for 50 hours to 100 hours.

(87) The details of the medium components are shown in Table 4 below. The concentration of the thus-cultured fermentation liquid was analyzed via HPLC and the results are shown in Table 5 below.

(88) TABLE-US-00015 TABLE 4 Composition Seed medium Main medium Feed medium Glucose (g/L) 10.1 40 560 MgSO.sub.47H.sub.2O (g/L) 0.5 4.2 Yeast extract (g/L) 10 3.2 KH.sub.2PO.sub.4 3 3 8 Ammonium sulfate 6.3 (g/L) NH.sub.4Cl (g/L) 1 NaCl (g/L) 0.5 Na.sub.2HPO.sub.412H.sub.2O 5.07 (g/L) DL-methionine (g/L) 0.5 0.5 L-isoleucine (g/L) 0.05 0.5 0.5 L-threonine (g/L) 0.5 0.5

(89) TABLE-US-00016 TABLE 5 Amount of O-succinylhomoserine production (g/L) CJM2 68 pCL_Pcj1_cvi metX CJW2H 18 pCL_Pcj1_cvi metX

(90) As shown in Table 5 above, it was confirmed that the CJM2 pCL_Pcj1_cvi metX strain, in which the metX gene derived from Chromobacterium Violaceum was introduced based on the threonine-producing strain as the parent strain, accumulates O-succinylhomoserine at high level.

(91) Those of ordinary skill in the art will recognize that the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The described embodiments are to be considered in all respects only as illustrative and not restrictive. The scope of the present invention is, therefore, indicated by the appended claims rather than by the foregoing description. All changes which come within the meaning and range of equivalency of the claims are to be embraced within the scope of the present invention.