Sophorolipid Highly-Productive Mutant Strain

20190062723 ยท 2019-02-28

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a microorganism exhibiting high production capability for sophorolipids. Disclosed is a yeast mutant strain having high sophorolipid productivity, in which a transporter transporting Acyl-CoA to a peroxisome has been deleted or deactivated.

Claims

1. A sophorolipid-producing yeast mutant strain, in which a transporter transporting Acyl-CoA to a peroxisome has been deleted or deactivated.

2. The mutant strain according to claim 1, wherein the transporter transporting Acyl-CoA to a peroxisome is PXA1, PXA2, or a protein equivalent thereto.

3. The mutant strain according to claim 2, wherein the PXA1 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:2, the PXA2 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:4, the protein equivalent to PXA1 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2, and forming a heterodimer together with PXA2 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome, and the protein equivalent to PXA2 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:4, and forming a heterodimer together with PXA1 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome.

4. The mutant strain according to claim 2, wherein PXA1 gene, PXA2 gene, or a gene equivalent thereto has been deleted or deactivated.

5. The mutant strain according to claim 4, wherein the PXA1 gene is a gene encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO:2, the PXA2 gene is a gene encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO:4, the gene equivalent to PXA1 gene is a gene encoding a protein that forms a heterodimer together with PXA2 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome, and the gene equivalent to PXA2 gene is a gene encoding a protein that forms a heterodimer together with PXA1 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome.

6. The mutant strain according to claim 1, wherein the sophorolipid-producing yeast is a microorganism of the genus Starmerella.

7. A method for producing a sophorolipid-producing yeast mutant strain, the method comprising deleting or deactivating a transporter transporting Acyl-CoA to a peroxisome in a sophorolipid-producing yeast.

8. The method according to claim 7, wherein the transporter transporting Acyl-CoA to a peroxisome is PXA1, PXA2, or a protein equivalent thereto.

9. The method according to claim 8, wherein the PXA1 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:2, the PXA2 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:4, the protein equivalent to PXA1 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2 and forming a heterodimer together with PXA2 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome, and the protein equivalent to PXA2 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:4 and forming a heterodimer together with PXA1 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome.

10. The method according to claim 8, comprising deleting or deactivating PXA1 gene, PXA2 gene, or a gene equivalent thereto.

11. The method according to claim 10, wherein the PXA1 gene is a gene encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO:2, the PXA2 gene is a gene encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO:4, the gene equivalent to PXA1 gene is a gene encoding a protein that forms a heterodimer together with PXA2 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome, and the gene equivalent to PXA2 gene is a gene encoding a protein that forms a heterodimer together with PXA1 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome.

12. The method according to claim 7, wherein the sophorolipid-producing yeast is a microorganism of the genus Starmerella.

13. A method for increasing the sophorolipid production capability of a sophorolipid-producing yeast, the method comprising deleting or deactivating a transporter transporting Acyl-CoA to a peroxisome in a sophorolipid-producing yeast.

14. The method according to claim 13, wherein the transporter transporting Acyl-CoA to a peroxisome is PXA1, PXA2, or a protein equivalent thereto.

15. The method according to claim 14, wherein the PXA1 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:2, the PXA2 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:4, the protein equivalent to PXA1 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2 and forming a heterodimer together with PXA2 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome, and the protein equivalent to PXA2 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:4 and forming a heterodimer together with PXA1 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome.

16. The method according to claim 14, comprising deleting or deactivating PXA1 gene, PXA2 gene, or a gene equivalent thereto.

17. The method according to claim 16, wherein the PXA1 gene is a gene encoding a protein consisting of an amino acid sequence set forth in SEQ ID NO:2, the PXA2 gene is a gene encoding a protein consisting of an amino acid sequence set forth in SEQ ID NO:4, the gene equivalent to PXA1 gene is a gene encoding a protein that forms a heterodimer together with PXA2 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome, and the gene equivalent to PXA2 gene is a gene encoding a protein that forms a heterodimer together with PXA1 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome.

18. The method according to claim 13, wherein the sophorolipid-producing yeast is a microorganism of the genus Starmerella.

19. A method for producing a sophorolipid, the method comprising culturing the sophorolipid-producing yeast mutant strain according to claim 1.

20. The method according to claim 19, wherein a medium for culturing comprises at least one substrate selected from the group consisting of C12-C20 fatty acids and alkyl esters thereof, C12-C20 alkanes, C12-C20 alkenes, C12-C20 alkynes, C12-C20 alcohols, and triacylglycerols, diacylglycerols, monoacylglycerols, and fats or oils, each comprising C12-C20 fatty acids or alkyl esters thereof.

21. The method according to claim 20, wherein a content of the substrate in the medium is from 1% to 30% by mass at the time of initiation of the culturing.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0018] FIG. 1 illustrates an increase in the sophorolipid production capability in a PXA1 gene- or PXA2 gene-deleted Starmerella bombicola mutant strain. pxa1: pxa1 mutant strain, pxa2: pxa2 mutant strain, PE: ethyl palmitate, SL: sophorolipid. Error bar=standard deviation (n=3).

[0019] FIG. 2 illustrates the amounts of various sophorolipids produced in Starmerella bombicola mutant strains. fox2:fox2 mutant strain, pxa1:pxa1 mutant strain. The term C12 to C18 represents sophorolipids having constituent fatty acid chain lengths of C12 to C18, respectively. Error bar=standard deviation (n=3).

DETAILED DESCRIPTION OF THE INVENTION

[0020] The present invention relates to a yeast mutant strain capable of producing sophorolipids with high efficiency, and a method for producing a sophorolipid using the yeast mutant strain.

1. Definition

[0021] According to the present specification, the identity of nucleotide sequences and amino acid sequences is calculated according to the Lipman-Pearson method (Science, 1985, 227:1435-1441). Specifically, the identity is calculated by performing an analysis using the homology analysis program (Search Homology) of genetic information processing software, Genetyx-Win (Ver. 5.1.1; Software Development), with the unit size to compare (ktup) being set to 2.

[0022] According to the present specification, the phrase at least 80% identity in connection with nucleotide sequences and amino acid sequences means identity of 80% or higher, preferably 85% or higher, more preferably 90% or higher, evenmore preferably 95% or higher, even more preferably 98% or higher, even more preferably 99% or higher.

[0023] According to the present specification, sophorolipid-producing yeast refers to a yeast having an capability to produce sophorolipids. Examples of the sophorolipid-producing yeast include Ascomycetes such as the genus Starmerella, the genus Candida, and the genus Wickerhamiella, and preferred examples include Starmerella bombicola, Candida bogoriensis, Candida batistae, Candida apicola, and Wickerhamiella domericqiae. A more preferred example may be Starmerella bombicola.

2. Sophorolipid-Producing Yeast Mutant Strain

[0024] The inventors of the present invention found that a sophorolipid-producing yeast in which a transporter transporting Acyl-CoA to a peroxisome has been deleted or deactivated, increases the sophorolipid production capability of the yeast.

[0025] The present inventionprovides a yeast mutant strainhaving high sophorolipid production capability. According to the yeast mutant strain of the present invention, sophorolipids having constituent fatty acids with various chain lengths can be produced efficiently.

[0026] The sophorolipid-producing yeast mutant strain of the present invention is a mutant strain in which a transporter transporting Acyl-CoA to a peroxisome has been deleted or deactivated. Preferably, the sophorolipid-producing yeast mutant strain of the present invention is a mutant strainproduced by deleting or deactivating a transporter transporting Acyl-CoA to a peroxisome in a sophorolipid-producing yeast through artificial modification.

[0027] Preferably, the yeast mutant strain of the present invention, in which a transporter transporting Acyl-CoA to a peroxisome has been deleted or deactivated, is a mutant strain in which the activity of the transporter (that is, activity of transporting Acyl-CoA to a peroxisome) has been reduced or lost, as compared to the strain before mutation (parent strain). For example, in the mutant strain of the present invention, expression of the transporter is suppressed, or the transporter activity of the expressed protein has been reduced or lost.

[0028] Examples of the transporter transporting Acyl-CoA to a peroxisome in a sophorolipid-producing yeast include PXA1, PXA2, and proteins equivalent to those. Therefore, according to an embodiment, the mutant strain of the present invention may be a mutant strain in which the amount of any one of the transporter proteins expressed has been decreased to be 50% or less, preferably 40% or less, more preferably 30% or less, even more preferably 20% or less, even more preferably 10% or less, even more preferably 5% or less, as compared to the parent strain. The amount of a protein expressed can be measured by a conventionally used method for quantitatively determining the expression of a protein, for example, bymeasurement of the amount of mRNA through quantitative PCR, a colorimetric determination method, a fluorescence method, Western blotting, ELISA, or radioimmunoassay, without being limited to these.

[0029] According to the present specification, PXA1 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:2. According to the present specification, PXA2 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:4.

[0030] According to the present specification, a protein equivalent to PXA1 refers to a protein that consists of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO: 2, and forms a heterodimer together with PXA2 or a protein equivalent thereto to thereby work as a transporter transporting Acyl-CoA to a peroxisome.

[0031] According to the present specification, a protein equivalent to PXA2 refers to a protein that consists of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO: 4, and forms a heterodimer together with PXA1 or a protein equivalent thereto to thereby work as a transporter transporting Acyl-CoA to a peroxisome.

[0032] Examples of means for deletion or deactivation of the transporter include a method of deleting or deactivating a gene encoding the transporter. This method brings reduction or loss of the activity of transporting Acyl-CoA to a peroxisome in yeast by suppressing the amount of the expressed transporter protein, or by changing the activity of the expressed protein.

[0033] Therefore, according to an embodiment, the sophorolipid-producing yeast mutant strain of the present invention is a mutant strain in which a gene encoding a transporter that transports Acyl-CoA to a peroxisome has been deleted or deactivated. According to a preferred embodiment, the sophorolipid-producing yeast mutant strain of the present invention is a mutant strain in which PXA1 gene, PXA2 gene, or a gene equivalent thereto has been deleted or deactivated.

[0034] According to the present specification, PXA1 gene is a gene that encodes PXA1 protein consisting of the amino acid sequence set forth in SEQ ID NO: 2. PXA1 gene may be the nucleotide sequence set forth in SEQ ID NO: 1, a complementary strand thereof, or a gene consisting of DNA composed of those. Furthermore, according to the present specification, PXA2 gene is a gene that encodes PXA2 protein consisting of the amino acid sequence set forth in SEQ ID NO:4. PXA2 gene may be the nucleotide sequence set forth in SEQ ID NO:3, a complementary strand thereof, or a gene consisting of DNA composed of those.

[0035] A gene equivalent to PXA1 gene is a gene encoding a protein that forms a heterodimer together with PXA2 or a protein equivalent thereto to thereby work as a transporter transporting Acyl-CoA to a peroxisome. The gene equivalent to PXA1 gene may be a nucleotide sequence having at least 80% identity with the nucleotide sequence set forth in SEQ ID NO:1, a complementary strand thereof, or a gene consisting of DNA composed of those.

[0036] A gene equivalent to PXA2 gene is a gene encoding a protein that forms a heterodimer together with PXA1 or a protein equivalent thereof to thereby work as a transporter transporting Acyl-CoA to a peroxisome. The gene equivalent to PXA2 gene may be a nucleotide sequence having at least 80% identity with the nucleotide sequence set forth in SEQ ID NO:3, a complementary strand thereof, or a gene consisting of DNA composed of those.

[0037] Examples of means for deleting or deactivating a gene of a yeast cell include introduction of mutation (deletion, insertion, substitution, or addition) to one or more nucleotides on the nucleotide sequence of the target gene, substitution or insertion of another nucleotide sequence into the nucleotide sequence, or deletion of a portion or the entirety of the nucleotide sequence. Alternatively, similar introduction of mutation, or similar substitution, insertion or deletion of a nucleotide sequence may also be carried out with regard to the promoter region of the target gene.

[0038] Regarding a specific technique for the introduction of mutation or the substitution, insertion or deletion of a nucleotide sequence, a method for genetic modification of a microorganism that is known in the pertinent art can be used. Examples of the method include, but are not limited to, ultraviolet irradiation, introduction of a site-specific mutation, and homologous recombination method using the SOE-PCR method (splicing by overlap extension PCR; Gene, 1989, 77:61-68).

[0039] After the introduction of mutation, or the substitution, insertion or deletion of a nucleotide sequence, a genetic analysis is carried out, or the amount of an expressed protein encoded by the target gene or the activity thereof is evaluated, and cells having a desired mutation are selected, to thereby obtain the mutant strain of the present invention.

[0040] Alternatively, in a case where the means for deleting or deactivating a gene is the homologous recombination method using SOE-PCR, a mutant strain having the target gene deleted therefrom can be obtained by incorporating a drug resistance marker gene into a DNA fragment for gene deletion that substitutes the target gene DNA, culturing, on a medium including a drug, cells into which the DNA fragment for deletion has been introduced, and isolating growing colonies. Furthermore, mutation may also be checked by carrying out the genetic analysis or evaluating the amount of the protein expressed or activity of the protein as described above. By following the procedure described above, the yeast mutant strain of the present invention in which a gene that encodes a transporter transporting Acyl-CoA to a peroxisome has been deleted or deactivated can be obtained.

3. Increase of Sophorolipid Production Capability in Mutant Strain

[0041] The sophorolipid-producing yeast mutant strain of the present invention that has been produced by deletion or deactivation of a transporter transporting Acyl-CoA to a peroxisome as described above, has increased sophorolipid production capability, as compared to the strain before mutation (parent strain). Therefore, an embodiment of the present invention can be a method for increasing the sophorolipid production capability of a sophorolipid-producing yeast, the method comprising deleting or deactivating a transporter transporting Acyl-CoA to a peroxisome in a sophorolipid-producing yeast.

4. Production of Sophorolipids

[0042] The sophorolipid-producing yeast mutant strain of the present invention has increased sophorolipid production capability. Furthermore, the sophorolipid-producing yeast mutant strain of the present invention can produce sophorolipids using, for example, hydrocarbon chains and fatty acids having various chain lengths as substrates. Therefore, when the sophorolipid-producing yeast mutant strain of the present invention is cultured together with a substrate having an appropriate chain length, theyeastmutant strain can efficiently produce a sophorolipid including a constituent fatty acid having a desired chain length. Therefore, the present invention also provides a method for producing a sophorolipid, the method comprising culturing the sophorolipid-producing yeast mutant strain of the present invention.

[0043] In the method for producing a sophorolipid of the present invention, the mutant strain of the present invention is cultured in a medium including substrates such as a fatty acid, a fatty acid alkyl ester, an alkane, an alkene, an alkyne, an alcohol, a triacylglycerol, a diacylglycerol, a monoacylglycerol, and a fat or oil. Sophorolipids are collected from the medium after culturing and are appropriately purified as necessary, and thereby sophorolipids can be produced.

[0044] Regarding the medium used for the culture, any conventional medium containing a carbon source, a nitrogen source, an inorganic salt, and if necessary, organic trace nutrients such as amino acids and vitamins, can be used. The medium may be any of a synthetic medium and a natural medium.

[0045] The carbon source and the nitrogen source included in the medium may be any type of material that can be utilized by the mutant strain to be cultured. Examples of the carbon source include saccharides such as glucose, glycerol, fructose, sucrose, maltose, mannose, galactose, starch hydrolysate, and malt; organic acids such as acetic acid and citric acid; and alcohols such as ethanol. These carbon sources can be used singly or in combination of two or more kinds thereof. Examples of the nitrogen source include ammonia; ammonium salts such as ammonium sulfate, ammonium carbonate, ammonium chloride, ammonium phosphate, and ammonium acetate; and nitrates.

[0046] Examples of the inorganic salt include phosphates, magnesium salts, calcium salts, iron salts, and manganese salts. Examples of the organic trace nutrients include amino acids, vitamins, fatty acids, nucleic acids, and peptones, casamino acids, yeast extracts and soybean protein degradation products that contain the amino acids, vitamins, fatty acids and nucleic acids. Ina case where an auxotrophic mutant strain that requires, for example, amino acids for growth is used, it is preferable that the required nutrients are added as supplements.

[0047] Preferred examples of the substrate that can be incorporated into the medium include C12-20 fatty acids and alkyl esters thereof, C12-20 alkanes, C12-20 alkenes, C12-20 alkynes, C12-20 alcohols; triacylglycerols, diacylglycerols and monoacylglycerols, each containing C12-20 fatty acids or alkyl esters thereof; and fats or oils containing C12-20 fatty acids or alkyl esters thereof. More preferred examples include C12-18 fatty acids and alkyl esters thereof, C12-18 alkanes, C12-18 alkenes, C12-18 alkynes, C12-18 alcohols; triacylglycerols, diacylglycerols and monoacylglycerols, each containing C12-C18 fatty acids or alkyl esters thereof; and fats or oils containing C12-C18 fatty acids or alkyl esters thereof. Even more preferred examples include C12-C18 fatty acids and alkyl esters thereof.

[0048] More specific examples of the substrate, which are not limited, include, as the C12-20 fatty acids, dodecanoic acid (lauric acid), tridecanoic acid, tetradecanoic acid (myristic acid), pentadecaonic acid (pentadecyl acid), hexadecanoic acid (palmitic acid), hexadecenoic acid, heptadecanoic acid (margaric acid), octadecanoic acid (stearic acid), octadecenoic acid, octadecadienoic acid, octadecatrienoic acid, nonadecanoic acid, eicosanoic acid, eicosadienoic acid, eicosatrienoic acid, and eicosatetraenoic acid; as the C12-20 alkanes, alkenes, alkynes and alcohols, dodecane, tridecane, tetradecane, pentadecane, hexadecane, hexadecene, heptadecane, octadecane, octadecene, octadecyne, nonadecane, eicosane, eicosene, eicosyne, dodecanol, tridecanol, tetradecanol, pentadecanol, hexadecanol, hexadecenal, heptadecanol, octadecanol, octadecenol, octadecynol, nonadecanol, and eicosanol; and as the fats or oils containing C12-20 fatty acids or alkyl esters thereof, coconut oil, palm oil, palm kernel oil, olive oil, rapeseed oil, rice bran oil, soybean oil, castor oil, and mahua oil.

[0049] Examples of the fatty acid alkyl esters include alkyl esters of the fatty acids mentioned above wherein the alkyl moiety has 1 to 4 carbon atoms, and preferred examples include methyl esters and ethyl esters.

[0050] The substrates mentioned above can be used singly or in combination of two or more kinds thereof. Preferably, a fatty acid having any chain length between C12 and C18; an alkyl ester thereof; a triacylglycerol, a diacylglycerol, a monoacylglycerol, or fats or oils, each containing the fatty acid or an alkyl ester thereof, or an alkane, an alkene, an alkyne, or an alcohol, each having any chain length between C12 and 18, is used. More preferably, a fatty acid having any chain length between C12 and C18, or an alkyl ester thereof is used.

[0051] The content of the substrate (at the time of initiation of culturing) that can be included in the medium is preferably 1% by mass or more, more preferably 3% by mass or more, even more preferably 5% by mass or more, and is preferably 30% by mass or less, more preferably 20% by mass or less, even more preferably 15% by mass or less. Alternatively, the content is preferably from 1% to 30% by mass, from 1% to 20% by mass, from 1% to 15% by mass, from 3% to 30% by mass, from 3% to 20% by mass, from 3% to 15% by mass, from 5% to 30% by mass, from 5% to 20% by mass, or from 5% to 15% by mass.

[0052] The culture conditions may be any conditions in which sophorolipids are fermentatively produced by the mutant strain of the present invention. Culturing is preferably carried out under aerobic conditions, and general methods such as aerated and agitated culture and shaking culture can be applied. The culturing temperature is preferably from 20 C. to 33 C., more preferably from 25 C. to 30 C., even more preferably from 28 C. to 30 C. The initial pH (30 C.) of the medium is preferably from 2 to 7, more preferably from 3 to 6. The culturing time is preferably about from 24 hours to 200 hours, more preferably from 50 to 200 hours.

[0053] In regard to the culturing described above, sophorolipids may be produced fermentatively by culturing the mutant strain of the present invention under the conditions that enables proliferation of cells, and sophorolipids may also be produced fermentatively by culturing the mutant strain of the present invention in the state of a resting cell, that is, in a state in which growth and proliferation has been stopped.

[0054] The method of collecting sophorolipids from the medium after culturing is not particularly limited, and collection may be performed according to any known collecting method. For example, the sophorolipids in the medium can be collected or purified by performing, for example, solvent extraction using, for example, ethyl acetate, fractional precipitation, liquid-liquid partition, column chromatography, high performance liquid chromatography, singly or in appropriate combination.

5. Exemplary Embodiments

[0055] As exemplary embodiments of the present invention, for example, the following substances, production methods, use, and methods will be further disclosed in the present specification. However, the present invention is not intended to be limited to these embodiments.

[0056] [1] A sophorolipid-producing yeast mutant strain, in which a transporter transporting Acyl-CoA to a peroxisome has been deleted or deactivated.

[0057] [2] The mutant strain according to [1], wherein the transporter transporting Acyl-CoA to a peroxisome is preferably PXA1, PXA2, or a protein equivalent thereto.

[0058] [3] The mutant strain according to [2], wherein preferably, the PXA1 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:2,

[0059] the PXA2 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:4,

[0060] the protein equivalent to PXA1 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2, and forming a heterodimer together with PXA2 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome, and

[0061] the protein equivalent to PXA2 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:4, and forming a heterodimer together with PXA1 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome.

[0062] [4] The mutant strain according to [2] or [3], wherein preferably, PXA1 gene, PXA2 gene, or a gene equivalent thereto has been deleted or deactivated.

[0063] [5] The mutant strain according to [4], wherein preferably,

[0064] the PXA1 gene is a gene encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO:2,

[0065] the PXA2 gene is a gene encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO:4,

[0066] the gene equivalent to PXA1 gene is a gene encoding a protein that forms a heterodimer together with PXA2 or a protein equivalent thereto to thereby work as a transporter transporting Acyl-CoA to a peroxisome, and

[0067] the gene equivalent to PXA2 gene is a gene encoding a protein that forms a heterodimer together with PXA1 or a protein equivalent thereto to thereby work as a transporter transporting Acyl-CoA to a peroxisome.

[0068] [6] The mutant strain according to any one of [1] to [5], wherein

[0069] the sophorolipid-producing yeast is preferably a microorganism of the genus Starmerella, more preferably Starmerella bombicola.

[0070] [7] The mutant strain according to any one of [1] to [6], wherein the mutant strain has increased sophorolipid productivity, as compared to the strain before mutation.

[0071] [8] A method for producing a sophorolipid-producing yeast mutant strain, the method comprising deleting or deactivating a transporter transporting Acyl-CoA to a peroxisome in a sophorolipid-producing yeast.

[0072] [9] A method for increasing the sophorolipid production capability of a sophorolipid-producing yeast, the method comprising deleting or deactivating a transporter transporting Acyl-CoA to a peroxisome in a sophorolipid-producing yeast.

[0073] [10] The method according to [8] to [9], wherein the transporter transporting Acyl-CoA to a peroxisome is preferably PXA1, PXA2, or a protein equivalent thereto.

[0074] [11] The method according to [10], wherein preferably, the PXA1 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:2,

[0075] the PXA2 is a protein consisting of the amino acid sequence set forth in SEQ ID NO:4,

[0076] the protein equivalent to PXA1 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:2, and forming a heterodimer together with PXA2 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome, and

[0077] the protein equivalent to PXA2 is a protein consisting of an amino acid sequence having at least 80% identity with the amino acid sequence set forth in SEQ ID NO:4and forming a heterodimer together with PXA1 or a protein equivalent thereto to work as a transporter transporting Acyl-CoA to a peroxisome.

[0078] [12] The method according to [10] or [11], preferably comprising deleting or deactivating PXA1 gene, PXA2 gene, or a gene equivalent thereto.

[0079] [13] The method according to [12], wherein preferably,

[0080] the PXA1 gene is a gene encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO:2,

[0081] the PXA2 gene is a gene encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO:4,

[0082] the gene equivalent to PXA1 gene is a gene encoding a protein that forms a heterodimer together with PXA2 or a protein equivalent thereto, to thereby work as a transporter transporting Acyl-CoA to a peroxisome, and

[0083] the gene equivalent to PXA2 gene is a gene encoding a protein that forms a heterodimer together with PXA1 or a protein equivalent thereto, to thereby work as a transporter transporting Acyl-CoA to a peroxisome.

[0084] [14] Themethodaccordingtoanyoneof [8] to [13],wherein

[0085] the sophorolipid-producing yeast is preferably a microorganism of the genus Starmerella, more preferably Starmerella bombicola.

[0086] [15] A method for producing a sophoroliplid, the method comprising culturing the sophorolipid-producing yeast mutant strain according to any one of [1] to [7].

[0087] [16] The method according to [15], wherein a medium for the culturing preferably comprises the following substrate:

[0088] at least one substrate selected from the group consisting of C12-C20 fatty acids and alkyl esters thereof, C12-C20 alkanes, C12-C20 alkenes, C12-C20 alkynes, C12-C20 alcohols, triacylglycerols, diacylglycerols and monoacylglycerols each of which comprises C12-C20 fatty acids or alkyl esters thereof, and fats or oils comprising C12-C20 fatty acids or alkyl esters thereof;

[0089] at least one substrate selected from the group consisting of C12-C18 fatty acids and alkyl esters thereof, C12-C18 alkanes, C12-C18 alkenes, C12-C18 alkynes, C12-C18 alcohols, triacylglycerols, diacylglycerols and monoacylglycerols each of which comprises C12-C18 fatty acids or alkyl esters thereof, and fats or oils comprising C12-C18 fatty acids or alkyl esters thereof; or

[0090] at least one substrate selected from the group consisting of C12-18 fatty acids and alkyl esters thereof.

[0091] [17] The method according to [16], wherein the content of the substrate in the medium is:

[0092] preferably 1% by mass or more, more preferably 3% by mass or more, even more preferably 5% by mass or more, and is preferably 30% by mass or less, more preferably 20% by mass or less, even more preferably 15% by mass or less, or

[0093] preferably from 1% to 30% bymass, from 1% to 20% by mass, from 1% to 15% by mass, from 3% to 30% by mass, from 3% to 20% by mass, from 3% to 15% by mass, from 5% to 30% by mass, from 5% to 20% by mass, or from 5% to 15% by mass.

[0094] [18] The method according to anyone of [15] to [17], wherein the method further comprises collecting sophorolipids from the medium after the culturing.

EXAMPLES

[0095] Hereinafter, the present invention will be more specifically described by way of Examples.

Example 1

Production of Gene-Deleted Mutant Strain

[0096] (1) Establishment of Fragment for Gene Deletion

[0097] Mutant strains having PXA1 gene, PXA2 gene, or FOX2 gene deleted therefrom were produced by a homologous recombination method using the SOE-PCR method.

[0098] A hygromycin-resistant gene (SEQ ID NO:5) was used for the selection of transformant. A hygromycin-resistant gene fragment was produced by PCR using plasmid loxP-PGK-gb2-hygro-loxP (Gene Bridges) having a hygromycin-resistant gene as a template, and using primers of SEQ ID NO:18 and SEQ ID NO:19. Fragments of a promoter and a terminator of URA3 gene were produced by PCR using the genome of Starmerella bombicola as a template, and using primers of SEQ ID NO:20 and SEQ ID NO:21, and primers of SEQ ID NO:22 and SEQ ID NO:23, respectively. The hygromycin-resistant gene fragment was ligated to the promoter fragment and the terminator fragment of URA3 gene by SOE-PCR.

[0099] A fragment for deleting PXA1 gene, PXA2 gene or FOX2 gene was produced. Using the genome of Starmerella bombicola as a template, fragments in the upstream region of each gene were produced by PCR using primers of SEQ ID NO:6 and SEQ ID NO:7, primers of SEQ ID NO:8 and SEQ ID NO:9, and primers of SEQ ID NO:10 and SEQ ID NO:11, respectively, while fragments in the downstream region of each gene were produced by PCR using primers of SEQ ID NO:12 and SEQ ID NO:13, primers of SEQ ID NO:14 and SEQ ID NO:15, and primers of SEQ ID NO:16 and SEQ ID NO:17, respectively. Furthermore, a hygromycin-resistant gene fragment including the promoter fragment and the terminator was produced by PCR using the SOE-PCR product as a template, and using primers of SEQ ID NO:20 and SEQ ID NO:23. Three fragments, namely, the thus-obtained upstream region fragment and the downstream region fragment of each gene and the hygromycin-resistant gene fragment, were ligated by SOE-PCR. The fragments thus obtained were respectively used as fragments for deletion of PXA1 gene, PXA2 gene, and FOX2 gene.

TABLE-US-00001 TABLE1 SEQ Primer IDNO. name Sequence(5.fwdarw.3) 6 pxa1upFw ATTTTGGAGAGTTTGTGACTGCTTTATCAA 7 pxa1upRv GTTGCGAGCTGTTTCGAAAATTACACTATC ATCCGGAGCGTGTGGGGTCA 8 pxa2upFw GGCATCAATTAATCACAACTAGCTTTCTCG 9 pxa2upRv GTTGCGAGCTGTTTCGAAAATTGAACTAAA GTTCTCCGTGCAGATATTTG 10 fox2upFw CTGAATTCTCCTAAGCATTTAACTGCCTTG 11 fox2upRv GTTGCGAGCTGTTTCGAAAAGTTTCACTTT CCCTTCTTGTATTTTCAATG 12 pxa1doFw tgtatagtgacgatgatgaaTTTGGCTACA ACTACCATCAGGGTCGTTAG 13 pxa1doRv TGAGATGACACACGTGACATGTCGATCCTA 14 pxa2doFw tgtatagtgacgatgatgaaCGATCTTGCG AACGCTAAAACCAGTAGTTT 15 pxa2doRv TAGCGCAGAGCAGTATGCCCCCTTCTTCCC 16 fox2doFw tgtatagtgacgatgatgaaCGGAGAAGCT ATATAGTTAAATAAATAAGA 17 fox2doRv ATGCATAATGTGCGCTTCCGCTCTGAGACA 18 Hyg-fw CACTACTGTAGAGAAATAATATGAAAAAGC CTGAACTCAC 19 Hyg-re GAAGGAACTGTTTGAGAAAATTATGAACAA ACGACCCAAC 20 pURA3-fw TTTTCGAAACAGCTCGCAACGATC 21 pUra3-re GTGAGTTCAGGCTTTTTCATATTATTTCTC TACAGTAGTG 22 tURA3-fw GTTGGGTCGTTTGTTCATAATTTTCTCAAA CAGTTCCTTC 23 tURA3-re TTCATCATCGTCACTATACACATC

[0100] (2) Production of Gene Deletion Strain

[0101] One platinum loop of Starmerella bombicola was inoculated into a 100-mL type test tube containing 5 mL of YPD Broth, and the cells were cultured for 48 hours at 30 C. and 250 rpm. The culture fluid thus obtained was inoculated in an amount of 1% (v/v) into a Sakaguchi flask containing 50 mL of YPD medium, and the cells were cultured at 30 C. and 120 rpm until an OD600 value of 1 to 2 was obtained. The proliferated cells were centrifuged for 5 minutes at 3,000 rpm and 4 C. to collect the cells, and then the cells were washed twice with 20 mL of sterilized water that had been chilled on ice. The cells were suspended in 1 mL of an ice-cooled 1 M sorbitol solution, and the suspension was centrifuged for 5 minutes at 5,000 rpm and 4 C. The supernatant was discarded, subsequently 400 L of a 1 M sorbitol solution was added to the residue, the mixture was placed on ice, and the mixture was suspended by pipetting. This yeast suspension was dispensed into 50 L each, and 1 g of a DNA solution for transformation (including the fragment for deletion of PXA1 gene, PXA2 gene, or FOX2 gene) was added to the yeast suspension. The mixture was transferred into an ice-cooled chamber having a 0.2 cm gap. Subsequently, a pulse of 25 F, 350, and 2.5 kV was applied to the mixture using a GENE PULSER II (Bio-Rad). An ice-cooled 1 M sorbitol-containing YPD Broth was added to the mixture to which a pulse had been applied, the mixture was transferred into a tube having a capacity of 1.5 mL, and the mixture was shaken for 2 hours at 30 C. Subsequently, the mixture was centrifuged for 5 minutes at 5,000 rpm and 4 C., to thereby collect the cells. The cells thus collected were resuspended in 200 L of a 1 M sorbitol solution, 100 L each of the suspension was smeared on a selective medium, and the cells were cultured for about one week at 30 C. For the selective medium, an agar medium containing 1% (w/v) of anyeast extract, 2% (w/v) of peptone, 2% (w/v) of glucose, and 500 ppm of hygromycin was used. Colonies that had grown were subjected to colony PCR, it was confirmed that the sequence length amplified from the region of each deletion target gene was changed, and thus mutant strains having PXA1 gene, PXA2 gene, or FOX2 gene deleted therefrom (pxa1 mutant strain, pxa2 mutant strain, and fox2 mutant strain) were obtained.

Example 2

Sophorolipid Productivity of pxa1 Mutant Strain and pxa2 Mutant Strain

[0102] (1) Culture of Mutant Strains

[0103] 5 mL of a medium containing 1% (w/v) of a yeast extract that had been sterilized in advance, 2% (w/v) of peptone, and 2% (w/v) of glucose was introduced into a large-sized test tube, and one platinum loop of any one of the pxa1 mutant strain and pxa2 mutant strain obtained in Example 1 as well as the parent strain thereof was inoculated into the medium. The cells were subjected to shaking culture for 48 hours at 30 C. and 250 rpm, and this was used as a seed culture fluid. The seed culture fluid was inoculated at a concentration of 1% (v/v) into 5 mL of a mixed medium containing, 2% (w/v) of a yeast extract, 5% (w/v) of a fatty acid ester, and 12.5% (w/v) of glucose, and shaking culture was carried out for 96 hours at 30 C. and 250 rpm. Ethyl palmitate was used as the fatty acid ester.

[0104] (2) Evaluation of Sophorolipid Productivity

[0105] After completion of the culturing, ethyl palmitate (PE) and sophorolipids (SL) in the culture fluid were extracted, and the amounts thereof were measured. For the extraction of PE, first, the entire amount of the culture fluid in the large-sized test tube cultured in section (1) was transferred into a Falcon tube (Greiner), subsequently 4 mL of hexane was added to the large-sized test tube and stirred by vortexing for 5 seconds, and the entire amount was transferred to the same Falcon tube. The liquids were thoroughly mixed by vortexing for 5 seconds, and subsequently the liquid was centrifuged for 5 minutes at 3,000 rpm and 25 C. The entire amount of the hexane fraction of the supernatant was collected into a glass tube using a Pasteur pipette. Hexane extraction as described above was repeated once for the remaining liquid, and thereby the entire amount of PE was extracted. For the extraction of SL, 4 mL of ethyl acetate was added to the large-sized test tube that had been used for culturing in section (1), the mixture was vortexed for 5 seconds, and the entire amount was collected into a Falcon tube. Subsequently, the liquid was centrifuged for 5 minutes at 3,000 rpm and 25 C., and the entire amount of the ethyl acetate fraction of the supernatant was collected into a fresh glass tube using a Pasteur pipette. The above-described ethyl acetate extraction was repeated once for the remaining liquid, and thereby, the entire amount of SL was collected.

[0106] Hexane or ethyl acetate was volatilized from the hexane fraction or the ethyl acetate fraction thus collected, by spraying nitrogen gas, and thus dissolved PE or SL was extracted. The difference between the weight of the glass tube containing PE or SL thus extracted, and the weight of the glass tube before collection, was calculated as the amount of PE or the amount of SL in the culture fluid.

[0107] The result is presented in FIG. 1. The relative values of sophorolipid productivity of each mutant strain in the case of designating the sophorolipidproductivity of the parent strain as 100%, are presented in Table 2. The mutant strains with deleted PXA1 gene or PXA2 gene showed increased sophorolipid productivity, as compared to the parent strain.

TABLE-US-00002 TABLE 2 Relative amount of SL produced Parent strain 100% pxa1 126% pxa2 112%

Example 3

Comparison of Sophorolipid Productivity between pxa1 Mutant Strain and fox2 Mutant Strain

[0108] pxa1 mutant strain, fox2 mutant strain, and their parent strain were cultured by a procedure similar to that of Example 2, and the amounts of fatty acid ester and sophorolipids in the culture fluid were measured. However, the culturing time in the mixed medium containing a fatty acid ester was changed to 72 hours, and ethyl laurate (C12), ethyl myristate (C14), ethyl palmitate (C16), or ethyl stearate (C18) was used as the fatty acid ester.

[0109] The result is presented in FIG. 2. Furthermore, the relative values of sophorolipid productivity of fox2 mutant strain and pxa1 mutant strain obtained in a case in which the sophorolipid productivity of the parent strain obtained by using the fatty acids having each chain length as substrates, was designated as 100%, are presented in Table 3.

[0110] It has been reported that the productivity for medium-chain sophorolipids is increased by destruction of FOX2 gene, which is related to the -oxidation metabolism of yeast (Non Patent Literature 3 and Patent Literature 3). In this Example as well, the fox2 mutant strain exhibited increased sophorolipid productivity, as compared to the parent strain, when C12 and C14 fatty acids were used as substrates. However, when C16 and C18 fatty acids were used as substrates, the sophorolipid productivity was decreased, as compared to that of the parent strain. On the other hand, the pxa1 mutant strain of the present invention showed even higher sophorolipid productivity than that of the fox2 mutant strain when C12 and C14 fatty acids were used as substrates. Furthermore, the pxa1 mutant strain showed increased sophorolipid productivity, as compared to the parent strain, even in the case of using any of C12, C14, C16, and C18 fatty acids as the substrate.

TABLE-US-00003 TABLE 3 Substrate carbon chain length C12 C14 C16 C18 Parent strain 100% 100% 100% 100% fox2 strain 268% 123% 32% 36% pxa1 strain 360% 188% 112% 112%