HIGHLY FUNCTIONAL HEPATOCYTE AND USE THEREOF
20190062699 ยท 2019-02-28
Assignee
Inventors
Cpc classification
C12N2506/45
CHEMISTRY; METALLURGY
C12N5/0671
CHEMISTRY; METALLURGY
C12N5/10
CHEMISTRY; METALLURGY
A61L27/3804
HUMAN NECESSITIES
C12N5/0696
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2760/18843
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
A61K31/573
HUMAN NECESSITIES
International classification
Abstract
The object is to obtain a highly functional hepatocyte that has a high ammonia-metabolizing function and is theoretically able to infinitely proliferate from a human iPS cell. There is provided a method for preparing an artificial hepatocyte comprising the following steps: the differentiation induction step 1 of culturing an iPS cell in a differentiation induction medium I containing activin A; the differentiation induction step 2 of culturing a cell obtained in the differentiation induction step 1 in a differentiation induction medium II containing bone morphogenetic protein 4 (BMP4) and fibroblast growth factor 2 (FGF2); and the differentiation induction step 3 of culturing a cell obtained in the differentiation induction step 2 in a differentiation induction medium III containing hepatocyte growth factor (HGF), oncostatin M, dexamethasone, and N,N-(methylenebis)(4,1-phenylene)diacetamide (FH1) and/or 2-([N-(5-chloro-2-methylphenyl)(methylsulfonamido)-N-(2,6-difluorophenyl)acetamide (FPH1) to obtain an artificial hepatocyte. The obtained artificial hepatocyte has an ammonia-metabolizing function of 100 ?g/dl/24 h or higher, and can constitute a mesh structure.
Claims
1. An artificial hepatocyte having an ammonia-metabolizing function of 100 ?g/dl/24 h or higher and able to constitute, a mesh structure.
2. The artificial hepatocyte according to claim 1, which can be cultured in a serum-free and feeder-free environment.
3. The artificial hepatocyte according to claim 1, which has been induced from an artificial pluripotent stem (iPS) cell.
4. The artificial hepatocyte according to claim 3, wherein the iPS cell has been produced by using a Sendai virus vector.
5. A method for preparing an artificial hepatocyte comprising the following steps: the differentiation induction step 1 of culturing an iPS cell in a differentiation induction medium I containing activin A, the differentiation induction step 2 of culturing a cell obtained in the differentiation induction step 1 in a differentiation induction medium II containing bone morphogenetic protein 4 (BMP4) and fibroblast growth factor 2 (FGF2); and the differentiation induction step 3 of culturing a cell obtained in the differentiation induction step 2 in a differentiation induction medium III containing hepatocyte growth factor (HGF), oncostatin M, dexamethasone, and N,N-(methylenebis)(4,1-phenylene)diacetamide (FH1) and/or 2-([N-(5-chloro-2-methylphenyl)(methylsulfonamido)-N-(2,6-difluorophenyl)acetamide (FPH1) to obtain an artificial hepatocyte.
6. The preparation method according to claim 5, wherein the iPS cell has been produced by using a Sendai virus vector.
7. The preparation method according to claim 5, wherein the differentiation induction medium III contains FH1 and FPH1.
8. The preparation method according to claim 5, wherein the differentiation induction steps 1 to 3 are performed in a serum-free and feeder-free environment.
9. The preparation method according to claim 5, wherein the differentiation induction step 1 and the differentiation induction step 2 are performed for 2 to 14 days in total, and the differentiation induction step 3 is performed for 2 to 14 days.
10. A hybrid artificial liver containing the artificial hepatocyte according to claim 1.
11. The hybrid artificial liver according to claim 10, which uses at least 10.sup.9 of the artificial hepatocytes.
12. An artificial hepatocyte obtained by the preparation method according to claim 5.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0027] [
[0028] [
[0029] [
[0030] [
[0031] [
[0032] [
[0033] [
[0034] [
[0035] [
MODES FOR CARRYING OUT THE INVENTION
[0036] Numerical value ranges indicated as X to Y include the values of X and Y as the maximum and minimum values, unless especially indicated. The expression A and/or B means at least one of A and B, unless especially indicated.
<Artificial Hepatocyte>
[0037] The present invention provides an artificial hepatocyte having a high ammonia-metabolizing function and able to constitute a mesh structure.
[Mesh Structure]
[0038] The expression able to constitute a mesh structure used fix the characteristics of the cell means that when the objective cell is cultured under appropriate conditions, a predetermined mesh structure is constituted. The mesh structure is constituted if the cells are inoculated in a culture vessel, which may be coated with an extracellular matrix (ECM) such as Matrigel (registered trademark), hyaluronic acid, heparin, fibronectin, laminin, vitronectin, or other ECM as required, at an appropriate density, and cultured for several days using an appropriate medium. The mesh structure comprises string portions having a thickness corresponding to a width of at least one cell to 1000 ?m (more specifically, a width of several cells to 500 ?m, further specifically 20 to 250 ?m), and voids having a circular shape, elliptical shape, or the like. The diameters of the voids are typically 100 to 2000 ?m, more specifically 200 to 1000 ?m, further specifically 300 to 1000 ?m. The mesh structure may have a thickness of 10 to 60 ?m corresponding to the width of 1 to 3 cells.
[Ammonia-Metabolizing Ability (Function)]
[0039] The term ammonia-metabolizing function referred to in the present invention means ammonia-metabolizing unction observed when the objective cell is cultured under appropriate conditions, unless especially indicated. Methods for measuring ammonia-metabolizing function are well known to those skilled in the art. It is preferable to perform adhesion culture using a culture vessel coated with EMC as required and the compound mentioned later (FH1) without using a feeder cell (HUVECs, MSCs, and the like). As for more detailed conditions, the methods described in the section of Examples of the present specification can be referred to.
[0040] The artificial hepatocyte obtained by the present invention has a high ammonia-metabolizing function. Specifically, the artificial hepatocyte of the present invention has an ammonia-metabolizing ability not lower than 100 ?g/dl/24 h, preferably not lower than 120 ?g/dl/24 h, more preferably that comparable to the metabolizing ability of the primarily cultured hepatocyte (160 to 200?g/dl/24 h), i.e., 160 ?g/dl/24 h, still more preferably 180 ?g/dl/24 h.
[Characteristics of Culture]
[0041] Culture in Serum-Free and/or Feeder-Free Environment
[0042] As the medium for culturing artificial hepatocyte of the present invention, the various existing media developed for culturing hepatocytes can be used. Examples of usable medium include the differentiation induction medium III mentioned later, HCM? BulletKit? Medium (Lonza Walkersville, Inc), and HBM? Basal Medium (Lonza Walkersville, Inc).
[0043] The artificial hepatocyte of the present invention can be cultured in a serum-free and/or feeder-free environment, preferably a serum-free and feeder-free environment. To culture in a serum-free and feeder-free environment means to perform culture by using a medium containing neither animal serum nor human serum in an environment where any cells other than the objective hepatocyte, such as mouse fetal fibroblast, a feeder cell (human umbilical vein endothelial cell (HUVEC)), or mesenchymal stem cell (MSC), do not coexist.
EMC Coat
[0044] For the culture of the artificial hepatocyte of the present invention, various kinds of existing culture vessels can be used. Although material of the culture vessel can be appropriately chosen by those skilled in the art, it is preferable to use a culture vessel coated with EMC, since such a culture vessel provides favorable growth and maintains high functionality of the hepatocyte. Preferred examples of ECM include Matrigel (registered trademark), hyaluronic acid, heparin, fibronectin, laminin vitronectin, proteoglycan (chondroitin sulfate proteoglycan, heparan sulphate proteoglycan, keratan sulfate proteoglycan, dermatan sulfate proteoglyan), various collagens, gelatin, tenascin, entactin, elastin, fibrillin, and so forth.
Maintenance and Subculture
[0045] It has been confirmed that the artificial hepatocyte of the present invention can be continuously cultured for about ten days by using the differentiation induction medium III mentioned later. It is considered that the hepatocyte can be subcultured and proliferated by inoculating it at an appropriate density. The appropriate density is, for example, such a density that the artificial hepatocytes exactly contact with one another. A density lower than such a density provides bad proliferation, and a density higher than such a density may induce marked cell death in a region where three-dimensional construction is observed.
<Method for Producing Artificial Hepatocyte>
[0046] The artificial hepatocyte of the present invention can be produced by the method comprising the following steps:
[0047] the differentiation induction step 1 of culturing an iPS cell in the differentiation induction medium I containing activin A,
[0048] the differentiation induction step 2 of culturing a cell obtained in the differentiation induction step 1 in the differentiation induction medium II containing bone morphogenetic protein 4 (BMP4) and fibroblast growth factor 2 (FGF2); and
[0049] the differentiation induction step 3 of culturing a cell obtained in the differentiation induction step 2 in the differentiation induction medium III containing hepatocyte growth factor (HGF), oncostatin M, dexamethasone, and a compound having N-phenyl-2-(N-phenylmethylsulfonamido)acetamide structure to obtain an artificial hepatocyte.
Differentiation Induction Step 1:
[0050] In the differentiation induction step 1, an iPS cell is cultured in the differentiation induction medium I containing at least activin A.
iPS Cell
[0051] In the present invention, an iPS cell derived from human or nonhuman animal is used as the starting cell. Methods for obtaining and establishing an iPS cell are well known to known those skilled in the art. Human iPS cells can be purchased or provided from Institute of Physical and Chemical Research (Riken) BioResource Research Center, Kyoto University, or National Center for Child Health and Development. Examples of iPS cells that are available and can be used for the present invention include, for example, those of the human artificial pluripotent stein (iPS) cell strain HiPS-RIKEN-1A (Institute of Physical and Chemical Research, HPS0003), which was established by introducing four factors (Oct3/4, Sox2, Klf4, and c-Myc) into an umbilical cord-derived fibroblast (RCB0436 HUC-F2) using a retrovirus vector, human iPS cell strain HiPS-RIKEN-2A (Institute of Physical and Chemical Research, HPS0009), which was established by introducing four factors (Oct3/4 Sox2, Klf4, and c-Myc) into an umbilical cord-derived fibroblast (RCB0197 HUC-Fm) using, a retrovirus vector, human iPS cell strain HiPS-RIKEN-12A (Institute of Physical and Chemical Research, HPS0029), which can be obtained by introducing three factors (Oct3/4, Sox2, and Klf4) into an umbilical cord-derived fibroblast using a retrovirus vector, human iPS cell strain Nips-B2 (Institute of Physical and Chemical Research, HPS0223), which was established by introducing four factors (Oct3/4, Sox2, Klf4, and c-Myc) using a Sendai virus vector, and so forth.
Use of Sendai Virus Vector
[0052] When an iPS cell is established, it is preferable to use a Sendai virus vector as the vector for introducing the factors. Retrovirus vectors enter into cell nuclei, and induce gene expression as DNA, and therefore it is concerned that the vectors may positively enter into patient's chromosomes, or cause genetic recombination with a chromosomal DNA, when the obtained iPS cell is used for the patient, even though such events may very rarely occur. On the other hand, Sendai virus vectors do not enter into cell nuclei, but replicate genomes thereof within the cytoplasm, and produce a lot of proteins. These genomes are made of RNA, and they materially differ from DNAs of the patient's chromosomes. Therefore, it is considered that there is theoretically no risk of modification of chromosomes of the patient in the nucleus by a Sendai virus vector.
[0053] Methods for establishing an iPS cell using a Sendai virus (SeV) vector are well known to those skilled in the art, and it can be established by, for example, culturing a commercial human fibroblast or the like in a medium containing a Sendai virus vector carrying a reprogramming factor expression unit. Examples of such a Sendai virus vector carrying a reprogramming factor expression unit include, for example, CytoTune-iPS (DNAVEC Corporation), and so forth.
Differentiation Induction Medium I
[0054] The differentiation induction medium I used in this step contains a cytokine such as Wnt3A or activin A. It is preferred that at least activin A is contained. As for the amount of the cytokine, amount of Wnt3A is, for example, about 10 to 50 ng/mL, preferably about 25 ng/ml, and amount of activin A is, for example, about 10 to 100 ng/ml, preferably about 100 ng/ml.
[0055] The differentiation induction medium I is free from serum, and for example, a medium having a basic composition such as RPMI1640 to which the aforementioned cytokine and serum substitute are added can be used. Examples of the serum substitute include B27 (registered trademark, Life Technologies), Knockout (registered trademark) Serum Replacement (Life Technologies), and so forth. A specific example it the composition of the differentiation induction medium I is that mentioned in the section of Examples in this specification. As for the composition of B27, G J. Brewer et al., Optimized Survival of Hippocampal Neurons in B27-Supplemented Neurobasal?, a New Serum-free Medium Combination, Journal of Neuroscience Research 35567476 (1993) can be referred to.
[0056] This step is performed by culturing iPS cells at 37? C. for several days in a 5% CO.sub.2 incubator using the differentiation induction medium I. The culture period of the differentiation induction step 1 is specifically 4 to 10 days, preferably 6 to 8 days, more preferably 7 days. The differentiation induction step 1 can be peiformed until the cells come to exhibit morphological characteristics of endomere.
Differentiation Induction Step 2
[0057] In the differentiation induction step 2, the cells obtained by the differentiation induction step 1 are cultured in the differentiation induction medium II.
Differentiation Induction Medium II
[0058] The differentiation induction medium II used in this step contains various cytokines, for example, fibroblast growth factor 2 (FGF2), bone morphogenetic protein 4 (BMP4), and hepatocyte growth factor (HGF). As for the amounts of the cytokines, amounts of FGF2, HGF, and BMP4 are, for example, 5 to 50 ng/ml, 5 to 50 ng/ml, and 5 to 50 ng/ml, respectively, preferably about 10 ng/ml, about 20 ng/ml, and about 20 ng/ml, respectively. The differentiation induction medium II contains at least the bone morphogenetic protein 4 (BMP4) and the fibroblast growth factor 2 (FGF2). The differentiation induction medium II can also be serum-free, and for example, a medium having a basic composition such as RPMI1640 to which the aforementioned cytokines and serum substitute are added can be used. A specific example of the composition of the differentiation induction medium II is that mentioned in the section of Examples in this specification.
[0059] This step can be performed by culturing the cells obtained in the step 1 at 37? C. in a 5% CO.sub.2 incubator using the differentiation induction medium II. The culture period of the differentiation induction step 2 is specifically 1 to 6 days, preferably 2 to 5 days, more preferably 3 to 4 days.
Differentiation Induction Step 3
[0060] This step is a step of culturing the cells obtained in the differentiation induction step 2 in the differentiation induction medium III to obtain artificial hepatocytes.
Differentiation Induction Medium III
[0061] Examples of the cytokine and hormone used in this step include oncostatin M (OSM), dexamethasone, and so forth. Amounts to be used of OSM and dexamethasone are, for example, 10 to 50 ng/ml, and 0.05 to 0.5 ?M, respectively, preferably about 25 ng/ml, and about 0.1 ?M, respectively. The differentiation induction medium III contains at least hepatocyte growth factor (HGF), oncostatin M, dexamethasone, and N,N-(methylenebis)(4,1-phenylene)diacetamide (FH1) and/or 2-(N-(5-chloro-2-methylphenyl)(methylsulfonamido-N-(2,6-difluorophenyl)acetamide (FPH1). Specific examples of the composition of the differentiation induction medium II are those mentioned in the section of Examples in this specification.
FH1 and FPH1
[0062] The differentiation induction medium III contains N,N-(methylenebis)(4,1-phenylene)diacetamide (FH1) and/or 2-N-(5-chloro-2-methylphenyl)(methylsulfonamido)-N-(2,6-difluorophenyl)acetamide (FPH1) represented by the following formulas.
##STR00001##
[0063] In a preferred embodiment, the differentiation induction medium III contains FH1 and FPH1.
[0064] This step can be performed by culturing the cells obtained in the differentiation induction step 2 in the differentiation induction medium III for about several days to several weeks. In this culture period, it is preferable to exchange the medium at a frequency of at least every 3 days, preferably everyday.
Other Conditions
[0065] All of the differentiation induction steps 1 to 3 can he performed under a serum-free and/or feeder-free environment, preferably serum-free and feeder-free environment. They can also be performed by using a culture vessel coated with ECM, as required.
Confirmation of Hepatocytes
[0066] It is known that hepatic parenchymal cells embryologically appear following the appearance of the cardiac muscle cells in the embryoid body. It is experimentally known that expression of hepatic parenchymal cells is observed near the cardiac muscle cells differentiated from the embryoid bodies.
[0067] As for the method for confirming the differentiation of the cells undergone the differentiation induction steps 1 to 3 into hepatocytes, the differentiation can be confirmed on the basis of expression of a hepatocyte (fetal hepatocyte)-specific marker gene or expression of a hepatocyte-specific marker protein such as transthyretin (TTR), ?-fetoprotein (AFP) fetal hepatocyte, a1-antitrypsin (AAT), tyrosine aminotransferase (TAT), tryptophan oxygenase (TO), tyrosine aminotransferase, asialoglycoprotein receptor (ASGR), and albumin, or by immunostaining using an anti-albumin antibody. Further, since many binucleated cells are observed among mouse hepatocytes, the differentiation can be confirmed by confirming morphology of the cell nuclei.
[0068] The confirmation is preferably performed on die basis of criteria that they can constitute a mesh structure, and they have a high ammonia-metabolizing ability, as described in the section of the artificial hepatocyte mentioned above.
<Others>
(Hybrid Artificial Liver)
[0069] The present invention provides a hybrid artificial liver and a method for producing the same. It is preferred that the hybrid artificial liver uses at least 10.sup.9 of the artificial hepatocytes of the present invention.
[0070] Hybrid artificial livers are classified into three forms, i.e., those equipped outside the body and connected to a blood vessel, those retained inside the body and connected to a blood vessel, and those retained in the abdominal cavity without connecting to a blood vessel. Since the hybrid artificial liver of the present invention uses hepatocytes derived from iPS cells, it is considered that it is preferably of the extracorporeal type in order to avoid the risk concerning cell transfer, and so forth.
[0071] In the development of a hybrid artificial liver, design and development of a reactor are also important elements. As bioreactors, there are known those of various types, such as HepatAssist (Hui T, Rozga J, Demetrios A A, J. Hepatobiliary Pancreat. Surg., 2001, 8:1-15), which is for hybrid artificial liver treatment using swine hepatocytes, and MELS (Modular Extracorporeal Liver System) using swine hepatocytes. These reactors can also be used for the present invention. Hepatocytes in a floating state tend not to show sufficient differentiation function, collide with surrounding cells, and easily receive stress stimuli. Further, it is considered that a reactor comprising a scaffold of hollow fibers and nonwoven fabric etc. is preferred so that a scaffold can be provided to the hepatocytes, since it has been found that the artificial hepatocytes of the present invention provide higher ammonia-metabolizing ability when they are cultured as adhesion culture according to the researches conducted by the inventors of the present invention.
[0072] Any hollow fiber membrane can be used so long as the cells can adhere to the membrane surface, and substance exchange is not disturbed, and specifically, commercial products conventionally used for medical uses, for example, polysulfone membrane, saponified ethylene-vinyl acetate random copolymer membrane (for example, Eval (trade name), Kuraray Medical. Inc., etc.), and so forth are preferred. As for pore sizes of commercial hollow fiber membranes, there are those having various pore sizes depending on uses thereof such as dialysis membrane (5 nm or smaller), plasma segregation membrane (20 to 30 nm), and plasma skimming membrane (30 to 200 nm). From the viewpoint of substance permeability; a plasma skimming membrane (30 to 200 nm) is preferred. In order to avoid the risk of rejection, the pore size is most preferably 30 to 100 nm, so that immunocompetent cells and immunoglobulin in the blood flowing through the inside of the hollow fibers should not directly contact with the cells filled on the scaffold of nonwoven fabric or the like outside the hollow fibers.
[0073] As the nonwoven fabric, those processed and modified so that cells can adhere to them are preferred. Examples of the fibers of the nonwoven fabric include those of polytetrafluoroethylene (PTFE), and so forth. Those consisting of polytetrafluoroethylene (PTFE) treated with polyamino acid methane (PAU) are particularly preferred, because of ease of processing thereof.
(Toxicity Test)
[0074] The artificial hepatocytes obtained according to the present invention can be used for a test for evaluating toxicity of drugs. When they are used for a toxicity test, an objective drug is added to the artificial hepatocytes, the cells are cultured, for example, at 37? C. in a 5% CO.sub.2 incubator, and the toxicity can be evaluated on the basis of change of ammonia-metabolizing ability with time, or presence or absence, or degree of cell death. Examples of techniques for measuring cell death include detection of fragmentation of chromosomal DNA by electrophoresis, detection of chromosomal DNA-reduced cells using flow cytometry, detection of cells causing apoptosis using annexin V, detection of dead cells using dead cell staining agent such as propidium iodide (PI), ATP assay, MTT assay, intracellular glutathione assay, LDH assay, and so forth.
(Method for Drug Screening)
[0075] The artificial hepatocytes obtained according to the present invention can be used for drug screening. Specific examples of the method for drug screening include, for example, a method of adding a test substance to a culture medium of a tissue comprising the artificial hepatocytes of the present invention or artificial hepatocytes, incubating them for a predetermined time, and then analyzing a metabolic product contained in at least either one of the culture medium and the cells constituting the liver tissue or organ, or the like, and so forth.
[0076] The test substance is not particularly limited, and can be appropriately chosen depending on the purpose, and examples include, for example, drugs, diagnostic agents, and functional foods relating to liver functions, as well as active ingredients of these. Drug screening can also be performed as screening for ingredients useful for improvement of liver functions, or screening for harmful ingredients that damage the liver. Examples of the screening for ingredients useful for improvement of the liver functions include, for example, searches for a cholesterol decomposition-promoting substance, a cholesterol biosynthesis inhibitor, and so forth.
EXAMPLES
<Preparation of iPS Cells>
[Preparation of iPS Cells]
[0077] iPS cells were prepared by the following method. [0078] 1. Thaw POIETICS (registered trademark) CORD BLOOD CD34+ Cells (Cat. No. 2C-101A) and POIETICS (registered trademark) Mobilized CD34+ Cells (Cat. No. 2G-101B). [0079] 2. Prepare iPS cells by using CytoTune (registered trademark)-iPS 2.0 Sendai Reprogramming Kit according to the protocol attached to the kit.
[Confirmation of iPS Cells]
[0080] The following procedure was performed to confirm acquisition of iPS cells.
Immunostaining
[0081] 1. Stick 253G1 (obtained from Institute of Physical and Chemical Research (Riken)) and CiPS to slide glass using CytoSpin (registered trademark) (800 rpm, 5 minutes) [0082] 2. Perform fixation with 4% paraformaldehyde (Nakalai Tesque) (15 minutes, room temperature) [0083] 3. Perform washing 3 times with PBS [0084] 4. Perform blocking (0.3% Triton X-100, 1% BSA, 10% AB serum, or Blocking One-Histo (Nakalai Tesque)) (10 to 20 minutes, room temperature) [0085] 5. Perform treatment with 0.1% Tween/PBS, 5 minutes, room temperature [0086] 6. R&D, Human Pluripotent Stem Cell 3 Color hunumocytochemistry Kit, 10-fold dilution for each, 3 hours, room temperature or o/n, 4? C. [0087] 7. Perform washing with PBS [0088] 8. Perform enclosure with VECTA SHIELD (registered trademark) Hard Set with DAPI [0089] 9. Perform observation with the all-in-one fluorescence microscope BZ-9000 (KEYENCE).
Flow Cytometry
[0090] 1. Separate 253G1 (obtained from institute of Physical and Chemical Research (Riken)) and CiPS by a treatment with Accutase at 37? C. for 5 minutes, and then collect them. [0091] 2. Perform staining with SSEA-4 FITC, SSEA-3 PE, and TRA-1-81 PE antibodies (final concentration, 1 ?g/ml for each) (4? C., 30 minutes). [0092] 3. Perform measurement with FACSCalibur. [0093] 4. Perform analysis with CellQuest or FlowJo.
Morphological Observation
[0094] During the culture performed as described later, morphology was periodically observed with the all-in-one fluorescence microscope BZ-9000 (KEYENCE).
Confirmation of Elimination of SeV Vector (CytoTune iPS2.0) [0095] 1. Culture iPS cells on a 12-well plate. [0096] 2. Perform washing with PBS. [0097] 3. Perform fixation with 1 ml/well of 10% neutral formalin (5 minutes, room temperature). [0098] 4. Perform washing with PBS. [0099] 5. Add 500 ?l of Anti-SeV antibody (diluted 500 times with 0.1% Triton X-100/PBS), [0100] 6. Allow reaction at 37? C. for 1 hour. [0101] 7. Perform washing with PBS. [0102] 8. Add 500 ?l of DyLight 550-labeled anti-rabbit IgG-antibody (diluted 500 times with 0.1% Triton X-100/PBS). [0103] 9. Allow reaction at 37? C. for 1 hour. [0104] 10. Perform washing with PBS. [0105] 11. Perform observation with the all-in-one fluorescence microscope BZ-9000 (KEYENCE).
Results
[0106] The results of the immunostaining and flow cytometry are shown in
<Preparation of iPS Cells for Inducing CiPS-Hep>
[0107] According to the following method, iPS cells for inducing iPS-derived highly functional hepatocytes (CiPS-Hep) were prepared. In the confirmation of the aforementioned prepared iPS cells such as iPS cell colony observation, the methods described in this section were performed.
[Preparation of Laminin-Coated Dish]
[0108] 1. Melt laminin-5.sup.1) (?80? C.) at 4?C. Pay attention not to warm it with hand. [0109] 2. Put PBS.sup.3) into wells of a 6-well plate.sup.2) in a volume of 1 ml/well, and spread it over each well. [0110] 3. Cool the 6-well plate containing PBS and 200-?L tip at 4C. [0111] 4. Put the melted laminin-5 into the wells containing PBS in a motion of drawing a spiral pattern, and quickly sway the plate about 10 times, so that laminin-5 spreads over the whole well. Since laminin-5 is highly adsorptive, never perform pipetting. [0112] 5. Attain coating by incubation at 4? C. overnight, or at 37? C. for 2 hours or longer. Don't leave the plate at 37? C. [0113] 6. When the plate is not used immediately, it can be doubly sealed with Parafilm, and stored at 4? C. (1 week).
[Thawing and Culture of Frozen Cells]
[0114] 1. Set P2 centrifuge at 20? C. [0115] 2. Take out various inhibitors (4 kinds used in the following step 9) from a freezer at ?30? C. [0116] 3. Prepare culture medium (henceforth referred to as ReproFF2).
TABLE-US-00001 TABLE 1 ReproFF2.sup.4) 500 ml +FGF2.sup.5) 1 mg/ml .sup.2.5 ?l (Final 5 ng/ml) +penicillin/streptomycin.sup.6) 5 ml (Final 1%) [0117] 4. Put ReproFF2 into 15-ml tubes.sup.7) in a volume of 9 ml or 4 ml each, and warm it at 37? C. [0118] 5. Rinse twice the laminin-coated dish with PBS(?), and put 1 ml each of PBS(?) into the [0119] 6. Take out the frozen cells from liquid nitrogen, and immerse them into a water bath at 37? C. for 2 minutes to thaw them. When the volume of the frozen cells is small, add an appropriate volume of warmed culture medium to the cells, and perform gentle pipetting to quickly thaw them. [0120] 7. Collect the thawed cells, transfer them into a 15-ml tube containing 9 ml of the culture medium, and mix them by gentle inversion of the tube. [0121] 8. Centrifuge them under the conditions of 160 g, 5 minutes, and room temperature with acceleration and braking. [0122] 9. Separately prepare 4 ml of culture medium+each inhibitor during the centrifugation.
TABLE-US-00002 TABLE 2 ReproFF2 4 ml +Thiazovivin.sup.8) 5 mM 4 ?l (Final 5 ?M) +CHIR99021.sup.9) 1 mM 4 ?l (Final 1 ?M) +PD0325901.sup.10) 400 ?M.sup. 4 ?l (Final 0.4 ?M) +SB431542.sup.11) 2 mM 4 ?l (Final 2 ?M) [0123] 10. Collect the 15-ml tube after centrifugation, and carefully remove the supernatant. [0124] 11. Add 1 ml of the inhibitor+culture medium, and gently loosen the cell pellet by pipetting. [0125] 12. Remove PBS(?) on the laminin-coated dish, and transfer the cell-suspending culture medium to the well. Wash the 15-ml tube with the remaining inhibitor+culture medium, and transfer it to the well. [0126] 13. Sway the dish to uniformly spread the cells, and incubate them at 37? C. and 5% CO.sub.2. [0127] 14. Gently stir the medium in the well on the next: day, and then remove the supernatant. [0128] 15. Add 4 ml of culture medium+each inhibitor again, and perform culture at 37? C. and 5% CO.sub.2.
[Medium Exchange]
[0129] 1. Remove the culture supernatant. [0130] 2. Add fresh culture medium ReproFF2 in a volume of 4 ml/well. [0131] 3. Perform the aforementioned operations every 2 or 3 days (on Monday, Wednesday, and Friday).
[Subculture of Cells]
[0132] 1. Prepare a laminin-coated dish. [0133] 2. Remove the culture supernatant. [0134] 3. Add 1 ml of PBS(?) to wash cell surfaces. [0135] 4. Remove PBS(?), add ESGRO Complete Accutase.sup.12) in a volume of 1 ml/well, and perform incubation at 37? C. and 5% CO for 5 minutes. [0136] 5. Separate the cells not completely separated in the well by pipetting, and collect the cell suspension into a 15-ml tube. [0137] 6. Add 1 ml of ReproFF2 to a well to wash the inside of the well, collect the medium into the 15-ml tube, and add further 1 ml of ReproFF2 to the 15-ml tube to obtain a total volume of 3 ml. [0138] 7. Sufficiently mix the prepared cell suspension, then dilute it 2-fold with a trypan blue staining solution.sup.13), and perform cell counting. [0139] 8. Put the cell suspension into new 15-ml tubes depending on the number of wells in which subculture is performed, so that a cell density of 5?10.sup.5 cells well is obtained. Cryopreserve the remaining cells if needed. [0140] 9. Centrifuge them under the conditions of 160 g, 5 minutes, and room temperature with acceleration and braking. [0141] 10. Prepare 4 ml of the culture medium+each inhibitor during the centrifugation.
TABLE-US-00003 TABLE 3 ReproFF2 4 ml + Thiazovivin 5 mM 4 ?l (Final 5 ?M) [0142] 11. Remove the supernatant after the centrifugation, loosen the cell pellet by pipetting using the culture medium+inhibitor, and inoculate the cells on each laminin-coated well. [0143] 12. Indicate the date, name of the iPS cell, and passage number on the culture plate, and perform culture at 37? C. and 5% CO.sub.2. Continue the subculture by performing the subculture operations on Monday, Friday, Wednesday, and Monday again.
[Cryopreservation of Cells]
[0144] 1. Separate the cells in the same manner as that used in the subculture, and count them. [0145] 2. Centrifuge the cell suspension under the conditions of 160 g, 5 minutes, and room temperature with acceleration and braking. [0146] 3. Attach a label indicating the date, cell name, and passage number to serum tubes.sup.14) used for freezing. [0147] 4. Sufficiently remove the supernatant after centrifugation, and suspend the cells in STEM-CELLBANKER.sup.15) at a density of 1?10.sup.6 cells/500 ?l. [0148] 5. Put the cell suspension into the labeled serum tubes in a volume of 500 ?l/tube. [0149] 6. After putting the cell suspension, put the serum tubes into a ?80? C. deep freezer. [0150] 7. Transfer the frozen cells from ?80? C. to a liquid nitrogen cell preservation system within 1 to 3 days, and store them.
<Induction of CiPS-Hep>
[0151] According to the following method, CiPS cells were differentiated to induce highly functional hepatocytes [0152] [Day 1: iPS-derived highly functional hepatocyte induction by differentiation step 1medium change to iPS-derived highly functional hepatocyte induction by differentiation medium I (henceforth referred to as medium I)] [0153] 1. Prepare a required amount of the medium I (4 ml/well).
TABLE-US-00004 TABLE 4 Serum-free RPMI 1640.sup.16) 4 ml +B27.sup.17) 50x (Final 1x) 80 ?l +recombinant human A ctivin A.sup.18) 10 ?g/ml (Final 100 ng/ml) 40 ?l [0154] 2. Remove the supernatant, and add 1 ml of serum-free RPMI 1640 to wash cell surfaces. [0155] 3. Add the medium I in a volume of 4 ml/well. [0156] 4. Perform an operation of removing the supernatant, and adding fresh medium I everyday up to Day 6. [0157] [Day 7: iPS-derived highly functional hepatocyte induction by differentiation step 2change of medium to iPS-derived highly functional hepatocyte induction by differentiation medium II (henceforth referred to as medium II)] [0158] 1. Prepare a required amount of medium II (4 ml/well).
TABLE-US-00005 TABLE 5 Serum-free RPMI 1640 4 ml +B27 50x (Final 1x) 80 ?l +BMP4.sup.19) 10 ?g/ml (Final 20 ng/ml) 8 ?l +FGF2 10 ?g/ml (Final 10 ng/ml) 4 ?l [0159] 2. Perform gentle pipetting of the culture supernatant, then remove the supernatant, and add the medium II in a volume of 4 ml/well. [0160] 3. Perform an operation of removing the supernatant, and adding fresh medium II everyday up to Day 9. [0161] [Day 10: iPS-derived highly functional hepatocyte induction by differentiation step 3]
1. Matrigel Coating of Culture Plate
[0162] 1.1. Thaw 300 ?l of BD Matrigel Growth Factor Reduced.sup.20) at 4? C. [0163] 1.2. Cool 24-well plate dish.sup.21) and Knock-Out-DMEM.sup.22) at 4? C. [0164] 1.3. When Matrigel is thawed, add the same volume of KnockOut-DMEM, and sufficiently mix them by pipetting. [0165] 1.4. Put the diluted Matrigel solution into wells of the 24-well plate dish in a volume of 200 ?l per one well, and spread it over the whole well. [0166] 1.5. Leave the 24-well plate dish standing at ordinary temperature for 3 hours or longer to attain coating.
2. Subculture of iPS Cell-Derived Highly Functional Hepatocytes
[0167] 2.1. Prepare iPS-derived highly functional hepatocyte induction by differentiation medium III (henceforth referred to as medium III) in a volume of 1 ml/well.
TABLE-US-00006 TABLE 6 HCM.sup.23) (HBM.sup.24) + 1 ml cocktail) +HGF.sup.25) 10 ?g/ml (Final 20 ng/ml) 2 ?l +Oncostatin M.sup.26) 10 ?g/ml (Final 10 ng/ml) 1 ?l +Dexamethasone.sup.27) 0.1 mM (Final 0.1 ?M) 1 ?l +FH1.sup.28)-1 25 mM (Final 50 ?M) 2 ?l HCM.sup.23) (HBM.sup.24) + 1 ml cocktail) +HGF.sup.25) 10 ?g/ml (Final 20 ng/ml) 2 ?l +Oncostatin M.sup.26) 10 ?g/ml (Final 10 ng/ml) 1 ?l +Dexamethasone.sup.27) 0.1 mM (Final 0.1 ?M) 1 ?l +FH1.sup.28)-1 25 mM (Final 50 ?M) 2 ?l +FPH1.sup.28)-2 12.86 mM (Final 20 ?M) 1.56 ?l [0168] 2.2. Remove the culture supernatant, and wash the cell surfaces with 1 ml of PBS(?). [0169] 2.3. Add 1 ml of ESGRO Complete Accutase, and carry out incubation at 37? C. for 5 minutes. [0170] 2.4. Deliberately carry out pipetting to separate the cells, and collect the cell suspension into a 15-ml tube. [0171] 2.5. Wash the inside of the well with 1 ml of HCM, collect the solution in the 15-ml tube, and further add 1 ml HCM to the 15-ml tube to obtain a total volume of 3 ml. [0172] 2.6. Sufficiently stir the cell suspension, and early out cell counting using trypan blue diluted 2-fold. [0173] 2.7. Put the cell suspension into new 15-ml tubes depending on the number of wells for subculture so that a density of 1.0?10.sup.6 cells/well is obtained. [0174] 2.8. Carry out centrifugation at 160 g and room temperature for 5 minutes. [0175] 2.9. During the centrifugation, add 1 ml of PBS(?) to the Matrigel-coated well to carry out washing, and remove the supernatant. Repeat this washing operation twice, and add 1 ml of PBS(?) to the well. [0176] 2.10. After the centrifugation, remove the supernatant and also the supernatant in the Matrigel-coated well when adhesion culture is performed, then loosen the cell pellet with the medium III, and inoculate the cells into the Matrigel-coated well.
[0177] When floating culture is performed, loosen the cell pellet by pipetting using the medium III, and inoculate the cells onto an MPC treatment plate (MD6 with Lid Low-Cell Binding, Nalge Nunc International, Japan).
[0178] When HUVEC and MSC are used as feeder cells, perform co-culture as required as adhesion culture (refer to Non-patent document 1 cited below). [0179] 2.11. Indicate the date, name of the cells, etc. on the culture plate, and carry out culture in an incubator at 37? C. and 5% CO.sub.2. [0180] 2.12. Carry out an operation of removing the supernatant, and adding flesh medium III on every other day up to Day 17. [0181] [Day 17: Completion of CiPS-Hep->ammonia metabolism test] [0182] 1. Prepare HBM (cocktail)+aqueous ammonia (henceforth referred to as ammonia medium) in a volume of 1 ml/well?2.
TABLE-US-00007 TABLE 7 HBM 1 ml Aqueous ammonia.sup.29) (1M) 2 ?l (2 mM) [0183] 2. Remove the culture supernatant, and wash the cell surfaces once with 1 ml of HBM, and once with ammonia HBM. [0184] 3. Remove the supernatant, and add 1 ml/well of the ammonia medium. [0185] 4. Put the ammonia medium or HBM (1 ml each) into empty wells and used as positive control and negative control. [0186] 5. Carry out culture at 37? C. and 5% CO.sub.2 for 24 hours. [0187] [Day 18: Collection of sample for ammonia metabolism test] [0188] 1. Collect the supernatant into an Eppendorf tube, and early out centrifugation at 500 g for 5 minute. [0189] 2. Collect the supernatant into three of new Eppendorf tubes in a volume of 300 ?l each, and freeze it at ?80? C. [0190] 3. Wash the well with PBS, add 1 ml of trypsin-EDTA.sup.30), and carry out incubation at 37? C. for 5 minutes. [0191] 4. Deliberately carry out pipetting to separate the cells, and put the cell suspension into an FACS tube.sup.31). [0192] 5. Carry out washing with 1 ml of HBM, and make the total volume 2 ml. [0193] 6. Perform counting using trypan blue.
<Confirmation of iPS-HEP Cell>
[0194] Acquisition of iPS cells was confirmed by carrying out the following procedure.
Ammonia Test Wako.SUP.32)
[0195] 1. Dissolve the supernatant. [0196] 2. Carry out centrifugation at 8000 rpm and 4? C. for 5 minutes. [0197] 3. Prepare diluted ammonia solutions. Not use the standard solution and the standard diluted solutions contained in the kit. Add 40 ?l of an ammonium ion standard solution (1000 mg/L) to 960 ?l of HBM (additive-free), and vortex them to prepare a standard solution.
TABLE-US-00008 TABLE 8 0 ?g/dl: HBM alone 100 ?g/dl: Standard solution (100 ?l) + HBM (300 ?l) 200 ?g/dl: Standard solution (150 ?l) + HBM (150 ?l) 300 ?g/dl: Standard solution (300 ?l) + HBM (100 ?l) 400 ?g/dl: Standard solution alone [0198] 4. Transfer 200 ?l each of the supernatant of the sample, and the diluted ammonia solutions to new Eppendorf tubes. [0199] 5. Add 800 ?l of a deproteinization solution and vortex them. [0200] 6. Carry out centrifugation at 8000 rpm and 4? C. for 5 minutes. [0201] 7. During the centrifugation, turn on the power sources of microplate reader and personal computer, and choose Tecan i-control. [0202] 8. Put the supernatant into wells of a 96-well flat bottom plate in a volume of 60 ?l each (in duplicate). [0203] 9. Add coloring test solution A to each well in a volume of 60 ?l. [0204] 10. Remove a lid, set the plate on the microplate reader, and sway the plate (double click Shaking, choose 10 sec and Normal, and click Start). [0205] 11. Add coloring test solution B to each well in a volume of 30 ?l. [0206] 12. Set the plate on the microplate reader, and sway the plate. [0207] 13. Add coloring test solution C to each well in a volume of 60 ?l as quickly as possible. [0208] 14. Set the plate on the microplate reader, and sway the plate. [0209] 15. Carry out incubation at 37? C. in a 5% CO.sub.2 incubator for 20 minutes. [0210] 16. Cool the plate at 4? C. for 10 minutes or longer to terminate the reaction. [0211] 17. Finely wipe the bottom of the plate, and set the plate on the microplate reader with adjusting the upper left corner. [0212] 18. Measure absorbance (620 or 630 nm) (double click Measure of Absorbance, select the well for measurement at 620 nm in Details, and click Start).
RT-PCR
[0213] 1. Extract RNA by using ISOGEN II (NIPPON GENE) according to the attached protocol. [0214] 2. Measure RNA concentration with Nano Drop (registered trademark). [0215] 3. Synthesize cDNA using PrimeScript High Fidelity RT-PCR Kit. [0216] 4. Carry out PCR using Veriti 96-Well Thermal Cycler (Applied Biosystems). [0217] 5. Primer sets were as follows.
TABLE-US-00009 TABLE9 SEQID PrimerName Sequence NO: hALBFor CCTTTGGCACAATGAAGTGGGTAACC 1 hALBRev CAGCAGTCAGCCATTTCACCATAGG 2 hHNF4aFor CTGCTCGGAGCCACCAAGAGATCCATG 3 hHNF4aRev ATCATCTGCCACGTGATGCTCTGCA 4 hOCT4For GACAACAATGAAAATCTTCAGGAGA 5 hOCT4Rev TTCTGGCGCCGGTTACAGAACCA 6 hCYP3A4For CCTTACATATACACACCCTTTG 7 hCYP3A4Rev GGTTGAAGAAGTCCTCCTAAGCT 8 h?-actinFor TCACCACCACGGCCGAGCG 9 h?-actinRev TCTCCTTCTGCATCCTGTCG 10 [0218] 7. Carry out electrophoresis of the RT-PCR products on 1% agarose gel. [0219] 8. Stain the gel with Gel Red, and observe it.
Results
[0220] Photographs of the obtained iPS-REP cells are shown in
[0221] The obtained results of the ammonia metabolism test and RT-PCR are shown in
LIST OF MATERIALS USED IN THE EXAMPLES
[0222]
TABLE-US-00010 TABLE 10 Catalogue Storage Reagent Volume Manufacturer No. temperature 01) Laminin-5 1 ?g/vial (47 ?l) Repro CELL RCHEOT004 ?80? C. Thawed on ice 02) 6-Well plate NUNC 140675 03) D-PBS() 500 ml Wako Pure 045-29795 Room Used as it was Chemical temperature Industries 04) ReproFF2 500 ml Repro CELL RCHEMD006 ?30? C. Stored at 4? C. after thawing, and used up within 1 month 05) FGF-2(=BFGF) 25 ?g (1 mg/ml) Repro CELL RCHEOT002 ?80? C. Divided into 5-?l portion, frozen again, thawed then stored at 4? C., used up within 1 month 06) Penicllin/streptomycin 100 ml Nacalai Tesque 26253-84 ?30? C. Divided into 5-ml portions mixed solution 07) 15-ml Tube NUNC 339650 08) Thiazovivin 5 mg StemRD Thia-05 ?30? C. Dissolved with DMSO (3.215 ml), put into light-shielded tubes in a volume of 260 ?l each ( 5 mM) 09) Stemolecule? CHIR99021 STEMGENT 04-0004-02 ?30? C. Stored in light-shielded in Solution tubes, frozen after every use 10) Stemolecule? PD0325901 STEMGENT 04-0006-02 ?30? C. Stored in light-shielded in Solution tubes, frozen after every use 11) SB431542, 5 mg 10 mM Cellagen C7243-5s ?30? C. Stored in light-shielded solution in DMSO Technology tubes, frozen after every use 12) Acculase? 100 ml Nacalai Tesque 12679-54 ?30? C. Thawed, and then stored at 4? C. 13) 0.4% Trypan blue 100 ml Life 15250-061 Room Used as it was staining solution technologies, temperature Inc 14) Serum tube S
o MS-4501 X Bakelite 15) STEM-CELLBANKER 20 ml TakaraBio CB043 ?30? C. Thawed, and then stored at 4? C. 16) RPMI1640 500 ml Wako Pure 189-02025 4? C. Used as it was Chemical Industries 17) B27 Serum-Free 10 ml Life 7504-044 ?30? C. Thawed at 4? C. with Supplement (50x), Liquid Technologies, light-shielding, put into Inc light-shielded tubes in a volume of 1 ml each 18) Recombinant 10 ?g Peprotech, Inc. AF-120-14E ?30? C. Dissoved with 1 ml of Human/Murine/Rat Activin A 0.1% BSA-PBS, divided into 200-?l portions (
10 ?g/ml) 19) Stemfactor BMP-4 10 ?g M
Biotec 130-095-549 ?30? C. HCL2 (Human Recombinant) 20) BD Matrigel Matrix 10 ml BD Biosciences 3542-30 ?30? C. Thawed on ice, divided Growth Factor Reduced into 100-?l in or 300-?l portions 21) 24 well-plate dish NUNC 126667 22) Cell Therapy Systems 500 ml Life A12861-01 4? C. Used as it was KnockOut? DMEM Technologies, CTS? (1x) Inc 23) Medium kit for hepatocytes Takara Bio CC-3199 4? C. Stored at ?30? C. as only (HCM BulletKit) cocktail, or at 4? C. after addition 24) Medium kit for hepatocytes CC-3198 4? C. only (HCM BulletKit) 25) Recombinant Human HGF 10 ?g Peprotech, Inc 100-39 ?30? C. Dissolved with 1 ml of 0.1% BSA-PBS, divided into 50-?l portions (
10 ?g/ml) 26) Recombinant Human 10 ?g Peprotech, Inc 300-10 ?30? C. Dissolved with 1 ml of 0.1% Oncostatin M (227 a.a.) BSA-PBS, divided into 50-?l portions (
10 ?g/ml) 27) Dexamethasone TOCRIS 1126 ?30? C. 10 mM Solution was diluted 10 times with ethanol 28)-1 FH1 5 mg Sigma 8ML0826 4? C. Dissolved with DMSO (708 ?l), and put into light-shielded tubes (
25 mM) 28)-2 FPH1 5 mg Glixx GLXC-03609 4? C. Dissolved with DMSO Laboratories (1 ml), and put into light-shielded tubes (
12.86 mM) 29) Ammonium ion standard 25 ml Wako 019-15461 25? C. or lower Light-shielded solution 30) Trypsin-EDTA 100 ml Life 25200-056 4? C. Technologies (Invitrogen) 31) FACS tube BD FALCON 352235 32) Ammonia Test Wako Wako 277-14401 4? C.
indicates data missing or illegible when filed
REFERENCE CITED IN EXAMPLES
[0223] Non-patent-document 1: T. Takebe et al., Vascularized and functional human liver from an iPSC-derived organ bud transplant, Nature, 499, 481-484 (2013), doi:10.1038/nature12271, Published online 3 Jul. 2013
INDUSTRIAL APPLICABILITY
[0224] The highly functional artificial hepatocyte induced from an iPS cell obtained by the present invention can be favorably used as a hybrid artificial liver. It can also be used for drug screening, toxicity test based on ammonia metabolism or the like as an index, and so forth.
SEQUENCE LISTING FREE TEXT
[0225] SEQ ID NO: 1, hALB For [0226] SEQ ID NO: 2, hALB Rev [0227] SEQ ID NO: 3, hHNF4a For [0228] SEQ ID NO: 4, hHNF4a Rev [0229] SEQ ID NO: 5, hOCT4 For [0230] SEQ ID NO: 6, hOCT4 Rev [0231] SEQ ID NO: 7, hCYP3A4 For [0232] SEQ ID NO: 8, hCYP3A4 Rev [0233] SEQ ID NO: 9, h?-actin For [0234] SEQ ID NO: 10, h?-actin Rev