HEMI-SYNTHETIC TRILOBINE ANALOGS FOR USE AS A DRUG

Abstract

The invention concerns a compound of the following formula (I) or a pharmaceutically acceptable salt or solvate thereof as well as a pharmaceutical composition containing such a compound, and the use of such a compound as a drug, notably as a DNMT inhibitor, in particular in the treatment of cancer.

##STR00001##

Claims

1-16. (canceled)

17. A compound of the following formula (I) or a pharmaceutically acceptable salt or solvate thereof: ##STR00051## wherein: W is H, X.sub.1 and X.sub.2 are, independently of each other, H, (C.sub.1-C.sub.10)-alkyl, (C.sub.1-C.sub.10)-alkyl-R.sub.2, (C.sub.2-C.sub.10)-alkenyl, (C.sub.2-C.sub.10)-alkenyl-R.sub.2, CONR.sub.3R.sub.4, CSNR.sub.3R.sub.4, COR.sub.3, COOR.sub.6, CN, SOOR.sub.7, C(NH)NHR.sub.3, (C.sub.1-C.sub.10)-alkyl-(C.sub.5-C.sub.10)-aryl or (C.sub.1-C.sub.10)-alkyl-(5-12)-membered-heterocycle, wherein: R.sub.2 is OH, O(C.sub.1-C.sub.10)-alkyl, O(C.sub.5-C.sub.10)-aryl, NO.sub.2, CN, NR.sub.4R.sub.5, (5-12)-membered-heterocycle, (C.sub.5-C.sub.10)-aryl, O((CH.sub.2).sub.2O).sub.nOH with n=1-3, CONR.sub.3R.sub.4, halogen, COOR.sub.4, CF.sub.3, or (C.sub.3-C.sub.12)-cycloalkyl, in which (C.sub.5-C.sub.10)-aryl and (5-12)-membered-heterocycle are optionally substituted by at least one group selected from NR.sub.4R.sub.5, OR.sub.5, (C.sub.1-C.sub.10)-alkyl, halogen and oxo (O), R.sub.3 is H, or a group chosen among (C.sub.1-C.sub.10)-alkyl, (C.sub.3-C.sub.12)-cycloalkyl, (C.sub.2-C.sub.10)-alkenyl, (C.sub.5-C.sub.10)-aryl and a (5-12)-membered-heteroaryl, said group being optionally substituted by at least one group selected from halogen, CN, NR.sub.4R.sub.5, mono(C.sub.1-C.sub.6)alkyl-amino, di-(C.sub.1-C.sub.6)-alkyl-amino, NO.sub.2, CONR.sub.4R.sub.5, COOR.sub.4, CF.sub.3, OR.sub.4 and (C.sub.1-C.sub.10)-alkyl-R.sub.8, R.sub.4 is H or (C.sub.1-C.sub.10)-alkyl, R.sub.5 is H, (C.sub.1-C.sub.10)-alkyl, (C.sub.5-C.sub.10)-aryl or (5-12)-membered-heterocycle, R.sub.6 is H, (C.sub.1-C.sub.10)-alkyl, (C.sub.5-C.sub.10)-aryl or (C.sub.1-C.sub.10)-alkyl-R.sub.2, R.sub.7 is (C.sub.1-C.sub.10)-alkyl, (C.sub.2-C.sub.10)-alkenyl, (C.sub.5-C.sub.10)-aryl or a (5-12)-membered-heterocycle, in which the fragments (C.sub.5-C.sub.10)-aryl and (5-12)-membered-heterocycle are optionally substituted by at least one group selected from halogen, CN, NR.sub.4R.sub.5, mono(C.sub.1-C.sub.6)alkyl-amino, di-(C.sub.1-C.sub.6)-alkyl-amino, NO.sub.2, CONR.sub.3R.sub.4, COOR.sub.4, CF.sub.3 and OR.sub.4, R.sub.8 is H, (C.sub.1-C.sub.10)-alkyl, (C.sub.5-C.sub.10)-aryl or (5-12)-membered-heterocycle, in which (C.sub.5-C.sub.10)-aryl and (5-12)-membered-heterocycle are optionally substituted by at least one group selected from NR.sub.4R.sub.5, OR.sub.5, (C.sub.1-C.sub.10)-alkyl, halogen and oxo, R.sub.1 is hydrogen, (C.sub.1-C.sub.6)-alkyl, COR.sub.6 or SOOR.sub.9 with R.sub.9 being a (C.sub.1-C.sub.6)-alkyl group optionally substituted by at least one halogen, with the proviso that at least one of X.sub.1 and X.sub.2 is not H or (C.sub.1-C.sub.10)-alkyl.

18. The compound according to claim 17, having the following formula (Ia) or a pharmaceutically acceptable salt or solvate thereof: ##STR00052##

19. The compound according to claim 17, wherein X.sub.2 is not H or (C.sub.1-C.sub.10)-alkyl.

20. The compound according to claim 17, wherein at least one of X.sub.1 and X.sub.2 is CONR.sub.3R.sub.4 or CSNR.sub.3R.sub.4.

21. The compound according to claim 20, wherein X.sub.2, is CONR.sub.3R.sub.4.

22. The compound according to claim 17, wherein R.sub.2 is CN, NR.sub.4R.sub.5 or a (5-12)-membered-heterocycle optionally substituted by at least one group selected from NR.sub.4R.sub.5, OR.sub.5, (C.sub.1-C.sub.10)-alkyl, halogen and oxo (O).

23. The compound according to claim 17, wherein R.sub.3 is H, or a group chosen among (C.sub.1-C.sub.10)-alkyl, (C.sub.3-C.sub.12)-cycloalkyl, (C.sub.2-C.sub.10)-alkenyl and (C.sub.6-C.sub.10)-aryl, said group being optionally substituted by at least one group selected from halogen, NR.sub.4R.sub.5, mono-(C.sub.1-C.sub.6)-alkyl-amino, di-(C.sub.1-C.sub.6)-alkyl-amino, OR.sub.4 and (C.sub.1-C.sub.10)-alkyl-R.sub.8.

24. The compound according to claim 17, wherein: R.sub.4 is H or (C.sub.1-C.sub.6)-alkyl, R.sub.5 is H or (C.sub.1-C.sub.6)-alkyl, R.sub.6 is (C.sub.1-C.sub.6)-alkyl-R.sub.2, R.sub.7 is (C.sub.1-C.sub.6)-alkyl, R.sub.8 is a (5-12)-membered-heterocycle, optionally substituted by at least one group selected from NR.sub.4R.sub.5, OR.sub.5, (C.sub.1-C.sub.10)-alkyl, halogen and oxo.

25. The compound according to claim 17, wherein the (5-12)-membered-heterocycle is: in the definition of R.sub.2, a monocyclic or bicyclic heteroaryl containing 1 to 5 nitrogen atoms, each cycle comprising 5 or 6 members; in the definition of R.sub.8, a saturated, unsaturated or aromatic hydrocarbon monocycle or bicycle, each cycle having 5 or 6 members and 1 to 4 carbon atoms which have been replaced with heteroatoms selected from nitrogen, oxygen and sulfur atoms.

26. The compound according to claim 25, wherein the (5-12)-membered-heterocycle is: in the definition of R.sub.2, a pyrrole, an imidazole, a pyrazole, a pyridine, a pyrimidine, a pyridazine, a pyrazine, an indole, a benzimidazole, a purine, a quinoline, an isoquinoline, a cinnoline, a quinazoline or a quinoxaline; in the definition of R.sub.8, a pyrroline.

27. The compound according to claim 17, selected from the group consisting of compounds of the following formulas: ##STR00053## ##STR00054## ##STR00055## ##STR00056## ##STR00057## ##STR00058## and the pharmaceutically acceptable salts and solvates thereof.

28. A method for inhibiting a DNA methyltransferase (DNMT) comprising the administration to a person in need thereof of an effective dose of a compound according to claim 17.

29. A method for treating a cancer or a neurological disease or for cell reprogramming, comprising the administration to a person in need thereof of an effective dose of a compound according to claim 17.

30. The method according to claim 29, for treating a cancer.

31. The method according to claim 30, wherein the cancer is selected from colon cancer; hepatocarcinoma; melanoma; breast cancer; ovarian cancer; kidney cancer; liver cancer; pancreatic cancer; prostate cancer; glioblastoma; lung cancer; neuroblastoma; myofibroblastic tumor; lymphoma; leukemia; and multiple myeloma.

32. A pharmaceutical composition comprising at least one compound according to claim 17, and at least one pharmaceutically acceptable excipient.

33. The pharmaceutical composition according to claim 32, further comprising at least one other active ingredient.

34. The pharmaceutical composition according to claim 33, wherein the at least one other active ingredient is an other anticancer agent.

35. The pharmaceutical composition according to claim 34, wherein said other anticancer agent is selected from the group consisting of cytotoxic agents, immunotherapies and other epigenetics drugs.

36. The pharmaceutical composition according to claim 35, wherein: cytotoxic agents are selected from doxorubicin, R-CHOP, PARP inhibitors, etoposide, cisplatin, vinerolbine, vinflunine, and bortezomib; immunotherapies are selected from antiCTL4 and antiPD1; and other epigenetics drugs are selected from HDACi, inhibitors of chromatin remodeler and inhibitors of histone modifiers. such as inhibitors of HDAC 1 & 2, such as CHD4, such as demethylases JARDI1A/B or methylases EZH2, and

37. The pharmaceutical composition according to claim 36, wherein: HDACi is selected from HDAC 1 & 2; inhibitors of chromatin remodeler is CDH4; and inhibitors of histone modifiers are selected from demethylases JARDI1A/B and methylases EZH2.

38. A pharmaceutical product comprising: i. at least one compound according to claim 17, and ii. at least one other active ingredient, as a combination product for simultaneous, separate or sequential use in the treatment of cancer.

Description

LEGEND OF THE FIGURE

[0134] FIG. 1: Fluorescent invasion area for spheroids in presence of DMSO or of 0.1, 0.32 or 1 M of compound 41 or 44.

EXAMPLES

[0135] The examples, which follow, illustrate the invention without limiting its scope in any way.

[0136] The following abbreviations have been used in the following examples. [0137] BSA: bovine serum albumin [0138] CMV: cytomegalovirus [0139] CpG: deoxycytidine-phosphate-deoxyguanosine [0140] DMF: Dimethylformamide [0141] DMSO: Dimethylsulfoxide [0142] DNMT: C5 DNA methyltransferase [0143] EMEM: Eagle's Minimum Essential Medium [0144] EDTA: Ethylenediaminetetraacetic acid [0145] HEPES: 4-(2-Hydroxyethyl)-1-piperazineethanesulfonic acid [0146] HPLC: High Performance Liquid Chromatography [0147] HRMS: High Resolution Mass Spectrometry [0148] luc: luciferase [0149] NMR: Nuclear Magnetic Resonance [0150] PBS: Phosphate buffered saline [0151] PCR: Polymerase Chain Reaction [0152] PBST: Phosphate buffered saline+Tween-20 [0153] RT: Room temperature [0154] SAH: S-adenosyl-L-homocysteine [0155] SAM: S-adenosyl-L-methionine [0156] THF: Tetrahydrofuran [0157] TLC: Thin Layer Chromatography

Example I. Synthesis of Examples of Compounds of Formula According to the Present Invention

Example 1: Product 10

[0158] To a solution of trilobine (1) (6 mg10.68 mol) in 300 L of tetrahydrofuran (THF) was added ethyl formate (46 L570 mol) and 1 drop of acetic acid. The mixture was stirred 24 h at RT in inert argon atmosphere. The reaction mixture was concentrated under reduced pressure and the residue was purified by semi-preparative X-Terra RP-18 HPLC, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95:5 to 50:50), to give 10 as a mixture of two rotamers in proportion 50/50 (0.4 mg, 0.678 mol, 6%).

##STR00003##

[0159] .sup.1H NMR (500 MHz, CDCl.sub.3) 8.51/8.24 (1H, s, H-1), 8.00/7.43 (1H, dd, J=8.3 Hz, J=2.2 Hz, H-14), 7.27/7.02 (1H, m, H-13), 7.09 (m, H-10), 6.97-6.87 (3H, dd, H-11, H-13, H-14), 6.71/6.67 (1H, s, H-5), 6.62/6.55 (1H, d, J=1.9 Hz, H-10), 6.42/6.36 (1H, s, H-5), 6.39-6.24 (1H, s, H-8), 5.76/4.95 (1H, br d, J=5.5 Hz, H-1), 4.23 (1H, m, H-3), 3.96/3.95 (3H, s, 12-OMe), 3.89/3.88 (3H, s, 6-OMe), 3.74 (2H, m, H-3), 3.69/3.61 (1H, br, H-1), 3.44 (1H, m, H-3), 3.28-2.96 (4H, m, H-, H-), 2.95/2.73 (6H, m, H-3, H-4, H-4), 2.43/2.42 (3H, s, N2-Me).

[0160] .sup.13C NMR (125 MHz, CDCl.sub.3) 161.2/160.9 (C-1), 154.6 (C-12), 150.2 (C-11), 147.6 (C-12), 146.9 (C-6), 139.7 (C-6 or C-7 or C-8), 139.6 (C-6 or C-7 or C-8), 139.2 (C-6 or C-7 or C-8), 137.3 (C-9), 133.2 (C-9), 132.2 (C-8a), 131.4 (C-10), 130.9/129.2 (C-14), 130.2 (C-7), 130.0 (C-4a), 127.7 (C-4a), 123.5/123.1 (C-13), 121.7/121.9 (C-11 and C-14), 118.0/118.9 (C-8a), 117.8/117.4 (C-10), 116.2/116.0 (C-5), 114.7/114.5 (C-8), 113.0/112.5 (C-13), 107.3/107.0 (C-5), 65.2/65.7 (C-1), 56.6 (C-6-OMe), 56.4 (C-12-OMe), 55.5/49.2 (C-1), 50.4/49.9 (C-3), 46.2/45.6 (C-), 41.1/36.4 (C-3), 40.2 (CN2-Me), 38.0/38.5 (C-), 29.2/27.1 (C-4), 26.4/26.2 (C-4).

[0161] HRMS-ESI (m/z) calculated for C.sub.36H.sub.35N.sub.2O.sub.6 [M+H].sup.+: 591.2490; Found: 591.2431.

Example 2: Product 11

[0162] To a solution of trilobine (1) (6 mg10.68 mol) in 200 L of dichloromethane (CH.sub.2Cl.sub.2) and 200 L of propan-2-ol, was added isocyanatotrimethylsilane (2 mg17.36 mol). The mixture was stirred 16 h at RT in inert argon atmosphere. The reaction mixture was concentrated under reduced pressure and the residue was purified by semi-preparative X-Terra RP-18 HPLC, eluting with a linear gradient H.sub.2O/MeCN with 0.02% trimethylamine (80:20 to 0:100). The collected fractions were evaporated under reduced pressure, to give 11 (4.7 mg, 7.77 mol, 73%).

##STR00004##

[0163] .sup.1H NMR (500 MHz, CDCl.sub.3) 7.96 (1H, br d, J=7.7 Hz, H-14), 7.19 (1H, dd, J=8.5 Hz, J=2.6 Hz, H-13), 7.05 (1H, br dd, J=8.1 Hz, J=1.8 Hz, H-10), 6.96 (1H, dd, J=8.1 Hz, J=2.6 Hz, H-11), 6.90 (2H, s, H-13, H-14), 6.64 (1H, s, H-10), 6.62 (1H, s, H-5), 6.39 (1H, s, H-5), 6.25 (1H, s, H-8), 5.57 (1H, br, H-1), 4.60 (2H, s, 1-NH.sub.2), 3.96 (3H, s, 12-OMe), 3.88 (3H, s, 6-OMe), 3.71-3.57 (2H, m, H-3), 3.32 (1H, d, J=14.2 Hz, H-), 3.27 (1H, br, H-1), 2.96-2.81 (6H, m, H-3, H-4, H-, H-), 2.78-2.71 (3H, m, H-3, H-4), 2.61-2.54 (1H, m, H-4), 2.34 (3H, s, N2-Me).

[0164] .sup.13C NMR (125 MHz, CDCl.sub.3) 157.4 (C-1), 154.9 (C-12), 150.1 (C-11), 147.5 (C-12), 146.7 (C-6), 139.7 (C-6 or C-7), 139.3 (C-6 or C-7), 139.1 (C-8), 137.6 (C-9), 135.1 (C-9), 134.9 (C-8a), 130.9 (C-14), 130.8 (C-4a), 130.6 (C-10), 130.2 (C-7), 128.5 (C-4a), 123.1 (C-13), 122.2 (C-14), 121.5 (C-11), 120.1 (C-8a), 117.7 (C-10), 115.9 (C-5), 114.5 (C-8), 112.3 (C-13), 106.6 (C-5), 67.1 (C-1), 56.6 (C-6-OMe), 56.4 (C-12-OMe), 52.2 (C-1), 51.2 (C-3), 46.1 (C-), 41.8 (CN2-Me), 41.1 (C-3), 40.3 (C-), 28.0 (C-4), 27.4 (C-4).

[0165] HRMS-ESI (m/z) calculated for C.sub.36H.sub.33N.sub.3O.sub.6 [M+H].sup.+: 606.2599; Found: 606.2598.

Example 3: Product 12

[0166] To a solution of trilobine (1) (6 mg10.68 mol) in 300 L of THF was added N,N-diisopropylethylamine (2 L11.78 mol) and N,N-diethyl-3-isothiocyanatopropan-1-amine (2 L11.07 mol). The mixture was stirred 16 h at RT in inert argon atmosphere. The reaction mixture was concentrated under reduced pressure and the residue was purified by semi-preparative X-Terra RP-18 HPLC, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (80:20 to 0:100), to give 12 (2 mg, 2.72 mol, 26%).

##STR00005##

[0167] .sup.1H NMR (500 MHz, CDCl.sub.3) 8.16 (1H, br, H-14), 7.92 (1H, br, 2-NH), 7.13 (1H, dd, J=8.3 Hz, J=2.3 Hz, H-13), 6.96 (1H, dd, J=8.4 Hz, J=2.0 Hz, H-11), 6.90-6.84 (3H, m, H-10, H-13, H-14), 6.68 (1H, s, H-5), 6.66 (1H, d, J=1.9 Hz, H-10), 6.63 (1H, br, H-1), 6.47 (1H, s, H-5), 6.44 (1H, s, H-8), 3.93 (3H, s, 12-OMe), 3.90 (3H, s, 6-OMe), 3.89-3.82 (6H, m, H-3, H-3, H-5), 3.63 (1H, br, H-1), 3.43 (1H, d, J=12.7 Hz, H-), 3.17-2.85 (9H, m, H-4, H-8, H-9, H-, H-), 2.66-2.74 (2H, m, H-4), 2.65-2.58 (2H, m, H-3), 2.28 (3H, s, N2-Me), 2.15-2.02 (2H, br, H-4), 1.20 (6H, br t, J=6.5 Hz, H-7, H-10).

[0168] .sup.13C NMR (125 MHz, CDCl.sub.3) 180.9 (C-1), 154.8 (C-12), 149.5 (C-11), 147.9 (C-12), 146.8 (C-6), 140.7 (C-6 or C-7), 139.5 (C-6 or C-7), 139.2 (C-8), 136.0 (C-9), 132.7 (C-9), 132.3 (C-14), 131.7 (C-4a), 130.6 (C-8a), 130.4 (C-10), 130.0 (C-4a and C-7), 132.1 (C-11), 122.7 (C-13), 121.1 (C-14), 119.4 (C-8a), 117.7 (C-10), 115.7 (C-5), 115.0 (C-8), 112.6 (C-13), 106.7 (C-5), 64.3 (C-1), 56.6 (C-6-OMe), 56.3 (C-12-OMe), 56.1 (C-1), 51.4 (C-3), 45.9 (C-8 and C-9), 44.6 (C-), 44.2 (C-3 and C-3 and C-5), 39.2 (CN2-Me), 36.3 (C-), 28.2 (C-4), 26.4 (C-4), 23.9 (C-4), 9.0 (C7 and C-10).

[0169] HRMS-ESI (m/z) calculated for C.sub.43H.sub.51N.sub.4O.sub.5S [M+H].sup.+: 735.3575; Found: 735.3572.

Example 4: Product 13

[0170] To a solution of trilobine (1) (6 mg10.68 mol) in 400 L of CH.sub.2Cl.sub.2 was added methanesulfonyl chlorure (2 L25.84 mol) and N,N-diisopropylethylamine (4.5 L26.46 mol). The mixture was stirred 12 h at RT in inert argon atmosphere. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (75:25 to 20:80), to give 13 (1.2 mg, 1.88 mol, 18%).

##STR00006##

[0171] .sup.1H NMR (500 MHz, CDCl.sub.3) 8.00 (1H, dd, J=8.5 Hz, J=2.2 Hz, H-14), 7.27-7.25 (1H, br, H-13), 7.12 (1H, dd, J=7.9 Hz, J=1.9 Hz, H-10), 7.02 (1H, dd, J=8.3 Hz, J=2.6 Hz, H-11), 6.87-6.90 (2H, m, H-13, H-14), 6.65 (1H, s, H-5), 6.60 (1H, d, J=1.7 Hz, H-10), 6.39 (1H, s, H-5), 6.19 (1H, s, H-8), 5.29 (1H, br, H-1), 4.04 (1H, m, H-3), 3.99 (3H, s, 12-OMe), 3.90 (3H, s, 6-OMe), 3.57-3.63 (1H, m, H-3), 3.50 (1H, br d, J=14.9 Hz, H-), 3.27 (1H, br t, J=3.3 Hz, H-1), 3.04-2.75 (7H, m, H-3, H-4, H-4, H-, H-), 2.78 (3H, s, 1-S-Me), 2.67-2.60 (2H, m, H-3, H-4), 2.41 (3H, s, N2-Me).

[0172] .sup.13C NMR (125 MHz, CDCl.sub.3) 154.8 (C-12), 150.3 (C-11), 147.4 (C-12), 147.1 (C-6), 139.5 (C-6 or C-7), 139.2 (C-6 or C-7), 139.1 (C-8), 137.6 (C-9), 137.8 (C-8a), 135.2 (C-9), 130.9 (C-10), 130.8 (C-4a), 130.3 (C-7), 129.8 (C-14), 126.8 (C-4a), 123.4 (13), 122.0 (C-14), 121.8 (C-11), 119.0 (C-8a), 117.5 (C-10), 116.0 (C-5), 114.5 (C-8), 112.2 (C-13), 107.0 (C-5), 67.6 (C-1), 56.6 (C-6-OMe), 56.4 (C-12-OMe), 54.1 (C-1), 50.7 (C-3), 45.8 (C-), 42.7 (CN2-Me), 41.1 (C-), 40.3 (C-3), 39.7 (C1-S-Me), 27.8 (C-4), 26.3 (C-4).

[0173] HRMS-ESI (m/z) calculated for C.sub.36H.sub.37N.sub.2O.sub.7S [M+H].sup.+: 641.2316; Found: 641.2332.

Example 5: Product 14

[0174] To a solution of trilobine (1) (6 mg10.68 mol) in 300 L of THF was added methyl isothiocyanate (1 L14.62 mol) and N,N-diisopropylethylamine (2 L11.76 mol). The mixture was stirred 12 h at RT in inert argon atmosphere. The reaction mixture was concentrated under reduced pressure and the residue was purified by semi-preparative X-Terra RP-18 HPLC, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (50:50 to 0:100), to give 14 (3.8 mg, 5.98 mol, 56%).

##STR00007##

[0175] .sup.1H NMR (500 MHz, CDCl.sub.3) 8.04 (1H, br, H-14), 7.14 (1H, dd, J=8.6 Hz, J=2.2 Hz, H-13), 6.97-6.90 (4H, m, H-10, H-11, H-13, H-14), 6.74 (1H, d, J=1.8 Hz, H-10), 6.66 (1H, s, H-5), 6.46 (1H, s, H-5), 6.39 (1H, s, H-8), 5.29 (1H, br, H-1), 6.37 (1H, m, H-3), 5.70 (1H, br, 2-NH), 3.96 (3H, s, 12-OMe), 3.91 (3H, s, 6-OMe), 3.84-3.89 (1H, m, H-3), 3.50 (1H, br d, J=13.7 Hz, H-), 3.37 (1H, br d, J=5.5 Hz, H-1), 3.26 (3H, d, J=4.5 Hz, 3-NH-Me), 3.10 (1H, m, H-4), 3.06-2.92 (5H, m, H-3, H-4, H-, H-), 2.79-2.72 (2H, m, H-3, H-4), 2.56 (1H, m, H-4), 2.26 (3H, s, N2-Me).

[0176] .sup.13C NMR (125 MHz, CDCl.sub.3) 182.0 (C-1), 155.6 (C-12), 149.6 (C-11), 147.9 (C-12), 147.0 (C-6), 139.9 (C-6 or C-7 or C-8), 139.4 (C-6 or C-7 or C-8), 139.1 (C-6 or C-7 or C-8), 135.8 (C-9), 134.7 (C-9), 134.0 (C-8a), 131.8 (C-4a), 131.6 (C-14), 130.4 (C-10), 130.3 (C-7), 129.2 (C-4a), 122.8 (C-13), 122.5 (C-14), 121.2 (C-11), 119.1 (C-8a), 118.3 (C-10), 115.8 (C-5), 114.5 (C-8), 112.5 (C-13), 106.6 (C-5), 66.0 (C-1), 56.7 (C-6-OMe), 56.4 (C-12-OMe), 56.1 (C-1), 51.8 (C-3), 44.9 (C-), 44.2 (C-3), 40.4 (CN2-Me), 38.9 (C-), 33.4 (C3-NH-Me), 28.0 (C-4), 26.7 (C-4).

[0177] HRMS-ESI (m/z) calculated for C.sub.37H.sub.38N.sub.3O.sub.5S [M+H].sup.+: 636.2527; Found: 636.2540.

Example 6: Product 15

[0178] To a solution of trilobine (1) (6 mg10.68 mol) in 300 L of THF was added cyanogen bromide (7 L15.42 mol) and N,N-diisopropylethylamine (3 L17.64 mol). The mixture was stirred 24 h at RT in inert argon atmosphere. The reaction mixture was concentrated under reduced pressure and the residue was purified by semi-preparative X-Terra RP-18 HPLC, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (50:50 to 0:100), to give 15 (0.8 mg, 1.36 mol, 13%).

##STR00008##

[0179] .sup.1H NMR (500 MHz, CDCl.sub.3) 7.73 (1H, dd, J=8.4 Hz, J=1.9 Hz, H-14), 7.30 (1H, dd, J=8.3 Hz, J=2.6 Hz, H-13), 7.17 (1H, dd, J=8.2 Hz, J=1.9 Hz, H-10), 7.03 (1H, dd, J=8.3 Hz, J=2.3 Hz, H-11), 6.90-6.86 (2H, m, H-13, H-14), 6.64 (1H, s, H-5), 6.56 (1H, d, J=1.5 Hz, H-10), 6.35 (1H, s, H-5), 6.17 (1H, s, H-8), 4.78 (1H, t, J=3.5 Hz, H-1), 3.98 (3H, s, 12-OMe), 3.88 (3H, s, 6-OMe), 3.57 (2H, m, H-3), 3.48 (1H, dd, J=15.7 Hz, J=2.7 Hz, H-), 3.28 (1H, br, H-1), 3.07 (1H, m, H-4), 3.06-2.92 (2H, m, H-, H-), 2.86 (1H, m, H-3), 2.78-2.70 (3H, m, H-4, H-4, H-), 2.67-2.61 (2H, m, H-3, H-4), 2.43 (3H, s, N2-Me).

[0180] .sup.13C NMR (125 MHz, CDCl.sub.3) 154.9 (C-12), 150.2 (C-11), 147.4 (C-12), 147.2 (C-6), 139.2 (C-6 or C-7), 139.1 (C-6 or C-7), 137.3 (C-9), 135.9 (C-8), 135.4 (C-9), 134.1 (C-8a), 131.3 (C-10), 130.6 (C-4a and C-7), 129.3 (C-14), 126.3 (C-4a), 123.3 (C-13), 122.1 (C-11 and C-14), 117.8 (C-1 and C-8a), 117.4 (C-10), 116.1 (C-5), 114.4 (C-8), 112.4 (C-13), 106.8 (C-5), 67.7 (C-1), 58.9 (C-1), 56.6 (C-6-OMe), 56.4 (C-12-OMe), 50.0 (C-3), 45.1 (C-), 42.7 (C-3), 42.9 (CN2-Me), 41.2 (C-), 27.8 (C-4), 27.0 (C-4).

[0181] HRMS-ESI (m/z) calculated for C.sub.36H.sub.34N.sub.3O.sub.5 [M+H].sup.+: 588.2500; Found: 588.2493.

Example 7: Product 16

[0182] To a solution of trilobine 1 (6 mg10.68 mol) in 300 L of ethanol was added 2 L acrylonitrile (133.17 mol) and 3 L of N-ethyl-N-isopropylpropan-2-amine (11.78 mol). The mixture was stirred 24 h at RT in inert argon atmosphere. The reaction mixture was concentrated under reduced pressure and the residue was purified by semi-preparative X-Terra RP-18 HPLC, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95:5 to 50:50), to give 16 (1. mg, 1.95 mol, 18%).

##STR00009##

[0183] .sup.1H NMR (500 MHz, MeOD) 7.66 (1H, dd, J=8.5 Hz, J=2.1 Hz, H-14), 7.18 (1H, dd, J=8.3 Hz, J=2.6 Hz, H-13), 7.14 (1H, dd, J=8.3 Hz, J=2.4 Hz, H-10), 7.02 (1H, d, J=8.3 Hz, H-13), 6.96 (1H, dd, J=8.3 Hz, J=2.1 Hz, H-14), 6.88 (1H, dd, J=8.3 Hz, J=2.6 Hz, H-11), 6.67 (1H, s, H-5), 6.65 (1H, d, J=2.0 Hz, H-10), 6.50 (1H, s, H-5), 6.32 (1H, s, H-8), 4.06 (1H, br, H-1), 3.93 (3H, s, 12-OMe), 3.83 (3H, s, 6-OMe), 3.61 (1H, br, H-1), 3.38 (2H, m, H-3, H-), 3.11 (1H, m, H-3), 3.05-2.72 (12H, m, H-1, H-2, H-3, H-4, H-4, H-, H-), 2.57 (1H, m, H-4), 2.53 (3H, s, N2-Me).

[0184] .sup.13C NMR (125 MHz, MeOD) 156.3 (C-12), 151.6 (C-11), 149.6 (C-12), 148.1 (C-6), 142.3 (C-6 or C-7), 141.5 (C-6 or C-7), 140.9 (C-9), 138.2 (C-8), 134.4 (C-9), 132.7 (C-8a), 132.5 (C-10), 131.5 (C-4a), 130.8 (C-7), 130.4 (C-14), 129.7 (C-4a), 123.6 (C-13), 123.5 (C-14), 122.4 (C-11), 121.0 (C-8a), 120.7 (C-3), 118.9 (C-10), 116.9 (C-5), 115.6 (C-8), 114.5 (C-13), 108.9 (C-5), 67.8 (C-1), 61.3 (C-1), 57.7 (C-6-OMe and C-12-OMe), 52.0 (C-3), 50.2 (C-1), 44.9 (C-), 43.6 (C-3), 41.3 (CN2-Me), 39.8 (C-), 27.0 (C-4), 23.6 (C-4), 18.1 (C-2).

[0185] HRMS-ESI (m/z) calculated for C.sub.38H.sub.38N.sub.3O.sub.5 [M+H].sup.+: 616.2806; Found: 616.2799.

Example 8: Product 17

[0186] To a solution of trilobine 1 (6 mg, 10.68 mol) in 2 mL of DMF was added 2-bromoacetonitrile (1 L14.35 mol), potassium iodide (0.5 mg3.01 mol) and potassium carbonate (2 mg14.47 mol). The mixture was stirred 24 h at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by semi-preparative X-Terra RP-18 HPLC, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (80:20 to 0:100), to give 17 (2.3 mg, 3.82 mol, 36%).

##STR00010##

[0187] .sup.1H NMR (500 MHz, MeOD) 7.68 (1H, dd, J=8.6 Hz, J=2.2 Hz, H-14), 7.20 (1H, dd, J=8.3 Hz, J=2.5 Hz, H-13), 7.13 (1H, dd, J=8.3 Hz, J=2.2 Hz, H-10), 7.01 (1H, d, J=8.2 Hz, H-13), 6.95 (1H, dd, J=8.2 Hz, J=2.2 Hz, H-14), 6.88 (1H, dd, J=8.3 Hz, J=2.6 Hz, H-11), 6.67 (1H, s, H-5), 6.60 (1H, d, J=2.0 Hz, H-10), 6.51 (1H, s, H-5), 6.25 (1H, s, H-8), 4.06 (1H, br, H-1), 3.92 (3H, s, 12-OMe), 3.86 (1H, m, H-1), 3.84 (3H, s, 6-OMe), 3.86 (1H, d, J=17.0 Hz, H-1), 3.62 (1H, br, H-1), 3.35 (2H, m, H-3, H-), 3.09 (1H, br m, H-3), 3.05-2.98 (3H, m, H-3, H-), 2.94-2.71 (5H, m, H-4, H-4, H-, H-), 2.66 (1H, m, H-4), 2.52 (3H, s, N2-Me).

[0188] .sup.13C NMR (125 MHz, MeOD) 156.3 (C-12), 151.7 (C-Hz), 149.4 (C-12), 148.2 (C-6), 142.3 (C-7), 141.3 (C-6), 140.5 (C-8), 140.3 (C-9), 134.4 (C-9), 133.2 (C-8a), 132.5 (C-10), 131.9 (C-4a), 131.0 (C-7), 130.3 (C-14), 129.4 (C-4a), 123.7 (C-11), 123.6 (C-14), 122.7 (C-13), 120.0 (C-8a), 118.8 (C-2 and C-10), 117.0 (C-5), 115.6 (C-8), 114.5 (C-13), 108.7 (C-5), 67.7 (C-1), 60.3 (C-1), 56.9 (C-6-OMe and C-12-OMe), 51.7 (C-3), 45.1 (C-3), 44.8 (C-), 42.6 (C-1), 41.3 (CN2-Me), 39.6 (C-), 27.0 (C-4), 24.5 (C-4).

[0189] HRMS-ESI (m/z) calculated for C.sub.37H.sub.36N.sub.3O.sub.5 [M+H].sup.+: 602.2649; Found: 602.2647.

Example 9: Product 18

[0190] ##STR00011##

[0191] To a solution of trilobine 1 (6 mg10.68 mol) in 2 mL of DMF was added 9-(4-chlorobutyl)-9H-purin-6-amine (3 mg13.29 mol), potassium iodide (0.5 mg3.01 mol) and potassium carbonate (5 mg36.18 mol). The mixture was stirred 24 hours at 70 C. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (80.20 to 0:100), to give 18 as a mixture of two rotamers in proportion 60/40 (1.8 mg, 2.26 mol, 21%).

##STR00012##

[0192] .sup.1H NMR (500 MHz, MeOD) 8.19/8.02 (1H, s, H-14), 8.15/8.00 (1H, s, H-8), 7.79/7.58 (1H, br d, J=7.7 Hz, H-14), 7.08 (1H, m, H-13), 7.03 (1H, d, J=8.2 Hz, H-13), 6.97 (2H, m, H-10, H-14), 6.81 (1H, br d, J=7.3 Hz, H-11), 6.74 (1H, s, H-5), 6.66/6.54 (1H, br, H-10), 6.63 (1H, s, H-5), 6.44/6.21 (1H, s, H-8), (1H, br d, J=7.3 Hz, H-1), 4.37-4.20 (4H, H-3, H-6), 3.91 (3H, s, 12-OMe), 3.87 (3H, s, 6-OMe), 3.80 (1H, br, H-1), 3.68-3.56 (2H, m, H-3), 3.33 (1H, m, H-3), 3.18 (1H, m, H-), 3.02-2.80 (8H, H-3, H-4, H-4, H-, H-), 2.52 (3H, s, N2-Me), 2.04 (2H, m, H-5), 1.73 (2H, m, H-4).

[0193] .sup.13C NMR (125 MHz, MeOD) 157.5 (C-1 or C-11), 157.3 (C-1 or C-11), 156.7/156.5 (C-12), 153.7/153.8 (C-14), 151.3/150.8 (C-11), 150.8/150.7 (C-16), 149.8/149.7 (C-12), 148.4/148.5 (C-6), 142.9/142.6 (C-8), 142.4 (C-6 or C-7), 141.1 (C-6 or C-7), 139.6 (C-8), 138.5/138.3 (C-9), 133.2 (C-9), 132.5 (C-4a), 132.3/131.5 (C-14), 132.0/131.8 (C-10), 131.7 (C-4a), 130.8 (C-7 and C-8a), 124.1/124.0 (C-14), 123.6/123.4 (C-13), 122.3/122.2 (C-11), 120.3 (C-10), 119.9 (C-8a), 119.0/118.9 (C-10), 117.0/117.1 (C-5), 115.9/115.4 (C-8), 114.6/114.5 (C-13), 108.9/108.7 (C-5), 66.4 (C-1), 67.0/66.2 (C-3), 57.0 (C-6-OMe and C-12-OMe), 53.8/53.9 (C-1), 52.6/52.1 (C-3), 46.9/46.7 (C-), 44.8/44.9 (C-6), 42.0/42.1 (C-3), 40.0 (CN2-Me), 37.5 (C-), 29.1 (C-4), 27.8 (C-5), 27.5 (C-4), 26.4 (C-4).

[0194] HRMS-ESI (m/z) calculated for C.sub.45H.sub.46N.sub.7O.sub.7 [M+H].sup.+: 796.3453; Found: 796.3442.

Example 10: Product 19

[0195] ##STR00013##

[0196] To a solution of trilobine 1 (6 mg10.68 mol) in 2 mL of DMF was added 9-(3-chloropropyl)-9H-purin-6-amine (3 mg14.17 mol), potassium iodide (0.5 mg3.01 mol) and potassium carbonate (5 mg36.18 mol). The mixture was stirred 24 hours at 70 C. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (80.20 to 0:100), to give 19 as a mixture of two rotamers in proportion 80/20 (1.8 mg, 2.30 mol, 22%).

##STR00014##

[0197] .sup.1H NMR (500 MHz, MeOD) 8.19/8.07 (1H, s, H-7), 8.14/7.98 (1H, s, H-13), 7.79/7.64 (1H, br d, J=8.3 Hz, H-14), 7.09 (1H, dd, J=8.1 Hz, J=2.3 Hz, H-13), 7.02 (1H, d, J=8.3 Hz, H-13), 6.98 (2H, m, H-10, H-14), 6.83 (1H, dd, J=8.2 Hz, J=2.1 Hz, H-11), 6.72 (1H, s, H-5), 6.65 (1H, br, H-10), 6.62 (1H, s, H-5), 6.42/6.35 (1H, s, H-8), 5.34 (1H, br d, J=7.3 Hz, H-1), 4.44-4.36 (2H, m, H-5), 4.32-4.17 (2H, m, H-3), 3.91 (3H, s, 12-OMe), 3.87 (3H, s, 6-OMe), 3.74 (1H, br, H-1), 3.66 (1H, m, H-3), 3.45 (1H, m, H-3), 3.17-2.77 (10H, H-3, H-4, H-4, H-, H-), 2.50/2.45 (3H, s, N2-Me), 2.35 (2H, m, H-4).

[0198] .sup.13C NMR (125 MHz, MeOD) 157.4 (C-1 or C-10), 156.9 (C-1 or C-10), 156.5 (C-12), 153.9 (C-13), 151.4 (C-11), 151.1 (C-15), 149.7 (C-12), 148.4 (C-6), 143.0 (C-7), 142.5 (C-6 or C-7), 141.1 (C-6 or C-7), 139.6 (C-8), 138.5 (C-9), 133.5 (C-9), 132.5 (C-4a), 132.3 (C-14), 131.9 (C-10), 131.6 (C-4a), 130.8 (C-7 and C-8a), 124.0 (C-14), 123.6 (C-13), 122.2 (C-11), 120.2 (C-9), 119.1 (C-10), 119.0 (C-8a), 117.0 (C-5), 115.7/115.9 (C-8), 114.5/114.6 (C-13), 108.8/108.6 (C-5), 66.7 (C-1), 64.7/64.4 (C-3), 57.0 (C-6-OMe and C-12-OMe), 53.7 (C-1), 52.6 (C-3), 47.0 (C-), 42.9 (C-5), 41.8 (C-3), 40.2 (CN2-Me), 37.5 (C-), 30.6/30.4 (C-4), 29.1/28.7 (C-4), 26.5 (C-4).

[0199] HRMS-ESI (m/z) calculated for C.sub.44H.sub.44N.sub.7O.sub.7 [M+H].sup.+: 782.3297; Found: 782.3296.

Examples 11 and 12: Products 20 and 21

[0200] To a solution of O-methylcocsoline 3 (6 mg10.68 mol) in 2 mL of DMF was added 2-bromoacetonitrile (3 mg25.01 mol), potassium iodide (0.5 mg3.01 mol) and potassium carbonate (5 mg36.18 mol). The mixture was stirred 24 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (95:5 to 0:100), to give 20 (0.2 mg, 0.33 mol, 3.1%) and 21 (1.4 mg, 2.08 mol, 19%).

##STR00015##

[0201] .sup.1H NMR (500 MHz, MeOD) 7.66 (1H, dd, J=8.2 Hz, J=2.4 Hz, H-14), 7.22 (1H, dd, J=8.0 Hz, J=2.2 Hz, H-10), 7.17 (1H, dd, J=8.5 Hz, J=2.6 Hz, H-13), 7.02-7.05 (2H, m, H-11, H-13), 6.96 (1H, dd, J=8.3 Hz, J=2.2 Hz, H-14), 6.62 (1H, s, H-5), 6.58 (1H, d, J=2.1 Hz, H-10), 6.53 (1H, s, H-5), 6.16 (1H, s, H-8), 4.13 (1H, br t, J=3.3 Hz, H-1), 4.00 (1H, d, J=17.4 Hz, H-1), 3.97 (3H, s, 12-OMe), 3.87 (3H, s, 6-OMe), 3.78 (1H, d, J=17.4 Hz, H-1), 3.46 (1H, br t, H-1), 3.41-3.19 (2H, m, H-3), 3.00-2.61 (10H, m, H-3, H-4, H-4, H-, H-), 2.58 (3H, s, N2-Me).

[0202] .sup.13C NMR (125 MHz, MeOD) 155.7 (C-12), 152.0 (C-11), 149.0 (C-12), 148.1 (C-6), 141.4 (C-6 or C-7 or C-8 or C-9), 141.2 (C-6 or C-7 or C-8 or C-9), 141.0 (C-6 or C-7 or C-8 or C-9), 140.5 (C-6 or C-7 or C-8 or C-9), 135.6 (C-8a), 135.4 (C-9), 132.6 (C-10), 131.6 (C-4a), 131.1 (C-7), 129.9 (C-14), 128.8 (C-4a), 123.8 (C-13), 123.2 (C-11), 122.8 (C-14), 121.1 (C-8a), 118.0 (C-10), 116.8 (C-5), 116.7 (C-2), 115.3 (C-8), 114.2 (C-13), 108.5 (C-5), 66.2 (C-1), 61.4 (C-1), 56.9 (C-6-OMe and C-12-OMe), 50.3 (C-3), 46.0 (C-3), 43.5 (C-), 43.2 (C-), 42.5 (C-1), 42.0 (CN2-Me), 28.9 (C-4), 24.6 (C-4).

[0203] HRMS-ESI (m/z) calculated for C.sub.37H.sub.36N.sub.3O.sub.5 [M+H].sup.+: 602.2649; Found: 602.2647.

##STR00016##

[0204] .sup.1H NMR (500 MHz, MeOD) 7.75 (1H, dd, J=8.5 Hz, J=2.2 Hz, H-14), 7.21 (1H, dd, J=8.2 Hz, J=2.4 Hz, H-10), 7.17 (1H, dd, J=8.4 Hz, J=2.7 Hz, H-13), 7.00-6.98 (2H, m, H-11, H-13), 6.92 (1H, dd, J=8.2 Hz, J=2.2 Hz, H-14), 6.57 (1H, s, H-5), 6.54 (1H, d, J=2.2 Hz, H-10), 6.47 (1H, s, H-5), 6.12 (1H, s, H-8), 4.24 (1H, br, J=3.3 Hz, H-1), 3.98 (1H, d, J=17.5 Hz, H-1), 3.94 (3H, s, 12-OMe), 3.88 (1H, m, H-1), 3.84 (3H, s, 6-OMe), 3.76 (2H, m, H-1 and H-1), 3.44 (1H, br, H-1), 3.18-2.56 (12H, m, H-3, H-3, H-4, H-4, H-, H-).

[0205] .sup.13C NMR (125 MHz, MeOD) 155.7 (C-12), 152.0 (C-11), 149.0 (C-12), 148.2 (C-6), 141.3 (C-6 or C-7 or C-8 or C-9), 141.0 (C-6 or C-7 or C-8 or C-9), 140.7 (C-6 or C-7 or C-8 or C-9), 135.8 (C-8a), 135.5 (C-9), 132.5 (C-10), 131.5 (C-4a), 131.1 (C-7), 129.7 (C-14), 129.0 (C-4a), 123.8 (C-13), 123.2 (C-11), 122.8 (C-14), 119.9 (C-8a), 119.0 (C-2), 118.1 (C-10), 116.8 (C-5), 116.7 (C-2), 115.3 (C-8), 114.3 (C-13), 108.4 (C-5), 66.3 (C-1), 60.3 (C-1), 56.9 (C-6-OMe and C-12-OMe), 49.6 (C-3), 45.2 (C-1 or C-3), 44.9 (C-1 or C-3), 43.6 (C- or C-), 43.5 (C- or C-), 42.5 (C-1), 28.9 (C-4), 24.0 (C-4).

[0206] HRMS-ESI (m/z) calculated for C.sub.38H.sub.34N.sub.4NaO.sub.5 [M+Na].sup.+: 649.2421; Found: 649.2415.

Example 13: Product 22

[0207] To a solution of O-methylcocsoline 3 (6 mg10.68 mol) in 2 mL of ethanol was added acrylonitrile (3 mg56.60 mol) and N-ethyl-N-isopropylpropan-2-amine (0.5 mg3.87 mol). The mixture was stirred 24 hours in inert argon atmosphere at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.1% formic acid (95:5 to 0:100), to give 22 (2.2 mg, 3.58 mol, 33%).

##STR00017##

[0208] .sup.1H NMR (500 MHz, MeOD) 7.65 (1H, dd, J=8.5 Hz, J=2.1 Hz, H-14), 7.20 (2H, m, H-10, H-13), 6.98 (2H, m, H-11, H-13), 6.90 (1H, dd, J=8.1 Hz, J=2.0 Hz, H-14), 6.58 (1H, s, H-5), 6.56 (1H, d, J=2.0 Hz, H-10), 6.54 (1H, s, H-5), 6.08 (1H, s, H-8), 4.29 (1H, br, H-1), 3.93 (3H, s, 12-OMe), 3.84 (3H, s, 6-OMe), 3.46 (1H, br t, J=3.4 Hz, H-1), 3.42-3.34 (2H, m, H-3, H-), 3.14 (1H, m, H-3), 3.05 (1H, m, H-4), 2.97-2.92 (2H, m, H-3, H-), 2.87-2.81 (2H, m, H-3, H-), 2.75-2.70 (5H, m, H-3, H-4, H-1, H-), 2.74 (3H, s, N2-Me), 2.67-2.57 (2H, m, H-4), 2.48 (2H, m, H-2).

[0209] .sup.13C NMR (125 MHz, MeOD) 156.3 (C-12), 151.8 (C-11), 149.0 (C-12), 148.6 (C-6), 141.3 (C-8), 140.8 (C-6 or C-7), 140.6 (C-6 or C-7), 139.4 (C-9), 136.6 (C-9), 136.3 (C-8a), 132.8 (C-10), 132.2 (C-4a), 131.4 (C-7), 129.9 (C-14), 127.8 (C-4a), 123.9 (C-13), 123.1 (C-11 or C-14), 123.0 (C-11 or C-14), 120.6 (C-3), 118.6 (C-8a), 118.4 (C-10), 116.9 (C-5), 115.3 (C-8), 114.3 (C-13), 108.4 (C-5), 66.4 (C-1), 61.9 (C-1), 57.0 (C-6-OMe and C-12-OMe), 49.4 (C-1), 47.0 (C-3), 46.3 (C-3), 42.7 (C-), 42.2 (C-), 41.4 (CN2-Me), 27.3 (C-4), 24.0 (C-4), 17.4 (C-2).

[0210] HRMS-ESI (m/z) calculated for C.sub.38H.sub.38N.sub.3O.sub.5 [M+H].sup.+: 616.2806; Found: 616.2807.

Example 14: Product 24

[0211] ##STR00018##

[0212] To a solution of O-methylcocsoline 3 (3 mg5.34 mol) in 200 L of DMF was added 9-(3-chloropropyl)-9H-purin-6-amine (13 mg61.42 mol), potassium iodide (0.5 mg3.01 mol) and potassium carbonate (8.5 mg36.18 mol). The mixture was stirred 24 hours at 70 C. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95.5 to 50:50), to give 24 (1.2 mg, 1.63 mol, 30%).

##STR00019##

[0213] .sup.1H NMR (500 MHz, MeOD) 8.19 (1H, s, H-11), 8.05 (1H, s, H-5), 7.66 (1H, dd, J=8.5 Hz, J=2.1 Hz, H-14), 7.25 (1H, dd, J=8.4 Hz, J=2.3 Hz, H-10), 7.18 (1H, dd, J=8.5 Hz, J=2.6 Hz, H-13), 7.00 (1H, dd, J=8.2 Hz, J=2.5 Hz, H-11), 6.80 (1H, d, J=8.3 Hz, H-13), 6.56-6.52 (3H, m, H-5, H-5, H-14), 6.49 (1H, d, J=2.1 Hz, H-10), 6.00 (1H, s, H-8), 4.24-4.28 (3H, m, H-1, H-3), 3.95 (3H, s, 12-OMe), 3.88 (3H, s, 6-OMe), 3.44 (1H, br d, J=16.4 Hz, H-), 3.38-3.34 (2H, m, H-1, H-3), 3.09 (1H, m, H-3), 2.96-2.75 (6H, m, H-3, H-4, H-, H-), 2.74 (3H, s, N2-Me), 2.67-2.58 (4H, m, H-1, H-4, H-), 2.49 (1H, m, H-1), 2.02 (2H, m, H-2).

[0214] .sup.13C NMR (125 MHz, MeOD) 157.4 (C-8), 156.0 (C-12), 153.8 (C-11), 151.8 (C-11), 150.9 (C-13), 148.8 (C-12), 148.6 (C-6), 143.0 (C-5), 141.3 (C-6 or C-7 or C-8), 140.8 (C-6 or C-7 or C-8), 140.7 (C-6 or C-7 or C-8), 139.8 (C-9), 136.4 (C-8a and C-9), 132.8 (C-10), 131.9 (C-4a), 131.3 (C-7), 129.8 (C-14), 128.0 (C-4a), 123.9 (C-13), 123.1 (C-11), 122.9 (C-14), 120.2 (C-7), 119.0 (C-8a), 118.1 (C-10), 116.8 (C-5), 115.2 (C-8), 113.9 (C-13), 108.3 (C-5), 66.6 (C-1), 61.8 (C-1), 57.0 (C-6-OMe or C-12-OMe), 56.9 (C-6-OMe or C-12-OMe), 51.3 (C-1), 46.8 (C-3), 46.4 (C-3), 43.2 (C-3), 42.2 (C-), 41.5 (CN2-Me), 41.3 (C-), 28.2 (C-2), 27.9 (C-4), 24.2 (C-4).

[0215] HRMS-ESI (m/z) calculated for C.sub.43H.sub.44N.sub.7O.sub.5 [M+H].sup.+: 738.3398; Found: 738.3383.

Example 15: Product 25

[0216] ##STR00020##

[0217] To a solution of O-methylcocsoline 3 (3 mg5.34 mol) in 200 L of DMF was added 9-(4-chlorobutyl)-9H-purin-6-amine (14 mg62.04 mol), potassium iodide (0.5 mg3.01 mol) and potassium carbonate (8.5 mg36.18 mol). The mixture was stirred 24 hours at 70 C. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95.5 to 50:50), to give 25 (2.1 mg, 2.80 mol, 52%).

##STR00021##

[0218] .sup.1H NMR (500 MHz, MeOD) 8.18 (1H, s, H-12), 8.08 (1H, s, H-6), 7.63 (1H, dd, J=8.2 Hz, J=2.4 Hz, H-14), 7.19 (2H, m, H-10, H-13), 6.96 (1H, d, J=8.4 Hz, H-13), 6.90 (2H, m, H-11, H-14), 6.65 (1H, s, H-5), 6.57 (2H, m, H-5, H-10), 6.17 (1H, s, H-8), 4.28 (1H, br d, J=4.1 Hz, H-1), 4.21 (2H, t, J=7.0 Hz, H-4), 3.92 (3H, s, 12-OMe), 3.85 (3H, s, 6-OMe), 3.66 (1H, br, H-1), 3.40 (2H, m, H-3, H-), 3.12 (1H, m, H-3), 3.09-2.95 (3H, m, H-3, H-), 2.87-2.79 (4H, m, H-4, H-, H-), 2.73 (3H, s, N2-Me), 2.69 (2H, m, H-4), 2.59 (2H, m, H-1), 1.87 (2H, m, H-3), 1.48 (2H, m, H-2).

[0219] .sup.13C NMR (125 MHz, MeOD) 157.4 (C-9), 156.4 (C-12), 153.8 (C-12), 151.6 (C-11), 150.9 (C-14), 149.3 (C-12), 148.7 (C-6), 142.8 (C-6), 141.9 (C-6 or C-7 or C-8), 140.9 (C-6 or C-7 or C-8), 140.5 (C-6 or C-7 or C-8), 139.0 (C-9), 134.9 (C-9), 133.8 (C8a), 132.7 (C-10), 132.2 (C-4a), 131.2 (C-7), 130.3 (C-14), 128.1 (C-4a), 123.9 (C-13), 123.5 (C-14), 122.8 (C-11), 120.1 (C-8), 118.6 (C-8a and C-10), 117.0 (C-5), 115.4 (C-8), 114.3 (C-13), 108.7 (C-5), 66.0 (C-1), 61.7 (C-1), 56.9 (C-6-OMe and C-12-OMe), 52.6 (C-1), 47.7 (C-3), 46.2 (C-3), 44.6 (C-4), 41.8 (C-), 41.5 (CN2-Me), 39.8 (C-), 28.9 (C-3), 26.6 (C-4), 24.5 (C-2), 24.2 (C-4).

[0220] HRMS-ESI (m/z) calculated for C.sub.44H.sub.46N.sub.7O.sub.5 [M+H].sup.+: 752.3555; Found: 752.3544.

Example 16: Product 27

[0221] ##STR00022##

[0222] To a solution of trilobine 1 (3 mg5.34 mol) in 200 L of MeCN was added 9-(4-chlorobutyl)-9H-purin-6-amine (10 mg44.31 mol), potassium iodide (0.5 mg3.01 mol) and potassium carbonate (8.5 mg36.18 mol). The mixture was stirred 24 hours at 70 C. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95.5 to 50:50), to give 27 (1.1 mg, 1.46 mol, 27%).

##STR00023##

[0223] .sup.1H NMR (500 MHz, MeOD) 8.16 (1H, s, H-12), 8.13 (1H, s, H-6), 7.42 (1H, dd, J=8.3 Hz, J=2.1 Hz, H-14), 7.12 (1H, dd, J=8.3 Hz, J=2.7 Hz, H-13), 7.09 (1H, dd, J=8.3 Hz, J=2.2 Hz, H-10), 7.04 (1H, d, J=8.4 Hz, H-13), 6.99 (1H, dd, J=8.2 Hz, J=2.1 Hz, H-14), 6.85 (1H, dd, J=8.3 Hz, J=2.7 Hz, H-11), 6.71 (1H, s, H-5), 6.64 (1H, d, J=1.9 Hz, H-10), 6.52 (1H, s, H-5), 6.33 (1H, s, H-8), 4.30 (2H, t, J=6.8 Hz, H-4), 4.12 (1H, d, J=5.9 Hz, H-1), 3.93 (3H, s, 12-OMe), 3.85 (3H, s, 6-OMe), 3.72 (1H, br, H-1), 3.31-3.27 (2H, m, H-3, H-), 3.21 (1H, m, H-3), 3.12-2.99 (3H, m, H-3, H-, H-), 2.94-2.86 (2H, m, H-4, H-4), 2.82-2.65 (5H, m, H-1, H-3, H-4, H-4), 2.54 (3H, s, N2-Me), 2.00 (2H, m, H-3), 1.70 (2H, br, H-2).

[0224] .sup.13C NMR (125 MHz, MeOD) 157.5 (C-9), 156.4 (C-12), 153.8 (C-12), 151.5 (C-11), 150.9 (C-14), 149.6 (C-12), 148.3 (C-6), 142.9 (C-6), 142.4 (C-6 or C-7 or C-8), 141.2 (C-6 or C-7 or C-8), 140.3 (C-6 or C-7 or C-8), 139.6 (C-9), 133.8 (C-9), 132.5 (C-10), 131.9 (C-4a), 131.4 (C-8a), 130.7 (C-7), 130.5 (C-14), 129.3 (C-4a), 123.9 (C-14), 123.7 (C-13), 122.6 (C-11), 120.1 (C-8), 119.8 (C-8a), 119.1 (C-10), 117.0 (C-5), 115.6 (C-8), 114.6 (C-13), 109.0 (C-5), 67.2 (C-1), 59.8 (C-1), 57.0 (C-6-OMe and C-12-OMe), 53.6 (C-1), 52.4 (C-3), 44.7 (C-4), 44.1 (C-), 43.0 (C-3), 40.6 (CN2-Me), 38.6 (C-), 29.1 (C-3), 26.7 (C-4), 25.5 (C-2), 23.9 (C-4).

[0225] HRMS-ESI (m/z) calculated for C.sub.44H.sub.46N.sub.7O.sub.5 [M+H].sup.+: 752.3555; Found: 752.3541.

Example 17: Product 28

[0226] ##STR00024##

[0227] To a solution of trilobine 1 (3 mg5.34 mol) in 200 L of DMF was added 9-(3-chloropropyl)-9H-purin-6-amine (10 mg47.25 mol), potassium iodide (0.5 mg3.01 mol) and triethylamine (10 L74.10 mol). The mixture was stirred 24 hours at 70 C. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95.5 to 50:50), to give 28 (1.7 mg, 2.31 mol, 43%).

##STR00025##

[0228] .sup.1H NMR (500 MHz, MeOD) 8.11 (1H, s, H-5), 8.09 (1H, s, H-11), 7.38 (1H, dd, J=8.3 Hz, J=2.1 Hz, H-14), 7.10 (1H, dd, J=8.3 Hz, J=2.7 Hz, H-13), 7.06 (1H, dd, J=8.3, J=2.1 Hz, H-10), 7.03 (1H, d, J=8.7 Hz, H-13), 6.99 (1H, dd, J=8.3 Hz, J=2.0 Hz, H-14), 6.81 (1H, dd, J=8.2 Hz, J=2.5 Hz, H-11), 6.71 (1H, s, H-5), 6.64 (1H, d, J=2.1 Hz, H-10), 6.46 (1H, s, H-5), 6.30 (1H, s, H-8), 4.37 (2H, m, H-3), 3.94 (1H, br, H-1), 3.92 (3H, s, 12-OMe), 3.83 (3H, s, 6-OMe), 3.77 (1H, br, H-1), 3.28-2.95 (7H, m, H-3, H-3, H-, H-), 2.94-2.60 (7H, m, H-1, H-3, H-4, H-4), 2.57 (3H, s, N2-Me), 2.22 (2H, m, H-2).

[0229] .sup.13C NMR (125 MHz, MeOD) 157.4 (C-8), 156.3 (C-12), 153.8 (C-11), 151.5 (C-11), 150.9 (C-13), 149.6 (C-12), 148.0 (C-6), 142.6 (C-5), 142.6 (C-6 or C-7 or C-8), 141.4 (C-6 or C-7 or C-8), 140.0 (C-6 or C-7 or C-8 and C-9), 133.5 (C-9), 132.5 (C-10), 131.7 (C-4a), 130.6 (C-8a and C-14), 130.4 (C-7), 129.7 (C-4a), 123.9 (C-14), 123.6 (C-13), 122.4 (C-11), 120.9 (C-8a), 120.2 (C-7), 119.2 (C-10), 117.0 (C-5), 115.7 (C-8), 114.6 (C-13), 108.9 (C-5), 67.0 (C-1), 59.7 (C-1), 57.0 (C-6-OMe or C-12-OMe), 56.9 (C-6-OMe or C-12-OMe), 52.5 (C-3), 51.7 (C-1), 43.8 (C-3), 43.5 (C-3), 42.5 (C-), 40.6 (CN2-Me), 38.1 (C-), 28.4 (C-2), 26.5 (C-4), 24.8 (C-4).

[0230] HRMS-ESI (m/z) calculated for C.sub.43H.sub.44N.sub.7O.sub.5 [M+H].sup.+: 738.3398; Found: 738.3387.

Example 19: Product 30

[0231] To a solution of trilobine 1 (3 mg5.34 mol) in 250 L of DMF was added 2,5-dimethylenepyrrolidin-1-yl-4-((2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)methyl)cyclohexanecarboxylate (6 mg18.16 mol) and triethylamine (10 L74.10 mol). The reaction mixture was stirred 18 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95.5 to 50:50), to give 30 (2.1 mg, 2.69 mol, 50%).

##STR00026##

[0232] .sup.1H NMR (500 MHz, MeOD) 7.87 (1H, dd, J=8.6 Hz, J=2.0 Hz, H-14), 7.07 (1H, dd, J=8.6 Hz, J=2.5 Hz, H-13), 7.00 (1H, d, J=8.1 Hz, H-13), 6.97 (2H, m, H-10, H-14), 6.82 (1H, m, H-11), 6.80 (2H, s, H-11, H-12), 6.71 (1H, s, H-5), 6.65 (1H, d, J=2.2 Hz, H-10), 6.64 (1H, s, H-5), 6.38 (1H, s, H-8), 5.79 (1H, br d, J=7.2 Hz, H-1), 3.91 (3H, s, 12-OMe), 3.87 (3H, s, 6-OMe), 3.87-3.73 (2H, m, H-3), 3.69 (1H, br, H-1), 3.38 (2H, m, H-8), 3.14 (1H, d, J=13.7 Hz, H-), 3.10-2.85 (7H, m, H-3, H-4, H-, H-), 2.82-2.77 (2H, m, H-4), 2.67 (1H, m, H-2), 2.48 (3H, s, N2-Me), 1.98-1.93 (2H, m, H-3 or H-4, or H-6 or H-7), 1.82-1.71 (3H, m, H-3 or H-4, or H-6 or H-7 and H-5), 1.59-1.50 (2H, m, (2H, m, H-3 or H-4, or H-6 or H-7), 1.19-1.05 (2H, m, H-3 or H-4, or H-6 or H-7).

[0233] .sup.13C NMR (125 MHz, MeOD) 177.1 (C-1), 173.0 (C-10 and C-13), 156.5 (C-12), 151.4 (C-11), 149.6 (C-12), 148.4 (C-6), 142.4 (C-6 or C-7 or C-8), 141.1 (C-6 or C-7 or C-8), 140.0 (C-6 or C-7 or C-8), 138.5 (C-9), 135.5 (C-11 and C-12), 133.8 (C-9), 132.4 (C-4a and C-10), 131.8 (C-14), 131.5 (C-4a and C-8a), 131.0 (C-7), 123.9 (C-14), 123.6 (C-13), 122.1 (C-11), 120.0 (C-8a), 119.0 (C-10), 116.9 (C-5), 115.8 (C-8), 114.5 (C-13), 108.5 (C-5), 66.7 (C-1), 57.0 (C-6-OMe or C-12-OMe), 56.9 (C-6-OMe or C-12-OMe), 52.5 (C-3), 51.8 (C-1), 47.1 (C-), 44.7 (C-8), 43.2 (C-3), 42.2 (C-2), 40.4 (CN2-Me), 38.2 (C-5), 37.7 (C-), 31.1 (C-4 or C-6), 31.0 (C-4 or C-6), 30.0 (C-4 or C-3 or C-7), 29.9 (C-4 or C-3 or C-7), 26.6 (C-4).

[0234] HRMS-ESI (m/z) calculated for C.sub.47H.sub.48N.sub.3O.sub.8 [M+H].sup.+: 782.3436; Found: 782.3436.

Example 20: Product 31

[0235] To a solution of acryloyl chloride (150 L1.85 mmol) and de N-hydroxysuccinimide (212 mg1.85 mmol) in 250 L of DMF was added trilobine 1 (3 mg5.34 mol) and triethylamine (10 L74.10 mol). The mixture was stirred 18 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95.5 to 50:50), to give 31 (2.6 mg, 4.22 mol, 79%).

##STR00027##

[0236] .sup.1H NMR (500 MHz, DMSO-d.sub.6) 8.04 (1H, dd, J=8.6 Hz, 1.7 Hz, H-14), 7.16 (2H, m, H-10, H-13), 7.02 (1H, dd, J=8.0 Hz, J=2.5 Hz, H-11), 6.99 (1H, d, J=8.3 Hz, H-13), 6.94-6.88 (2H, m, H-2, H-14), 6.66 (1H, s, H-5), 6.63 (1H, s, H-5), 6.47 (1H, d, J=1.9 Hz, H-10), 6.25 (1H, dd, J=16.6 Hz, J=2.2 Hz, H-3), 6.06 (1H, s, H-8), 5.88 (1H, br, H-1), 5.77 (1H, dd, J=10.5 Hz, J=2.2 Hz, H-3), 4.09 (1H, m, H-3), 3.86 (3H, s, 12-OMe), 3.79 (3H, s, 6-OMe), 3.66 (1H, m, H-3), 3.32 (1H, br d, J=16.0 Hz, H-), 3.07 (1H, br, H-1), 2.96 (1H, dd, J=15.7 Hz, J=5.5 Hz, H-), 2.88-2.70 (5H, m, H-3, H-4, H-), 2.63-2.56 (2H, m, H-4), 2.46 (1H, m, H-3), 2.25 (3H, s, N2-Me).

[0237] .sup.13C NMR (125 MHz, DMSO-d.sub.6) 164.1 (C-1), 153.7 (C12), 149.7 (C-11), 146.7 (C-12), 146.2 (C-6), 138.8 (C-6 or C-7 or C-8), 138.6 (C-6 or C-7 or C-8), 138.2 (C-6 or C-7 or C-8), 137.9 (C-9), 135.5 (C-8a), 134.7 (C-9), 130.7 (C-4a and C-10), 130.3 (C-14), 128.9 (C-7), 128.5 (C2 and C-4a), 128.1 (C-3), 122.3 (C-13), 121.8 (C-14), 121.4 (C-11), 119.1 (C-8a), 116.4 (C-10), 115.4 (C-5), 113.5 (C-8), 112.6 (C-13), 107.2 (C-5), 67.2 (C-1), 56.0 (C-6-OMe or C-12-OMe), 55.7 (C-6-OMe or C-12-OMe), 49.9 (C-3), 49.7 (C-1), 45.1 (C-), 42.4 (CN2-Me), 40.4 (C- or C-3), 40.3 (C- or C-3), 28.2 (C-4), 27.3 (C-4).

[0238] HRMS-ESI (m/z) calculated for C.sub.38H.sub.37N.sub.2O.sub.6 [M+H].sup.+: 617.2646; Found: 617.2654.

Example 21: Product 32

[0239] To a solution of 3-chloropropanoyl chloride (100 L1.04 mmol) and N-hydroxysuccinimide (12 mg107.97 mol) in 250 L of DMF was added trilobine 1 (3 mg5.34 mol) and trimethylamine (10 L74.10 mol). The mixture was stirred 48 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95.5 to 50:50), to give 32 (0.7 mg, 1.07 mol, 20%).

##STR00028##

[0240] .sup.1H NMR (500 MHz, MeOD) 7.91 (1H, dd, J=8.2 Hz, 2.0 Hz, H-14), 7.10 (H, dd, J=8.4 Hz, J=2.6 Hz, H-13), 7.02 (2H, m, H-10, H-13), 6.97 (1H, dd, J=8.1 Hz, J=2.0 Hz, H-14), 6.86 (1H, dd, J=8.1 Hz, J=2.5 Hz, H-11), 6.70 (1H, s, H-5), 6.66 (1H, d, J=2.1 Hz, H-10), 6.65 (1H, s, H-5), 6.38 (1H, s, H-8), 5.83 (1H, br dd, J=7.6 Hz, J=1.7 Hz, H-1), 3.92 (3H, s, 12-OMe), 3.91-3.88 (2H, m, H-3 or H-3), 3.87 (3H, s, 6-OMe), 3.72 (2H, m, H-3 or H-3), 3.60 (1H, br, H-1), 3.22 (1H, br d, J=14.1 Hz, H-), 3.11-2.71 (11H, m, H-2, H-3, H-4, H-4, H-, H-), 2.43 (3H, s, N2-Me).

[0241] .sup.13C NMR (125 MHz, MeOD) 171.1 (C-1), 156.6 (C12), 151.4 (C-11), 149.5 (C-12), 148.5 (C-6), 142.2 (C-6 or C-7 or C-8), 141.0 (C-6 or C-7 or C-8), 140.0 (C-6 or C-7 or C-8), 138.5 (C-9), 134.1 (C-9), 132.5 (C-4a and C-14), 132.2 (C-8a), 131.8 (C-7 and C-10), 131.4 (C-4a), 123.9 (C-14), 123.6 (C-13), 122.2 (C-11), 119.9 (C-8a), 119.0 (C-10), 116.9 (C-5), 115.7 (C-8), 114.4 (C-13), 108.5 (C-5), 66.9 (C-1), 57.0 (C-6-OMe and C-12-OMe), 52.5 (C-3), 52.0 (C-1), 46.9 (C-), 43.4 (C-3 or C-3), 41.0 (C-3 or C-3), 40.6 (CN2-Me), 38.3 (C-), 37.7 (C-2), 29.5 (C-4), 26.9 (C-4).

[0242] HRMS-ESI (m/z) calculated for C.sub.38H.sub.38ClN.sub.2O.sub.6[M+H].sup.+: 653.2398; Found: 653.2413.

Example 22: Product 33

[0243] To a solution of N,N-dicyclohexylcarbodiimide (100 L460 mol) and N-hydroxysuccinimide (12 mg107.97 mol) in 250 L of DMF was added trilobine 1 (3 mg5.34 mol) and triethylamine (10 L74.10 mol). The mixture was stirred 48 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (95.5 to 50:50), to give 33 (0.4 mg, 0.59 mol, 11%).

##STR00029##

[0244] .sup.1H NMR (500 MHz, MeOD) 8.01 (1H, dd, J=8.6 Hz, J=2.2 Hz, H-14), 7.95 (2H, m, H-10), 7.00 (1H, d, J=8.3 Hz), 6.95-6.86 (3H, m), 6.72 (1H, m), 6.64 (1H, s), 6.61 (1H, s), 6.27 (1H, s, H-8), 5.92 (1H, dd, J=6.6 Hz, J=1.8 Hz, H-1), 3.93 (3H, s, 12-OMe), 3.86 (3H, s, 6-OMe), 3.26 (2H, m), 3.02-2.64, 10H, m), 2.35-6-2.34 (9H, m, N2-Me, N5-Me).

[0245] .sup.13C NMR (125 MHz, MeOD) 167.0, 156.6, 149.3, 148.5, 142.7, 140.9, 140.2, 132.3 (C-14), 131.8 (C-10), 125.6, 123.6, 122.5, 119.0, 116.8, 115.4 (C-8), 114.3, 108.4 (C-5), 68.0, 61.4, 57.0 (C-6-OMe and C-12-O-Me), 52.3 (C-1), 52.2, 49.9, 45.4 (CN5-Me), 43.3, 41.4 (CN2-Me), 33.3, 29.7, 27.6.

[0246] HRMS-ESI (m/z) calculated for C.sub.41H.sub.44N.sub.3O.sub.6 [M+H].sup.+: 674.3225; Found: 674.3204.

Example 23: Products 1, 2, 3 and 7

[0247] ##STR00030## ##STR00031##

[0248] To an ice-cooled solution of product 34 (48.5 mg79.77 mol) in 800 L of methanol was added iron sulphate heptahydrate (82 mg294.95 mol). The reaction was stirred 48 hours at RT. Then, the reaction mixture was concentrated under reduced pressure. The residue was dissolved with EDTA (10 mL0.1M) and adjusted at pH=10 with ammoniac. The solution was extracted by a liquid-liquid extraction with dichloromethane. The organic phase was dried with sulfate magnesium and concentrated under reduced pressure. The residue was purified by silica gel column with a linear gradient of dichloromethane-methanol 1% NH.sub.3 (100:0 to 90:10), to give nortrilobine 7 (6.4 mg, 19.08 mol, 15%), trilobine 1 (5.6 mg, 9.96 mol, 12%), isotrilobine 2 (3.9 mg, 6.77 mol, 9%) and O-methylcocsoline 3 (4 mg, 7.12 mol, 9%).

##STR00032##

[0249] .sup.1H NMR (500 MHz, MeOD) 7.64 (1H, dd, J=8.3 Hz, J=1.9 Hz, H-14), 7.15 (2H, m, H-10, H-13), 6.96 (1H, d, J=8.3 Hz, H-13), 6.93 (1H, dd, J=8.3 Hz, J=2.7 Hz, H-11), 6.87 (1H, dd, J=8.1 Hz, J=2.0 Hz, H-14), 6.52 (1H, s, H-5), 6.49 (1H, d, J=2.0, H-10), 6.43 (1H, s, H-5), 6.07 (1H, s, H-8), 4.27 (1H, t, J=3.3 Hz, H-1), 3.92 (3H, s, 12-OMe), 3.78 (3H, s, 6-OMe), 3.27 (1H, m, H-), 3.22 (1H, m, H-1), 3.15-3.10 (2H, m, H-3), 2.92-2.56 (9H, m, H-3, H-4, H-4, H-, H-), 2.39 (3H, s, N2-Me).

[0250] .sup.13C NMR (125 MHz, MeOD) 155.7 (C-12), 151.8 (C-11), 148.8 (C-12), 147.8 (C-6), 141.2 (C-6 or C-7 or C-9), 141.0 (C-6 or C-7 or C-9), 140.1 (C-8), 136.4 (C-9), 136.2 (C-8a), 132.5 (C-10), 131.0 (C-4a), 130.8 (C-7), 129.8 (C-4a), 129.6 (C-14), 123.5 (C-13), 123.2 (C-14), 122.8 (C-11), 122.4 (C-8a), 118.3 (C-10), 116.7 (C-5), 115.3 (C-8), 114.1 (C-13), 108.4 (C-5), 68.8 (C-1), 56.9 (C-6-OMe), 56.8 (C-12-OMe), 54.7 (C-1), 50.5 (C-3), 45.6 (C-), 42.9 (CN2-Me), 41.9 (C-), 39.3 (C-3), 28.7 (C-4), 28.1 (C-4).

[0251] HRMS-ESI (m/z) calculated for C.sub.35H.sub.35N.sub.2O.sub.5 [M+H].sup.+: 563.2540; Found: 563.2541.

##STR00033##

[0252] .sup.1H NMR (500 MHz, MeOD) 7.63 (1H, dd, J=8.4 Hz, J=2.0 Hz, H-14), 7.18 (1H, dd, J=7.8 Hz, J=2.0 Hz, H-10), 7.16 (1H, dd, J=8.2 Hz, J=2.5 Hz, H-13), 6.98 (1H, d, J=8.3 Hz, H-13), 6.95 (1H, dd, J=8.2 Hz, J=2.8 Hz, H-11), 6.91 (1H, dd, J=8.3 Hz, J=2.0 Hz, H-14), 6.58 (1H, s, H-5), 6.56 (1H, d, J=1.9, H-10), 6.49 (1H, s, H-5), 6.13 (1H, s, H-8), 4.10 (1H, m, H-1), 3.93 (3H, s, 12-OMe), 3.83 (3H, s, 6-OMe), 3.35 (1H, m, H-), 3.21 (1H, m, H-1), 3.17 (H, m, H-3), 3.00-2.88 (4H, m, H-3, H-3, H-4, H-), 2.81-2.60 (5H, H-3, H-4, H-4, H-, H-), 2.57 (3H, s, N2-Me), 2.37 (3H, s, N2-Me).

[0253] .sup.13C NMR (125 MHz, MeOD) 156.0 (C-12), 151.9 (C-11), 148.9 (C-12), 148.0 (C-6), 141.4 (C-6 or C-7 or C-8 or C-9), 141.0 (C-6 or C-7 or C-8 or C-9), 140.8 (C-6 or C-7 or C-8 or C-9), 140.5 (C-6 or C-7 or C-8 or C-9), 136.2 (C-9), 135.8 (C-8a), 132.6 (C-10), 131.5 (C-4a) 130.9 (C-7), 130.0 (C-14), 128.8 (C-4a), 123.8 (C-13), 123.3 (C-13), 122.9 (C-11), 121.1 (C-8a), 118.4 (C-1), 116.8 (C-5), 115.2 (C-8), 114.2, C-13), 108.4 (C-5), 68.9 (C-1), 61.5 (C-1), 56.9 (C-6-OMe and C-12-OMe), 51.8 (C-3), 46.0 (C-3), 42.6 (CN2-Me), 42.4 (C-), 42.0 (CN2-Me), 41.6 (C-), 28.1 (C-4), 24.6 (C-4).

[0254] HRMS-ESI (m/z) calculated for C.sub.36H.sub.37N.sub.2O.sub.5 [M+H].sup.+: 577.2697; Found: 577.2698.

##STR00034##

[0255] .sup.1H NMR (500 MHz, CDCl.sub.3) 7.55 (1H, dd, J=8.3 Hz, J=2.1 Hz, H-14), 7.25 (1H, dd, J=8.3 Hz, J=2.7 Hz, H-13), 7.14 (1H, dd, J=8.3 Hz, J=2.1 Hz, H-10), 6.91 (3H, m, H-11, H-13, H-14), 6.65 (1H, s, H-5), 6.64 (1H, d, J=1.9 Hz, H-10), 6.35 (H, s, H-5), 6.21 (1H, s, H-8), 4.00 (1H, m, H-1), 3.99 (3H, s, 12-OMe), 3.88 (3H, s, 6-OMe), 3.62 (1H, d, J=4.6 Hz, H-1), 3.34 (1H, d, J=14.5 Hz, H-), 3.20-3.11 (2H, m, H-3, H-3), 3.03-2.90 (4H, H-3, H-3, H-4, H-), 2.78-2.72 (2H, m, H-4, H-), 2.66 (1H, m, H-), 2.63 (3H, s, N2-Me), 2.59-2.50 (2H, m, H-4, H-4).

[0256] .sup.13C NMR (125 MHz, CDCl.sub.3) 154.9 (C-12), 150.2 (C-6), 147.7 (C-11), 146.2 (C-6), 139.9 (C-6 or C-7 or C-8 or C-9), 139.6 (C-6 or C-7 or C-8 or C-9), 139.5 (C-6 or C-7 or C-8 or C-9), 139.3 (C-6 or C-7 or C-8 or C-9), 136.4 (C-8a), 134.7 (C-9), 131.7 (C-10), 131.2 (C-4a), 129.7 (C-7), 128.9 (C-14), 127.6 (C4a), 122.6 (C-13), 122.1 (C-14), 121.5 (C-11), 121.1 (C-8a), 117.9 (C-10), 116.5 (C-5), 113.2 (C-8), 112.7 (C-13), 106.9 (C-5), 60.7 (C-1 and C-1), 56.5 (C-6-OMe and C-12-OMe), 45.1 (C-3), 44.1 (C-), 43.2 (C-3), 42.4 (CN2-Me), 41.7 (C-), 29.0 (C-4), 24.3 (C-4).

[0257] HRMS-ESI (m/z) calculated for C.sub.35H.sub.35N.sub.2O.sub.5 [M+H].sup.+: 563.2540; Found: 563.2544.

##STR00035##

[0258] .sup.1H NMR (500 MHz, MeOD) 7.58 (1H, dd, J=8.4 Hz, J=2.2 Hz, H-14), 7.20 (1H, dd, J=8.3 Hz, J=2.6 Hz, H-13), 7.07 (1H, dd, J=8.3 Hz, J=2.2 Hz, H-10), 7.04 (1H, d, J=8.4 Hz, H-13), 7.02 (1H, dd, J=8.3 Hz, J=2.0 Hz, H-14), 6.74 (1H, dd, J=8.4 Hz, J=2.5 Hz, H-11), 6.62 (1H, s, H-5), 6.61 (1H, d, J=1.8 Hz, H-10), 6.57 (1H, s, H-5), 6.27 (1H, s, H-8), 4.37 (1H, dd, J=5.8 Hz, J=1.5 Hz, H-1), 3.91 (3H, s, 12-OMe), 3.80 (1H, m, H-1), 3.79 (3H, s, 6-OMe), 3.45-3.34 (3H, m, H3, H-), 3.19 (1H, m, H-3), 3.12-2.98 (H-3, H-4, Ha), 2.93-2.88 (3H, m, H-4, H-, H-), 2.83 (1H, m, H-4), 2.71 (1H, m, H-4).

[0259] .sup.13C NMR (125 MHz, MeOD) 157.3 (C-12), 151.3 (C-11), 149.8 (C-12), 148.7 (C-6), 142.0 (C-6 or C-7), 141.0 (C6 or C-7), 139.9 (C-8), 138.4 (C-9), 133.8 (C-9), 133.5 (C-8a), 132.7 (C-4a and C-10), 130.9 (C-7), 130.5 (C-14), 128.6 (C-4a), 124.2 (C-14), 123.6 (C-13), 122.3 (C-11), 119.6 (C-10), 119.2 (C-8a), 117.2 (C-5), 114.8 (C-13), 114.6 (C-8), 108.9 (C-5), 59.7 (C-1), 57.0 (C-6-OMe or C-12-OMe), 56.9 (C-6-OMe or C-12-OMe), 54.3 (C-1), 44.2 (C-), 42.6 (C-3), 40.8 (C-), 38.2 (C-3), 27.6 (C-4), 26.9 (C-4).

[0260] HRMS-ESI (m/z) calculated for C.sub.34H.sub.33N.sub.2O.sub.5 [M+H].sup.+: 549.2384; Found: 549.2388.

Example 24: Product 41

[0261] To a solution of nortrilobine 7 (7.5 mg13.69 mol) in 500 L of tetrahydrofuran was added 3-(diethylamino)propylisothiocyanate (5 L29.02 mol) and N-ethyl-N-isopropylpropan-2-amine (5 L29.40 mol). The mixture was stirred 24 hours at RT in inert argon atmosphere. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (80:20 to 0:100), to give 41 (6.2 mg, 6.95 mol, 51%).

##STR00036##

[0262] .sup.1H NMR (500 MHz, MeOD) 8.35 (1H, br, H-14), 7.12 (1H, br, H-10), 7.07 (1H, br, H-13), 7.00 (1H, br, H-11), 6.97 (1H, d, J=8.2 Hz, H-13), 6.80 (1H, br d, J=8.3 Hz, H-14), 6.75 (1H, br, H-10), 6.60 (1H, br s, H-5), 6.50 (1H, br s, H-5), 6.03 (1H, br s, H-8), 3.94 (3H, s, 12-OMe), 3.84 (3H, s, 6-OMe), 3.80 (2H, m, H-3 or H-3), 3.71-3.60 (4H, m, H-3, H-3 or H-3), 3.47 (1H, br d, J=15.9 Hz, H-), 3.14-3.05 (8H, m, H-7, H-7, H-9, H-9), 3.03-2.87 (8H, m, H-4, H-5, H-5, H-, H-), 2.79-2.68 (2H, m, H-4, H-4), 2.58 (1H, br d, J=16.3 Hz, H-4), 2.06 (2H, br, H-4 or H-4), 1.91 (2H, br, H-4 or H-4), 1.24 (12H, br t, J=7.1 Hz, H-8, H-10).

[0263] .sup.13C NMR (125 MHz, MeOD) 182.1 (C-1 or C-1), 182.0 (C-1 or C-1), 156.7 (C12), 151.7 (C-11), 149.5 (C-12), 148.2 (C-6), 141.6 (C-6 or C-7), 141.1 (C-6 or C-7), 140.4 (C-8), 139.4 (C-9), 135.7 (C-4a), 135.2 (C-9), 132.2 (C-10 and C-14), 131.4 (C-8a), 130.9 (C-7), 129.9 (C-4a), 124.2 (C-14), 123.3 (C-13), 122.5 (C-11), 121.4 (C-8a), 118.7 (C-10), 117.1 (C-5), 115.0 (C-8), 114.1 (C-13), 108.5 (C-5), 62.7 (C-1), 59.1 (C-1), 57.0 (C-6-OMe and C-12-OMe), 50.6 (C-5 or C-5), 50.5 (C-5 or C-5), 48.2 (C-7 or C-7 or C-9 or C-9), 48.0 (C-7 or C-7 or C-9 or C-9), 46.2 (C-), 45.9 (C-), 44.1 (C3 or C3), 43.9 (C3 or C3), 42.8 (C-3), 28.7 (C-4), 27.9 (C-4), 25.7 (C-4 and C-4), 9.6 (C-8 or C-8 or C-10 or C-10), 9.5 (C-8 or C-8 or C-10 or C-10).

[0264] HRMS-ESI (m/z) calculated for C.sub.50H.sub.64N.sub.6O.sub.5S.sub.2[M+H].sup.+: 893.4452; Found: 893.4450.

Example 25: Product 42

[0265] To a solution of O-methylcosoline 3 (6.3 mg11.21 mol) in 300 L of tetrahydrofuran was added N,N-diethyl-3-isothiocyanatopropan-1-amine (3 L11.07 mol) and triethylamine (3 L22.22 mol). The mixture was stirred 20 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 1% formic acid (80:20 to 0:100), to give 42 (6 mg, 8.17 mol, 73%).

##STR00037##

[0266] .sup.1H NMR (500 MHz, MeOD) 7.66 (1H, br dd, J=8.4 Hz, J=1.6 Hz, H-14), 7.21 (2H, dd, J=8.5 Hz, J=2.3 Hz, H-10, H-13), 7.09 (1H, br dd, J=8.3 Hz, J=2.5 Hz, H-11), 6.94 (1H, d, J=8.1 Hz, H-13), 6.78-6.74 (2H, m, H-10, H14), 6.60 (1H, s, H-5), 6.50 (1H, s, H-5), 5.98 (1H, s, H-8), 4.20 (1H, br t, J=3.2 Hz, H-1), 3.94 (3H, s, 12-OMe), 3.82 (3H, s, 6-OMe), 3.69 (2H, m, H-3), 3.39 (1H, br d, J=15.6 Hz, H-), 3.28 (1H, m, H-3), 3.20 (4H, q, J=7.3 Hz, H-7, H-9), 3.12-3.06 (3H, m, H-3, H-), 3.12-3.06 (3H, m, H-3, H-5), 2.99 (1H, m, H-4), 2.92-2.87 (2H, m, H-), 2.86-2.74 (3H, m, H-4, H-4, H-), 2.67 (3H, s, N2-Me), 2.63 (1H, m, H-4), 1.97 (2H, br, H-4), 1.28 (6H, br t, J=7.5 Hz, H-8, H-10).

[0267] .sup.13C NMR (125 MHz, MeOD) 182.3 (C-1), 156.7 (C12), 151.7 (C-11), 149.5 (C-12), 148.4 (C-6), 141.6 (C-6 or C-7 or C-8), 141.2 (C-6 or C-7 or C-8), 140.8 (C-6 or C-7 or C-8), 140.2 (C-9), 135.8 (C-8a), 135.1 (C-9), 132.6 (C-10), 131.4 (C-4a or C-7), 131.2 (C-4a or C-7), 129.5 (C-14), 128.3 (C-4a), 124.2 (C-14), 123.8 (C-13), 122.9 (C-11), 119.0 (C-8a), 118.5 (C-10), 117.0 (C-5), 115.0 (C-8), 114.0 (C-13), 108.2 (C-5), 62.8 (C-1), 62.0 (C-1), 57.0 (C-6-OMe or C-12-OMe), 56.9 (C-6-OMe or C-12-OMe), 50.3 (C-5), 48.1 (C-7 and C-9), 46.5 (C-3), 46.1 (C-), 43.6 (C-3), 42.5 (C-), 41.5 (CN2-Me), 28.6 (C-4), 25.5 (C-4), 24.0 (C-4), 9.2 (C-8 and C-10).

[0268] HRMS-ESI (m/z) calculated for C.sub.43H.sub.51N.sub.4O.sub.5S [M+H].sup.+: 735.3575; Found: 735.3559.

Example 26: Product 43

Step 1: Synthesis of N-methyl-carbamoylimidazole

[0269] ##STR00038##

[0270] To a solution of 1,1-carbonyldiimidazole (2 g12.33 mmol) in a mixture of DMF-MeCN (8 mL, (2:6)) was added MeNH.sub.3Cl (0.690 g10.30 mmol). The reaction mixture was stirred 2 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by silica gel column with a linear gradient of dichloromethane-methanol (100:0 to 96:4), to give N-methyl-carbamoylimidazole (808 mg, 6.46 mmol, 68%)

Step 2: Addition of N-methyl-carbamoylimidazole to Nortrilobine (Product 7)

[0271] To a solution of nortrilobine 7 (5 mg9.12 mol) in 500 L of dicholoromethane was added N-methyl-carbamoylimidazole (3 mg23.98 mol) and triethylamine (4 L29.63 mol). The mixture was stirred 24 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (80:20 to 0:100), to give 43 (3.3 mg, 4.98 mol, 55%).

##STR00039##

[0272] .sup.1H NMR (500 MHz, CDCl.sub.3) 8.13 (1H, br dd, J=8.5 Hz, J=1.6 Hz, H-14), 7.30 (1H, dd, J=8.5 Hz, J=2.7 Hz, H-13), 7.16 (1H, dd, J=8.2 Hz, J=2.2 Hz, H-10), 7.06 (1H, dd, J=8.2 Hz, J=2.7 Hz, H-11), 6.91 (1H, d, J=8.1 Hz, H-13), 6.80 (1H, dd, J=8.2 Hz, J=2.2 Hz, H-14), 6.65 (1H, d, J=2.1 Hz, H-10), 6.64 (1H, s, H-5), 6.33 (1H, s, H-5), 6.13 (1H, s, H-8), 5.73 (1H, br d, H-1), 4.58 (1H, q, J=4.5 Hz, 2-NH), 4.43 (1H, dd, J=13.8 Hz, J=5.0 Hz, H-3), 4.34 (1H, br d, H-1), 4.06 (1H, q, J=4.6 Hz, 2-NH), 4.00 (3H, s, 12-OMe), 3.86 (3H, s, 6-OMe), 3.77 (1H, br, H-3), 3.49 (1H, m, H-3), 3.65 (1H, br d, J=15.0 Hz, H-), 3.11 (1H, dd, J=14.9 Hz, J=3.4 Hz, H-), 2.97-2.91 (3H, m, H-3, H-4, H-), 2.90 (3H, d, J=4.7 Hz, 3-NHMe), 2.82 (1H, dd, J=14.9 Hz, J=3.2 Hz, H-), 2.77-2.68 (2H, m, H-4, H-4), 2.65 (3H, d, J=4.6 Hz, 3-NHMe), 2.50 (1H, br d, J=15.4 Hz, H-4).

[0273] .sup.13C NMR (125 MHz, CDCl.sub.3) 157.7 (C-1), 157.5 (C-1), 154.0 (C12), 151.0 (C-11), 147.9 (C-12), 146.6 (C-6), 140.1 (C-6 or C-7), 139.8 (C-6 or C-7), 139.2 (C-8 or C-9), 139.1 (C-8 or C-9), 134.5 (C-9), 133.6 (C-8a), 131.1 (C-10), 130.8 (C-4a), 130.4 (C-14), 130.0 (C-7), 128.2 (C-4a), 123.4 (C-13), 121.5 (C-11 and C-14), 120.8 (C-8a), 116.6 (C-10), 116.2 (C-5), 114.0 (C-8), 112.1 (C-13), 106.7 (C-5), 59.3 (C-1), 56.6 (C-6-OMe), 56.4 C-12-OMe), 52.5 (C-1), 46.4 (C-), 45.7 (C-), 39.7 (C-3), 37.6 (C-3), 28.4 (C-4), 28.0 (C-3), 27.6 (C-3), 27.3 (C-4).

[0274] HRMS-ESI (m/z) calculated for C.sub.38H.sub.38N.sub.4NaO.sub.7 [M+Na].sup.+: 685.2633; Found: 685.2616.

Example 27: Product 44

[0275] To a solution of trilobine 1 (12 mg21.35 mol) in 500 L of dicholoromethane was added N-methyl-carbamoylimidazole (2.7 mg21.58 mol) and triethylamine (4 L29.63 mol). The mixture was stirred 24 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (55:45 to 40:60), to give 44 (4.7 mg, 7.59 mol, 36%).

##STR00040##

[0276] .sup.1H NMR (500 MHz, MeOD) 7.96 (1H, br dd, J=8.5 Hz, J=1.7 Hz, H-14), 7.06 (1H, dd, J=8.4 Hz, J=2.5 Hz, H-13), 7.00 (1H, m, H-10), 6.99 (1H, d, J=8.3 Hz, H-13), 6.92 (1H, dd, J=8.3 Hz, J=2.0 Hz, H-14), 6.87 (1H, dd, J=8.1 Hz, J=2.4 Hz, H-11), 6.62 (1H, d, J=1.8 Hz, H-10), 6.58 (1H, s, H-5), 6.56 (1H, s, H-5), 6.22 (1H, s, H-8), 5.66 (1H, br d, J=6.3 Hz, H-1), 3.91 (3H, s, 12-OMe), 3.84 (3H, s, 6-OMe), 3.56 (2H, m, H-3), 3.25 (2H, m, H-1, H-), 2.94-2.82 (6H, m, H-3, H-4, H-, H-), 2.80 (3H, s, 3-NHMe), 2.76 (2H, m, H-3, H-4), 2.62 (1H, m, H-4), 2.31 (3H, s, N2-Me).

[0277] .sup.13C NMR (125 MHz, MeOD) 160.3 (C-1), 156.6 (C12), 151.6 (C-11), 149.3 (C-12), 148.2 (C-6), 141.4 (C-6 or C-7), 140.8 (C-6 or C-7), 140.0 (C-8), 139.3 (C-9), 136.0 (C-9), 135.1 (C-8a), 132.1 (C-4a and C-14), 131.7 (C-10), 131.1 (C-4a or C-7), 131.0 (C-4a or C-7), 123.6 (C-14), 123.4 (C-13), 122.2 (C-11), 121.2 (C-8a), 119.0 (C-10), 116.8 (C-5), 115.3 (C-8), 114.3 (C-13), 108.3 (C-5), 68.1 (C-1), 57.0 (C-6-OMe and C-12-OMe), 53.0 (C-1), 52.2 (C-3), 47.1 (C-), 41.5 (CN2-Me and C-3), 40.3 (C-), 28.7 (C-4), 28.0 (C-3), 27.6 (C-4).

[0278] HRMS-ESI (m/z) calculated for C.sub.37H.sub.38N.sub.3O.sub.6 [M+H].sup.+: 685.2755; Found: 620.2753.

Example 28: Product 45

[0279] To a solution of O-methylcocsoline 3 (12 mg21.35 mol) in 500 L of dicholoromethane was added N-methyl-carbamoylimidazole (2.7 mg21.58 mol) and triethylamine (4 L29.63 mol). The mixture was stirred 24 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (55:45 to 40:60), to give 45 (3.8 mg, 6.14 mol, 29%).

##STR00041##

[0280] .sup.1H NMR (500 MHz, MeOD) 7.63 (1H, br dd, J=8.7 Hz, J=1.3 Hz, H-14), 7.18 (2H, m, H-10, H-13), 7.01 (1H, dd, J=8.3 Hz, J=2.5 Hz, H-11), 6.95 (1H, d, J=8.3 Hz, H-13), 6.75 (1H, dd, J=8.0 Hz, J=1.7 Hz, H-14), 6.61 (1H, d, J=1.7 Hz, H-10), 6.53 (1H, s, H-5), 6.45 (1H, s, H-5), 6.05 (1H, s, H-8), 4.84 (1H, br, H-1), 4.0 (2H, m, H-1, H-3), 3.93 (3H, s, 12-OMe), 3.81 (3H, s, 6-OMe), 3.29 (1H, m, H-), 3.14 (1H, m, H-3), 3.05 (1H, m, H-3), 2.94-2.88 (2H, m, H-3, H-4), 2.82 (1H, m, H-), 2.76-2.66 (3H, m, H-4, H-, H-), 2.64 (3H, s, 3-NHMe), 2.55 (3H, s, N2-Me), 2.49 (1H, m, H-4).

[0281] .sup.13C NMR (125 MHz, MeOD) 160.3 (C-1), 156.6 (C12), 152.0 (C-11), 149.5 (C-12), 148.3 (C-6), 141.8 (C-6 or C-7 or C-8 or C-9), 141.6 (C-6 or C-7 or C-8 or C-9), 141.5 (C-6 or C-7 or C-8 or C-9), 141.2 (C-6 or C-7 or C-8 or C-9), 136.5 (C-8a or C-9), 136.4 (C-8a or C-9), 133.2 (C-10), 131.7 (C-4a), 131.3 (C-7), 129.7 (C-14), 129.3 (C-4a), 123.9 (C-13 and C-14), 123.1 (C-11), 121.0 (C-8a), 118.5 (C-10), 117.4 (C-5), 115.3 (C-8), 114.6 (C-13), 108.5 (C-5), 62.4 (C-1), 59.1 (C-1), 57.3 (C-6-OMe or C-12-OMe), 57.2 (C-6-OMe or C-12-OMe), 47.7 (C-), 46.7 (C-3), 43.5 (C-), 42.2 (CN2-Me), 39.7 (C-3), 29.2 (C-4), 28.2 (C-3), 24.5 (C-4).

[0282] HRMS-ESI (m/z) calculated for C.sub.37H.sub.38N.sub.3O.sub.6 [M+H].sup.+: 685.2755; Found: 620.2749.

Example 29: Product 46

[0283] To a solution of O-methylcocsoline 3 (10 mg17.79 mol) in 500 L of THF was added methyl isothiocyanate (2.5 L36.55 mol) and N,N-diisopropylethylamine (5 L29.40 mol). The mixture was stirred 24 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (80:20 to 0:100), to give 46 (7.2 mg, 11.34 mol, 64%).

##STR00042##

[0284] .sup.1H NMR (500 MHz, CDCl.sub.3) 7.66 (1H, dd, J=8.3 Hz, J=2.0 Hz, H-14), 7.26 (1H, dd, J=8.3 Hz, J=2.7 Hz, H-13), 7.21 (1H, dd, J=8.3 Hz, J=2.1 Hz, H-10), 7.08 (1H, dd, J=8.4 Hz, J=2.7 Hz, H-11), 6.91 (1H, d, J=8.3 Hz, H-13), 6.78 (1H, dd, J=8.0 Hz, J=2.1 Hz, H-14), 6.67 (2H, m, H-5, H-10), 6.34 (1H, s, H-5), 6.04 (1H, s, H-8), 5.42 (1H, br d, J=11.3 Hz, H-3), 5.24 (1H, q, J=4.2 Hz, 2-NH), 4.54 (1H, br, H-1), 4.07 (1H, br t, J=3.0 Hz, H-1), 4.01 (3H, s, 12-OMe), 3.87 (3H, s, 6-OMe), 3.36 (1H, br dd, J=15.9 Hz, J=2.6 Hz, H-), 3.19-3.12 (3H, m, H-3, H-3, H-), 2.94 (3H, d, J=4.3 Hz, 3-NHMe), 2.92-2.86 (3H, m, H-3, H-4, H-4), 2.82 (1H, dd, J=15.2 Hz, J=3.6 Hz, H-), 2.74 (1H, dd, J=16.0 Hz, J=3.7 Hz, H-), 2.62 (3H, s, N2-Me), 2.57-2.49 (2H, m, H-4, H-4).

[0285] .sup.13C NMR (125 MHz, CDCl.sub.3) 182.2 (C-1), 153.4 (C12), 151.4 (C-11), 148.2 (C-12), 146.3 (C-6), 140.9 (C-9), 140.5 (C-6 or C-7), 140.2 (C-6 or C-7), 139.3 (C-8), 133.4 (C-9), 132.4 (C-8a), 131.6 (C-10), 133.7 (C-4a), 129.6 (C-7), 128.7 (C-14), 128.13 (C-4a), 123.0 (C-13), 121.8 (C-11), 121.5 (C-14), 120.7 (C-8a), 116.3 (C-5 and C-10), 113.6 (C-8), 112.1 (C-13), 106.8 (C-5), 61.7 (C-1), 60.5 (C-1), 56.5 (C-6-OMe), 56.4 (C-12-OMe), 45.6 (C-3 or C-), 45.5 (C-3 or C-), 44.1 (C-3), 42.2 (C- and CN2-Me), 32.8 (C-3), 27.8 (C-4), 24.0 (C-4).

[0286] HRMS-ESI (m/z) calculated for C.sub.37H.sub.38N.sub.3O.sub.5S [M+H].sup.+: 636.2527; Found: 636.2524.

Example 30: Product 47

[0287] To a solution of nortrilobine 7 (5 mg9.12 mol) in 500 L of THF was added methyl isothiocyanate (2 L29.24 mol) and N,N-diisopropylethylamine (3 L17.64 mol). The mixture was stirred 24 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (80:20 to 0:100), to give 47 (3.2 mg, 4.61 mol, 51%).

##STR00043##

[0288] .sup.1H NMR (500 MHz, CDCl.sub.3) 8.31 (1H, br, H-14), 7.25 (1H, dd, J=8.3 Hz, J=2.4 Hz, H-13), 7.14 (1H, br dd, J=8.3 Hz, J=2.3 Hz, H-10), 7.05 (1H, dd, J=8.1 Hz, J=2.6 Hz, H-11), 6.93 (1H, d, J=8.3 Hz, H-13), 6.81 (1H, dd, J=8.3 Hz, J=1.8 Hz, H-14), 6.77 (1H, d, J=1.9 Hz, H-10), 6.69 (1H, s, H-5), 6.57 (1H, br, H-1), 6.37 (1H, s, H-5), 6.17 (1H, s, H-8), 5.80 (1H, q, J=4.4 Hz, 2-NH), 5.45 (1H, br d, J=12.0 Hz, H-3), 5.20 (1H, q, J=4.3 Hz, 2-NH), 4.53 (1H, br, H-1), 4.26 (1H, br, H-3), 4.01 (3H, s, 12-OMe), 3.87 (3H, s, 6-OMe), 3.70 (1H, m, H-3), 3.42 (1H, br d, J=14.5 Hz, H-), 3.28 (1H, m, H-), 3.24 (3H, d, J=4.4 Hz, 3-NHMe), 3.15 (1H, td, J=12.8 Hz, J=2.6 Hz, H-3), 3.05 (1H, dd, J=14.9 Hz, J=5.3 Hz, H-), 2.99 (1H, m, H-4), 2.93 (3H, d, J=4.5 Hz, 3-NHMe), 2.90 (1H, m, H-4), 2.87-2.79 (2H, m, H-4, H-), 2.57 (1H, br d, J=16.4 Hz, H-4).

[0289] .sup.13C NMR (125 MHz, CDCl.sub.3) 182.2 (C-1), 182.0 (C-1), 154.3 (C12), 151.1 (C-11), 148.4 (C-12), 146.9 (C-6), 140.5 (C-6 or C-7), 140.0 (C-6 or C-7), 139.2 (C-8), 137.8 (C-9), 133.3 (C-9), 132.5 (C-8a), 131.5 (C-14), 133.3 (C-4a), 130.9 (C-10), 130.1 (C-7), 128.3 (C-4a), 123.0 (C-13), 121.8 (C-14), 121.5 (C-11), 120.0 (C-8a), 116.9 (C-10), 116.3 (C-5), 113.8 (C-8), 112.2 (C-13), 106.9 (C-5), 61.8 (C-1), 57.0 (C-1), 56.6 (C-6-OMe), 56.4 (C-12-OMe), 45.6 (C-), 44.8 (C-), 44.1 (C-3), 44.2 (C-3), 42.5 (C-3), 33.4 (C-3), 32.8 (C-3), 28.2 (C-4), 27.2 (C-4).

[0290] HRMS-ESI (m/z) calculated for C.sub.38H.sub.38N.sub.4NaO.sub.5S [M+Na].sup.+: 717.2156; Found: 717.2156.

Example 31: Product 48

Step 1: Synthesis of N-(3-(diethylamino)propyl)-1H-imidazole-1-carboxamide

[0291] ##STR00044##

[0292] To a solution of 1,1-carbonyldimidazole (200 mg1.23 mmol) in a mixture of DMF-MeCN (8 mL, (2:6)) was added 3-(diethylamino)propylamine (194 L1.23 mmol). The reaction mixture was stirred 2 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by silica gel column with a linear gradient of dichloromethane-methanol (100:0 to 85:15), to give N-(3-(diethylamino)propyl)-1H-imidazole-1-carboxamide (60 mg, 0.267 mmol, 22%).

Step 2: Addition of N-(3-(diethylamino)propyl)-1H-imidazole-1-carboxamide to Nortrilobine 7

[0293] To a solution of nortrilobine 7 (6.3 mg11.49 mol) in 500 L of dicholoromethane was added N-(3-(diethylamino)propyl)-1H-imidazole-1-carboxamide (10.32 mg46.00 mol) and triethylamine (6 L44.44 mol). The mixture was stirred 24 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (80:20 to 0:100), to give 48 (3.1 mg, 3.60 mol, 31%).

##STR00045##

[0294] .sup.1H NMR (500 MHz, CDCl.sub.3) 8.16 (1H, br d, J=8.5 Hz, H-14), 7.30 (1H, dd, J=8.4 Hz, J=2.7 Hz, H-13), 7.16 (1H, br dd, J=8.2 Hz, J=1.9 Hz, H-10), 7.05 (1H, dd, J=8.2 Hz, J=2.5 Hz, H-11), 6.90 (1H, d, J=8.3 Hz, H-13), 6.79 (1H, dd, J=8.3 Hz, J=1.8 Hz, H-14), 6.62 (1H, d, J=2.0 Hz, H-10), 6.61 (1H, s, H-5), 6.32 (1H, s, H-5), 6.11 (1H, s, H-8), 5.80 (1H, br, H-1), 4.65 (1H, br, H-1), 4.26 (1H, br d, J=12.0 Hz, H-3), 4.01 (1H, m, H-3), 3.98 (3H, s, 12-OMe), 3.85 (3H, s, 6-OMe), 3.44 (4H, m, H-3, H-3), 3.33 (1H, br d, J=15.5 Hz, H-), 3.19 (1H, m, H-3), 3.06-2.92 (5H, m, H-3, H-4, H-, H-), 2.89-2.76 (8H, m, H-7, H-7, H-9, H-9), 2.73 (1H, m, H-4), 2.69-2.61 (5H, m, H-4, H-5, H-5), 2.51 (1H, br d, J=16.3 Hz, H-4), 1.92 (2H, m, H-4 or H-4), 1.73 (2H, m, H-4 or H-4), 1.16 (12H, m, H-8, H-8, H-10, H-10).

[0295] .sup.13C NMR (125 MHz, CDCl.sub.3) 157.3 (C-1 or C-1), 157.2 (C-1 or C-1), 154.2 (C12), 150.8 (C-11), 147.7 (C-12), 146.4 (C-6), 139.9 (C-6 and C-7), 139.3 (C-8 or C-9), 139.2 (C-8 or C-9), 134.6 (C8a and C-9), 131.1 (C-10), 130.2 (C-4a and C-14), 129.8 (C-7), 128.5 (C-4a), 123.2 (C-13), 121.8 (C-14), 121.5 (C-11), 121.2 (C-8a), 116.8 (C-10), 116.1 (C-5), 114.2 (C-8), 112.3 (C-13), 106.7 (C-5), 58.4 (C-1), 56.6 (C-6-OMe), 56.3 (C-12-OMe), 52.2 (C-1), 50.0 (C-5 and C-5), 46.5 (C-), 46.0 (C7 and C7 and C-9 and C-9), 45.4 (C-), 39.2 (C-3 and C-3 and C-3), 38.1 (C-3), 28.2 (C-4), 27.4 (C-4), 25.5 (C-4 or C-4), 24.8 (C-4 or C-4), 9.8 (C-8 or C-8 or C-10 or C-10), 9.4 (C-8 or C-8 or C-10 or C-10).

[0296] HRMS-ESI (m/z) calculated for C.sub.50H.sub.65N.sub.6O.sub.7 [M+H].sup.+: 861.4909; Found: 861.4892.

Example 32: Product 49

[0297] To a solution of trilobine 1 (10.5 mg18.68 mol) in 500 L of dicholoromethane was added N-(3-(diethylamino)propyl)-1H-imidazole-1-carboxamide (8.4 mg37.44 mol) and 65 trimethylamine (5 L37.03 mol). The mixture was stirred 24 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.1% formic acid (85:15 to 70:30), to give 49 (8 mg, 11.14 mol, 59%).

##STR00046##

[0298] .sup.1H NMR (500 MHz, CDCl.sub.3) 7.96 (1H, br d, J=7.4 Hz, H-14), 7.19 (1H, br d, J=7.4 Hz, H-13), 6.97 (2H, br m, H-10, H-14), 6.88 (2H, br m, H-11, H-13), 6.67 (1H, s, H-5), 6.60 (1H, br, H-10), 6.43 (1H, s, H-5), 6.35 (1H, s, H-8), 5.67 (1H, br d, J=5.8 Hz, H-1), 3.94 (3H, s, 12-OMe), 3.88 (3H, s, 6-OMe), 3.69-3.59 (3H, m, H-1, H-3), 3.49-3.40 (2H, m, H-3), 3.28 (2H, m, H-3, H-), 3.11 (1H, br d, J=14.4 Hz, H-), 3.04-2.97 (6H, m, H-5, H-7, H-9), 2.94-2.83 (4H, m, H-4, H-, H-), 2.74-2.66 (3H, m, H-3, H-4), 2.35 (3H, s, N2-Me), 2.01 (2H, m, H-4), 1.25 (6H, t, J=7.0 Hz, H-8, H-10).

[0299] .sup.13C NMR (125 MHz, CDCl.sub.3) 157.8 (C-1), 154.4 (C12), 149.8 (C-11), 147.7 (C-12), 146.5 (C-6), 140.6 (C-6 or C-7), 139.7 (C-6 or C-7), 138.7 (C-8), 137.6 (C-9), 132.7 (C-9), 131.3 (C-14), 131.0 (C-8a), 130.8 (C-4a), 130.6 (C-10), 129.9 (C-4a), 129.7 (C-7), 123.1 (C-13), 122.8 (C-14), 121.3 (C-11), 120.3 (C-8a), 117.4 (C-10), 115.8 (C-5), 114.8 (C-8), 112.5 (C-13), 106.8 (C-5), 64.8 (C-1), 56.6 (C-6-OMe), 56.3 (C-12-OMe), 51.4 (C-1), 50.9 (C-3), 49.1 (C-5), 49.2 (C-), 45.6 (C-7 and C-9), 40.9 (C-3), 39.5 (CN2-Me), 38.1 (C-3), 37.3 (C-), 28.3 (C-4), 26.3 (C-4), 24.6 (C-4), 8.6 (C-8 and C-10).

[0300] HRMS-ESI (m/z) calculated for C.sub.43H.sub.51N.sub.4O.sub.6 [M+H].sup.+: 719.3803; Found: 719.3794.

Example 33: Product 50

[0301] To a solution of O-methylcocsoline 3 (10.5 mg18.68 mol) in 500 l of THF was added N-(3-(diethylamino)propyl)-1H-imidazole-1-carboxamide (2.5 L36.55 mol) and triethylamine (5 L37.03 mol). The mixture was stirred 24 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (85:15 to 70:30), to give 50 (12 mg, 16.71 mol, 89%).

##STR00047##

[0302] .sup.1H NMR (500 MHz, CDCl.sub.3) 7.66 (1H, br d, J=7.8 Hz, H-14), 7.28 (1H, br, H-13), 7.17 (1H, br d, J=7.9 Hz, H-10), 7.11 (1H, br d, J=7.9 Hz, H-11), 6.91 (1H, d, J=8.1 Hz, H-13), 6.78 (1H, br d, J=7.9 Hz, H-14), 6.67 (1H, br, H-10), 6.63 (1H, s, H-5), 6.33 (1H, s, H-5), 6.12 (1H, s, H-8), 4.77 (1H, br, H-1), 4.26 (1H, br d, J=11.6 Hz, H-3), 4.09 (1H, br, H-1), 3.98 (3H, s, 12-OMe), 3.87 (3H, s, 6-OMe), 3.41 (1H, br d, J=15.3 Hz, H-), 3.29-3.18 (3H, m, H-3, H-3), 3.08-2.94 (8H, m, H-3, H-3, H-4, H-7, H-9, H-), 2.88 (2H, m, H-5), 2.82-2.73 (3H, m, H-4, H-, H-), 2.63 (3H, s, N2-Me), 2.54 (2H, m, H-4, H-4), 1.87 (2H, m, H-4), 1.24 (6H, t, J=7.1 Hz, H-8, H-10).

[0303] .sup.13C NMR (125 MHz, CDCl.sub.3) 157.2 (C-1), 154.4 (C12), 150.5 (C-11), 147.8 (C-12), 146.5 (C-6), 140.0 (C-6 or C-7 or C-8 or C-9), 139.8 (C-6 or C-7 or C-8 or C-9), 139.7 (C-6 or C-7 or C-8 or C-9), 134.6 (C-8a and C-9), 131.5 (C-10), 130.2 (C-4a), 129.8 (C-7), 128.4 (C-14), 127.3 (C-4a), 122.8 (C-13), 122.0 (C-14), 121.8 (C-11), 119.5 (C-8a), 116.9 (C-10), 116.2 (C-5), 114.1 (C-8), 112.5 (C-13), 106.6 (C-5), 61.0 (C-1), 58.0 (C-1), 56.5 (C-6-OMe), 56.4 (C-12-OMe), 48.9 (C-5), 46.5 (C-), 45.6 (C-7 and C-9), 45.2 (C-3), 42.1 (C-), 41.5 (CN2-Me), 38.2 (C-3 or C-3), 38.1 (C-3 or C-3), 28.2 (C-4), 24.7 (C-4), 23.3 (C-4), 8.5 (C-8 and C-10).

[0304] HRMS-ESI (m/z) calculated for C.sub.43H.sub.51N.sub.4O.sub.6 [M+H].sup.+: 719.3803; Found: 719.37940.

Example 34: Product 51

[0305] Step 1: Treatment of Product 44 with Hydrogen Peroxide

[0306] To an ice-cooled mixture of product 44 (8.6 mg13.89 mol) in H.sub.2O/1,4-dioxane (1:2, 450 L) and sodium tungstate (2.5 mg7.58 mol) was added drop-wise hydrogen peroxide (18 L332.3 mol). The reaction was stirred 1.5 hours at RT. Then manganese dioxide was added until a black precipitate. The reaction mixture was concentrated under reduced pressure and the residue was purified by silica gel column with an isocratic dichloromethane-methanol 1% NH.sub.3 (70:30).

Step 2: Treatment with Iron Sulphate Heptahydrate:

[0307] To an ice-cooled solution of product of step 1 (6.8 mg10.71 mol) in 400 l of methanol was added iron sulphate heptahydrate (13 mg46.76 mol). The reaction was stirred 24 hours at RT. Then, the reaction mixture was concentrated under reduced pressure. The residue was dissolved with EDTA (10 mL0.1M) and adjusted at pH=10 with ammoniac. The solution was extracted by a liquid/liquid extraction with dichloromethane. The organic phase was dried with sulfate magnesium and concentrated under reduced pressure. The residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (60:40 to 30:70), to give 51 (1.2 mg, 1.98 mol, 14%).

##STR00048##

[0308] .sup.1H NMR (500 MHz, MeOD) 7.83 (1H, dd, J=8.6 Hz, J=2.0 Hz, H-14), 7.05 (1H, br dd, J=8.3 Hz, J=2.3 Hz, H-13), 7.01 (1H, br d, J=8.5 Hz, H-13), 6.97 (1H, br, H-14), 6.93 (1H, br, H-10), 6.80 (1H, br, H-11), 6.70 (1H, br, H-10), 6.63 (2H, br s, H-5, H-5), 6.32 (1H, br s, H-8), 5.57 (1H, br d, J=8.6 Hz, H-1), 3.91 (3H, s, 12-OMe), 3.86 (3H, s, 6-OMe), 3.66 (1H, m, H-3), 3.48 (1H, br, H-1), 3.38 (1H, m, H-3), 3.22 (1H, br d, J=13.3 Hz, H-), 3.07-2.83 (6H, m, H-3, H-4 or H-4, H-, H-), 2.81 (3H, br, NH-3Me), 2.76 (2H, m, H-4 or H4, H-), 2.64 (1H, m, H-4 or H-4).

[0309] .sup.13C NMR (125 MHz, MeOD) 160.5 (C-1), 157.5 (C12), 151.1 (C-11), 149.7 (C-12), 148.3 (C-6), 141.4 (C-6 or C-7 or C-8), 140.4 (C-6 or C-7 or C-8), 139.8 (C-6 or C-7 or C-8), 138.3 (C-9), 137.0 (C-8a), 135.4 (C-9), 134.0 (C-4a), 132.5 (C-14), 131.6 (C-10), 131.5 (C-4a), 131.2 (C-7), 124.4 (C-14), 123.1 (C-13), 121.6 (C-11), 120.9 (C-8a), 119.8 (C-10), 116.8 (C-5), 114.5 (C-8), 114.0 (C-13), 108.3 (C-5), 60.2 (C-1), 57.0 (C-6-OMe and C-12-OMe), 52.9 (C-1), 47.3 (C-), 43.6 (C-3), 42.2 (C-3), 41.1 (C-), 29.0 (C-4 or C-4), 28.9 (C-4 or C-4), 28.0 (C-3).

[0310] HRMS-ESI (m/z) calculated for C.sub.36H.sub.36N.sub.3O.sub.6 [M+H].sup.+: 606.2599; Found: 606.2602.

Example 35: Product 53

[0311] To a solution of 2-norcocsuline 5 (6 mg10.95 mol) in 250 L of dicholoromethane was added N-methylcarbamoylimidazole (5.5 mg44 mol) and triethylamine (2 L14.84 mol). The mixture was stirred 16 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (70:30 to 35:65), to give 53 (2.1 mg, 3.47 mol, 32%).

##STR00049##

[0312] .sup.1H NMR (500 MHz, DMSO-d.sub.6) 7.99 (1H, dd, J=8.5 Hz, J=1.8 Hz, H-14), 7.12 (2H, m, H-10, H-13), 6.99 (1H, dd, J=8.2 Hz, J=2.6 Hz, H-11), 6.79 (1H, d, J=8.0 Hz, H-13), 6.74 (1H, dd, J=8.2 Hz, J=1.9 Hz, H-14), 6.65 (1H, s, H-5), 6.60 (1H, s, H-5), 6.54 (1H, q, J=4.2 Hz, 2-NH), 6.42 (1H, d, J=1.9 Hz, H-10), 6.07 (1H, s, H-8), 5.64 (1H, m, H-1), 3.79 (3H, s, 6-OMe), 3.72 (1H, m, H-3), 3.41 (1H, m, H-3), 3.18 (1H, br, H-), 3.07 (1H, br t, J=3.4 Hz, H-1), 2.85-2.65 (7H, m, H-3, H-4, H-4, H-, H-), 2.64 (3H, d, J=4.4 Hz, NH-3Me) 2.55 (1H, m, H-4), 2.46 (1H, m, H-3), 2.24 (3H, s, N2-Me).

[0313] .sup.13C NMR (125 MHz, DMSO-d.sub.6) 157.2 (C-1), 154.1 (C12), 148.7 (C-11), 145.8 (C-6), 144.8 (C-12), 138.8 (C-6 or C-7), 138.7 (C-6 or C-7), 138.2 (C-9), 138.0 (C-8), 135.5 (C-8a), 132.9 (C-9), 130.6 (C-4a), 130.5 (C-10), 130.1 (C-14), 129.0 (C-4a), 128.7 (C-7), 122.2 (C-13 or C-14), 122.1 (C-13 or C-14), 121.2 (C-11), 120.2 (C-8a), 116.9 (C-10), 116.5 (C-13), 115.4 (C-5), 113.5 (C-8), 107.2 (C-5), 67.2 (C-1), 55.9 (C-6-OMe), 50.7 (C-1), 50.1 (C-3), 45.1 (C-), 42.3 (CN2-Me), 40.3 (C-), 38.9 (C-3), 27.3 (C-3), 27.2 (C-4), 26.7 (C-4).

[0314] HRMS-ESI (m/z) calculated for C.sub.36H.sub.36N.sub.3O.sub.6 [M+H].sup.+: 606.2599; Found: 606.2596.

Example 36: Product 54

[0315] To an ice-cooled (50 C.) mixture of cocsuline 4 (6 mg10.68 mol) in 600 L of dichloromethane (600 L) and triethylamine (2 L14.84 mol) was added trifluoromethanesulfonic anhydride (2 L12.2 mol). The mixture was stirred 2 hours at 50 C. and then 16 hours at RT. The reaction mixture was concentrated under reduced pressure and the residue was purified by HPLC semi-preparative X-Terra RP-18, eluting with a linear gradient H.sub.2O/MeCN with 0.02% triethylamine (80:20 to 0:100), to give 54 (4.9 mg, 7.06 mol, 66%).

##STR00050##

[0316] .sup.1H NMR (500 MHz, CDCl.sub.3) 7.63 (1H, dd, J=8.4 Hz, J=2.1, H-14), 7.23 (1H, dd, J=8.5 Hz, J=2.6 Hz, H-13), 7.21 (2H, m, H-10, H-13), 7.00 (1H, dd, J=8.4 Hz, J=2.7 Hz, H-11), 6.93 (1H, dd, J=8.3 Hz, J=1.9 Hz, H-14), 6.73 (1H, d, J=1.9 Hz, H-10), 6.63 (1H, s, H-5), 6.33 (1H, s, H-5), 6.03 (1H, s, H-8), 4.02 (1H, br t, J=3.2 Hz, H-1), 3.87 (3H, s, 6-OMe), 3.36 (1H, br dd, J=15.4 Hz, J=2.5 Hz, H-), 3.23 (1H, br t, J=3.1 Hz, H-1), 3.17 (1H, m, H-3), 3.00-2.81 (5H, m, H-3, H-3, H-4, H-), 2.76-2.69 (2H, m, H-4, H-), 2.64-2.61 (2H, m, H-3, H-4), 2.60 (3H, s, N2-Me), 2.52 (1H, m, H-4), 2.39 (3H, s, N2-Me).

[0317] .sup.13C NMR (125 MHz, CDCl.sub.3) 153.3 (C12), 152.5 (C-11), 146.3 (C-6), 144.3 (C-12), 141.1 (C-9), 140.0 (C-6 or C-7 or C-8), 139.7 (C-6 or C-7 or C-8), 139.5 (C-6 or C-7 or C-8), 136.9 (C-9), 134.9 (C-8a), 131.6 (C-10), 130.2 (C-4a), 129.7 (C-7), 128.9 (C-14), 127.8 (C-4a), 123.0 (C-13), 122.5 (C-13), 122.4 (C-14), 121.5 (C-11), 120.6 (C-8a), 119.0 (d, J=2.6 Hz, C-2), 118.8 (C-10), 116.1 (C-5), 113.9 (C-8), 106.8 (C-5), 67.3 (C-1), 60.6 (C-1), 56.5 (C-6-OMe), 50.3 (C-3), 45.3 (C-3), 42.8 (CN2-Me), 42.3 (C-), 42.1 (CN2-Me), 41.9 (C-), 27.6 (C-4), 23.7 (C-4).

[0318] HRMS-ESI (m/z) calculated for C.sub.36H.sub.34F.sub.3N.sub.2O.sub.7S [M+H].sup.+: 695.2033; Found: 695.2117.

Example II. Biological Tests of the Compounds According to the Invention

[0319] II. 1 hDNMT3A Assay

[0320] hDNMT3A enzyme inhibition was adapted from the restriction-based fluorescence assay protocol as described in the literature (Ceccaldi et al. ChemBioChem 2011, 12, 1337-1345). Briefly, a 5-labelled biotin oligonucleotide is hybridized to its complementary strand labelled with 6-carboxyfluorescein at the 3-end into a 384 well microplate (black Optiplates; Perkin Elmer) pre-coated with avidin. The duplex contains a unique CpG site overlapping with a restriction site of a methylation sensitive restriction enzyme. The human C-terminal DNMT3A (623-908a.a.), produced as described in (Gros et al. Nucl. Acids Res. 2013, 41(19):e185), was added in each well (200 ng/well) and mixed with the chemical compounds at desired concentrations and freshly prepared SAM (20 M final concentration) to start the reaction in a total volume of 50 L. After 1 hour incubation at 37 C. each well were washed three times with PBS, Tween-20 0.05%, NaCl (500 mM) and three more times with PBST. Specific fluorescent signals were detected with the methylation-sensitive restriction enzyme HpyCH4IV (NEB) as described and measured on a Perkin Elmer Envision detector. The percentage of inhibition is reported. The formula used to calculate the percentage of inhibition is [(XY)/X]100, where X is the signal determined in the absence of the inhibitor and Y is the signal obtained in the presence of the inhibitor. The concentration at which 50% of efficacy of inhibition is observed (EC50) was determined by analysis of a concentration range of the tested compound in triplicates. The non-linear regression fittings with sigmoidal dose-response (variable slope) were performed with GraphPad Prism 4.03 (GraphPad Software).

[0321] Compounds of the invention inhibit human DNMT3A enzyme as reported in the table 1.

TABLE-US-00001 TABLE 1 Percentage of inhibition of catalytic human DNMT3A by the compounds at 32 and 10 M and concentration in M at which 50% of efficacy of inhibition is observed (EC50). hDNMT 3A inhibition Inhibition (%) N.sup.o EC50 (M) 32 M 10 M Trilobine (1) 3.80 96 88 3.21 to 4.49 (10) n.d. 72 17 (11) n.d. 77 43 (12) 2.67 to 3.80 93 78 (13) n.d. 45 39 (14) 1.91 96 93 1.15 to 3.18 (15) n.d. 50 46 (16) n.d. 77 56 (17) n.d. 79 69 (18) n.d. 66 66 (19) n.d. 71 67 (20) n.d. 66 50 (21) n.d. 82 32 (22) n.d. 64 60 (24) n.d. 77 42 (25) n.d. 72 46 (27) n.d. 67 21 (28) n.d. 60 18 (30) 4.19 to 9.36 88 66 (31) n.d. 79 43 (32) 5.34 to 6.87 82 57 (33) n.d. 87 32 (41) 0.557 to 0.910 95 94 (42) 0.64 98 98 0.47 to 0.86 (43) n.d. 49 24 (44) 3.96 96 82 3.04 to 5.17 (45) n.d. 73 31 (46) n.d. 52 7 (47) n.d. 40 10 (48) 1.93 98 82 1.00 to 3.72 (49) 6.10 75 60 3.72 to 10.0 (50) 2.06 91 69 1.28 to 3.31 (51) n.d. 69 2 (54) n.d. 32 0

[0322] II.2 hDNMT1 Assay.

[0323] His-DNMT1 (182 kDa, human) was cloned, expressed and purified as described (Halby et al. ChemBioChem 2012, 13, 157-165). The reaction was performed in a 10 L total reaction volume in low volume NBS 384-well microplates (Corning), containing the tested compound (up to 1% DMSO), 1 M of a SAM/[methyl-.sup.3H] SAM (3TBq/mmol, PerkinElmer) mix in a ratio of 3-to-1 (isotopic dilution 1*:3), 0.3 M of biotinylated hemimethylated DNA duplex (5-GATmCGCmCGATGmCGmCGAATmCGmCGATmCGATGmCGAT-3 and BIOT-5-ATCGCATCGATCGCGATTCGCGCATCGGCGATC-3), and 90 nM of DNMT1 in methylation buffer (20 mM HEPES pH 7.2, 1 mM EDTA, 50 mM KCl, 25 g/mL BSA). The reaction was incubated at 37 C. for 2 hours. 8 L are then transferred into a streptavidin 96-well scintillant coated Flashplate (PerkinElmer) containing 190 L of 20 M SAH in 50 mM Tris-HCl pH 7.4. The Flashplate was agitated at room temperature for 1 hour and read in 200 L of 50 mM Tris-HCl pH 7.4 on TopCount NXT (PerkinElmer). The percentage of inhibition is reported. The formula used to calculate the percentage of inhibition is [(XY)/X]100, where X is the signal determined in the absence of the inhibitor and Y is the signal obtained in the presence of the inhibitor.

[0324] Compounds of the invention inhibit human DNMT1 enzyme as reported in the table 2.

TABLE-US-00002 TABLE 2 Table 1. Percentage of inhibition of full-length human DNMT3 by the compounds at 32 and 10 M and concentration in M at which 50% of efficacy of inhibition is observed (EC50). hDNMT 1 inhibition EC50 Inhibition (%) N.sup.o (M) 32 M 10 M Trilobine (1) n.d.* 50% 4% (41) 11.0 0.7 99% 60% (42) 10.6 2.8 100% 38% (44) n.d.* 15% 0% (48) 14.6 1.3 98% 32% *n.d.: not determined

[0325] Since the compounds are inhibitors of DNMTs, their ability to induce the luciferase expression under the control of a methylated CMV promoter was evaluated.

II.3 CMV-luc Reexpression

[0326] KG-1 cells were stably transfected with the firefly luciferase reporter gene (luc+ from pGL3; Promega) under the control of the cytomegalovirus (CMV) promoter (from pEGFP-N1; Clontech Laboratories Inc.) partially methylated (50%). 20,000 cells per well were seeded in a 96-well plate. After 24 h incubation in the presence of the test compound or solvant (DMSO), the induction of the promoter was measured by quantification of the luciferase signal with the Brite-lite assay system (PerkinElmer) according to the manufacturer's protocol. The luminescence was measured on an EnVision multilabel plate reader (PerkinElmer), and the data are expressed as the fold induction as compared with the DMSO control. The mean of three experiments and the standard error is reported.

[0327] Compounds of the invention induced expression of the luciferase gene under the control of the methylated CMV promoter (table 3).

TABLE-US-00003 TABLE 3 Induction fold in the luciferase expression induced by the compounds compared to cells treated with DMSO. Induction Fold (IF) of luciferase gene reporter in KG-1 CMV-Luc Concentration (M) No 10 5 3.2 1 0.32 0.1 Trilobine (1) too 6.4 0.1 3.5 1.1 2.6 1.4 1.9 1.2 1.1 0.1 cytotoxic (41) 3.1 0.4 2.8 0.2 2.0 0.3 1.3 0.1 1.1 0.1 1.1 0.1 (42) too 2.3 0.1 2.0 0.2 1.5 0.1 1.3 0.1 1.2 0.1 cytotoxic (44) 9.0 1.3 2.5 0.9 2.0 0.1 1.3 0.1 1.1 0.1 1.1 0.1 (48) 2.3 1.3 1.3 0.1 1.2 0.1 1.2 0.1 1.2 0.3 1.1 0.1

[0328] Their ability to demethylate the CMV promoter in the cancer cells and to open the chromatin on such promoter was also measured.

[0329] II.4 CMV Promoter Analysis

[0330] Using the Nucleosome Occupancy and Methylome Sequencing (NOMe-Seq) technique, the methylation status of the CMV promoter and the position of the nucleosomes on such promoter were both analysed.

[0331] NOMe-seq is a modified version of the methylation-dependent single promoter assay described by Miranda et al. (Curr Protoc Mol Biol. 2010 21.17.1-16) and the methylase-based DNA assay was performed as previously described with minor modifications. After nuclei extraction, GpC DNA methyltransferase M.CviPI (New England Biolabs) reactions were done in M.CviPI reaction buffer. GpC methyltransferase treatment was followed by DNA extraction, sodium bisulfite conversion, PCR amplification of the region of interest, cloning, and sequencing of individual clones to reveal the structure of single replicas as functional units. After treatment with the compounds or with DMSO, KG-1-Luc cells were centrifuged for 5 min at 500g. Cell pellets were washed in ice-cold PBS, resuspended in 1 mL of ice-cold nuclei buffer [10 mM Tris (pH 7.4), 10 mM NaCl, 3 mM MgCl.sub.2, 0.1 mM EDTA, and 0.5% Nonidet P-40, plus protease inhibitors] per 210.sup.6 cells, and incubated on ice for 10 min. Nuclei were recovered by centrifugation at 900g for 5 min, washed twice in nuclei wash buffer [10 mM Tris (pH 7.4), 10 mM NaCl, mM MgCl.sub.2, and 0.1 mM EDTA containing protease inhibitors], and resuspended with 200 L in 1M.CviPI reaction buffer supplemented with 0.3 M sucrose, 160 M SAM (New England Biolabs). 100 L of purified genomic DNA were treated with 100 U of M.CviPI for 15 min at 37 C. in 200 L final volume. The other part of 100 L of purified genomic DNA were not treated with 100 U of M.CviPI but just incubated for 15 min at 37 C. to obtain CpG methylation profile. Reactions were stopped by the addition of an equal volume of stop solution [20 mM Tris.HCl (pH 7.9), 600 mM NaCl, 1% SDS, 10 mM EDTA, and 400 g/mL Proteinase K] and incubated at 55 C. overnight. DNA was purified by phenol/chloroform extraction and ethanol precipitation. Bisulfite conversion was performed with the EZ DNA Methylation-Gold Kit (Zymo Research). Bisulfited DNA was eluted with 12 L of water and 8 L were used for CMV amplification.

[0332] PCR Amplification of Bisulfite-Treated DNA

[0333] The CMV promoter DNA amplification was carried on 8.3 L eluted bisulfited DNA in 20 L PCR reaction containing 1KAPA2G Buffer A, 2.0 mM MgCl.sub.2, 200 M dNTPs, 125 nM each primer and 1.0 units KAPA2G Robust HotStart DNA Polymerase (KapaBiosystems) on C1000 Touch thermal cycler 95 C. 3 min following by 95 C. for 20 sec, 55 C. for 30 sec, 72 C. for 30 sec40 cycles and final extension at 72 C. 1 min. PCR fragments were quality controlled by agarose gel electrophoresis. Oligonucleotides used are listed in table below.

[0334] Steps of cloning and sequencing were as those described previously except that M13 PCR was used to amplify the cloned sequence in 20 L PCR reaction volume containing 1KAPA2G Buffer B, 2.0 mM MgCl.sub.2, 200 M dNTPs, 125 nM each primer and 1.0 U KAPA2G Robust HotStart DNA Polymerase (KapaBiosystems) on C1000 Touch thermal cycler 95 C. 3 min following by 95 C. for 20 sec, 55 C. for 30 sec, 72 C. for 30 sec40 cycles and final extension at 72 C. 1 min.

TABLE-US-00004 TABLE4 Oligonucleotidesusedinthisstudy Targets Sequences Analysis CMV F:GGGGTTATTAGTTTATAGTTTATATATGGA NOMeSeq R:AATACCAAAACAAACTCCCATTAAC M13 5 TGTAAAACGACGGCCAGT3 NOMeSeq forward P16 F:GGTTTTTTTAGAGGATTTGAGGGATAGG COBRA CDKN2A R:CTACCTAATTCCAATTCCCCTACAAACTTC P15 F:TGAGATGGTAGAATAAAAATTATTAAAAA BisulfitePCR CDKN2B R:AAACAAAAACATACCCAATAAAAAC Cloning- Sequencing

[0335] Sequence Alignment and Analysis of CG and GC Methylation Levels

[0336] Genomic alignment and bisulfite sequence analysis was performed largely as previously described (Berman et al. Nat Genet 2012, 44, 40-6).

[0337] BISMA (Bisulfite Sequencing DNA Methylation Analysis) software was used for CpG methylation analysis of primary bisulfite sequencing data from subcloned individual molecules (Rohde et al. BMC Bioinformatics 2010, 11, 230). Methyl Viewer (Pardo et al. Nucleic Acids Res 2011, 39, e5) was used to obtain GC methylation results and nucleosome occupancy. The ratio of methylation is representative of the chromatin accessibility by M.CviPI and nucleosome occupancy. The combined methylation status for each clone by CpG (BISMA) or GpC (Methyl Viewer) site has been assembled. The methylation status of cytosines in CpG and GpC contexts at a given position within the sequence, given as ratio of methylation, can be calculated as follows: R=[MCT/MCNT], where MCT is the percentage of Methylated Cytosines analysed DNA sequence in the Treated sample, and MCNT is the percentage of Methylated Cytosines on the same DNA sequence in a Not Treated sample. The chromatin accessibility is represented in the table 5 as ration of GpC methylation. The DNA demethylation is reported as percentage of methylated cytosine in the treated sample compared the non treated sample (Table 5).

[0338] C5 DNA Methylation Analysis at Endogenous Promoters

[0339] Cancer cell lines (colon HCT116 or leukaemia KG1) were treated with the compounds as indicated in the Data Tables and then analysed as following.

[0340] DNA Extraction and Bisulphite Treatment

[0341] DNA was isolated from cultured cells using the DNeasy Blood and Tissue Kit according to the manufacturer's specifications (Qiagen). DNA bisulphite conversion was performed on 2 g of DNA using the EZ DNA Methylation-Gold Kit according to the manufacturer's specifications (Zymo Research) and bisulfited DNA was eluted with 10 L of water.

[0342] Two different techniques were used to analyse the DNA methylation profile after bisulfite conversion of genomic DNA: (A) cloning and sequencing or (B) COBRA. The primers for each promoter are specified in Table 4.

[0343] A/ Cloning and Sequencing

[0344] Sequencing of bisulfite-treated DNA allowing resolution of the methylation state of every cytosine in the target sequence, at single molecule resolution, is considered as the gold standard for DNA methylation analysis.

[0345] CDKN2B (P15) and P73 Promoter PCR Amplification of Bisulfite-Treated DNA

[0346] Bisulfite-specific primers with a minimum length of 18 bp were designed using Primer 3 program. The target sequence of the designed primers contained no CpGs allowing amplification of both un- and hypermethylated DNAs. All primers were tested for their ability to yield high quality sequences and primers that gave rise to an amplicon of the expected size using non-bisulfite treated DNA as a template were discarded, thus ensuring the specificity for bisulfite-converted DNAs. Primers used in this study are listed in the table above. The targeted DNA amplification was set up with 2.5 L eluted bisulfited DNA in 50 L PCR reaction volume containing 1PCR buffer, 1.5 mM MgCl.sub.2, 200 M dNTPs, 200 nM each primer and 1.0 units Platinum Taq DNA Polymerase (Invitrogen) on C1000 Touch thermal cycler 94 C. 2 min following by 94 C. for 30 sec, 55 C. for 30 sec, 72 C. for 1 min35 cycles and final extension at 72 C. 6 min. PCR fragments were quality controlled by agarose gel electrophoresis.

[0347] Cloning and Sequencing

[0348] PCR amplicons were cloned with the StrataClone Ultra Blunt PCR Cloning Kit (Agilent Technologies), according to the manufacturers' instructions and up to 24 clones were picked for sequencing. First, M13 PCR was performed to amplify cloned sequence: each colony was resuspended in 50 L water and 1 L of each bacterial suspension was used to a 20 L PCR reaction volume containing 1PCR buffer, 2.5 mM MgCl.sub.2, 2 mM dNTPs, 3.2 M each primer that anneals to sites flanking the insertion/ligation plasmid site, and 1.25 units AmpliTaq Gold DNA polymerase (Applied Biosystems) on C1000 Touch thermal cycler 95 C. 10 min following by 95 C. for 45 sec, 55 C. for 45 sec, 72 C. for 1 min35 cycles and final extension at 72 C. 10 min. PCR amplicons were cleaned up using Bio-Gel-P100 (BioRad Laboratories) to remove any excess nucleotides and primers. Final sequencing was performed using a M13 primer on ABI 3100 capillary sequencers using 1/8 dilution of ABI Prism BigDye terminator V3.1 sequencing chemistry after hotstart 96 C. for 60 sec and thermocycling 96 C. for 10 sec, 50 C. for 10 sec, 60 C. for 4 min25 cycles. Sequencing reactions were cleaned up using Sephadex G-50 (GE Healthcare) to remove any excess nucleotides and dyes. Electrophoregram files and methylation signals at a given CpG site were quantified using the BISMA software as described above.

[0349] B/ Combined Bisulfite Restriction Analysis (COBRA)

[0350] This technique is a variation of bisulfite sequencing and combines bisulfite conversion based polymerase chain reaction with restriction digestion. DNA methylation levels are easily and quickly measured at fewer CpG sites than bisulfite-cloning-sequencing.

[0351] CDKN2A (P16) Promoter PCR Amplification of Bisulfite-Treated DNA

[0352] DNA amplification was set up with 100 ng eluted bisulfited DNA in 50 L PCR reaction containing 1PCR buffer, 2.5 mM MgCl.sub.2, 0.3 mM dNTPs, 400 nM each primer and 1.25 units EpiTaq HS (Takara) on C1000 Touch thermal cycler by 98 C. for 10 sec, 55 C. for 30 sec, 72 C. for 30 sec40 cycles. 20 L of PCR amplicons were digested in 30 L by 2 units of BsiEI at 60 C. for 90 min. DNA fragments were migrated by 2% agarose gel electrophoresis and each band was quantified by Image Lab Software v2.0 (BioRad Laboratories).

[0353] Compounds of the invention are able to demethylate the promoter of several tumor suppressor genes in several cancer cells (data reported in the table here below) and to demethyate the CMV promoter, open the chromatin on such promoter and reactivate the luciferase signal (as reported in table 5).

TABLE-US-00005 TABLE 5 activity of the compounds on the CMV promoter and P15 promoter in leukaemia KG1 cells and on P16 promoter in colon cancer cells HTC116, n.d. = not determined KG1 CMV-Luc model (24 h) at 5 M DNA Chromatin Demethylation (COBRA) IF-24 h demethylation accessibility P16 or P73*/HCT116 P15/KG1 Trilobine (1) 5.8 0.6 37 8% 1.9 0.1 37% after 3 days 25% after (at 0.1 M) 3 days (at 52% after 7 days 0.32 M) (at 0.1 M) 53% after 21 days (at 0.1 M) (41) 3.3 0.1 0% 2.1 0.1 0% after 7 days (at 0.1 M) n.d. *24% after 7 days (at 0.32 M) (42) 1.1 0.6 n.d. n.d. n.d. n.d. (44) 5.9 0.2 53 6% 2.3 0.2 0% after 7 days (at 0.1 M) n.d. *17% after 7 days (at 0.32 M) (48) 1.1 n.d. n.d. ND n.d.

[0354] In addition the compounds were able to demethylate tumour suppressor genes promoters in cancer cells such as P16 in colon cancer cell line HCT116 and P15 in leukemia KG1.

[0355] II.5 Anti-Proliferative Activity

[0356] Human cancer cells were obtained from the ATCC (USA) and cultivated in medium suggested by the supplier supplemented with foetal calf serum (Lonza, France), at 37 C. and under 5% CO.sub.2. To measure the anti-proliferative properties of tested molecules, 210.sup.4 cells are seeded at day 0 in a 96 wells plate. The compounds to be tested, stored at 20 C. as 10.sup.2 M stock solution in 100% DMSO, are freshly diluted on day 1 in the cell medium, before adding a dose range of 3.2 nM to 10 M to the cells. Cells are treated everyday and cell viability assessed after 3 days or 7 days of treatment. The cell viability is assessed using the ATPLite kit from Perkin (ATPlite 1 Step Luminescence Assay System, ref 3016739), following the provider instructions. The raw data are analyzed with GraphPad Prism software (v4.03) to generate IC50 values corresponding to the compound concentrations giving 50% reduction in cell viability. The values presented are the mean results of at least two independent experiments. The standard errors are indicated.

[0357] Compounds of the invention present a potential anti-cancer activity on a panel of cancer cell lines (table 6).

TABLE-US-00006 TABLE 6 Antiproliferative activity: IC50 (M)* HCT116 (colorectal KG-1 WM266-4 cancer) (leukemia) (melanoma)* Trilobine (1) 1.19 0.02 2.1 0.8 3.2 0.8 (41) 0.96 0.02 5.3 0.4 4.4 1.5 (42) 0.50 0.01 3.57 0.04 n.d. (44) 1.88 0.03 4.20 0.05 12 3 *two treatments instead of three. n.d. = not determined

[0358] To further test the effect of compounds on DNA methylation and gene reexpression we analysed its effect on the invasiveness capacity of metastatic melanoma WM266 cell line in a 3D model.

[0359] II.6 Spheroid Formation and Invasion Assay

[0360] After treatment with compound 1 or 42 at concentrations at which the compound is not cytotoxic, metastatic melanoma cells WM-266-4 GFP (3000 cells/condition) were allowed to form spheroids for 2 days on agarose 1% (Sigma-Aldrich, #A95-39) coated in 96-well plates, leading to 300 m diameter spheroids. Then six different spheroids for each condition were individually embedded in EMEM media (Lonza, #BE12-684F) containing 1% of Bovin Collagen I (BD, #354231) and 2% SVF. The initial spheroid size and the 24 h invasion area were measured by fluorescent microscopy, using an Axiovert 200M device (5 Plan-Neofluor objective, Carl Zeiss, Germany). Fluorescent invasion areas were quantified using Image J (NIH) software on the sum of six Z-stacks images (20 m interval) for each spheroid. Invasion Index was obtained by normalising the invasion area at 24 h by the initial spheroid area. Six individual spheroids were quantified for each condition and three independent experiments were performed. The results are illustrated in annexed FIG. 1.

[0361] Compounds of the invention decreased the invasion index in metastatic melanoma cells.

[0362] In conclusion, the compounds inhibit DNA methylation, in vitro and in cancer cells. By their action, the compounds are able to reprogram the cancer cells towards less aggressive state and could be used to sensitize towards immunotherapies and chemotherapies.