METHOD FOR CONVERTING MESENCHYMAL STEM CELLS INTO ENDOTHELIAL CELLS BY USING SPECIFIC TRANSCRIPTION FACTORS

20190055518 ยท 2019-02-21

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a method for converting mesenchymal stem cells into endothelial cells by using specific transcription factors and, more specifically, a method for converting mesenchymal stem cells into endothelial cells by using Oct4, Nanog, Tal1, and LMO2, which are specific transcription factors. According to the present invention, the method for converting adult cells or mesenchymal stem cells, which are adult stem cells, into endothelial cells was developed by selecting two types of genes, which are less directly related to cancer induction, among cell reprogramming factors and two types of transcription factors, which are not expressed or expressed at a low level in mesenchymal stem cells, among transcription factors related to vascular development, and combining all four transcription factors. The method can be applied in the production of endothelial cells for forming regenerative tissue in tissue engineering and ischemic disease therapy.

Claims

1. A method for converting mesenchymal stem cells into endothelial cells, the method comprising: the step of introducing Oct4, Nanog, Tal1, and LMO2 genes or a protein encoded by the genes into the mesenchymal stem cells.

2. The method of claim 1, wherein the Oct4, Nanog, Tal1, and LMO2 genes are transduced into the mesenchymal stem cells using a lentiviral vector.

3. The method of claim 2, wherein the Oct4 gene is represented by SEQ ID NO: 1, the Nanog gene is represented by SEQ ID NO: 2, the Tal1 gene is represented by SEQ ID NO: 3, and the LMO2 gene is represented by SEQ ID NO: 4.

4. The method of claim 1, wherein the Oct4 protein is represented by SEQ ID NO: 5, the Nanog protein is represented by SEQ ID NO: 6, the Tal1 protein is represented by SEQ ID NO: 7, and the LMO2 protein is represented by SEQ ID NO: 8.

5. A composition for differentiation induction of mesenchymal stem cells into endothelial cells, the composition comprising Oct4, Nanog, Tal1, and LMO2 genes or a protein encoded by the genes.

6. A composition for tissue regeneration, the composition comprising endothelial cells, which are obtained by the method of claim 1, as an active ingredient.

7. A cell therapy composition for treating ischemic diseases, the cell therapy composition comprising endothelial cells, which are obtained by the method of claim 1, as an active ingredient.

Description

DESCRIPTION OF DRAWINGS

[0018] FIG. 1 illustrates the conversion of endothelial cells (EC) by the introduction of Oct4, Nanog, Tal1, and LMO2 genes. FIG. 1A illustrates a schematic diagram for the induction of MSC into endothelial cells. FIG. 1B illustrates the results of gene expression, which was confirmed with RT-PCR, after the introduction of Oct4, Nanog, Tal1, and LMO2 genes using lentiviral system for the induction of umbilical cord-derived MSC into endothelial cells. FIG. 1C illustrates the results of FACS analysis of cells (iEC) positive for CD31/CD144, which is an endothelial cell marker, after induction into endothelial cells. FIG. 1D illustrates the results of expression patterns of an endothelial cell marker, which was analyzed with RT-PCR, after iECs, which were induced into endothelial cells, were subcultured and expanded. FIG. 1E illustrates the results of expression patterns of Oct4, Nanog, Tal1, and LMO2 genes, which were analyzed with RT-PCR, after the expansion of iECs. FIG. 1F illustrates the results of exhibiting no conversion to endothelial cells when culturing MSC in EGM2 and endothelial cell-derived medium (EGM2+10 M SB431542) without gene transfer.

[0019] FIG. 2 illustrates the results of examining the reproducibility and conversion rate of CD31/CD144 positive cells while repeating experiments with changing of culture time, in which MSC is converted into EC by Oct4, Nanog, Tal1, and LMO2.

[0020] FIG. 3 illustrates the results of ac-LDL uptake and tube formation after the expansion of the converted iEC and then the examination of the expression of VE-cadherin by immunofluorescence.

[0021] FIG. 4A illustrates the optimal gene combinations required for the conversion from WJ-MSC to endothelial cells. FIG. 4B illustrates the results of repeated experiments. In FIGS. 4A and 4B, ONTL represents a group using a combination of Oct4, Nanog, Tal1 4, and LMO2, OTL represents a group using a combination of Oct4, Tal1 4, and LMO2, NTL represents a group using a combination of Nanog, Tal1 4, and LMO2, and ONL represents a group using a combination of Oct4, Nanog, and LMO2.

BEST MODES OF THE INVENTION

[0022] Tal1 and LMO2 are known as major modulators of hematopoiesis and endothelial cell transcription. Human umbilical cord-derived mesenchymal stem cells were transduced with recombinant lentiviruses capable of delivering the cDNAs of Oct4, Nanog, Tal1, and LMO2 (See FIG. 1A) and cultured in a medium with blasticidin (350 ng/ml) and puromycin (350 ng/ml) for 10 days to select only transduced cells. RT-PCR was performed using total RNA. It was confirmed that these four genes were expressed in selected cells (See FIG. 1B). Then, these cells were cultured in EGM2 including SB431542 (10 M) which is TGF inhibitor for 35 days to induce conversion to endothelial cells. FACS analysis of these cells confirmed an induced cell population including 4.96% of CD31+VE-cadherin+ cells (See FIG. 1C). These CD31+VE-cadherin+ cells were sorted by FACS and cultured in the same medium. PCR analysis of these cultured cells (iEC) leads to analyze endothelial genes of VE-cadherin, VEGFR2, CD31, and eNOS. As a result, VE-cadherin, VEGFR2, CD31, and eNOS were detected in cultured iEC cells as in HUVEC (See FIG. 1D). Analysis of Oct 4, Nanog, Tal1, and LMO2 gene expression in cultured iEC revealed the expression of Nanog, Tal1, and LMO2 except Oct 4 (See FIG. 1E). In contrast, it was shown that culture of MSCs without the transduction of these four transcription factors in the same induction medium did not induce conversion to EC cells (See FIG. 1F). Direct conversion of MSC to EC by these four factors could be confirmed in repeated experiments. Even on induction on the 11th day, conversion to EC cells occurred (See FIG. 2). It was confirmed that CD31 and CD144 positive cells ranged from 1.4% to 7%.

[0023] For the detailed analysis of the characteristics of iEC, immunofluorescence analysis of these cells revealed that VE-Cadherin was expressed around the cells as in HUVEC. In contrast to MSC, these cells had an ability of Dil-labeled ac-LDL uptake, indicating that they have endothelial cell characteristics.

[0024] Lastly, the present inventors have examined whether a tube-like structure may be formed in these induced cells. As illustrated in FIG. 3, the tube-like structure is formed on Matrigel at 20 hours in these cells as in HUVEC, in contrast to MSC.

[0025] Through the above results, the present inventors confirmed that reprogramming of MSC and adult cells into endothelial cells may be performed by Oct4, Nanog, Tal1, and LMO2.

[0026] Further, the present inventors confirmed that MSC and adult cells may be efficiently converted into endothelial cells only when all four genes of Oct4, Nanog, Tal1, and LMO2 are used as described above. According to one embodiment of the present invention, degree of endothelial cell conversion according to the gene combination was analyzed for a group in which three genes of Oct4, Tal1, and LMO2 (OTL) are introduced, a group in which three genes of Nanog, Tal1, and LMO2 (NTL) are introduced, a group in which three genes of Oct4, Nanog, and LMO2 (ONL) are introduced, and a group in which four genes of Oct4, Nanog, Tal1, and LMO2 are introduced.

[0027] As a result, as illustrated in FIG. 4, it was confirmed that cells were transformed into CD31/CD144 positive cells on the group in which four genes including Oct4, Nanog, LMO2, and Tal1 were introduced. However, it was confirmed that cells were not transformed into CD31/CD144 positive cells on the combination in which three genes of Oct4, Tal1, LMO2 (OTL), Nanog, Tal1, and LMO2, (NLT), or Oct4, Nanog, and LMO2 (ONL) were introduced.

[0028] Therefore, as a result, the present invention found that four special genes such as Oct4, Nanog, LMO2, and Tal1 should be introduced to completely convert MSC and adult cells into endothelial cells.

[0029] In the present invention, 4 genes, such as, Oct4, Nanog, LMO2, and Tal1, respectively, introduced for endothelial cell conversion are preferably Oct4 gene represented by SEQ ID NO: 1, Nanog gene represented by SEQ ID NO: 2, LMO2 gene represented by SEQ ID NO: 3 and Tal1 represented by SEQ ID NO: 4.

[0030] In addition, introduction of these genes into cells may be performed using any gene introduction technique known in the art. Lentiviral vectors are used in one embodiment of the present invention.

[0031] The endothelial cells obtained by the method as described above can be applied to the production of endothelial cells (EC) for constituting regenerated tissues in tissue engineering and treatment of ischemic diseases.

[0032] Accordingly, the present invention may provide a composition for regenerating a tissue including the endothelial cells obtained by the method of the present invention as an active ingredient. Further, the present invention may provide provides a composition for a cell therapy agent for treatment of ischemic diseases, which includes endothelial cells obtained by the method of the present invention as an active ingredient.

[0033] According to the present invention, endothelial cells converted from stem cells may be used as a cell therapy agent for tissue regeneration or treatment of ischemic diseases. In the case of tissue regeneration, the endothelial cells converted in the present invention may be used in a portion corresponding to the endothelial cells in terms of tissue structure.

MODES OF THE INVENTION

[0034] Hereinafter, the present invention will be described in more detail with reference to Embodiments. These embodiments are for further illustrating the present invention, and the scope of the present invention is not limited to these embodiments.

Embodiment 1

[0035] Conversion to Endothelial Cells by the Introduction of Oct4, Nanog, Tal1, and LMO2 Genes

[0036] 1-1. Cell Culture and Reagent Preparation

[0037] Human umbilical vein endothelial cells (HUVEC) were isolated from human blood vessels according to the method described by Jaffe, et al. HUVEC cells were cultured in M199 medium including 20% FBS (Invitrogen), 30 g/ml endothelial cell growth supplements (ECGS, BD Biosciences), 90 g/ml heparin, 1% antibiotic. iEC was cultured in EGM2 medium (Lonza) added with 10 M SB431542 (Sigma), and mesenchymal stem cells (MSC) derived from umbilical cord were cultured in DMEM (Invitrogen) medium including 20% FBS and 1% antibiotic. Human umbilical cord samples were collected in accordance with the procedure approved by the Clinical Trial Evaluation Committee, Catholic University (project no. MC13TISI0078, MC12TISI0094).

[0038] 1-2. Lentiviral Vectors and Transduction

[0039] Lentiviral vectors carrying Nanog, Tal1, and LMO2 were purchased from GeneCopoeia (USA), and Oct4 vectors were obtained from Won-Hee Suh, professor of Ajou University. On the day before transfection, 293FT cells were plated on a 10 cm tissue culture plate, in order for the cell density to reach about 90% to 95% on the day of transfection. To prepare lentivirus, psi-EF1-Bls-hOct4, psi-EF1-Puro-hNanog, psi-EF1-Puro-hTaL1, and psi-EF1-Puro-hLMO2 (Genecopoeia; 3 for each plasmid), which are the desired vector plasmids, were mixed with 9 g of ViraPowerPackaging Mix and 12 g of Lipofectamine 2000 complex and then were added to 293FT cells. After overnight incubation at 37 C. and 5% CO.sub.2, the medium was replaced with 293FT medium without antibiotics. The culture supernatant was collected 48 hours after the medium change. The virus supernatant was filtered through a 0.45 m PVDF filter to remove the cells, and the virus stock was stored at 80 C. MSC (510.sup.4/well) was plated for 24 hours and infected with 5 MOI in 10% FBS-DMEM medium including 8 g/ml polybrene (Sigma-Aldrich). After 24 hours, the medium including the virus was replaced with fresh DMEM medium added with 20% FBS and penicillin/streptomycin and then cultured for two days. The cells were then cultured for ten days in a medium including blasticidin (350 ng/ml) and puromycin (350 ng/ml), and the transfected cells were selected (See FIG. 1A).

[0040] 1-3. Induction of MSC Transduced with Lentivirus into Endothelial Cells

[0041] MSC cells transduced with lentivirus were cultured in a gelatin-coated plate including endothelial cell growth medium EGM2 and 10 M SB431542 to induce conversion into endothelial cells. The medium was replaced every two days. After three days to five days, the cells were split at 1:2 when the density of cells became 90%. The cells were cultured for 11 days to 35 days, and then iEC was isolated by FACS.

[0042] 1-4. RNA Extraction and RT-PCR

[0043] Total RNA was extracted from cultured cells using Trizol reagent (Invitrogen). cDNA synthesis for RT-PCR was carried out using SuperScript synthesis system (Enzynomics) in accordance with the manufacturer's instructions. Each gene was amplified by PCR using the primer set described in Table 1. The PCR conditions for the synthesized cDNA were as follows: a total 30 cycles of 95 C. for 7 minutes (initial denaturation), 95 C. for 1 minute (denaturation), 54 C. to 60 C. for 1 minute (annealing) and 72 C. for 1 minute (extension) and 72 C. for 10 minutes (last extension). PCR products were analyzed by 1.0% agarose-gel electrophoresis, and DNA bands were visualized by SYBR safe DNA gel staining (Invitrogen).

TABLE-US-00001 TABLE 1 Name Forward Reserve Accession no. Oct4 AGGAGATATGCAAAGCAGAA AGAGTGGTGACGGAGACAG NM_002701 Nanog ATCCAGCTTGTCCCCAAAG ATTTCATTCTCTGGTTCTGG NM_024865.2 Tal1 TCACCACCAACAATCGAGTGA CTCCTCCTGGTCATTGAGCAG NM_003189.2 AGAGG CTTGG LMO2 TCCCCAATGTCCTCGGCCAT ATCCGCTTGTCACAGGAT NM_005574.3 CD31 ATGATGCCCAGTTTGAGGTC GACGTCTTCAGTGGGGTTGT NM_000442.4 VE-ead CCCTACCAGCCCAAAGTGTG CGACTTGGCATCCCATTGTC NM_001795.3 VEGFR2 GCGATGGCCTCTTCTGTAAG ACACGACTCCATGTTGGTCA EU826563.1 eNOS TGATGGCGAAGCGAGTGAA ACTCATCCATACACAGGACC NM_000603.4 CG

[0044] It was examined whether Oct4, Nanog, Tal1, and LMO2 were expressed after transduction with lentivirus using RT-PCR as described above. It was confirmed that these genes were expressed (See FIG. 1B). Meanwhile, these cells were induced to differentiate into endothelial cells and then were separated by FACS sorting. The separated iECs were subcultured and amplified, and then the endothelial marker expression patterns were analyzed by RT-PCR as described above. As a result, it was confirmed that VE-cadherin, VEGFR2, CD31, and eNOS were expressed like HUVEC (See FIG. 1D). Expression of Nanog, Tal1, and LMO2 was confirmed by RT-PCR (See FIG. 1E).

[0045] 1-5. FACS Analysis

[0046] After induction of differentiation into endothelial cells, FACS analysis was performed to confirm the cells positive to CD31/CD144, which are endothelial cell markers.

[0047] For this purpose, cells were collected and stained with PE-conjugated VE-cadherin antibody (1:400; BD Biosciences) or FITC-conjugated CD31 antibody (1:400; BD Biosciences) for 30 minutes in ice. The samples were analyzed with a FACSAria III cell analyzer (BD Biosciences). Data were analyzed with BD CellQuest Pro software (version 5.2.1). For identification of CD31+/CD144+ cells, the cells were transduced with the virus and then were cultured for 35 days in the endothelial differentiation induction medium. Then, the cells were collected and analyzed by FACS Beckman coulter cell sorter (BD Biosciences). Data were analyzed with FACS summit software (version 6.1.3). CD31+/CD144+ iECs were separated by FACS and subsequently cultured in EGM2 including 10 M SB431542 using plates coated with 1% gelatin.

[0048] As illustrated in FIG. 1C, the result confirms that cells (iEC) positive for CD31/CD144 which was an endothelial cell marker were present at a ratio of 4.96%.

Embodiment 2

[0049] Review of Reproducibility and Rate for Conversion of MSC into EC by Oct4, Nanog, Tal1, and LMO2

[0050] While four genes were introduced to induce the differentiation of endothelial cells in the same experimental scheme as in Embodiment 1, the experiments were repeatedly performed by changing the incubation time in the endothelial cell induced medium. Therefore, it was examined whether CD31/CD144 positive cells were reproducibly prepared and how the conversion rates were changed.

[0051] For identification of CD31+/CD144+ cells, the cells were transduced with the virus and then were cultured for 11 days to 35 days in the endothelial differentiation induction medium. Then, the cells were collected and analyzed by FACS Beckman coulter cell sorter (BD Biosciences). Data were analyzed with FACS summit software (version 6.1.3). CD31+/CD144+ iECs were separated by FACS and subsequently cultured in EGM2 including 10 M SB431542 using plates coated with 1% gelatin.

[0052] As illustrated in FIG. 2, the result confirmed that CD31/CD144 positive cells were reproducibly prepared, and the cells were produced at a ratio of about 1.4% to about 7%.

Embodiment 3

[0053] Examination of the Characteristics of the Expanded iEC Through Subculture

[0054] After expansion CD31/CD144 positive cells (iEC) sorted by FACS, expression of VE-cadherin was examined by immunofluorescence, and ac-LDL uptake and tube formation were examined.

[0055] 3-1. Examination of Expression of VE-Cadherin by Immunofluorescence Staining

[0056] Cells were fixed with 100% methanol for five minutes and permeabilized with 0.1% Triton X-100 for three minutes. Non-specific protein binding sites were blocked with 5% BSA for one hour. Cells were reacted with VE-cadherin (1:100, cell signaling) primary antibody and washed three times with PBS. Further, the cells were reacted with the secondary antibody with which Cy 3 (Millipore) was combined for two hours. Lastly, all slides were counterstained with 1 g/ml DAPI (Sigma). The images were obtained with a confocal microscope (Zeiss LSM 510 Meta with LSM image examiner software, Germany).

[0057] 3-2. Analysis of In Vitro Endothelial Cell Function

[0058] ac-LDL uptake by adherent cells, which is one of the major features of the endothelial cell line was measured (Murohara et al., J. Clin. Invest., 2000). Cells cultured in gelatin-coated chamber slides for 24 hours were reacted at 37 C. for four hours in medium including 15 g/ml Dil-labeled acetyl-low density lipoprotein (Dil-ac-LDL, Molecular Probes, Eugene, Oreg.). After washing, the samples were observed with a fluorescence microscope and an inverted phase microscope, and three fields were randomly selected and photographed.

[0059] 3-3. Analysis of Tube (Vascular) Formation

[0060] Refrigerated Matrigel (150 l, BD Bioscience) was placed in a precooled 48-well plate and incubated at 37 C. for 30 minutes. HUVECs, MSC, and iEC were dispensed onto solidified Matrigel (210.sup.4 cells/well) and cultured in EGM for 20 hours. Then, tube formation was photographed.

[0061] As illustrated in FIG. 3, the result confirmed that VE-cadherin was expressed at the cell interface in the expanded iEC and could take up the Dil-labeled ac-LDL, similarly to the HUVEC cells, which is completely different from MSC and has the ability to form a tube.

Embodiment 4

[0062] Optimal Gene Combinations for the Conversion of Wharton's Jelly Mesenchymal Stem Cells (WJ-MSC) into Endothelial Cells

[0063] The present inventors conducted the following experiments to identify the optimal genes required for conversion of mesenchymal stem cells into endothelial cells, which was confirmed by the results of Embodiments as described above.

[0064] Endothelial cell differentiation potency was examined for a group in which four genes, Oct4, Nanog, Tal1, and LMO2, which were used in Embodiments as described above, were introduced; a group in which three genes, Oct4, Tal1 and LMO2 (OTL) were introduced; a group in which three genes, Nanog, Tal1 and LMO2 (NTL) were introduced; and a group in which three genes, Oct4, Nanog, and LMO2 (ONL) were introduced. Specifically, a combination of three genes, Oct4, Tal1 and LMO2 (OTL), Nanog, Tal1, and LMO2 (NTL) or Oct4, Nanog, and LMO2 (ONL) were introduced into cells, and after 24 hours, the cells were exchanged with fresh DMEM medium added with penicillin/streptomycin. The cells were cultured for two days and then subjected to cell selection for ten days to isolate transduced cells. Then, the cells were cultured in endothelial cell growth medium EGM2 including 10 M SB431542 on a gelatin-coated dish. The cells were cultured for 21 days while replacing the medium every two days, and then subjected to FACS analysis.

[0065] As illustrated in FIG. 4, the results confirmed that four genes including Oct4, Nanog, Tal1, and LMO2 were introduced to convert into CD31/CD144 positive cells, but CD31/CD144 positive cells could not be obtained when a combination of three genes was introduced (See FIG. 4A). Even in the case of conducting an additional repeated experiment, CD31/CD144 positive cells were obtained at high efficiency (5%) when four genes were simultaneously introduced, but CD31/CD144 positive cells hardly appeared when a combination of three genes, Nanog, Tal1, and LMO2 was introduced (See FIG. 4B).

[0066] As a result, the present inventors confirmed that four transcription factors such as Oct4, Nanog, Tal1, and LMO2 are required for efficient conversion of MSC into endothelial cells under the differentiation culture conditions of the present experiment. It was confirmed that the endothelial cell conversion did not occur in the absence of one gene among them.

[0067] The present invention has been mainly described above with reference to preferred embodiments thereof. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the fundamental scope of the present invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive aspect. The scope of the present invention is defined by the appended claims instead of the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.