Antibodies directed to ricin toxin

Abstract

The invention provides a pharmaceutical composition comprising as an active ingredient a combination of three isolated monoclonal antibodies or any antigen-binding fragment thereof which bind ricin toxin and neutralize its toxic effects, and a pharmaceutically acceptable carrier, excipient or diluent. The invention also provides a method of prophylaxis, treatment or amelioration of ricin toxin poisoning including administering to a subject in need thereof a therapeutically effective amount of the pharmaceutical composition.

Claims

1. A pharmaceutical composition comprising as an active ingredient a combination of at least two isolated monoclonal antibodies or any antigen-binding fragment thereof which bind to ricin toxin, and a pharmaceutically acceptable carrier, excipient or diluent, wherein said antibodies are selected from the group consisting of: a. a monoclonal antibody comprising a heavy chain complementarity determining region (CDRH) 1 denoted by SEQ ID NO. 93, CDRH2 denoted by SEQ ID NO. 94, CDRH3 denoted by SEQ ID NO. 95, and the light chain complementarity determining region (CDRL) 1 denoted by SEQ ID NO. 123, a CDRL2 denoted by SEQ ID NO. 124, and a CDRL3 denoted by SEQ ID NO. 125; b. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 114, CDRH2 denoted by SEQ ID NO. 115, CDRH3 denoted by SEQ ID NO. 116, and a CDRL1 denoted by SEQ ID NO. 144, a CDRL2 denoted by SEQ ID NO. 145, and a CDRL3 denoted by SEQ ID NO. 146; and c. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 120, CDRH2 denoted by SEQ ID NO. 121, CDRH3 denoted by SEQ ID NO. 122, and a CDRL1 denoted by SEQ ID NO. 150, a CDRL2 denoted by SEQ ID NO. 151, and a CDRL3 denoted by SEQ ID NO. 152.

2. The pharmaceutical composition according to claim 1, wherein said isolated monoclonal antibodies are selected from a group consisting of: a. a monoclonal antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 73 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 83; b. a monoclonal antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 80 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 90; and c. a monoclonal antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 82 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 92.

3. The pharmaceutical composition according to claim 1, wherein said composition comprises the isolated monoclonal antibodies: a. a monoclonal antibody comprising a heavy chain complementarity determining region (CDRH) 1 denoted by SEQ ID NO. 93, CDRH2 denoted by SEQ ID NO. 94, CDRH3 denoted by SEQ ID NO. 95, and the light chain complementarity determining region (CDRL) 1 denoted by SEQ ID NO. 123, a CDRL2 denoted by SEQ ID NO. 124, and a CDRL3 denoted by SEQ ID NO. 125; b. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 114, CDRH2 denoted by SEQ ID NO. 115, CDRH3 denoted by SEQ ID NO. 116, and a CDRL1 denoted by SEQ ID NO. 144, a CDRL2 denoted by SEQ ID NO. 145, and a CDRL3 denoted by SEQ ID NO. 146; and c. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 120, CDRH2 denoted by SEQ ID NO. 121, CDRH3 denoted by SEQ ID NO. 122, and a CDRL1 denoted by SEQ ID NO. 150, a CDRL2 denoted by SEQ ID NO. 151, and a CDRL3 denoted by SEQ ID NO. 152 and a pharmaceutically acceptable carrier, excipient or diluent.

4. The pharmaceutical composition according to claim 1, wherein said composition consists of the isolated monoclonal antibodies a. a monoclonal antibody comprising a heavy chain complementarity determining region (CDRH) 1 denoted by SEQ ID NO. 93, CDRH2 denoted by SEQ ID NO. 94, CDRH3 denoted by SEQ ID NO. 95, and the light chain complementarity determining region (CDRL) 1 denoted by SEQ ID NO. 123, a CDRL2 denoted by SEQ ID NO. 124, and a CDRL3 denoted by SEQ ID NO. 125; b. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 114, CDRH2 denoted by SEQ ID NO. 115, CDRH3 denoted by SEQ ID NO. 116, and a CDRL1 denoted by SEQ ID NO. 144, a CDRL2 denoted by SEQ ID NO. 145, and a CDRL3 denoted by SEQ ID NO. 146; and c. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 120, CDRH2 denoted by SEQ ID NO. 121, CDRH3 denoted by SEQ ID NO. 122, and a CDRL1 denoted by SEQ ID NO. 150, a CDRL2 denoted by SEQ ID NO. 151, and a CDRL3 denoted by SEQ ID NO. 152 and a pharmaceutically acceptable carrier, excipient or diluent.

5. The pharmaceutical composition according to claim 1, wherein said isolated monoclonal antibodies are chimeric, humanized or human antibodies.

6. The pharmaceutical composition according to claim 1, wherein said isolated monoclonal antibodies are chimeric antibodies.

7. The pharmaceutical composition according to claim 1, wherein said isolated monoclonal antibodies are antibody fragments selected from the group consisting of Fv, single chain Fv (scFv), heavy chain variable region, light chain variable region, Fab, F(ab)2 and any combination thereof.

8. The pharmaceutical composition according to claim 1, wherein said isolated monoclonal antibodies are neutralizing antibodies.

9. The pharmaceutical composition according to claim 1, wherein said composition further comprising an adjuvant.

10. The pharmaceutical composition according to claim 1, wherein said composition further comprises an additional anti-ricin agent.

11. A method of prophylaxis, treatment or amelioration of ricin toxin poisoning comprising administering to a subject in need thereof a therapeutically effective amount of the pharmaceutical composition according to claim 1.

12. The method according to claim 11, wherein said method further comprises administering to a subject in need thereof an additional anti-ricin agent.

13. The method according to claim 11, wherein said pharmaceutical composition is administered to said subject prior to or after exposure to ricin toxin.

14. The method according to claim 13, wherein said pharmaceutical composition is administered to said subject immediately after exposure to ricin toxin or between about 1 to about 96 hours after exposure to ricin toxin.

15. The method according to claim 11, wherein said isolated monoclonal antibodies in the pharmaceutical composition are administered at a therapeutically effective amount of 10-50,000 g/kg.

16. The method according to claim 11 wherein said pharmaceutical composition is administered to said subject as a single dose or as multiple doses.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) In order to better understand the subject matter that is disclosed herein and to exemplify how it may be carried out in practice, embodiments will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:

(2) FIG. 1 Multiple Alignment of the heavy chain nucleic acid sequences of the antibodies MH1, MH2, MH36, MH49, MH67, MH73, MH74, MH75, MH76, and MH77. Nucleic acid sequences of the heavy chains of the indicated antibodies are shown as a multiple alignment.

(3) FIG. 2 Multiple Alignment of the light chain nucleic acid sequences of the antibodies MH1, MH2, MH36, MH49, MH67, MH73, MH74, MH75, MH76, and MH77. Nucleic acid sequences of the light chains of the indicated antibodies are shown as a multiple alignment.

(4) FIG. 3 Amino acid sequences of the heavy chain variable domains of the antibodies MH1, MH2, MH36, MH49, MH67, MH73, MH74, MH75, MH76, and MH77 Amino acid sequences of the heavy chains of the indicated antibodies are shown as a multiple alignment. The complementarity determining regions (CDRs) are shown in grey boxes.

(5) FIG. 4 Amino acid sequences of the light chain variable domains of the antibodies MH1, MH2, MH36, MH49, MH67, MH73, MH74, MH75, MH76, and MH77 Amino acid sequences of the light chains of the indicated antibodies are shown as a multiple alignment. The CDRs are shown in grey boxes.

(6) FIGS. 5A and 5B Screening the binding activity of antibodies MH1, MH2, MH36, MH49, MH67, MH73, MH74, MH75, MH76, and MH77 to Ricin. FIG. 5A shows a bar graph showing the binding of the indicated antibodies to Ricin, Ricin A chain (RTA) and Ricin B chain (RTB), using an ELISA assay. FIG. 5B shows a graph showing the binding of antibody MH73 to Ricin, RTA and RTB, using Biolayer Interferometry. Abbreviations: RTA, Ricin A chain; RTB, Ricin B chain; O.D., optical density.

(7) FIG. 6 Post-exposure treatment of ricin-intoxicated mice. Mice were intra-nasally instilled with the indicated doses of ricin. Six hours later, the ricin-intoxicated mice were either treated by intravenous administration of the four antibody cocktail (solid lines, n=10 for 2LD.sub.50, n=5 for 3LD.sub.50, n=7 for 4 LD.sub.50, and n=15 for 5LD.sub.50) or left untreated (dashed lines, n=5 for each ricin dose). Animal survival was monitored for 14 days.

(8) FIGS. 7A and 7B The efficacy of antibody cocktail versus mono-therapy. Ricin intoxicated mice were treated 24 hours post intoxication with either (A) the four antibodies cocktail (solid line, n=25), or (B) with either MH1 (n=32), MH73 (n=30), MH75 (n=29) or MH77 (n=28). Dashed lines represent intoxicated untreated mice (n=10). Animal survival was monitored for 14 days.

(9) FIG. 8A and 8B In vitro neutralization of ricin. Cultured Ub-FL cells were incubated for 6 hours with ricin (30 ng/ml) and increasing concentrations of the indicated anti-ricin monoclonal antibodies (A) or of the indicated antibodies combinations (B). The residual activity of the intracellular luciferase was determined and expressed as percent activity determined for untreated cells.

(10) FIGS. 9A, 9B and 9C Epitope binning. The ability of anti-ricin antibodies to bind the toxin, simultaneously, was evaluated using the Octet Red system. Following immobilization of the first antibody (A) MH1, (B) MH77 or (C) MH73, ricin was loaded and following a short wash the complex was immersed in a well containing the indicated antibody (indicated by the dashed line), washed again and immersed with the next antibody as indicated.

(11) FIG. 10 Post-exposure treatment of ricin-intoxicated mice using the three antibodies-cocktail. Ricin intoxicated mice were treated with the antibody cocktail comprised of three antibodies at either 24 hours (n=15), 48 hours (n=30), 72 hours (n=25) or 96 hours (n=26) post exposure. Dashed lines: Untreated animals (n=15). Animal survival was monitored for 14 days.

DETAILED DESCRIPTION OF EMBODIMENTS

(12) The present disclosure is based on the preparation of monoclonal antibodies directed against the ricin toxin that are able to neutralize the activity of the toxin, as described below and demonstrated in the Examples.

(13) Therefore the present disclosure provides an isolated monoclonal antibody or any antigen-binding fragment thereof which binds to ricin toxin, wherein said antibody is selected from a group consisting of: a. a monoclonal antibody, comprising a heavy chain complementarity determining region (CDRH) 1 denoted by SEQ ID NO. 93, CDRH2 denoted by SEQ ID NO. 94, CDRH3 denoted by SEQ ID NO. 95, and the light chain complementarity determining region (CDRL) 1 denoted by SEQ ID NO. 123, a CDRL2 denoted by SEQ ID NO. 124, and a CDRL3 denoted by SEQ ID NO. 125, or a variant thereof; b. a monoclonal antibody comprising a CDRH1 denoted by SEQ ID NO. 96, CDRH2 denoted by SEQ ID NO. 97, CDRH3 denoted by SEQ ID NO. 98, and a CDRL1 denoted by SEQ ID NO. 126, a CDRL2 denoted by SEQ ID NO. 127, and a CDRL3 denoted by SEQ ID NO. 128, or a variant thereof; c. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 99, CDRH2 denoted by SEQ ID NO. 100, CDRH3 denoted by SEQ ID NO. 101, and a CDRL1 denoted by SEQ ID NO. 129, a CDRL2 denoted by SEQ ID NO. 130, and a CDRL3 denoted by SEQ ID NO. 131, or a variant thereof; d. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 102, CDRH2 denoted by SEQ ID NO. 103, CDRH3 denoted by SEQ ID NO. 104, and a CDRL1 denoted by SEQ ID NO. 132, a CDRL2 denoted by SEQ ID NO. 133, and a CDRL3 denoted by SEQ ID NO. 134, or a variant thereof; e. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 105, CDRH2 denoted by SEQ ID NO. 106, CDRH3 denoted by SEQ ID NO. 107, and a CDRL1 denoted by SEQ ID NO. 135, a CDRL2 denoted by SEQ ID NO. 136, and a CDRL3 denoted by SEQ ID NO. 137, or a variant thereof; f. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 108, CDRH2 denoted by SEQ ID NO. 109, CDRH3 denoted by SEQ ID NO. 110, and a CDRL1 denoted by SEQ ID NO. 138, a CDRL2 denoted by SEQ ID NO. 139, and a CDRL3 denoted by SEQ ID NO. 140, or a variant thereof; g. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 111, CDRH2 denoted by SEQ ID NO. 112, CDRH3 denoted by SEQ ID NO. 113, and a CDRL1 denoted by SEQ ID NO. 141, a CDRL2 denoted by SEQ ID NO. 142, and a CDRL3 denoted by SEQ ID NO. 143, or a variant thereof; h. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 114, CDRH2 denoted by SEQ ID NO. 115, CDRH3 denoted by SEQ ID NO. 116, and a CDRL1 denoted by SEQ ID NO. 144, a CDRL2 denoted by SEQ ID NO. 145, and a CDRL3 denoted by SEQ ID NO. 146, or a variant thereof; i. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 117, CDRH2 denoted by SEQ ID NO. 118, CDRH3 denoted by SEQ ID NO. 119, and a CDRL1 denoted by SEQ ID NO. 147, a CDRL2 denoted by SEQ ID NO. 148, and a CDRL3 denoted by SEQ ID NO. 149, or a variant thereof; and j. a monoclonal antibody comprising the CDRH1 denoted by SEQ ID NO. 120, CDRH2 denoted by SEQ ID NO. 121, CDRH3 denoted by SEQ ID NO. 122, and a CDRL1 denoted by SEQ ID NO. 150, a CDRL2 denoted by SEQ ID NO. 151, and a CDRL3 denoted by SEQ ID NO. 152, or a variant thereof.

(14) The term ricin toxin refers to a glycoprotein found in the seeds of Ricinus communis (R. communis, also known as castor oil plant). These seeds are also referred to herein as castor beans. Ricin toxin is composed of two polypeptide chains, A and B, joined together by a disulfide bond. The ricin toxin may be prepared using any method known in the art, for example by extraction from seeds of R. communis, as described in the Examples below.

(15) As indicated above, the present invention provides isolated monoclonal antibodies that bind to ricin toxin. The term antibody refers to a polypeptide encoded by an immunoglobulin gene or functional fragments thereof that specifically binds and recognizes an antigen, namely ricin toxin.

(16) The term monoclonal antibody, monoclonal antibodies or mAb as herein defined refers to a population of substantially homogenous antibodies, i.e., the individual antibodies comprising the population are identical except for possibly naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are directed against a single antigenic site (epitope).

(17) Monoclonal antibodies may be prepared and purified by any method known in the art. For example, monoclonal antibodies may be prepared from B cells taken from the spleen or lymph nodes of immunized animals (e.g. rats, mice or monkeys), by fusion with immortalized B cells under conditions which favor the growth of hybrid cells.

(18) Immunization of animals may be carried out by any method known in the art, for example by immunizing monkeys, as described below. The immunized monkeys are then sacrificed and samples are taken from their blood and lymphatic nodes in order to isolate mRNA that will be used for variable heavy and variable light (VH/VL) chain amplification and further used for example for constructing a phage display library, in order to select active antibodies. Based on the results obtained from a phage display library, full length antibodies are produced, as known in the art and as described below.

(19) Purification of monoclonal antibodies may be performed using any method known in the art, for example by affinity chromatography, namely, by using an affinity column to which a specific epitope (or antigen) is conjugated. Alternatively purification of antibodies may be based on using protein A column chromatography, as described below.

(20) An exemplary antibody structural unit comprises a tetramer, as known in the art. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one light chain and one heavy chain. The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen (or epitope) recognition.

(21) Thus, the terms heavy chain variable region (V.sub.H) and light chain variable region (V.sub.L) refer to these heavy and light chains, respectively. More specifically, the variable region is subdivided into hypervariable and framework (FR) regions. Hypervariable regions have a high ratio of different amino acids in a given position, relative to the most common amino acid in that position. Four FR regions which have more stable amino acids sequences separate the hypervariable regions. The hypervariable regions directly contact a portion of the antigen's surface. For this reason, hypervariable regions are herein referred to as complementarity determining regions, or CDRs, the CDRs are positioned either at the heavy chain of the antibody (a heavy chain complementarity determining region) or at the light chain of the antibody (a light chain complementarity determining region).

(22) From N-terminal to C-terminal, both light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The CDRs are primarily responsible for binding to an epitope of an antigen. The CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3, numbered sequentially starting from the N-terminus, and are also typically identified by the chain in which the particular CDR is located.

(23) Thus, the complementarity determining regions CDRH1, CDRH2 and CDRH3 refer to the three complementarity determining regions starting from the N-terminus of the antibody's heavy chain (also referred to herein as heavy chain complementarity determining region) and the complementarity determining regions CDRL1, CDRL2 and CDRL3 refer to the three complementarity determining regions starting from the N-terminus of the antibody's light chain (also referred to herein as light chain complementarity determining region).

(24) For example, as demonstrated in FIG. 3 in the context of the heavy chain of the antibody referred to herein as MH1, CDRH1, CDRH2 and CDRH3 appear as grey boxes in the amino acid sequence of the heavy chain of the antibody. The respective CDRL1, CDRL2 and CDRL3 of the antibody referred to herein as MH1, appear in FIG. 4 in the context of the light chain of the antibody.

(25) Binding of antibodies or antigen-binding fragments thereof to ricin toxin may be determined using any method known in the art, for example using an ELISA assay as described below or BIAcore analysis.

(26) In some embodiments the isolated monoclonal antibody according to the invention comprises the CDRH1 denoted by SEQ ID NO. 93, CDRH2 denoted by SEQ ID NO. 94, and CDRH3 denoted by SEQ ID NO. 95, and the CDRL1 denoted by SEQ ID NO. 123, CDRL2 denoted by SEQ ID NO. 124, and the CDRL3 denoted by SEQ ID NO. 125, or a variant thereof.

(27) In other embodiments the isolated monoclonal antibody as herein defined comprises the CDRH1 denoted by SEQ ID NO. 96, CDRH2 denoted by SEQ ID NO. 97, and the CDRH3 denoted by SEQ ID NO. 98, and the CDRL1 denoted by SEQ ID NO. 126, CDRL2 denoted by SEQ ID NO. 127, and the CDRL3 denoted by SEQ ID NO. 128, or a variant thereof.

(28) In further embodiments the isolated monoclonal antibody as herein defined comprises the CDRH1 denoted by SEQ ID NO. 99, CDRH2 denoted by SEQ ID NO. 100, and the CDRH3 denoted by SEQ ID NO. 101, and the CDRL1 denoted by SEQ ID NO. 129, CDRL2 denoted by SEQ ID NO. 130, and the CDRL3 denoted by SEQ ID NO. 131, or a variant thereof.

(29) In still further embodiments the isolated monoclonal antibody as herein defined comprises the CDRH1 denoted by SEQ ID NO. 102, CDRH2 denoted by SEQ ID NO. 103, and the CDRH3 denoted by SEQ ID NO. 104, and the CDRL1 denoted by SEQ ID NO. 132, CDRL2 denoted by SEQ ID NO. 133, and the CDRL3 denoted by SEQ ID NO. 134, or a variant thereof.

(30) In some embodiments the isolated monoclonal antibody as herein defined comprises the CDRH1 denoted by SEQ ID NO. 105, CDRH2 denoted by SEQ ID NO. 106, and the CDRH3 denoted by SEQ ID NO. 107, and the CDRL1 denoted by SEQ ID NO. 135, CDRL2 denoted by SEQ ID NO. 136, and the CDRL3 denoted by SEQ ID NO. 137, or a variant thereof.

(31) In other embodiments the isolated monoclonal antibody as herein defined comprises the CDRH1 denoted by SEQ ID NO. 108, CDRH2 denoted by SEQ ID NO. 109, and the CDRH3 denoted by SEQ ID NO. 110, and the CDRL1 denoted by SEQ ID NO. 138, CDRL2 denoted by SEQ ID NO. 139, and the CDRL3 denoted by SEQ ID NO. 140, or a variant thereof.

(32) In further embodiments the isolated monoclonal antibody according to the invention comprises the CDRH1 denoted by SEQ ID NO. 111, CDRH2 denoted by SEQ ID NO. 112, and the CDRH3 denoted by SEQ ID NO. 113, and the CDRL1 denoted by SEQ ID NO. 141, CDRL2 denoted by SEQ ID NO. 142, and the CDRL3 denoted by SEQ ID NO. 143, or a variant thereof.

(33) In still further embodiments the isolated monoclonal antibody as herein defined comprises the CDRH1 denoted by SEQ ID NO. 114, CDRH2 denoted by SEQ ID NO. 115, and the CDRH3 denoted by SEQ ID NO. 116, and the CDRL1 denoted by SEQ ID NO. 144, CDRL2 denoted by SEQ ID NO. 145, and the CDRL3 denoted by SEQ ID NO. 146, or a variant thereof.

(34) In yet further embodiments the isolated monoclonal antibody as herein defined comprises the CDRH1 denoted by SEQ ID NO. 117, CDRH2 denoted by SEQ ID NO. 118, and the CDRH3 denoted by SEQ ID NO. 119, and the CDRL1 denoted by SEQ ID NO. 147, CDRL2 denoted by SEQ ID NO. 148, and the CDRL3 denoted by SEQ ID NO. 149, or a variant thereof.

(35) In some embodiments the isolated monoclonal antibody as herein defined comprises the CDRH1 denoted by SEQ ID NO. 120, CDRH2 denoted by SEQ ID NO. 121, and the CDRH3 denoted by SEQ ID NO. 122, and the CDRL1 denoted by SEQ ID NO. 150, CDRL2 denoted by SEQ ID NO. 151, and the CDRL3 denoted by SEQ ID NO. 152, or a variant thereof.

(36) The CDRs of the antibodies referred to herein are presented in Table 4 as well as in the context of their respective heavy and light chain sequences, e.g. in FIG. 3 and in FIG. 4, respectively.

(37) By the term variant it is meant sequences of amino acids or nucleotides that are different from the sequences specifically identified herein, namely, in which one or more amino acid residues or nucleotides are deleted, substituted or added.

(38) It should be appreciated that by the term added, as used herein it is meant any addition(s) of amino acid residues to the sequences described herein. For example, the variant antibodies of the invention may be extended at their N-terminus and/or C-terminus with various identical or different amino acid residues.

(39) Variants also encompass various amino acid substitutions. An amino acid substitution is the result of replacing one amino acid with another amino acid which has similar or different structural and/or chemical properties Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved.

(40) Variants further encompass conservative amino acid substitutions. Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

(41) Each of the following eight groups contains other exemplary amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M).

(42) Conservative nucleic acid substitutions are nucleic acid substitutions resulting in conservative amino acid substitutions as defined above.

(43) As used herein, the term amino acid or amino acid residue refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.

(44) Variant sequences refer to amino acid or nucleic acids sequences that may be characterized by the percentage of the identity of their amino acid or nucleotide sequences, respectively, with the amino acid or nucleotide sequences described herein (namely the amino acid or nucleotide sequences of the heavy and light chains of the antibodies herein described).

(45) Therefore in some embodiments, variant sequences as herein defined refer to nucleic acid sequences that encode the heavy and light chain variable regions, each having a sequence of nucleotides with at least 70% or 75% of sequence identity, around 80% or 85% of sequence identity, around 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% of sequence identity when compared to the sequences of the heavy and light chain variable regions described herein.

(46) In some embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein said antibody comprises a heavy chain variable region and a light chain variable region, wherein said heavy chain variable region is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 60, SEQ ID NO. 61, SEQ ID NO. 62, SEQ ID NO. 53, SEQ ID NO. 54, SEQ ID NO. 55, SEQ ID NO. 56, SEQ ID NO. 57, SEQ ID NO. 58, or SEQ ID NO. 59 and wherein said light chain variable region is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 63, SEQ ID NO. 64, SEQ ID NO. 65, SEQ ID NO. 66, SEQ ID NO. 67, SEQ ID NO. 68, SEQ ID NO. 69, SEQ ID NO. 70, SEQ ID NO. 71, or SEQ ID NO. 72.

(47) In other embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 60 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 63.

(48) In further embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 61 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 64.

(49) In still further embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 62 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 65.

(50) In some embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 53 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 66.

(51) In other embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 54 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 67.

(52) In further embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 55 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 68.

(53) In still further embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 56 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 69.

(54) In some embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 57 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 70.

(55) In other embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 58 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 71.

(56) In further embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention is wherein the heavy chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to the nucleic acid sequence denoted by SEQ ID NO. 59 and wherein the light chain variable region of the antibody is encoded by a nucleic acid sequence which is at least 70% identical to SEQ ID NO. 72.

(57) In further embodiments the isolated monoclonal antibody according to the invention is wherein said antibody comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 73, SEQ ID NO. 74, SEQ ID NO. 75, SEQ ID NO. 76, SEQ ID NO. 77, SEQ ID NO. 78, SEQ ID NO. 79, SEQ ID NO. 80, SEQ ID NO. 81, SEQ ID NO. 82 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 83, SEQ ID NO. 84, SEQ ID NO. 85, SEQ ID NO. 86, SEQ ID NO. 87, SEQ ID NO. 88, SEQ ID NO. 89, SEQ ID NO. 90, SEQ ID NO. 91, SEQ ID NO. 92, or a variant thereof.

(58) In specific embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 73 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 83, or a variant thereof.

(59) In other embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 74 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 84, or a variant thereof.

(60) In further embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 75 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 85, or a variant thereof.

(61) In still further embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 76 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 86, or a variant thereof.

(62) In some embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 77 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 87, or a variant thereof.

(63) In other embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 78 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 88, or a variant thereof.

(64) In further embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 79 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 89, or a variant thereof.

(65) In still further embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 80 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 90, or a variant thereof.

(66) In yet further embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 81 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 91, or a variant thereof.

(67) In some specific embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 82 or a variant thereof and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 92, or a variant thereof.

(68) As demonstrated in FIG. 5, all of the monoclonal antibodies prepared as described herein showed high binding affinity to ricin toxin, five of which (namely the antibodies referred to herein as MH1, MH36, MH49, MH67 and MH74) were shown to bind the RTA subunit; five of which (namely the antibodies referred to herein as MH2, MH75, MH76 and MH77 and MH73) were shown to bind the RTB subunit.

(69) As demonstrated in Example 4, antibodies of the invention exhibited a substantial efficacy with regard to protection from ricin intoxication, further resulting in very high percentages of mice survival after ricin intoxication (83% to 100% survival). Therefore, in a specific embodiment the invention provides an isolated monoclonal antibody or any antigen-binding fragment thereof which binds to ricin toxin, wherein administration of said antibody results in significant protection of the infected subjects against ricin intoxication. The protective effect can be measured for example in animal models of ricin intoxication as shown in Example 4 below. Significant protection is understood as survival of at least about 80%, or at least about 83%, or at least about 85%, or at least about 90% of infected animals. It should be noted that administration of certain antibodies results in between 95% and 100% survival of infected animals (namely, 95%, 96%, 97%, 98%, 99% or 100% survival of the animals).

(70) Specifically, the antibodies designated MH73, MH36, MH75, MH1 and MH77 showed significant protection of infected mice against ricin intoxication in an in vivo protection model. All these antibodies showed protection percentage higher than 83%. More specifically, each of the antibodies MH36, MH75, MH1 and MH77 showed protection percentage higher than 95%.

(71) Therefore, in a specific embodiment, the present invention provides an isolated monoclonal antibody or any antigen-binding fragment thereof which binds to ricin toxin, selected from the group consisting of the antibodies designated MH73, MH36, MH75, MH1 and MH77. In another specific embodiment, the present invention provides an isolated monoclonal antibody or any antigen-binding fragment thereof which binds to ricin toxin, selected from the group consisting of the antibodies designated MH36, MH75, MH1 and MH77. The amino acid sequences of the heavy chain variable region and the light chain variable region of each of these antibodies are specified below.

(72) As indicated above, the ricin toxin is composed of two polypeptide chains, A and B, joined together by a disulfide bond.

(73) Therefore the term ricin A chain as used herein and as known in the art, refers to the A chain of ricin (RTA), which is the catalytic subunit of the glycoprotein. RTA is approximately 30 kDa in size. In some embodiments RTA may be prepared for example by extracting the toxin from seeds of R. communis and subjecting the obtained extract to reducing conditions and further separation steps, thereby separating the A chain from the B chain, as described for example below.

(74) Therefore in some embodiments the isolated monoclonal antibody according to the invention binds to ricin A chain.

(75) In specific embodiments the isolated monoclonal antibody as herein defined comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 73, SEQ ID NO. 75, SEQ ID NO. 76, SEQ ID NO. 77, or SEQ ID NO. 79 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 83, SEQ ID NO. 85, SEQ ID NO. 86, SEQ ID NO. 87, or SEQ ID NO. 89.

(76) In other words, in some embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH1, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 73 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 83.

(77) In other embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH36, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 75 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 85.

(78) In further embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH49, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 76 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 86.

(79) In still further embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH67, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 77 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 87.

(80) In yet further embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH74, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 79 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 89.

(81) As indicated above, five antibodies, namely the antibodies referred to herein as MH2, MH73, MH75, MH76 and MH77 were shown to bind the RTB subunit.

(82) As used herein, the term ricin B chain refers to the B chain of ricin (RTB), which is a galactose specific lectin. RTB is approximately 33 kDa.

(83) In some embodiments RTB may be prepared for example by extracting the toxin from seeds of R. communis, and subjecting the extract to reducing conditions and to further separation steps, thereby separating the A chain from the B chain, for example as shown below.

(84) Therefore in some embodiments the isolated monoclonal antibody according to the invention binds to ricin B chain.

(85) In specific embodiments the isolated monoclonal antibody according to the invention comprises a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 74, SEQ ID NO. 78, SEQ ID NO. 80, SEQ ID NO. 81, or SEQ ID NO. 82 and a light chain variable region denoted by SEQ ID NO. 84, SEQ ID NO. 88, SEQ ID NO. 90, SEQ ID NO. 91, or SEQ ID NO. 92.

(86) In further embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH2, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 74 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 84.

(87) In further specific embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH73, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 78 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 88.

(88) In yet further embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH75, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 80 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 90.

(89) In some embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH76, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 81 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 91.

(90) In yet further embodiments the isolated monoclonal antibody according to the invention is the antibody also referred to herein as MH77, namely an antibody comprising a heavy chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 82 and a light chain variable region comprising the amino acid sequence denoted by SEQ ID NO. 92.

(91) The isolated monoclonal antibody according to the invention may be a chimeric, a humanized or a human antibody.

(92) As described in the appended Examples, chimeric macaque-human antibodies were raised against the ricin toxin, in which portions of the heavy and light chains were derived from rhesus macaque and the remainder of the chain(s) was derived from a human antibody sequence.

(93) The term chimeric antibodies as herein defined refers to antibodies in which a portion of the heavy and/or light chain is derived from a particular species, while the remainder of the chain(s) is derived from another species, as well as fragments of such antibodies, which exhibit the same biological activity (namely biding to the ricin toxin). Chimeric antibodies may be prepared by any method known in the art, for example as described below.

(94) Therefore in some embodiments the isolated monoclonal antibody according to the invention is a chimeric antibody.

(95) It is appreciated that humanized forms of non-human (for example, murine) antibodies are antibodies that contain a human-derived immunoglobulin framework with minimal sequences derived from non-human immunoglobulin at the CDRs and optionally at additional relevant positions. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and activity.

(96) The term human antibody as used herein refers to an antibody that possesses an amino acid sequence corresponding to that of an antibody produced by a human and/or has been made using any of the techniques for making human antibodies disclosed herein. This definition specifically excludes a humanized antibody that comprises non-human antigen-binding residues.

(97) Preparation of humanized and human antibodies is well known in the art.

(98) The present invention further encompasses any antigen-binding fragments of the isolated monoclonal antibody of the invention. Such antigen-binding fragments may be for example Fab and F(ab).sub.2, which are capable of binding antigen. Such fragments may be produced by any method known in the art, for example by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab).sub.2 fragments).

(99) Therefore in some embodiments the isolated monoclonal antibody according to the invention is wherein said antibody is an antibody fragment selected from the group consisting of Fv, single chain Fv (scFv), heavy chain variable region, light chain variable region, Fab, F(ab).sub.2 and any combination thereof.

(100) As exemplified below, the chimeric antibodies prepared in accordance with the present disclosure were shown to neutralize the ricin toxin using an in vitro neutralization assay in Hela Ub-FL cells. The amount of antibody required to neutralize 50% of the toxin is shown in Table 5 below.

(101) Thus in some embodiments the isolated monoclonal antibody according to the invention is wherein said antibody is a neutralizing antibody.

(102) The term Neutralizing antibody (or Nab) as herein defined refers to an antibody which defends a cell from an antigen or infectious body by inhibiting or neutralizing the biological effect of the antigen or infectious body. Neutralizing antibodies are mainly defined by their in vitro activity, which in the present case may be assessed for example by the antibody amount that is required to neutralize 50% of the ricin toxin. As used herein the term highly neutralizing anti ricin antibody refers to an antibody that is capable of neutralizing the toxin and protecting between about 95% and 100% of animals exposed to ricin toxin in an in vivo protection model, when the antibody is given post-exposure, for example, six hours post exposure.

(103) In another one of its aspects the present invention provides a bispecific molecule comprising the antibody as herein defined.

(104) By the term bispecific molecule as herein defined it is meant a molecule comprising a first entity being an antibody or any antigen binding fragment thereof as herein defined and a second entity. The second entity may be a second antibody or antigen binding fragment thereof that specifically binds to a different target, such as but not limited to an epitope in ricin toxin that is different from the epitope recognized by the antibodies in accordance with the invention. The second antibody or antigen binding fragment thereof may also target other toxins, any other protein of a pathogen, a host-related protein, or a host cell, as non-limiting examples. Bispecific antibodies include cross-linked or heteroconjugate antibodies and can be made using any convenient cross-linking or recombinant methods.

(105) In yet another one of its aspects the present invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding an antibody or any antigen-binding fragment thereof as herein defined.

(106) The term nucleic acid or nucleic acid molecule as herein defined refers to polymer of nucleotides, which may be either single- or double-stranded, which is a polynucleotide such as deoxyribonucleic acid (DNA), and, where appropriate, ribonucleic acid (RNA). The terms should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides. The term DNA used herein also encompasses cDNA, i.e. complementary or copy DNA produced from an RNA template by the action of reverse transcriptase (RNA-dependent DNA polymerase).

(107) In still another one of its aspects the present invention provides an expression vector comprising the isolated nucleic acid molecule as herein defined.

(108) The term Expression vector sometimes referred to as expression vehicle or expression construct, as used herein, encompass vectors such as plasmids, viruses, bacteriophage, integratable DNA fragments, and other vehicles, which enable the integration of DNA fragments into the genome of the host. Expression vectors are typically self-replicating DNA or RNA constructs containing the desired gene or its fragments, and operably linked genetic control elements that are recognized in a suitable host cell and effect expression of the desired genes. These control elements are capable of effecting expression within a suitable host. The expression vector in accordance with the invention may be competent with expression in bacterial, yeast, or mammalian host cells, to name but few.

(109) The present invention further provides a host cell transfected with the isolated nucleic acid molecule or with the expression vector as herein defined.

(110) The term host cells as used herein refers to cells which are susceptible to the introduction of the isolated nucleic acid molecule according to the invention or with the expression vector according to the invention. Preferably, said cells are mammalian cells, for example CHO cells or HEK 293 (which were used in the present disclosure). Transfection of the isolated nucleic acid molecule or the expression vector according to the invention to the host cell may be performed by any method known in the art.

(111) In yet another one of its aspects the present invention provides an immunoconjugate comprising the antibody or any antigen-binding fragment thereof as herein defined and an additional anti-ricin agent.

(112) The term immunoconjugate as herein defined refers to an antibody or any antigen-binding fragment thereof according to the invention that is conjugated (linked or joined) to an additional agent Immunoconjugates may be prepared by any method known to a person skilled in the art, for example, by cross-linking the additional agent to the antibody according to the invention or by recombinant DNA methods.

(113) The term additional anti-ricin agent as herein defined refers to any agent known in the art for the treatment of ricin poisoning. In some embodiments the additional anti-ricin agent in accordance with the invention is a sugar analogue (that prevents ricin binding to its target), an inhibitor of the catalytic subunit of ricin toxin (for example azidothymidine) and an additional antibody.

(114) The term additional antibody as herein defined refers to an antibody, which is not the antibody according to the invention, which may be used in combination with any one of the antibodies of the invention. Such antibody may be directed against ricin, against a different antigen or toxin of Ricinus communis, against a different pathogen or against a host-related moiety.

(115) The present invention further provides a pharmaceutical composition comprising as an active ingredient the isolated monoclonal antibody or any antigen-binding fragment thereof as herein defined, the bispecific molecule or the immunoconjugate according to the invention and a pharmaceutically acceptable carrier, excipient or diluent.

(116) The pharmaceutical composition of the invention generally comprises the antibody or any antigen-binding fragment thereof as herein defined and a buffering agent, an agent which adjusts the osmolarity of the composition and optionally, one or more pharmaceutically acceptable carriers, excipients and/or diluents as known in the art. Supplementary active ingredients can also be incorporated into the compositions, e.g. antibiotics.

(117) As used herein the term pharmaceutically acceptable carrier, excipient or diluent includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents and the like, as known in the art. The carrier can be solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. Each carrier should be both pharmaceutically and physiologically acceptable in the sense of being compatible with the other ingredients and not injurious to the subject. Except as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic composition is contemplated.

(118) In some embodiments the pharmaceutical composition as herein defined further comprises an adjuvant.

(119) An adjuvant as herein defined refers to a pharmacological and/or immunological agent that modifies the effect of other agents. Adjuvants are inorganic or organic chemicals, macromolecules or entire cells of certain killed bacteria, which enhance the immune response to an antigen. Examples of adjuvants include, but are not limited to Freund's adjuvant, aluminium hydroxide etc.

(120) In some further embodiments the pharmaceutical composition according to the invention further comprises an additional anti-ricin agent.

(121) In yet another one of its aspects, the present invention provides the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention, the bispecific molecule, the immunoconjugate or the pharmaceutical composition as herein defined for use in a method of prophylaxis, treatment or amelioration of ricin toxin poisoning.

(122) Further provided is a method of prophylaxis, treatment or amelioration of ricin toxin poisoning comprising administering to a subject in need thereof a therapeutically effective amount of the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention, the bispecific molecule, the immunoconjugate or the pharmaceutical composition as herein defined.

(123) By the term prophylaxis as herein defined it is meant to provide a preventive or prophylactic treatment, namely acting in a protective manner, to defend against or prevent ricin poisoning, namely before exposure to ricin toxin.

(124) The terms treatment,treating,treat or forms thereof as used herein, mean preventing, ameliorating or delaying the onset of one or more clinical indications of poisoning or disease activity resulting from exposure to ricin toxin in a subject at risk of being poisoned by or exposed to ricin toxin or in a subject that was exposed to ricin toxin.

(125) Administration according to the present invention may be performed by any of the following routes: oral administration, intravenous, intramuscular, intraperitoneal, intratechal or subcutaneous injection; intrarectal administration; intranasal administration, ocular administration or topical administration.

(126) In specific embodiments administration according to the present invention may be performed intravenously.

(127) In some embodiments the method according to the invention is further comprises administering to a subject in need thereof an additional anti-ricin agent.

(128) The term subject in need thereof as herein defined means warm-blooded animals, such as for example rats, mice, dogs, cats, guinea pigs, primates and humans at risk of being exposed to ricin toxin or anyone who has come in contact with ricin toxin, for example mail handlers, military personnel, laboratory workers and people who may be exposed to ricin toxin during a bio-terror event.

(129) The method according to the invention may be applied where the isolated monoclonal antibody or any antigen-binding fragment thereof, bispecific molecule, immunoconjugate or pharmaceutical composition as herein defined is administered to the subject prior to or after exposure to ricin toxin.

(130) In some embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof, bispecific molecule, immunoconjugate or pharmaceutical composition as herein defined is administered to the subject immediately after exposure to ricin toxin or between about 1 to about 72 hours after exposure to ricin toxin.

(131) As used herein the term immediately encompasses the instant time frame following detection of ricin poisoning, e.g. minutes after detection.

(132) By way of a non-limiting example, the isolated monoclonal antibody or any antigen-binding fragment thereof, bispecific molecule, immunoconjugate or pharmaceutical composition as herein defined is administered to the subject about 1, 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66 or about 72 hours after exposure to ricin toxin.

(133) The term therapeutically effective amount for purposes herein defined is determined by such considerations as are known in the art in order to cure, arrest or at least alleviate or ameliorate the medical conditions associated with ricin poisoning. For any preparation used in the methods of the invention, the dosage or the therapeutically effective amount can be estimated initially from in vitro cell culture assays or based on animal models known in the art.

(134) In the above and other embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof is administered at a therapeutically effective amount. The treating physician would be able to determine the appropriate therapeutic dosage depending on various clinical parameters of the patient as is well known in the art. A therapeutically effective amount of the antibody is for example between about 10 g/kg to about 50 mg/kg. Non-limiting examples of dosage forms include 1 mg/kg, 2 mg/kg, 3 mg/kg, 3.3 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 30 mg/kg, 40 mg/kg and 50 mg/kg.

(135) It should be appreciated that the therapeutically effective amount as herein defined refers to the isolated monoclonal antibody or any antigen-binding fragment per se, as the active ingredient of a pharmaceutical composition, or as a component of a bispecific molecule or an immunoconjugate.

(136) In some further embodiments the isolated monoclonal antibody or any antigen-binding fragment thereof, bispecific molecule, immunoconjugate or pharmaceutical composition as herein defined is administered to the subject as a single dose or as multiple doses.

(137) As demonstrated in the appended examples, the antibodies described herein, in particular the antibodies referred to as MH75, MH1, MH77, MH73, MH2, MH76, MH49, MH36, MH67 and MH74 were shown to neutralize the ricin toxin in an in vitro assay, by measuring the translation capacity of a cell that was exposed to ricin toxin.

(138) Specifically, using mice in vivo protection model the antibodies designated MH73, MH36, MH75, MH1 and MH77 yielded extremely high survival rates of 83%, 95%, 96%, 100% and 100%, respectively.

(139) Thus in still another one of its aspects the present invention provides a method of neutralizing ricin poisoning comprising administering to a subject in need thereof a therapeutically effective amount of the isolated monoclonal antibody or any antigen-binding fragment thereof, the bispecific molecule, the immunoconjugate or the pharmaceutical composition as herein defined.

(140) By the term neutralizing it is meant blocking, preventing or at least reducing the biological activity of ricin toxin, namely blocking, preventing or at least reducing its ability to inactivate the 28S ribosomal subunit.

(141) The ability of the antibody to neutralize the toxicity of ricin toxin may be monitored by any method known in the art, in particular, using the neutralization assay described herein below or using a viability assay, for example by following the survival of cells that were exposed to ricin toxin and incubated in the presence of the antibody as herein defined, or using a standard animal model, for example as shown in the examples.

(142) In certain embodiments the anti-ricin antibodies of the invention can serve as an effective post-exposure therapy for ricin intoxication at early as well as at late time-points after exposure. While each of the antibodies MH73, MH75, MH1 and MH77 is capable of providing high protection rate by itself, combinations of these highly neutralizing antibodies could also be therapeutically effective.

(143) For example, a combination of the antibodies MH1 and MH75, or a combination of the antibodies MH1 and MH77, or a combination of the antibodies MH75 and MH77. Also contemplated are combinations of at least three of these antibodies, for example a combination of MH75, MH1 and MH77. Also contemplated are combinations of at least four of these antibodies, for example a combination of MH73, MH75, MH1 and MH77.

(144) For example, as detailed in the Examples section below a composition comprising the antibodies MH75, MH1 and MH77 (also referred to as the antibody cocktail therapy) was highly effective, its administration resulting in very high cure rates (>70%) when animals were treated as late as 48 hours post exposure and significant protection (>30%) even at 72 hours. The present invention thus discloses for the first time that a composition comprising several anti-ricin antibodies can serve as a highly effective antidote at such late time-points after exposure. From the clinical point of view, this extended therapeutic window is of high importance, allowing adequate time to accurately identify the causative agent and may permit initiation of life-saving treatment with these antibodies even after the onset of clinical signs.

(145) The present invention thus provides a pharmaceutical composition comprising a combination of two or more of the antibodies of the invention and a pharmaceutically acceptable carrier, excipient or diluent, wherein the antibodies of the invention are the antibodies referred to as MH75, MH1, MH77, MH73, MH2, MH76, MH49, MH36, MH67 and MH74. In particular, the antibodies referred to as MH73, MH75, MH1 and MH77. In certain embodiments the pharmaceutical composition comprises a combination of two, three or four antibodies. In particular, a combination of two, three or four of the antibodies referred to as MH73, MH75, MH1 and MH77.

(146) In one embodiment, the present invention provides a pharmaceutical composition comprising a combination of at least two anti-ricin antibodies, wherein said the antibodies are selected from the group consisting of antibodies MH75, MH1 and MH77, and a pharmaceutically acceptable carrier, excipient or diluent.

(147) In a preferred embodiment, the present invention provides a pharmaceutical composition comprising the antibodies MH75, MH1 and MH77 and a pharmaceutically acceptable carrier, excipient or diluent. In another embodiment the present invention provides a pharmaceutical composition consisting of the antibodies MH75, MH1 and MH77, and a pharmaceutically acceptable carrier, excipient or diluent.

(148) By way of a non-limiting example, the pharmaceutical composition comprising the combination of antibodies as herein defined is administered to the subject about 1, 6, 12, 18, 24, 30, 36, 42, 48, 54, 60, 66, 72 or about 96 hours after exposure to ricin toxin.

(149) The pharmaceutical composition comprising the combination of antibodies as herein defined is administered to the subject at a therapeutically effective amount. The treating physician would be able to determine the appropriate therapeutic dosage depending on various clinical parameters of the patient as is well known in the art. A therapeutically effective amount of the antibody is for example between about 10 g/kg to about 50 mg/kg. Non-limiting examples of dosage forms include 1 mg/kg, 2 mg/kg, 3 mg/kg, 3.3 mg/kg, 5 mg/kg, 10 mg/kg, 20 mg/kg, 30 mg/kg, 40 mg/kg and 50 mg/kg.

(150) As shown in the Examples below an amount of 300 g per mouse of the antibody combination comprising MH1, MH75 and MH77 was effective in ameliorating ricin intoxication in mouse models. This amount is equal to a dose of 10 mg/kg. The corresponding effective dose in humans may even be slightly lower, e.g. 1-10 mg/kg.

(151) The present invention further provides a method of detecting ricin toxin in a biological sample obtained from a subject, said method comprising: (a) contacting said biological sample with the isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention, wherein said monoclonal antibody is labeled with a detectable marker; and (b) detecting said isolated monoclonal antibody or any antigen-binding fragment thereof; wherein the presence of said isolated monoclonal antibody or any antigen-binding fragment thereof indicates the presence of ricin toxin in said biological sample.

(152) Detecting the isolated monoclonal antibody may be performed by any method known to a person skilled in the art based on the detectable marker present on the antibody.

(153) The term detectable marker refers to any atom, molecule or a portion thereof, the presence, absence or level of which is directly or indirectly monitorable. Labeling of the antibodies as herein defined may be performed by any method known in the art.

(154) The term biological sample as herein defined encompasses fluids, solids and tissues obtained from the subject. The term biological sample also refers to forensic samples.

(155) In another one of its aspects the present invention provides a kit for detecting ricin toxin comprising: (a) at least one labeled isolated monoclonal antibody or any antigen-binding fragment thereof according to the invention; (b) means for detection of said labeled isolated monoclonal antibody; and optionally (c) instructions for use of said kit.

(156) It is appreciated that the term purified or isolated refers to molecules, such as amino acid or nucleic acid sequences, peptides, polypeptides or antibodies that are removed from their natural environment, isolated or separated. An isolated antibody is therefore a purified antibody. As used herein, the term purified or to purify also refers to the removal of contaminants from a sample.

(157) The term about as used herein indicates values that may deviate up to 1%, more specifically 5%, more specifically 10%, more specifically 15%, and in some cases up to 20% higher or lower than the value referred to, the deviation range including integer values, and, if applicable, non-integer values as well, constituting a continuous range.

EXAMPLES

(158) Without further elaboration, it is believed that one skilled in the art can, using the preceding description, utilize the present disclosure to its fullest extent. The following preferred specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the claimed invention in any way.

(159) Standard molecular biology protocols known in the art not specifically described herein are generally followed essentially as in Sambrook & Russell, 2001.

(160) Standard medicinal chemistry methods known in the art not specifically described herein are generally followed essentially in the series Comprehensive Medicinal Chemistry by various authors and editors, published by Pergamon Press.

(161) Experimental Procedures

(162) Immunization

(163) Crude ricin was prepared from seeds of endemic Ricinus communis (R. communis) that were homogenized in a Waring blender in 5% acetic acid/phosphate buffer (Na.sub.2HPO.sub.4, pH 7.4). The homogenate was centrifuged and the clarified supernatant containing the toxin was subjected to ammonium sulphate precipitation (60% saturation). The precipitate was dissolved in PBS and dialyzed extensively against the same buffer. The crude ricin preparation was loaded onto a gel-filtration column (Superdex 200HR 16/60 Hiload) and washed out with PBS to yield two well-separated protein peaks corresponding to RCA (Ricinus communis agglutinin, another toxic protein found in the castor bean) and ricin. Ricin was further reduced in the presence of DTT in pH 9.0 followed by the addition of Iodoacetamide (IAA, added in order to block cysteines and prevent disulfide bond formation) and dialysis in PBS.

(164) Two rhesus macaques (Macaca Mulata) were used for eliciting antibodies against ricin. The first rhesus macaque was injected with 100 g of reduced ricin, prepared as described above, mixed with complete Freund's adjuvant followed by two monthly booster injections of 100 g reduced ricin mixed with incomplete Freund's adjuvant. The second rhesus macaque was injected with 2 g of purified ricin mixed with complete Freund's adjuvant followed by three monthly booster injections of 5, 80 and 80 g purified ricin mixed with incomplete Freud adjuvant. Seven days after the last boost, the monkeys were sacrificed and samples were taken from their blood and lymphatic nodes in order to isolate mRNA that was subsequently used for variable heavy and variable light (VH/VL) chain amplification.

(165) Phage Library Construction

(166) mRNA was extracted from lymph nodes and peripheral blood of the immunized Macaques, and was reverse-transcribed into cDNA. The heavy and light chains variable regions (VH and VL, respectively) were amplified from the cDNA, using a set of primers designed to cover all known antibody families of Monkeys. The nucleic acid sequences of these primers (synthesized by Integrated DNA Technologies, IDT) are detailed in Table 1 below (SEQ ID NO. 1 to SEQ ID NO. 52). VH and VL were randomly assembled by PCR to construct a combinatorial single-chain (scFv) library, which was then cloned into phagmid vector to create a phage-display library.

(167) TABLE-US-00001 TABLE1 Primersdesignedfortheamplification ofantibodiesvariableregions SEQIDNO. Primer Sequence 1 Lib-H1F CAGGAGCAGCTGGTGCAGTC 2 Lib-H2F CAGGTCCAGCTGGTGSAGWC 3 Lib-H3F CAGGTSCAGCTCGAGSAGTC 4 Lib-H4F CAGGTGCAGCTGCAGGAGTC 5 Lib-H5F CAGCTGCAGCTGCAGSAGTC 6 Lib-H6F CAGGTGCAGCTRCTCGAGTS 7 Lib-H7F CAGGTSCAGCTGGTGCAGTY 8 Lib-H8F CAGGTSACCTTGAAGGAGTC 9 Lib-H9F CAGGTCCAGCTGCAGGAAAG 10 Lib-H10F GAGGTGCAGYTGGTGGAGWC 11 Lib-H11F GAGGTTCAGYTGGTKGAATC 12 Lib-H12F GAGGTGCAGCTGGTGSARTC 13 Lib-H13F GAGGTGCAGCTGGYRGAGTC 14 Lib-H14F GAAGTGCAGYTGGTGGAGTC 15 Lib-H15F GAGGTGCAGCTCGAGGAGTC 16 Lib-H16F GAGGTGCAGCTGCTCGAGTC 17 VHRev1 CTGARGAGRCTGTGACC 18 VHRev2 CTGAGGACACGGCAACC 19 Lib-K1F GATATTGTGATGAYCCAGAC 20 Lib-K2F GATACTGTGATGACCCAGAC 21 Lib-K3F GATATYGAGCTCACBCAGTC 22 Lib-K4F GATGTTGYRATGACTCAGTC 23 Lib-K5F GACATTCAGMTGWCCCAGTC 24 Lib-K6F GACGTTCAGATGACCCAGTC 25 Lib-K7F GACATCCAGATGACCCAGTC 26 Lib-K8F GAGCTCCWGATGACMCAGTC 27 Lib-K9F GAAATWGTRATGACGCAGTC 28 Lib-K10F GAAATCGAGCTCACRCAGTC 29 Lib-K11F CAAGTTATATTGACTCAGTC 30 Lib-K12F GACATCGAGCTCACCCAGTC 31 Lib-K13F GAGCTCGTGTTGACACAGTC 32 Lib-K1Rev YTTGAKATCCAGTTTGGTCCCGGG 33 Lib-K2Rev TTTGAYCTCCACCYTGGTCCCTCC 34 Lib-K3Rev TTTGATSTCCACTTTGGTCCCCTG 35 Lib-K4Rev TYTGATTTCCACCYTGGTCCCTTG 36 Lib-K5Rev CTTGATGTCCACCTTGGTCCCGTG 37 Lib-K6Rev TTTTAGTACCACCTTGGTCCCTTG 38 Lib-L1F CAGCCAGKGCTGACTCAGCC 39 Lib-L2F CAGCCTGKGCTGACTCAGYC 40 Lib-L3F CAGTCTGTGYTGACKCAGCC 41 Lib-L4F CAGTCTGCCCTGACTCAGCC 42 Lib-L5F CAGTCTGCCCCGAYTCAGYC 43 Lib-L6F CAGGCTGCCCYGACTCAGYC 44 Lib-L7F CAGGCAGGGCTGACTCAGCC 45 Lib-L8F CAGACTGTGGTGACCCAGGA 46 Lib-L9F AAGCCTATGCTGACTCAGCC 47 Lib-L10F TCTTCTGRGCTGACTCAGGA 48 Lib-L11F TCCTATGAGCTGACWCAGCC 49 Lib-L12F CAGSCTGTGCTGACTCAGCC 50 Lib-L13F CWGCCTGTGCTGACTCARYC 51 Lib-L1Rev TAGRACGGTSAGCCGGGTC 52 Lib-L2Rev GAGGAYGGTCAAYTTGGTG
Phage Particle Amplification

(168) The E. coli TG1 strain (Lucigen #60502) was infected with the desired phages, in the presence of a helper phage, M13KO7 (NEB #N0315S). The infected culture was centrifuged and the pellet was eluted with 2YT medium containing Ampicilin (100 g/ml) and Kanamicin (50 g/ml), and incubated over-night (o.n.) in 30 C. Following a further centrifugation step, the supernatant was passed over 0.45 m filter and the phage particles were incubated in the presence of 2.5M NaCl, 20% PEG 6000 for 2 hours on ice. After an additional centrifugation step of 1 hr at 9000 g, the pellet containing the phage particles was eluted with PBS and stored at 4 C.

(169) Panning

(170) The process of selecting antibodies against a specific antigen from a phage display library is called panning. In one cycle of panning, the library is incubated with the antigen, to allow binding. The unbound phages are then eliminated by washing, while those phages displaying scFv that is bound to the antigen are eluted and enriched. The eluted and enriched phages obtained in the first panning cycle may be subjected to additional panning cycles for screening of specific clones. Several consecutive panning cycles usually allow the selection of high affinity antibodies.

(171) Biotinylated ricin, namely pure ricin that was biotinylated using a commercial kit (EZ-Link sulfo-NHS-biotin, pierce) was first incubated with Streptavidin (SA) beads (Dynabeads M-280, Invitrogen #11206D) for 30 minutes (min). The phage display library was added to the beads and the mixture was incubated for an additional 90 min The beads were then washed with 3% bovine serum albumin (BSA) in phosphate buffered saline (PBS), followed by washing with phosphate buffered saline Tween-20 (PBST) and PBS. The bound phages were eluted from the beads by incubation in 100 mM Triethylamine for 30 min, followed by neutralization with 200 l Tris-HCl pH 7.5 (1M). The resulting phages were used to infect TG1 cells and grown over night for phage enrichment. The culture was then collected and 100 l were used for phage rescue, to prepare the input for the next round of panning. In total, three rounds of selection were used for isolating the anti-ricin antibodies.

(172) Screening

(173) Individual clones were obtained by performing three rounds of selection (three panning cycles) as described above and grown in 96-well plates. Each clone was then tested for its ability to specifically bind ricin, and each of its subunits, namely ricin chain A and ricin chain B in an ELISA assay as described below. Maxisorp 96-well microtiter plates were coated overnight with 5 g/ml of ricin (50 l/well) in NaHCO.sub.3 buffer (50 mM, pH 9.6), then washed and blocked with PBST buffer (0.05% Tween 20, 2% BSA in PBS) at room temperature for one hour. Clone samples were added to the ricin-coated plates for an incubation of one hour, the plates were then washed with PBST, incubated with the detecting horseradish peroxidase (HRP)-conjugated anti-M13 antibody and then developed using Tetramethylbenzidine (TMB/E). Single-stranded DNA of phage clones was prepared using Big Dye (Applied Biosystems) and the PCR products were analyzed with ABI PRISM 310 Genetic Analyzer (Applied Biosystems).

(174) Producing Full Length Antibodies

(175) Each single chain variable fragment (scFv) isolated from the phage display library was cloned into a mammalian full-length Immunoglobulin expression vector, providing each chain with the corresponding signal-peptide and constant gene, and resulting in IgGl// chimeric macaque-human antibody expression.

(176) Antibody Sequencing

(177) The plasmids encoding the chimeric antibodies were sequenced using ABI PRISM 310 Genetic Analyzer (Applied Biosystems). The plasmids were transiently transfected to HEK293 cells, and antibodies were purified from the culture media using Protein A columns.

(178) In vitro Neutralization Assay

(179) Hela Ub-FL cells (7) were cultured in Dulbecco's modified Eagle's medium (DMEM, Biological Industrial, Beit Haemek, Israel) supplemented with 10% fetal calf serum (FCS). For cytotoxicity studies (i.e. the neutralization assays), cells were seeded in 96-well plates (110.sup.5 cells/well) in medium containing ricin (at 2 ng/ml, prepared as described above) and incubated at 37 C. in the presence or absence of the anti-ricin antibodies prepared as discussed above. Sixteen hours later the medium was removed, and the cells were subjected to a protein translation assay, in order to determine the neutralizing effect of the antibody. Briefly, the cells were lysed and the residual intracellular ubiquitin-luciferase fusion protein activity was determined using D-luciferin as a substrate (measured in luminometer; Victor3, PerkinElmer) and expressed as percent activity determined for untreated cells.

(180) In vivo Protection Assay

(181) Female out bred ICR mice (Charles River Laboratories) were maintained at 20-22 C. and a relative humidity of 5010% on a 12-h light/dark cycle, fed with commercial rodent chow (Koffolk Inc.) and provided with tap water ad libitum. Treatment of animals was in accordance with regulations outlined in the USDA Animal Welfare Act and the conditions specified in Guide for Care and Use of Laboratory Animals (National Institute of Health, 1996). Animal studies were approved by the local ethical committee on animal experiments.

(182) Mice, 27-32 gr, were intranasaly intoxicated with 2LD.sub.50 of ricin (5 g/Kg, 50 l/mice) and six hours later were treated with 100 g of anti-ricin antibody which was injected intravenously. The mice were monitored for 14 days and the protection conferred by each antibody was calculated as percent of surviving mice. Mice intoxicated with ricin without antibody treatment, were used as control.

Example 1

(183) Preparation of Chimeric Antibodies Directed to Ricin

(184) Rhesus macaques were immunized against ricin and mRNA was extracted from the immunized macaques and reverse-transcribed into cDNA, as described above. The cDNA was further used for construction of a phage-display library and individual phage clones were selected as described above.

(185) After panning and screening of the phage display library, 10 different antibodies, termed MH1, MH2, MH36, MH49, MH67, MH73, MH74, MH75, MH76 and MH77, were isolated and sequenced, as described above. The nucleic acid sequences of the heavy and the light chains of the antibodies are shown in Table 2 below. A sequence alignment of the nucleic acid sequences of the above isolated antibodies is shown in FIG. 1 for the heavy chain sequences and in FIG. 2 for the light chain sequences of the above antibodies.

(186) TABLE-US-00002 TABLE2 Nucleicacidsequencesofthe antibodiesheavyandlightchains SEQ ID NO. Sequence Description 53 GAGGCGCAGCTCGAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACC Heavychain CTGTCCCTCAGTTGCGCTGTCTCTGGTGGCTCCTTCAGGAGTTACTGGTGG ofMH49 GGCTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGAGTATC TATGGCAGTAGTGGGAGCACCGAATACAACCCCTCCCTCAAAAGTCGAGCC ACCATTTCAAGAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCT GTGACCGCCGCGGACACGGCCGTCTATTACTGTGCGAGGCAGATACAATTT TTGACTGATGCTTTTGATTTCTGGGGCCAAGGGCTCAGGGTCACAGTCTCC TCA 54 CAGGTGCAGCTCGAGCAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACC Heavychain CTGTCCCTCAGTTGCGCTGTCTCTGGTGGCTCCTTCAGGAGTTACTGGTGG ofMH67 GGCTGGATCCGCCAGCCCCCAGGGAAGGGCCTGGAGTGGATTGGGAGTATC TATGGCAGTAGTGGGAGCACCGAATACAACCCCTCCCTCAAAAGTCGAGCC ACCATTTCAAGAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCT GTGACCGCCGCGGACACGGCCGTCTATTACTGTGCGAGGCAGATACAATTT TTGACTGATGCTTTTGATTTCTGGGGCCAAGGGCTCAGGGTCACAGCCTCC TCA 55 CAGGTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCGGAGACC Heavychain CTGTCCCTCACCTGCGCTGTCTCTGGTGGCTCCCTCAGCAGTAACTACTGG ofMH73 AGCTGGATCCGCCAGGCCCCAGGGAAGGGACTGGAGTGGATTGGACATATC TTTGGTGGTGGTGGGGGCACCGACTACAACCCCTCCCTCAAGAGTCGAGTC ACCATTTCAACAGACACGTCCAAGAACCAGTTCTCCCTGAAGCTGAGCTCT CTGGCCGCCGCGGACACGGCCGTGTATTACTGTGCGAGAGCTGCAATAATG TACCCCAACCGGTTCGATGTCTGGGGCCCGGGAGTCCTGGTCACAGCCTCT AGC 56 GAGGTGCAGCTGGTGCAATCTGGAGCAGAGGTGAAAAGGCCCGGGGAGTCA Heavychain CTGAAGATCTCCTGTAAGACTTCTGGATACAGCTTTACCAGCTACTGGATC ofMH74 AGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGGCGATT GATCCTACTGATTCTGATACCAGATACAACCCGTCCTTCCAAGGCCAGGTC ACCATCTCCGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGG CTGAAGGCCTCGGACACCGCCACGTATTACTGTGCGAAATCAGACTGGAGT GATTATTATGGCAACTCATTGGATGTCTGGGGCCGGGGAGTTCTGGTCACA GCCTCTTCA 57 CAGGAGCAGCTGGTGCAGTCTGGGGGCGGCTTGGCAAAGCCTGGGGGGTCC Heavychain CTGAGACTCTCCTGCGCAGACTCCGGATTCACCTTCAGTGACCACTACATG ofMH75 GACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCACGTATT AGTACTGGTGGTGGAACCACATGGTACGCAGACTCCGTGAAGGGCAGATTC ACCATCTCCAGAGAGAACGCCAACAACACACTGTATCTTCAAATGAACAGC CTGAGAGGTGAGGACACGGCTGTCTATTACTGTGCGAAAGTTCCCACGGGA TACAGTCAAGGGGTCTGGGGGCCGGGAGTCCTGGTCACAGCCTCCTCA 58 CAGGTGCAGCTGCAGGAGTCTGGGGGCGGCTTGGCAAAGCCTGGGGGGTCC Heavychain CTGAGACTCTCCTGCGCAGCCTCCGGATTCACCTTCAGTGACTACTACATG ofMH76 GACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGATTGGGTCTCACGCATT AGTAATGGTGGTGGTACCACATGGTACGCAGACTCCGTGAAGGGCAGATTC ACCATCTCCAGAGAGAACGCCAAGAACACACTGTATCTTCAAATGAACAGC CTGAGACCTGAGGACACGGCTGTCTATTACTGTGCGACGGTGCCCACAGCG ACATCTGGAATAGGCAACTGGGGCCAGGGAGTCCTGGTCACAGCCTCCTCA 59 CAGGTGCAGCTGCTCGAGTCGGGCCCAGGACTGGTGAAGCCTTCAGAGACC Heavychain CTGTCCCTCACCTGCACTGTCTCTGGTGGCTCTTTCAGTAGTAGTCATTGG ofMH77 TGGAACTGGATCCGCCAGGCCCCAGGGAAAGGGCTGGAGTGGATTGGCTAT ATCACCACTAGTAATGGTGCCACCTACTACAACCCCTCCCTCAAGAGTCGA GTCACCATTTCAACAGACACGTCCAAGAACCAGTTCTCCCTGAAACTGAGC TCTGTGACCGCCGCGGACTCGGCCGTGTATTTCTGTGCGAGGGGATACAGT AACTGGGACAACTGGTTCGATGTCTGGGGCCCGGGAGTCCTGGTCACAGTC TCCTCA 60 CAGCTGCAGCTGCAGGAGTCGGGCCCAGGACTGGTGAAGCCTTCAGAGACC Heavychain CTGTCCCTCACTTGCGCTGTCTCTGGTGGCTCCATCAGCGGTGGTTATGGC ofMH1 TGGGGCTGGATCCGCCAGCCCCCAGGGAAGGGGCTGGAGTGGGTTGGGAGT ATCTATGGTAGTACTGGGAACACCTACTACAACCCCTCCCTCAAGAGTCGA GTCACCATTTCAACAGACACGTCCAAGAACCAGCTCTCCCTGAAGGTGAGC TCTGTGACCGCCGCGGACACGGCCATCTACTACTGTGCGAGAGCCCGCAGT GGTACTTTGTGGTTCCTCGAGTTCTGGGGCCAGGGCGCCCCGGTCACAGCA TCCTCA 61 GAGGTTCAGTTGGTGGAATCTGGGGGCGGCTTGGCAAAGCCTGGGGGGTCC Heavychain CTGAGACTCTCCTGCGCAGCCTCCGGATTCACCTTCAGTGACTACTACATG ofMH2 GACTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCACGTATT AGTAATGGTGGTGGTAGTAAATGGTACGCAGACTCCGTGAAGGGCAGATTC ACCATCTCCAGAGAGAACGCCAAGAACACACTGTATCTTCAAATGAACAGC CTGAGAGCTGAGGACACGGCTGTATATTACTGTGCGGAAGTTCCCACGGGA TACAGTCAAGGTGTCTGGGGCCCGGGAGTCCTGTTCACAGTCTCCTCA 62 GAAGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCC Heavychain CTGAGGCTCTCCTGTGCAGCCTCTGGATTCACCTTCAGTAACGTCTGGATG ofMH36 AACTGGGTCCGCCAGACTCCAGGGAAGGGGCTAGAGTGGGTTGCCCGTATT AAAGTCAAAGCTGACGGTGGAACAGCAGATTACGCCGCGTCTGTGAAAGGC AGATTCACCATCTCAAGAGACGATTCAAAGAACACACTGTATCTGCAAATG AACAGTCTGAAAACCGAGGACACGGCCGTGTATTACTGCACCACAGAGGAG ATTACAGTGGCCCGTTATGACTACTGGGGCCAGGGAGTCCTGGTCACAGTC TCCTCA 63 CAGCCTGTGCTGACTCAGCCACGCTCAGTGTCCGTGTCCCCAGGACAGACG Lightchain GCCAGGATCACCTGTGGGGGAGACAACATTGGAAGTAAAAGTGTGCAGTGG ofMH1 TACCAGCAGAAGCCACCGCAGGCCCCTGTGCTGGTCATCTATGCTGATAGC GAACGGCCCTCAGGAATCCCTGAGCGATTCTCTGGCTCCAACTCAGGGAAC ACCGCCACCCTGACCGTCAGCGGGGTCGAGGCCGGGGATGAGGCTGACTAT TACTGTCAGGTGTGGGACAGTAGTAGTGATCATGTGTTATTCGGAGGAGGG ACCCGGCTGACCGTCCTA 64 CAGTCTGTGTTGACTCAGCCACAATCGGTGTCGGTGTCCCCAGGACAGACG Lightchain GCCAGGATCTCCTGTGGGGGAGACAACATTGGAAGTAAAAATGTGCACTGG ofMH2 TACCAGCAGAAGCCACCGCAGGCCCCTGTGCTGGTCATCTATGCTGGAACC GAACGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCCGGGAAC ACGGCCACCCTGACCATCAGCGGGGTCGAGGCCGGGGATGAGGCGGACTAT TACTGTCAGGTGTGGGACGGTACCCGTGAGCATGTATTATTCGGAGGAGGG ACCCGGCTCACCGTCCTA 65 CAGTCTGTGTTGACTCAGCCACCCTCAGCGTCTGGGGCTCCCGGGCAGAGT Lightchain GTCACCATCTCTTGCTCTGGAAGCAGCTCCAACATCAGAGGTAATGGTGTA ofMH36 CACTGGTACCAGCAGCTCTCAGGAATGGCCCCCAAACTCCTCATCTATAAT AATAATCAGCGACCCTCAGGGGTCCCTGACCGATTCTCTGGCTCCAAGTCT GGCACGTCAGCCTCCCTGGCCATCACTGGTCTCCAGTCTGAGGATGAGGCC GATTATTACTGCGAGGCATGGGATAACAGCCTGAGCGGTGGCTTATTCGGA GGAGGGACCCGGCTGACCGTCCTA 66 CAGCCAGGGCTGACTCAGCCTCCCTCAGCGTCTGGGGCTCCCGGGCAGAGT Lightchain GTCACCATCTCTTGCTCTGGAAGCAGCTCTGACATTGGAAGTCATGACGTC ofMH49 TACTGGTACCAGCAGCTCCCAGGGACGGCCCCCAAGCTCCTCATCTACTAC AGTAATCAGCGACCCTCAGGGGTCCCTGACCGAATCTCTGGCTCCAAGTCT GGCACGTCAGCCTCCCTGACCATCAGCGGTCTCCGGTCCGAGGATGAGGCT GATTATTACTGTGAAACATGGGAAAACAGCCTGAGCGGTCCGGTCTTCGGC GGAGGGACCCGGCTCACCGTCCTA 67 GACATTCAGCTGACCCAGTCTCCATCCTCCGTGTCTGCTTCTGTGGGAGAC Lightchain AGAGTCACCATCACTTGTCGGGCGAGTCAGGCCATCAGTACTTATTTAGCC ofMH67 TGGTATCTACAGAGGCCGGGGAAAGCCCCTGAACTCCTGATCTATTATGCA ACCACTTTACACACTGGGGTCGCTTCAGGTCTCACTGGCAGTGGATCTGGG ACGGATTTCACTCTCACCCTCAGTGCCCTGCAACCTGTAGATGTTGGAACT TACTACTGTCAACAGTTTAAAACTTTACCGTACACTTTTGGCCAGGGGACC AAAGTGGACATCAAA 68 GAGCTCCTGATGACACAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGAC Lightchain AGAGTCACCATCTCTTGCCGGGCAAGTCAGAACATTTATAGTAATTTAGCG ofMH73 TGGTATCAGCAGAAACCAGGGAAAACTCCTAAGCTCCTGATCTATGCTGCA TCCATCTTGCAGAGTGGGATTCCCTCTCGGTTCAGCGGCAGCGGATCTGGG ACAGATTACACTCTCACCATCACCAACCTGCAGCCTGAAGATTTTGGAACT TATTACTGTCAGCAAGGTTTTGGTATCCCCTACACTTTTGGCCAGGGGACC AAAGTGGAGTTCAAA 69 CAGTCTGTGTTGACTCAGCCGCCCTCAGTGTCTGGGGCGCCAGGACAGAGG Lightchain GTCACCATCTCCTGCACTGGGAGTAATTCCAACATCGGGGCGGGTTATTAT ofMH74 GTGCAGTGGTACCAGCAGCTTCCAGGAACGGCCCCCAAACTCCTCATCTAT GAAAATAATAAGCGACCCTCAGGGGTTTCTGATCGATTCTCTGGCTCCAAG TCTGGTACCTCAGCCTCCCTGACCATCACTGGACTTCAGTCTGAGGATGAG GCTGACTATTACTGCCAGTCCTATGACAGCAGCCTGAGTGTTGTGTTATTC GGAGGAGGGACCCGGCTCACCGTCCTA 70 CAGTCTGTGTTGACTCAGCCACAATCGGTGTCGGTGTCCCCAGGACAGACG Lightchain GCCAGGATCACCTGTGGGGGAGACAACATTGGAAGTAAAAATGTGCACTGG ofMH75 TACCAGCAGAAGCCACCGCAGGCCCCTGTGCTGGTCATCTATGCTGAAACC GAGCGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCCGGGAAC ACGGCCACCCTGACCATCAGCGGAGTCGAGGCCGGGGATGAGGCGGACTAT TACTGTCAGGTGTGGGACGGTAGCAGTGCACATGTATTATTCGCAGGAGGG ACCCGGCTGACCGTCCTA 71 CAGCCAGGGCTGACTCAGCCACACTCGGTGTCGGTGTCCCCAGGACAGACG Lightchain GCCAGGATCACCTGTGGGGGAGACAACATTGGAAGTAAAAATGTGCACTGG ofMH76 TACCAGCAGAAGCCACCGCAGGCCCCTGTGCTGGTCATCTATGCTGATAGC GAACGGCCCTCAGGGATCCCTGAGCGATTCTCTGGCTCCAACTCCGGGAAC ACGGCCACCCTGACCATCAGCGGGGTCGAGGCCGGGGATGAGGCTGACTAT TACTGTCAGGTGTGGGACAGTAGCAGTAATCATGTGTTATTCGGAGGAGGG ACCCGGCTCACCGTACTA 72 GACATTCAGATGTCCCAGTCTCCTTCCTCCCTGTCTGCATCTGTGGGAGAC Lightchain AAAGTCACCATCACTTGCCAGGCAAGTCAGAGTGTTAGCAGCTGGTTAGCC ofMH77 TGGTATCGGCAGAAACCAGGGAAGGCCCCTAAGCCCCTGATCTATAAGGCA TCCAGTTTGGAAGGTGGGGTCCCCTCAAGGTTCAGCGGCAGTGGATCTGGG ACAGATTTCACTCTCACCATCAACAGCCTGCAGCCTGAAGATTTTGCAACT TATTACTGTCAACAGTATAACAGTGTGCCGTACAGTTTTGGCCACGGGACC AAGGTGGACATCAAG

(187) The amino acid sequences of the heavy and the light chains of the antibodies MH1, MH2, MH36, MH49, MH67, MH73, MH74, MH75, MH76 and MH77 are shown in Table 3 below. The complementarity determining regions (CDRs) are shown in underline. A sequence alignment of the amino acid sequences of the above isolated antibodies is shown in FIG. 3 for the heavy chain and in FIG. 4 for the light chain of the antibodies.

(188) TABLE-US-00003 TABLE3 Aminoacidsequencesoftheantibodies heavyandlightchains SEQID NO. Sequence Description 73 Heavychain ofMH1 74 Heavychain ofMH2 75 Heavychain ofMH36 76 0 Heavychain ofMH49 77 Heavychain ofMH67 78 Heavychain ofMH73 79 Heavychain 0 ofMH74 80 Heavychain ofmH75 81 Heavychain ofMH76 82 Heavychain ofMH77 0 83 Lightchain ofMH1 84 Lightchain ofMH2 85 Lightchain ofMH36 86 0 Lightchain ofMH49 87 Lightchain ofMH67 88 Lightchain ofMH73 89 Lightchain 0 ofMH74 90 Lightchain ofMH75 91 Lightchain ofMH76 92 Lightchain ofMH77 0 CDRs are shown in underline.

(189) The amino acid sequences of the complementarity determining regions (CDRs) of the heavy and the light chains of the antibodies MH1, MH2, MH36, MH49, MH67, MH73, MH74, MH75, MH76 and MH77 are presented in Table 4 below. The sequences of CDRH1, CDRH2 and CDRH3 are identical in antibodies 49 and 67. These two antibodies have the same heavy chain CDRs with a different light chain, as a result of the combinatorial arrangement of the scFv's. Therefore, the sequences denoted by SEQ ID NO. 102, 103, and 104, are identical to SEQ ID NO. 105, 106, and 107, respectively.

(190) TABLE-US-00004 TABLE4 Aminoacidsequencesofthe antibodiesheavyandlightchainCDRs SEQ IDNO. Sequence Description 93 SGGYGWG MH1heavychainCDRH1 94 SIYGSTGNTYYNPSLKS MH1heavychainCDRH2 95 ARSGTLWFLEF MH1heavychainCDRH3 96 SDYYMD MH2heavychainCDRH1 97 RISNGGGSKWYADSVKG MH2heavychainCDRH2 98 VPTGYSQGV MH2heavychainCDRH3 99 SNVWMN MH36heavychainCDRH1 100 RIKVKADGGTADYAASVKG MH36heavychainCDRH2 101 EEITVARYDY MH36heavychainCDRH3 102 RSYWWG MH49heavychainCDRH1 103 SIYGSSGSTEYNPSLKS MH49heavychainCDRH2 104 QIQFLTDAFDF MH49heavychainCDRH3 105 RSYWWG MH67heavychainCDRH1 106 SIYGSSGSTEYNPSLKS MH67heavychainCDRH2 107 QIQFLTDAFDF MH67heavychainCDRH3 108 SSNYWS MH73heavychainCDRH1 109 HIFGGGGGTDYNPSLKS MH73heavychainCDRH2 110 AAIMYPNRFDV MH73heavychainCDRH3 111 TSYWIS MH74heavychainCDRH1 112 AIDPTDSDTRYNPSFQG MH74heavychainCDRH2 113 SDWSDYYGNSLDV MH74heavychainCDRH3 114 SDHYMD MH75heavychainCDRH1 115 RISTGGGTTWYADSVKG MH75heavychainCDRH2 116 VPTGYSQGV MH75heavychainCDRH3 117 SDYYMD MH76heavychainCDRH1 118 RISNGGGTTWYADSVKG MH76heavychainCDRH2 119 VPTATSGIGN MH76heavychainCDRH3 120 SSSHWWN MH77heavychainCDRH1 121 YITTSNGATYYNPSLKS MH77heavychainCDRH2 122 GYSNWDNWFDV MH77heavychainCDRH3 123 GDNIGSKSVQ MH1lightchainCDRL1 124 ADSERPS MH1lightchainCDRL2 125 QVWDSSSDHVLFGG MH1lightchainCDRL3 126 GDNIGSKNVH MH2lightchainCDRL1 127 AGTERPS MH2lightchainCDRL2 128 QVWDGTREHVLFGG MH2lightchainCDRL3 129 GSSSNIRGNGVH MH36lightchainCDRL1 130 NNNQRPS MH36lightchainCDRL2 131 EAWDNSLSGGLFGG MH36lightchainCDRL3 132 GSSSDIGSHDVY MH49lightchainCDRL1 133 YSNQRPS MH49lightchainCDRL2 134 ETWENSLSGPVFGG MH49lightchainCDRL3 135 ASQAISTYLA MH67lightchainCDRL1 136 YATTLHT MH67lightchainCDRL2 137 QQFKTLPYTFGQ MH67lightchainCDRL3 138 ASQNIYSNLA MH73lightchainCDRL1 139 AASILQS MH73lightchainCDRL2 140 QQGFGIPYTFGQ MH73lightchainCDRL3 141 GSNSNIGAGYYVQ MH74lightchainCDRL1 142 ENNKRPS MH74lightchainCDRL2 143 QSYDSSLSVVLFGG MH74lightchainCDRL3 144 GDNIGSKNVH MH75lightchainCDRL1 145 AETERPS MH75lightchainCDRL2 146 QVWDGSSAHVLFAG MH75lightchainCDRL3 147 GDNIGSKNVH MH76lightchainCDRL1 148 ADSERPS MH76lightchainCDRL2 149 QVWDSSSNHVLFGG MH76lightchainCDRL3 150 ASQSVSSWLA MH77lightchainCDRL1 151 KASSLEG MH77lightchainCDRL2 152 QQYNSVPYSFGH MH77lightchainCDRL3

Example 2

(191) Binding of the Chimeric Antibodies to Ricin

(192) An Elisa assay, or Biolayer Interferometry (Octate.sup.red; Fortebio) were used in order to assess the binding ability of the various antibodies prepared as described above to ricin and to each of its two subunits, namely the A chain (RTA) and the B chain (RTB). As demonstrated in FIG. 5A, all of the antibodies showed high affinity to ricin and were able to bind variable epitopes on the antigen.

(193) Interestingly, five of the antibodies, namely the antibodies MH1, MH36, MH49, MH67 and MH74 bind the RTA subunit; five antibodies, namely the antibodies MH2, MH73, MH75, MH76 and MH77 bind the RTB subunit. The results concerning MH73 were inconclusive in the ELISA assay but the antibody clearly binds the RTB subunit as measured using Biolayer Interferometry as shown in FIG. 5B.

Example 3

(194) The Chimeric Antibodies Neutralize the Ricin Toxin in vitro

(195) The capability of each of the antibodies MH1, MH2, MH36, MH49, MH67, MH73, MH74, MH75, MH76 and MH77 to neutralize the ricin toxin was studied using an in vitro neutralization assay in Hela Ub-FL cells, as described above.

(196) The amount of antibody required to neutralize 50% of the toxin is shown in Table 5 below for each of the assayed antibodies (ED=effective dose). As demonstrated in the Table, all of the antibodies were capable of neutralizing the toxin.

(197) TABLE-US-00005 TABLE 5 Concentration of antibody required to neutralize 50% of the toxin Antibody ED.sub.50 (ng/ml) MH1 200 MH2 5,200 MH36 27,000 MH49 1,200 MH67 52,000 MH73 11,000 MH74 83,000 MH75 150 MH76 10,500 MH77 500

(198) Remarkably, the antibodies MH75, MH1, MH77 and were highly effective in neutralizing the toxin as compared to the other antibodies. Without wishing to be bound by theory, the differences in neutralization efficiency may result from differences in the affinity of each one of the antibodies to the epitope it binds, and also from differences in the epitopes, where some may be more affective for neutralization than others.

Example 4

(199) The capability of each of the anti-ricin antibodies to neutralize the ricin toxin was studied using an in vivo protection assay, as described above.

(200) Several anti-ricin antibodies of the invention were tested for their ability to neutralize ricin in vivo. The antibodies MH1 and MH36 were chosen as representatives of the anti-RTA group, MH73, MH75 and MH77 for the anti-RTB group and MH2 and MH76 as representatives of antibodies showing lower affinity

(201) TABLE-US-00006 TABLE 6 Post exposure treatment efficacy Antibody Survival proportions (%) 0% MH1 100 MH2 40 MH36 95 MH73 83 MH75 96 MH76 60 MH77 100

(202) Table 6 shows the survival proportions of mice treated with the different antibodies six hours after intranasal intoxication with 2LD.sub.50 of ricin. Upon intranasal exposure of mice to 2LD.sub.50 of ricin, untreated control animals succumb within 5-9 days (mean time to death of 6.5 days). At six hours post intoxication, mice were treated by intravenous administration of 100 g of the tested antibody and were monitored for 14 days. It was found that treatment with MH1, MH36, MH75 or MH77 yielded extremely high survival rates of 95-100%. Treatment with antibody MH73 resulted with 83% survival while in those groups treated with MH2 or MH76, 40% and 60%, respectively, have survived.

Example 5

(203) Extended Therapeutic Window for Post-Exposure Treatment of Ricin Intoxication Conferred by the Use of a Combination of High-Affinity Antibodies

(204) Experimental Procedures

(205) In Vitro Ricin Neutralization Assay

(206) Pure ricin was prepared as described previously (8). HeLa Ub-FL cells (7) were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Biological Industries, Beit Haemek, Israel) supplemented with 10% fetal calf serum (FCS). For cytotoxicity studies (11), cells were seeded in 96-well plates (1.510.sup.4 cells/well) in medium containing ricin (30 ng/ml) and incubated at 37 C. in the presence or absence of the anti-ricin antibody. Six hours later, the medium was removed; the cells were lysed; and the residual intracellular ubiquitin-luciferase fusion protein activity was determined using D-luciferin as a substrate and expressed as percent activity determined for untreated cells.

(207) In Vivo Protection Assay

(208) Female outbred ICR mice (Charles River Laboratories, Canterbury, UK) were maintained at 20-22 C. and a relative humidity of 5010% on a 12-h light/dark cycle, fed with commercial rodent chow (Koffolk Inc., Rancho Santa Fe, Calif., USA) and tap water ad libitum. Treatment of animals was in accordance with regulations outlined in the U.S. Department of Agriculture (USDA) Animal Welfare Act and the conditions specified in the Guide for Care and Use of Laboratory Animals (National Institute of Health, 2011). Animal studies were approved by the local ethical committee on animal experiments.

(209) Anesthetized mice, 27-30 g, were intoxicated by intranasal instillation (50 l/mice) of the indicated ricin doses (LD.sub.50=2.55 g/kg) that was slowly applied (25 l/nostril) using a gel-loading tip (12, 13) and treated at the indicated time points after intoxication. For the mono-antibody treatment, each antibody was diluted in PBS to a concentration of 0.5 mg/ml and for the antibody cocktail therapy, the antibodies were diluted to a final concentration of 1, 1.5 or 2 mg/ml (for the cocktail of 2, 3 or 4 antibodies, respectively). At the indicated time points after intoxication, mice were treated with 100 g of each antibody (alone or in a cocktail) by intravenous injection in a final volume of 200 l. The mice were monitored for 14 days, and the protection conferred by each antibody was calculated as the percent of surviving mice. Mice intoxicated with ricin without antibody treatment were used as control. Survival plots were calculated using Prism software (Version 5.01, GraphPad Software Inc., La Jolla, Calif., USA, 2007).

(210) Epitope Binning

(211) Binding studies were carried out using the Octet Red system (ForteBio, Version 8.1, Menlo Park, Calif., USA, 2015) that measures biolayer interferometry (BLI), essentially as described in Noy et al (14). All steps were performed at 30 C. with shaking at 1500 rpm in a black 96-well plate containing 200 l solution in each well. Streptavidin-coated biosensors were loaded with biotinylated antibody (5 g/ml) for 300 sec followed by a wash. The sensors were then reacted for 300 sec with ricin (10 g/ml), moved to buffer-containing wells for another wash step and reacted with non-labeled antibody pair (300 sec followed by another short wash). Binding and dissociation were measured as changes over time in light interference after subtraction of parallel measurements from unloaded biosensors.

(212) Results

(213) The treatment efficacy of a cocktail comprising the antibodies MH1, MH73, MH75 and MH77 (100 g/mouse of each of the antibodies; total 400 g/mouse) was first tested. 100% of the animals that were treated with the antibody cocktail had survived, while untreated mice succumbed within 7 days (FIG. 6). This treatment conferred full protection to animals that were intoxicated with ricin also at a higher dose of 3LD.sub.50 and high protection rates of 86% and 73% were achieved even when the challenge doses of ricin were increased to 4LD.sub.50 and 5LD.sub.50.

(214) Next, in an attempt to widen the therapeutic window, the efficacy of treatment was measured at significantly later time points after ricin intoxication. To this end, mice were intoxicated with 2LD.sub.50 of ricin and treated with the antibody cocktail (MH1, MH73, MH75 and MH77; 100 g/mouse of each of the antibodies; total 400 g/mouse) 24 hours post intoxication. 56% of the treated animals had survived the challenge (FIG. 7A). These results are significantly higher when compared to the treatment efficacy of polyclonal anti-ricin antibodies at this time point, which results in only about 30% survival (8, 9). In order to better understand the contribution of the different antibodies in the antibody cocktail, the protection efficacy of the individual antibodies at 24 hours post exposure was compared to that of the antibody cocktail. Interestingly, it was found that when administered alone, most of the antibodies provided better protection than the cocktail of four antibodies. In fact, treatment with antibodies MH1, MH75 and MH77 resulted in survival rates of 72%, 62% and 89%, respectively (FIG. 7B). In comparison, 53% of the animals treated with antibody MH73 survived, a value that is similar to that achieved when animals were treated with the antibody cocktail (56%).

(215) In order to explore the possibility of interference within the antibody cocktail, two approaches were taken: (1) the neutralization efficacy of each pair of the antibodies was tested in vitro and compared to the neutralization efficacy of each antibody in itself and to that of the cocktail of the four antibodies, and (2) the binding profiles of different combinations of the antibodies to the toxin, was tested.

(216) The neutralization efficacy of the antibodies was evaluated by determining their ability to inhibit the toxin activity in the HeLa Ub-FL cells based assay (FIG. 8). The presented values express the antibody concentration needed to neutralize 50% of ricin activity (PD.sub.50). The rank order of the neutralization efficacies of the individual antibodies was found to be MH75>MH1=MH77>MH73 with PD.sub.50 values of 180, 620, 600 and 14,200 ng/ml, respectively (Table 7). When combined, the PD.sub.50 value of the antibody cocktail was 220 ng/ml, similar to the PD.sub.50 value of the best-neutralizing antibody, namely MH75.

(217) TABLE-US-00007 TABLE 7 PD.sub.50 values of anti-ricin antibodies, alone, in pairs or as a cocktail. 1.sup.st Antibody 2.sup.nd Antibody PD.sub.50 (ng/ml).sup.a MH1 620 MH73 14,200 MH75 180 MH77 600 MH1 MH73 520 MH1 MH75 200 MH1 MH77 270 MH73 MH75 190 MH73 MH77 480 MH75 MH77 210 4 Abs cocktail 220 .sup.aValues are calculated from the in vitro neutralization assay

(218) Without wishing to be bound by theory, it appears that one (or more) of the four antibodies in the cocktail interferes with the activity of the other antibodies.

(219) The binding profile of the antibody cocktail to ricin was studied next, using the Octet system, where protein-protein interactions can be monitored online in a label-free manner. Antibody MH1 was immobilized to the biosensor and then submerged in a ricin-containing well and the formation of the antibody-toxin complex induced a wavelength shift (FIG. 9A). Submerging of the MH1-ricin complex in MH75-containing well induced an additional wavelength shift, testifying that both antibodies bind to distinct epitopes. Likewise, the new-formed complex further interacted with antibodies MH77 and MH73, thus indicating that the four antibodies can bind simultaneously to ricin. Yet, it was noted that the wavelength shift that was induced by MH77 was much lower than expected. Therefore, MH77 was immobilized to a sensor and its interaction with the other anti-RTB antibodies was tested. In this setup, it was found that while MH75 binds well with MH77, the binding of MH73 to the pre-formed complex was impaired (FIG. 9B). It was further shown that once a complex of the antibodies MH73 (as the immobilized moiety) and MH75 was formed, antibody MH77 could not bind the toxin (FIG. 9C). It was thus concluded that there is some kind of steric hindrance when the three anti-RTB antibodies bind to ricin, and while this interference cannot be detected in vitro, in the in vivo model, under harsher conditions, it does appear to impair the antibody-cocktail activity.

(220) The binding-profile of the antibody sets suggest that the main interference arises from the simultaneous binding of MH73 and MH77. As antibody MH73 was shown to provide the lowest protection efficacy as compared to the other three antibodies (FIG. 7B), it was decided to exclude it from the cocktail. Indeed, when tested in vivo, the three-antibodies based cocktail (MH1+MH75+MH77) was able to induce very high protection rates (80%) when given to ricin-intoxicated mice, 24 hours post exposure (FIG. 10).

(221) Next, the possibility to initiate treatment at even later time-points (longer than 24 hours post intoxication) was evaluated. To this end, mice were intoxicated with ricin and treated with the antibody-cocktail (three antibodies: MH1+MH75+MH77; 100 g/mouse of each of the antibodies; total 300 g/mouse) at 48-96 hours post exposure. It was found that very high cure rates were obtained (73%) when treatment was performed 48 hours post intoxication and a significant proportion (36%) of the intoxicated mice that were treated as late as 72 hours post exposure also survived (FIG. 10). Only by 96 hours post intoxication, the antibody-treatment ceased to provide a significant protection. These results are quite remarkable, especially in light of the fact that at this time point, the ricin-intoxicated mice suffer from extensive damage to the lung tissue (8, 15).