Metal-nucleic acid nanoparticle, preparation method therefor and use thereof

Abstract

The present application relates to a metal-nucleic acid nanoparticle which is a nanoparticle having a spherical structure formed by assembly of metal ions with nucleic acids via coordination. The preparation thereof is mixing a metal ion solution with a nucleic acid solution to obtain a mixture followed by vortex, heating, centrifugation, washing with water and resuspension to obtain the metal-nucleic acid nanoparticles.

Claims

1. A metal ion-nucleic acid nanoparticle, wherein the metal ion-nucleic acid nanoparticle is a nanoparticle having a spherical structure formed by assembly of metal ions with nucleic acids via coordination interaction, wherein the metal ions are Fe(II) ions.

2. The metal ion-nucleic acid nanoparticles according to claim 1, wherein the metal ion-nucleic acid nanoparticle has a particle size of 5 to 3000 nm.

3. A preparation method for the metal ion-nucleic acid nanoparticle according to claim 1, wherein the preparation method is: mixing an Fe(II) ion solution with a nucleic acid solution to obtain a mixture followed by vortex, heating, centrifugation, washing with water and resuspension to obtain the metal ion-nucleic acid nanoparticles.

4. The preparation method according to claim 3, wherein a concentration of the Fe(II) ion in the mixture is 0.01-30 mM; a concentration of the nucleic acid in the mixture is 0.005-1.0 mM.

5. The preparation method according to claim 3, wherein a molar ratio of the Fe(II) ion to the nucleic acid in the mixture is (1-100): 1.

6. The preparation method according to claim 3, wherein a solvent used to prepare the Fe(II) ion solution and the nucleic acid solution is deionized water; the vortex is carried out for 0-60 s—the heating is carried out by metal bath heating; the heating is carried out at a temperature of 25-100° C., the heating is carried out for 1-10 h; the centrifugation is carried out at a speed of 8000-15000 rpm, the centrifugation is carried out for 1-30 min—the centrifugation, washing with water and resuspension are carried out for 1 to 5 times.

7. A multifunctional metal ion-nucleic acid nanoparticle, wherein the multifunctional metal ion-nucleic acid nanoparticle comprises the metal ion-nucleic acid nanoparticle according to claim 1 and an effector molecule.

8. The multifunctional metal ion-nucleic acid nanoparticle according to claim 7, wherein the effector molecule is a drug molecule and/or a fluorescent tracer molecule.

9. The multifunctional metal ion-nucleic acid nanoparticle according to claim 7, wherein the effector molecule is used in an amount of ranges from 1% to 60% relative to the metal ion-nucleic acid nanoparticle.

10. A preparation method for the multifunctional metal ion-nucleic acid nanoparticle according to claim 7, wherein the preparation method is: adding an Fe(II) metal ion solution into a nucleic acid solution containing an effector molecule to obtain a mixture followed by vortex, heating, centrifugation, washing with water and resuspension to obtain the multifunctional metal ion-nucleic acid nanoparticles.

11. The preparation method according to claim 10, wherein the preparation method comprises the following steps: (1) adding an Fe(II) ion solution to a nucleic acid solution containing an effector molecule such that a concentration of the Fe(II) ion is 0.01-30 mM, a concentration of the nucleic acid is 0.005-1.0 mM, and a molar ratio of the Fe(II) ion to the nucleic acid is (1-100):1; (2) vortexing the mixture for 0-60 s, and then heating the same in a metal bath at 25-100 C for 1-10 h; (3) centrifuging the mixture at a speed of 8000-15000 rpm for 1-30 min, washing it with water and resuspending the same 1 to 5 times to obtain the multifunctional metal ion-nucleic acid nanoparticle.

12. A drug delivery system comprising the metal ion-nucleic acid nanoparticle according to claim 1.

13. The drug delivery system according to claim 12, wherein the drug is an anti-tumor drug.

14. A biological detection reagent comprising the multifunctional metal ion-nucleic acid nanoparticle according to claim 7.

15. The metal ion-nucleic acid nanoparticle according to claim 2, the nucleic acid is a single-stranded DNA, a double-stranded DNA, a circular DNA, an RNA, or a combination of them.

16. The metal ion-nucleic acid nanoparticle according to claim 15, wherein the RNA is a siRNA or a miRNA.

17. The multifunctional metal ion-nucleic acid nanoparticle according to claim 8, the drug is an anti-tumor drug.

18. A drug delivery system comprising the multifunctional metal ion-nucleic acid nanoparticle according to claim 7, wherein the drug is an anti-tumor drug.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1A is a transmission electron micrograph of the metal-nucleic acid nanoparticles prepared in Example 2;

(2) FIG. 1B is a transmission electron micrograph of the metal-nucleic acid nanoparticles prepared in Example 3;

(3) FIG. 1C is a transmission electron micrograph of the metal-nucleic acid nanoparticles prepared in Example 6;

(4) FIG. 1D is a transmission electron micrograph of the metal-nucleic acid nanoparticles prepared in Example 10;

(5) FIG. 1E is a transmission electron micrograph of the metal-nucleic acid nanoparticles prepared in Example 14;

(6) FIG. 2 is a graph showing the ultraviolet spectrum of the metal-nucleic acid nanoparticles prepared in Example 1;

(7) FIG. 3A is a high-resolution transmission electron micrograph of the metal-nucleic acid nanoparticles prepared in Example 1;

(8) FIG. 3B is a diagram showing the selected area electron diffraction analysis of the metal-nucleic acid nanoparticle prepared in Example 1;

(9) FIG. 4A is a schematic diagram showing the selected area in the linear scanning of the metal-nucleic acid nanoparticle prepared in Example 1;

(10) FIG. 4B is a graph showing the linear scanning of the selected area of FIG. 4A;

(11) FIG. 5 is a graph showing the infrared spectrum of the metal-nucleic acid nanoparticle prepared in Example 1;

(12) FIG. 6 is a graph showing the Zeta potential of the metal-nucleic acid nanoparticles prepared in Example 1;

(13) FIG. 7 is a graph showing the results of the flow cytometry assay of cellular uptake of the metal-nucleic acid nanoparticles prepared in Example 3;

(14) FIG. 8A is a graph showing the results of an ELISA test of the immune factor TNF-α;

(15) FIG. 8B is a graph showing the results of an ELISA test of the immune factor IL-6;

(16) FIG. 9 is a graph showing the results of an MTT assay of the drug-loaded metal-nucleic acid nanoparticle prepared in Example 17.

DETAILED DESCRIPTION

(17) The technical solutions of the present application are further described below by specific embodiments. It should be understood by those skilled in the art that these examples are merely to facilitate the understanding of the present application and should not be construed as limitation thereto.

Example 1

(18) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with nucleic acids via coordination, wherein the preparation method thereof comprised the following steps.

(19) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 20 s, and then heated in a metal bath at 95° C. for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this washing step was carried out twice to obtain the metal-nucleic acid nanoparticles.

Example 2

(20) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with nucleic acids via coordination, wherein the preparation method thereof comprised the following steps.

(21) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 150 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGCTGCTAATCCTGA). The mixture was vortexed for 60 s, and then heated in a metal bath at 1001 for 1 h followed by centrifugation at 15000 rpm for 20 min, washing with water and resuspension, and this washing step was carried out 3 times to obtain the metal-nucleic acid nanoparticle.

Example 3

(22) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(23) 75 μL of 0.2 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 1425 μL containing 75 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases and labeled with fluorescent dye Cy5 (TCCATGACGTTCCTGACGTT). The mixture was vortexed for 10 s, and then heated in a metal bath at 75□ for 1 h followed by centrifugation at 14000 rpm for 1 min, washing with water and resuspension, and this step was carried out five times to obtain the metal-nucleic acid nanoparticle.

Example 4

(24) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(25) 30 μL of 50 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 40 s, and then heated in a metal bath at 25□ for 10 h followed by centrifugation at 8000 rpm for 30 min, washing with water and resuspension, and this step was carried out 1 time to obtain the metal-nucleic acid nanoparticle.

Example 5

(26) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(27) 30 μL of 0.5 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 60 s, and then heated in a metal bath at 25□ for 10 h followed by centrifugation at 8000 rpm for 30 min, washing with water and resuspension, and this step was carried out 1 time to obtain the metal-nucleic acid nanoparticle.

Example 6

(28) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(29) 30 μL of 0.6 M FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 8 mM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGACTATAATCCTGA). The mixture was vortexed for 20 s, and then heated in a metal bath at 95° C. for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this step was carried out twice to obtain the metal-nucleic acid nanoparticle.

Example 7

(30) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(31) 75 μL of 0.2 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 1425 μL containing 75 μL of 100 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (AAATTTTTTTTTTTTTTTTT). The mixture was vortexed for 10 s, and then heated in a metal bath at 75□ for 1 h followed by centrifugation at 14000 rpm for 1 min, washing with water and resuspension, and this step was carried out five times to obtain the metal-nucleic acid nanoparticle.

Example 8

(32) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(33) 90 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 225 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (TCCATGACGTTCCTGACGTT). The mixture was vortexed for 20 s, and then heated in a metal bath at 95° C. for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this step was carried out twice to obtain the metal-nucleic acid nanoparticle.

Example 9

(34) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(35) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 20 s, and then heated in a metal bath at 75□ for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this step was carried out twice to obtain the metal-nucleic acid nanoparticle.

Example 10

(36) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(37) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid, wherein the nucleic acid was a ribonucleotide sequence small interfering RNA containing 21 bases (GCGGCAGCAGGUAGCAAAGdTdT). The mixture was vortexed for 20 s, and then heated in a metal bath at 95° C. for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this step was carried out twice to obtain the metal-nucleic acid nanoparticle.

Example 11

(38) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(39) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 20 s, and then heated in a metal bath at 50□ for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this step was carried out twice to obtain the metal-nucleic acid nanoparticle.

Example 12

(40) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(41) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 40 s, and then heated in a metal bath at 95□ for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this step was carried out twice to obtain the metal-nucleic acid nanoparticle.

Example 13

(42) The present example provided a metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination, wherein the preparation method thereof comprised the following steps.

(43) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 20 s, and then heated in a metal bath at 95° C. for 3 h followed by centrifugation at 13,000 rpm for 15 min, washing with water and resuspension, and this step was carried out twice to obtain the metal-nucleic acid nanoparticle.

Example 14

(44) The present example provided a drug-loaded metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination and loaded with a drug, wherein the preparation method thereof comprised the following steps.

(45) 18 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 582 μL containing 45 μL of 200 μM nucleic acid and 150 μL of 1 mg/mL ribonuclease, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 20 s, and then heated in a metal bath at 60□ for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this step was carried out twice to obtain the drug-loaded metal-nucleic acid nanoparticle.

Example 15

(46) The present example provided a drug-loaded metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination and loaded with a drug, wherein the preparation method thereof comprised the following steps.

(47) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid and 190 μL of 1 mg/mL ribonuclease, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 40 s, and then heated in a metal bath at 95□ for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this step was carried out twice to obtain the drug-loaded metal-nucleic acid nanoparticle.

Example 16

(48) The present example provided a drug-loaded metal-nucleic acid nanoparticle which was a nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination and loaded with a drug, wherein the preparation method thereof comprised the following steps.

(49) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 150 μL of 200 μM nucleic acid and 300 μL of 1 mg/mL ribonuclease, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGAAAATGCTAATCCTGA). The mixture was vortexed for 20 s, and then heated in a metal bath at 80□ for 3 h, followed by centrifugation at 13,000 rpm for 15 min, washing with water and resuspension, and this step was carried out twice to obtain the drug-loaded metal-nucleic acid nanoparticle.

Example 17

(50) The present example provided a drug-loaded metal-nucleic acid nanoparticle which was a spherical nanoparticle having a spherical structure formed by combining metal ions with a nucleic acid via coordination and loaded with a drug, wherein the preparation method thereof comprised the following steps.

(51) 30 μL of 20 mM FeCl.sub.2.4H.sub.2O solution was quickly added to an aqueous solution having a total volume of 570 μL containing 75 μL of 200 μM nucleic acid and 10 μL of 10 mM doxorubicin, wherein the nucleic acid was a deoxyribonucleotide sequence containing 20 bases (ATCGTCGATGCTAATCCTGA). The mixture was vortexed for 20 s, and then heated in a metal bath at 95° C. for 3 h followed by centrifugation at 13,000 rpm for 10 min, washing with water and resuspension, and this step was carried out twice to obtain the drug-loaded metal-nucleic acid nanoparticle.

Example 18

(52) Test on Morphology and Particle Size:

(53) The products prepared in Examples 1-17 were tested for morphology and particle size. The specific operation method was as follows. The prepared product was ultrasonically dispersed with deionized water, and the dispersion was dropped on a copper mesh. After it was naturally dried, the sample was observed for morphology with a transmission electron microscope. Then an average particle size of any 100 particles in the electron micrograph was statistically calculated using ImageJ software and was deemed as an average particle size of the sample. The results are shown in FIG. 1 and Table 1. FIGS. 1A, 1B, 1C, 1D, and 1E are electron micrographs of Example 2, Example 3, Example 6, Example 10, and Example 14, respectively.

(54) As can be seen from FIGS. 1A to 1E, the prepared products were nanoparticles having a spherical structure.

(55) TABLE-US-00001 TABLE 1 Product Particle size Example 1 75 nm Example 2 100 nm Example 3 150 nm Example 4 320 nm Example 5 330 nm Example 6 520 nm Example 7 20 nm Example 8 200 nm Example 9 815 nm Example 10 110 nm Example 11 765 nm Example 12 720 nm Example 13 660 nm Example 14 1.5 μm Example 15 2.1 μm Example 16 2.7 μm Example 17 270 nm

Example 19

(56) Test on UV Performance

(57) The product prepared in Example 1 was tested for UV performance. The specific operation method was as follows. The sample was formulated into dispersions having the same concentration. The dispersion was placed in a cuvette and measured for UV absorption within the spectral range of 250-600 nm with an UV-visible spectrophotometer. The position of an ultraviolet absorption peak with maximum peak intensity was the ultraviolet absorption wavelength of the product. The results are shown in FIG. 2.

(58) It can be seen from FIG. 2 that the nanoparticle prepared in Example 1 had an ultraviolet absorption peak near 272 nm, which was red-shifted by about 10 nm compared with the ultraviolet spectrum of pure DNA. The red shift effect was related to the coordination of metal ions with DNA.

Example 20

(59) Test on Nanoparticle Crystal Form:

(60) The product prepared in the Example 1 was tested for nanoparticle crystal form. The specific operation method was as follows. The sample was dispersed with deionized water, and the dispersion was dropped on a copper mesh. After it was naturally dried, the sample was observed for morphology with a high-resolution transmission electron microscope. Electron diffraction was used to perform selected area electron diffraction to analyze whether the sample was crystalline. The results are shown in FIGS. 3A and 3B.

(61) As can be seen from FIGS. 3A and 3B, the high-resolution transmission electron micrograph showed that the nanoparticle prepared in Example 1 had no lattice fringes, and the selected area electron diffraction diagram showed no diffraction spots, indicating that the nanoparticle has an amorphous structure.

Example 21

(62) Test on Element Distribution:

(63) The product prepared in Example 1 was tested for element distribution. The specific operation method was as follows. The sample was dispersed with deionized water, and the dispersion was dropped on a copper mesh. After it was naturally dried, the elemental distribution was analyzed and linear scanning was performed with high-angle annular dark-field scanning transmission electron microscopy-energy dispersive X-ray spectrometer. The results are shown in FIGS. 4A and 4B.

(64) As can be seen from FIGS. 4A and 4B, elements Fe, P and N were uniformly distributed throughout the nanoparticle, indicating that Fe and DNA were well assembled together.

Example 22

(65) Test on Infrared Spectrum:

(66) The product prepared in Example 1 was tested for infrared spectrum. The specific operation method was as follows. The sample was dispersed with deionized water, and the obtained dispersion was dropped on a silicon wafer. After it was naturally dried, functional groups in the sample were analyzed with a Fourier transform infrared spectrometer. The result is shown in FIG. 5.

(67) It can be seen from FIG. 5 that the peak of the phosphate skeleton in the DNA was at 1213 cm.sup.−1, while the peak of the phosphate skeleton in the metal-DNA nanoparticle was shifted to 1192 cm.sup.−1, indicating that the phosphate skeleton had a coordination effect.

Example 23

(68) Test on Potential:

(69) The product prepared in Example 1 was tested for potential. The specific operation method was as follows. The sample was dispersed with deionized water, diluted and placed in a dish for potential measurement and tested with a nano-laser particle size analyzer. The result is shown in FIG. 6.

(70) As can be seen from FIG. 6, the potential of the nanoparticles was −22.5 mV, indicating that the DNA was combined with Fe to make it uniformly disperse in the aqueous solution.

Example 24

(71) Flow Cytometry Test:

(72) The product prepared in Example 3 was subjected to a flow cytometry test. The specific operation method was as follows. RAW264.7 macrophages were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 100 units/ml water-soluble penicillin G, 4.5 mg/mL glucose, 4×10.sup.−3 M L-glutamine, 10% FBS and 100 μg/mL streptomycin at a culture density of 4×10.sup.5 cells/well in a culture dish in a CO.sub.2 incubator at 37° C. After 24 hours of incubation, the medium was washed, and fresh cell culture medium containing the product of Example 3 was added. After an additional 4 hours of incubation, the treated cells were rinsed with pre-heated PBS solution (3×2 mL) to remove free nanoparticles, and fresh medium was added to the culture dish. An appropriate number of cells was taken and treated with an antibody, and then subjected to the flow cytometry test using a flow cytometer. The result is shown in FIG. 7.

(73) As can be seen from FIG. 7, the nanoparticles prepared in Example 3 showed strong fluorescence intensity, quantitatively indicating that the nanoparticles entered into the cells well.

Example 25

(74) ELISA Test:

(75) The product prepared in Example 3 was subjected to an ELISA test. The specific operation method was as follows. RAW264.7 macrophages were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 100 units/ml water-soluble penicillin G, 4.5 mg/mL glucose, 4×10.sup.−3 M L-glutamine, 10% FBS and 100 μg/mL streptomycin at a culture density of 4×10.sup.5 cells/well in a culture dish in a CO.sub.2 incubator at 37° C. After 24 hours of incubation, the medium was washed, and fresh cell culture medium containing the product of Example 3 was added. After an additional 4 hours of incubation, the treated cells were rinsed with pre-heated PBS solution (3×2 mL) to remove free nanoparticles, and fresh medium was added to the culture dish. An appropriate number of cells was taken and treated with an antibody, and then subjected to the ELISA test using a microplate reader. The result is shown in FIG. 8. FIG. 8A shows the detection results of TNF-α factor, and FIG. 8B shows the detection results of IL-6 factor.

(76) As can be seen from FIGS. 8A and 8B, the nanoparticles prepared in Example 3 produced a large amount of immune factors TNF-α and IL-6, which can kill tumor cells by immune response (in the figures, Ctrl represented a control group and Fe-CpG NPs represented the nanoparticles prepared in Example 3.)

Example 26

(77) MTT Test:

(78) The product prepared in Example 17 was subjected to MTT test. The specific operation method was as follows. RAW264.7 macrophages were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 100 units/ml water-soluble penicillin G, 4.5 mg/mL glucose, 4×10.sup.−3 M L-glutamine, 10% FBS and 100 μg/mL streptomycin at a culture density of 4×10.sup.5 cells/well in a culture dish in a CO.sub.2 incubator at 37° C. After 24 hours of incubation, the medium was washed, and fresh cell culture medium containing the product of Example 17 was added. After an additional 4 hours of incubation, the treated cells were rinsed with pre-heated PBS solution (3×2 mL) to remove free nanoparticles, and fresh medium was added to the culture dish. An appropriate number of cells were taken and treated, and then medium containing MTT was added. The cells were subjected to the MTT test using a microplate reader. The result is shown in FIG. 9.

(79) As can be seen from FIG. 9, the cells incubated with the doxorubicin co-encapsulated metal-DNA nanoparticles prepared in Example 17 induced a low cell viability, indicating that the nanoparticles had a strong killing effect on tumor cells (Ctrl in the figure represented a control group).

(80) The applicant states that the present application describes the metal-nucleic acid nanoparticle of the present application and the preparation method and use thereof by the above examples. However, the present application is not limited to the above examples, and it does not mean that the present application must rely on the above examples to implement.

(81) The foregoing describes the optional embodiments of the present application in detail. However, the present application is not limited to the specific details in the foregoing embodiments, and various simple modifications may be made to the technical solutions of the present application within the technical concept of the present application.

(82) In addition, it should be noted that the specific technical features described in the above specific embodiments may be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present application will not further explain the various possible combinations.