Modified S1 subunit of the coronavirus spike protein

11512115 · 2022-11-29

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates i.a. to a recombinant avian coronavirus spike protein or fragment thereof comprising a mutation at amino acid position 267 to Cysteine. Further, the present invention relates to an immunogenic composition comprising an avian coronavirus with such spike protein.

    Claims

    1. An avian coronavirus spike protein or fragment thereof, wherein at least a part of the S1 subunit is from an avian coronavirus with a restricted cell or tissue tropism, and wherein at amino acid position 267 is a Cysteine, wherein the amino acid sequence of SEQ ID NO:1 is used for determining the position numbering in the spike protein and the Cysteine at amino acid position 267 leads to an extended cell or tissue tropism of the avian coronavirus.

    2. A recombinant avian coronavirus spike protein or fragment thereof comprising a mutation at amino acid position 267 to Cysteine, wherein the amino acid sequence of SEQ ID NO:1 is used for determining the position numbering in the spike protein and the mutation at amino acid position 267 to Cysteine leads to an extended cell or tissue tropism of the avian coronavirus.

    3. The avian coronavirus spike protein or fragment thereof of claim 1, wherein the avian coronavirus is IBV (infectious bronchitis virus).

    4. The avian coronavirus spike protein or fragment thereof of claim 1, wherein the Cysteine at amino acid position 267 is introduced by a mutation.

    5. The avian coronavirus spike protein or fragment thereof of any one of claims 1, wherein the avian coronavirus is infecting and/or replicating in at least one cell line selected from the list consisting of: DF-1 (Douglas Foster), PBS-12, PBS-12SF (PBS-12 serum free), BHK21 (baby hamster kidney), HEK 293T (human embryonic kidney), Vero (Verda Reno), MA104, RK13 (rabbit kidney), LMH (leghorn male hepatoma), MDCK (Madin-Darby canine kidney), MDBK (Madin-Darby bovine kidney), PK15 (porcine kidney), PK2A (porcine kidney), SF9, SF21 and SF+ (Spodoptera frugiperda).

    6. The avian coronavirus spike protein or fragment thereof of any one of claim 1, wherein the amino acid position 267 is within the S1 subunit of the spike protein.

    7. The avian coronavirus spike protein or fragment thereof of any one of claim 1, wherein the spike protein is not from an IBV Beaudette strain.

    8. The IBV spike protein or fragment thereof of any one of claim 3, wherein the spike protein is from an IBV with a genotype or serotype or a strain selected from a list consisting of: Arkansas, Brazil, California, Connecticut, Delaware, Dutch, Florida, Georgia, Gray, Holte, Iowa, Italy-02, JMK, LDT3, Maine, H52, H120, M41, Pennsylvania, PL84084, Qu, QX, Q1, SE 17, Variant 2 and 4/91.

    9. The IBV spike protein or fragment thereof of any one of claim 3, wherein the IBV spike protein or fragment thereof is selected from a list of genotypes consisting of: GI-2 to 27, GII-1, GIII-1, GIV-1, GV-1, GVI-1.

    10. The IBV spike protein or fragment thereof of any one of claim 3, wherein the IBV spike protein or fragment thereof consists of or comprises an amino acid sequence as shown in SEQ ID NO: 2, 3, 4, 5, 6, 7, 8, 77 or a sequence having at least 80%, 85%, 90%, 93%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%, 99.95%, 99.98% or 99.99% sequence identity thereto.

    11. The IBV spike protein or fragment thereof of any one of claim 3, wherein said at least a part of the S1 subunit is from an IBV selected from a list of genotypes or serotypes or strains consisting of: Arkansas, Brazil, California, Connecticut, Delaware, Dutch, Florida, Georgia, Gray, Holte, Iowa, Italy-02, JMK, LDT3, Maine, H52, H120, M41, Pennsylvania, Pennsylvania, PL84084, Qu, QX, Q1, SE 17, Variant 2 and 4/91.

    12. The avian coronavirus spike protein or fragment thereof of any one of claim 1, wherein the avian coronavirus or IBV with restricted cell or tissue tropism is restricted to infection and/or replication in embryonated chicken eggs and/or in primary chicken kidney cells.

    13. A nucleotide sequence encoding the spike protein or fragment thereof of any one of claim 1.

    14. A plasmid comprising a nucleotide sequence of claim 13.

    15. A cell comprising a plasmid of claim 14.

    16. A viral particle comprising a spike protein or fragment thereof of any one of claim 1.

    17. An avian coronavirus comprising the spike protein or fragment thereof of claim 1.

    18. The avian coronavirus or IBV of claim 17, wherein the avian coronavirus or IBV is attenuated.

    19. A cell comprising the viral particle of claim 16.

    20. An immunogenic composition comprising the spike protein of claim 1.

    21. A method for the production or manufacture of an avian coronavirus with an extended cell or tissue tropism comprising the use of the avian coronavirus spike protein or fragment thereof of any one of claim 1.

    22. A method for culturing an avian coronavirus in a cell or tissue culture comprising the use of the avian coronavirus spike protein or fragment thereof of claim 1.

    23. The method of claim 21 or 22, wherein the coronavirus spike protein is an IBV (infectious bronchitis virus) spike protein.

    24. A method for immunizing a subject comprising administering to such subject an immunogenic composition of claim 20.

    25. A method of treating or preventing clinical signs caused by IBV in a subject of need, the method comprises administering to the subject a therapeutically effective amount of an immunogenic composition of claim 20.

    26. A method of reducing the ciliostasis in a subject of need, in comparison to a subject of a non-immunized control group of the same species, the method comprises administering to the subject a therapeutically effective amount of an immunogenic composition of claim 20.

    27. The avian coronavirus spike protein or fragment thereof of claim 3, wherein the IBV with restricted cell or tissue tropism is restricted to infection and/or replication in embryonated chicken eggs and/or in primary chicken kidney cells.

    28. An IBV (infectious bronchitis virus) comprising the spike protein of claim 3.

    29. A cell comprising the avian coronavirus of claim 17.

    30. A cell comprising the IBV of claim 28.

    31. An immunogenic composition comprising the viral particle of claim 16.

    32. An immunogenic composition comprising the IBV of claim 28.

    33. The avian coronavirus spike protein or fragment thereof of claim 2, wherein the avian coronavirus is IBV (infectious bronchitis virus).

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    (1) FIG. 1. In ovo kinetics for H52 rIBV S F267C in comparison to H52 rIBV wild type virus assessed by detection of viral load via RT-qPCR. Data point represent the mean of 5 samples per time point. Error bars indicate the standard deviation.

    (2) FIG. 2. Passaging of H52 rIBV S F267C in Eb66® cells. RT-qPCR CT values are determined at the time point of infection (t=0) and harvest (t=72) of each passage. P1 to P5 are generated by infection with a 1/10 dilution of the virus stock of the previous passage. P6 and P7 are generated by inoculation with a 1/1000 dilution of the previous passage. The experiment is repeated with an MOI of 0.001 for the first passage and similar results are obtained.

    (3) FIG. 3. Replication kinetics of H52 rIBV S F267C in EB66® cells. Cells are infected with rIBV at an MOI of 0.001 based on TCID50 titers from the third EB66®-propagated passage of the viruses. Nucleic acids are isolated at 0, 8, 24, 48 and 72 hpi and analyzed via IBV-specific RT-qPCR. Each data point represents the mean ct value of three independent experiments. Error bars indicate the standard error of the mean (SEM).

    (4) FIG. 4. Replication kinetics of H52 rIBV S F267C in EB66® cells. Samples of time points 0, 8, 24, 48 and 72 hpi are analyzed by TCID50 titration. Results of one experiment are shown.

    (5) FIG. 5 Summary of ciliostasis scoring for protection by H52 rIBV S F267C against M41 challenge. The sum of the 10 individual scores for the 10 rings of one animal is calculated and is represented by one dot in the graph. Maximum ciliostasis corresponds to a score of 40, while no ciliostasis is represented by a score of 0. Mean and significance are calculated using GraphPad Prism and an ordinary one-way ANOVA test (p<0,0001).

    (6) FIG. 6. Summary of RT-qPCR results of kidneys tissues 7 days after challenge for the efficacy study of H52 rIBV S F267C. Each individual bird is indicated by one dot.

    (7) FIG. 7. Replication of H52 rIBV S F267C in PBS-12SF cells determined via immunofluorescence analysis. One of three independent experiments is shown.

    (8) FIG. 8: Relication of H52 rIBV S F267C in PBS-12SF cells determined via nucleic acid extraction from the supernatant and subsequent RT-qPCR analysis. One of two independent experiments is shown.

    (9) FIG. 9. Replication of H52 rIBV S F267C in HEK 293T cells determined via immunofluorescence analysis. One of three independent experiments is shown.

    (10) FIG. 10. In ovo kinetics for CR88 rIBV S L269C in comparison to CR88 rIBV wild type virus assessed by detection of viral load via RT-qPCR. Data point represent the mean of 5 samples per time point. Error bars indicate the standard deviation.

    (11) FIG. 11. Passaging of CR88 rIBV S L269C in Eb66® cells. RT-qPCR CT values are determined at the time point of infection (t=0) and harvest (t=72) of the respective passage. CR88 rIBV wild type is included as negative control. For CR88 rIBV S L269C data for P2, P5 and P8 are shown. The CR88 rIBV included in the same passaging experiment has one passage less in the initial passage (P1) and the last passage (P7). Each passage is generated by infection with a 1/100 dilution of the previous passage.

    (12) FIG. 12. Replication kinetics of CR88 rIBV S L269C in EB66® cells. Cells are infected with rIBV at an MOI of 0.001 based on TCID.sub.50 titers from the third EB66®-propagated passage of the viruses. Nucleic acids are isolated at 0, 8, 24, 48 and 72 hpi and analyzed via IBV-specific RT-qPCR. Each data point represents the mean ct value of three independent experiments. Error bars indicate the standard error of the mean (SEM).

    (13) FIG. 13. Replication kinetics of CR88 rIBV S L269C in EB66® cells. Samples of time points 0, 8, 24, 48 and 72 hpi are analyzed by TCID50 titration. Results of one experiment are shown.

    (14) FIG. 14 Summary of ciliostasis scoring for protection by CR88 rIBV S L269C against 793B challenge. The sum of the 10 individual scores for the 10 rings of one animal is calculated and is represented by one dot in the graph. Maximum ciliostasis corresponds to a score of 40, while no ciliostasis is represented by a score of 0. Mean and significance are calculated using GraphPad Prism and an ordinary one-way ANOVA test (*p<0.02, **p<0.007).

    (15) FIG. 15. Summary of RT-qPCR results of kidneys tissues 7 days after challenge for the efficacy study of CR88 rIBV S L269C. Each individual bird is indicated by one dot.

    (16) FIG. 16. In ovo kinetics for H52 rIBV QX S L270C and CR88 rIBV QX S L270C compared to IBV QX, H52 rIBV and CR88 rIBV, assessed by detection of viral load via RT-qPCR. Data point represent the mean of 5 samples per time point. Error bars indicate the standard deviation.

    (17) FIG. 17. Passaging of CR88 rIBV QX S L270C in Eb66® cells. RT-qPCR CT values are determined at the time point of infection (t=0) and harvest (t=72) of the respective passage.

    (18) FIG. 18. Passaging of H52 rIBV QX S L270C in Eb66® cells. RT-qPCR CT values are determined at the time point of infection (t=0) and harvest (t=72) of the respective passage.

    (19) FIG. 19. Replication kinetics of H52 rIBV QX S L270C and CR88 rIBV QX S L270C in EB66® cells. Cells are infected with rIBV at an MOI of 0.001 based on TCID.sub.50 titers from the third EB66®-propagated passage of the viruses. Nucleic acids are isolated at 0, 8, 24 and 48 hpi and analyzed via IBV-specific RT-qPCR. Each data point represents the mean ct value of three independent experiments, each performed in triplicates. Error bars indicate the standard error of the mean (SEM).

    (20) FIG. 20. Summary of ciliostasis scoring for protection by CR88 rIBV QX S L270C and H52 rIBV QX S L270C against D388 QX challenge. The sum of the 10 individual scores for the 10 rings of one animal is calculated and is represented by one dot in the graph. Maximum ciliostasis corresponds to a score of 40, while no ciliostasis is represented by a score of 0. Mean and significance are calculated using GraphPad Prism and an ordinary one-way ANOVA test (***p<0.001, ****p<0.0001).

    (21) FIG. 21. Summary of RT-qPCR results of kidneys tissues 7 days after challenge for the efficacy study of CR88 rIBV QX S L270C and H52 rIBV QX S L270C. Each individual bird is indicated by one dot.

    SEQUENCES OVERVIEW

    (22) SEQ ID NO:1 IBV H52 spike protein SEQ ID NO:2 IBV H52 spike protein with F267C mutation SEQ ID NO:3 IBV CR88 spike with L269C mutation SEQ ID NO:4 IBV QX spike protein with L270C mutation SEQ ID NO:5 IBV Q1 spike protein with L271C mutation SEQ ID NO:6 IBV Var 2 spike protein with L270C mutation SEQ ID NO:7 IBV BR-I spike protein with L274C mutation SEQ ID NO:8 IBV Ark spike protein with L274C mutation SEQ ID NO:9 pUC57-s H52 rIBV donor plasmid SEQ ID NO:10 pUC57-s H52 rIBV S F267C donor plasmid SEQ ID NO:11 IBV CR88 spike sequence SEQ ID NO:12 pUC57-s CR88 mIBV donor plasmid SEQ ID NO:13 pGEM-T IBV CR88 spike plasmid SEQ ID NO:14 pUC57-s CR88 rIBV S L269C donor plasmid SEQ ID NO:15 pGEM-T IBV CR88 spike with L269C mutation SEQ ID NO:16 to 64 primers SEQ ID NO:65 IBV QX spike protein SEQ ID NO:66 pGEM-T IBV QX S L270C plasmid SEQ ID NO:67 pUC57-s CR88 rIBV donor plasmid SEQ ID NO:68 pUC57-s CR88 rIBV QX S L270C donor plasmid SEQ ID NO:69 pUC57-s H52 rIBV QX S L270C donor plasmid SEQ ID NO:70 to 75 primers SEQ ID NO:76 IBV ArkDPI spike protein SEQ ID NO:77 IBV ArkDPI spike protein with L274C mutation SEQ ID NO:78 pUC57-s IBV ArkDPI S L274C SEQ ID NO:79 pUC57-s H52 rIBV ArkDPI S Ecto L274C donor plasmid SEQ ID NO:80 to 84 primers

    EXAMPLES

    (23) The following examples are set forth below to illustrate specific embodiments of the present invention. These examples are merely illustrative and are understood not to limit the scope or the underlying principles of the present invention.

    Example 1

    Generation of Recombinant IBV H52 in which the Amino Acid 267 of the Spike Protein is Mutated to a Cysteine

    (24) For the generation of recombinant IBV the method of targeted RNA recombination as described by van Beurden et al. (Virol J. 2017; 14(1):109) is applied.

    (25) Donor Plasmid Construction

    (26) The pUC57-s IBV-5-1b-S-SIR-3T donor plasmid, hereafter referred to as pUC57-s H52 rIBV donor plasmid (SEQ ID NO:9), is used as template for the construction of the H52 rIBV donor plasmid with a H52 spike in which the amino acid 267 of the H52 spike (SEQ ID NO:1) 51 subunit is mutated from a phenylalanine to a cysteine (SEQ ID NO:2) which is called pUC57-s H52 rIBV S F267C (SEQ ID NO:10). Mutation of the wild type sequence is achieved by using the Q5® Site-Directed Mutagenesis Kit (NEB) with the primers PO1942 and PO1943 (table 1) and according to the kit protocol, with an annealing temperature of 58° C. and an elongation time of 5 minutes and 30 seconds. Positive clones are identified by EcoRV and XhoI restriction digest, flowed by Sanger sequencing with primers PO618 and PO633 (table 1). Afterwards, the integrity of the spike and donor region sequence is confirmed by sequencing with primers SEQ ID NO:19 to SEQ ID NO: 40 in table 1.

    (27) TABLE-US-00001 TABLE 1 Primers for SDM and sequencing SEQ ID NO: Name Sequence 64 M13-24F ccagggttttcccagtcacg 16 M13-24R cggataacaatttcacacagg 17 PO1942 aacactattttcacgatagac 18 PO1943 aatactacttgtacgttacacaatttc 19 PO618 taaatggtgatcttgttt 20 PO632 gcattcactgctgtacaa 21 PO633 cgctcttagtaacataaac 22 PO636 ctgaggtcaatgctttatc 23 PO706 gacagagcacaagtttgatc 24 PO709 acttcaagcatttgtacagg 25 PO710 ggtcaacaatgtaattttgct 26 PO713 gcagatgctaaaacagaaag 27 PO714 tcacctgaacaatcttcagc 28 PO715 ggtcaccagtatatttctgc 29 PO718 aaagaagcaggatgatgaag 30 PO726 aagagatgttggtaacacct 31 PO728 ctaaaccggctggttttaat 32 PO729 ccatagcttttgccactatt 33 PO731 cgcttgtaaatagaaggtct 34 PO732 acataccaaggccacttaat 35 PO733 ggtcctgttccagtatagta 36 PO734 cttgtcctgctttgttaaga 37 PO756 gtggatcgtcttataactgg 38 PO759 ctcgcattacaaaggctaag 39 PO766 ccagttataggacacccatc 40 PO767 gttggttcttctggaaatgt
    Targeted RNA Recombination and Rescue of Recombinant IBV

    (28) The H52 murinized (m)IBV helper virus and recombinant IBV are generated as described by van Beurden et al. (Virol J. 2017; 14(1):109). Briefly, for the generation of H52 rIBV S F267C, LR7 cells are infected with H52 mIBV and electroporated with in vitro transcript generated from the pUC57-s H52 SF267C donor plasmid (SEQ ID NO:10) and subsequently injected into 8 day old embryonated SPF chicken eggs (VALO BioMedia). After up to 8 days of incubation, the allantoic fluids of all eggs are analyzed separately for the rescue of recombinant IBV after RNA isolation with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher) and by using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO1323 and PO1324 (table 2) binding in H52 IBV lab and H52 IBV S spike are used to distinguish the recombinant IBV from mIBV. Positive samples are further analyzed to confirm the presence of the intended spike F267C mutation using the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase with primers PO618 and PO633 (table 2) followed by QIAquick PCR purification and Sanger sequencing with the same primers. The positive allantoic fluid of the egg inoculated with the highest dilution of LR7 cells is used for an end-point dilution in 8-day old SPF eggs. Nucleic acids isolation and sample analysis is conducted as described above. The same procedure is applied for a second end-point dilution. Afterwards, one positive-tested allantoic fluid is used for propagation in 10-day old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:1000 in 1×PBS and 100 μl are injected per egg, which are subsequently incubated at 37.5° C. and 60% humidity. Allantoic fluid is harvested 48 hours post inoculation, pooled, cleared from debris and stored at −80° C.

    (29) TABLE-US-00002 TABLE 2 PCR and sequencing primers used to  identify rescued H52 rIBV and to  confirm the targeted S F267C mutation. SEQ ID NO: Name Sequence 41 PO1323 tcagcatggacgtgtggtta 42 PO1324 ccccatgtaaatgccaacca 19 PO618 taaatggtgatcttgttt 21 PO633 cgctcttagtaacataaac
    In Vitro and in Ovo Characterization of Recombinant IBV
    Determination of Embryo Infectious Dose 50% (EID.sub.50)

    (30) An aliquot of the virus stock is thawed and 10-fold diluted in 1×PBS to determine the 50% embryo infectious dose (EID.sub.50 by inoculation of 100 μl into the allantoic cavity of five 8-day old embryonated chicken eggs per dilution. Eggs are incubated at 36.5° C., 60% humidity until 7 days post inoculation. Eggs with dead embryos after 24 hours are excluded from the experiment. All other eggs with dead embryos at 7 days post inoculation are considered positive. All eggs with living embryos are canceled from the bottom at 7 days post inoculation to identify dwarfs, which are considered positive. The EID.sub.50/ml is calculated with the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3):493-497).

    (31) Tissue Culture Infectious Dose 50% (TCID.sub.50)

    (32) Eb66® cell viability is analyzed with BioRad TC20 and trypan blue with the gate set to 6-13 μm. Per 96 well 2×10.sup.6 living Eb66® cells/ml in EX-CELL® EBx™ GRO-I Serum-Free Media+2.5 mM L-Glutamine are seeded 1 day prior to inoculation and incubated at 37° C. and 7.5% CO.sub.2. A 10-fold serial dilution of the virus in Eb66® cell medium is performed and 100 μl per dilution (at least 4 replicates per dilution) are added to Eb66® cells after removing the culture medium. If allantoic fluid is used for infection it is passed though a 0.45 μm pore sized filter prior to dilution. Infected cells are incubated for 72 hours followed by immunofluorescence staining to identify positive wells. Medium is aspirated from all wells, which are subsequently washed with 1×PBS before the addition of 100 μl ethanol per well for cell fixation for 10 min at RT and subsequent air drying of the cells. The cells are incubated with 100 μl of primary chicken anti-IBV Mass serum (Boehringer Ingelheim), diluted 1:250 in 1×PBS, for 45 min at room temperature. After removal of the primary antibody each well is washed three times with 1×PBS. 100 μl of secondary Alexa Fluor 488 goat anti-chicken IgG antibody (ThermoFisher Scientific, 1:500 dilution in 1×PBS) are added and incubated for 45 min at room temperature in the dark. After removal of the secondary antibody, each well is washed three times with 1×PBS, leaving the final wash on the cells. Positive wells are identified by fluorescence microscopy and recorded to calculate the TCID.sub.50/ml with the formula of Reed and Muench (Am J Epidemiol, 1938; 27(3):493-497).

    (33) In Ovo Replication Kinetics

    (34) Eight day-old embryonated chicken eggs are inoculated with 10.sup.2 EID.sub.50 of rIBV and the respective controls. Eggs are canceled daily after 0, 8, 24, 34, 48 and 72 hours of incubation and embryo mortality is recorded. Five preselected eggs per sample and time point are removed and transferred to 4° C. for at least 2 hours. Subsequently, the allantoic fluid is harvested and stored at −80° C. For analysis, samples are thawed and diluted 1:10 in 1×PBS without Ca and Mg and nucleic acids are extracted with the QIAamp DNA Blood Mini kit (Qiagen) with addition of carrier RNA using the Hamilton Starlet pipet robot. Extracted nucleic acids are analyzed by RT-qPCR for the relative amount of IBV RNA with a protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2):60-5). Briefly, the same primers and probe are used and the thermoprofile is adapted for the use of TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the ABI™ 7900HT Fast Real-Time PCR System (Thermo Fisher Scientific). All nucleic acid samples are analyzed in triplicates using a 10-fold dilution series of IBV H52 as reference.

    (35) Similar in ovo replication kinetics are observed for H52 rIBV wild type and H52 rIBV S F267C (FIG. 1). This suggests no disadvantage by the mutation of Phenylalanine to Cysteine at the position 267 of the spike for in ovo replication efficiency of the mutated rIBV compared to the wild type rIBV.

    (36) Passaging of rIBV in Eb66® Cells

    (37) Eb66® cells are seeded at a density of 4×10.sup.5 cells/ml in EX-CELL® EBx™ GRO-I Serum-Free Media+2.5 mM L-Glutamine into T25 flasks with a total volume of 5 ml and are infected with rIBV and controls. The cultures are incubated for 72 hours at 37° C. and 7.5% CO.sub.2 and shaking at 100 rpm. The culture is harvested and stored at −80° C. For passages 1, 2, 5, 6 and 7 virus replication is assessed via RT-qPCR. For this, 250 μl of the suspension are removed directly after inoculation (time point 0 h) and after harvest (time point 72 h) for nucleic acid isolation. Nucleic acids are isolated with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher). The RT-qPCR is performed as described above.

    (38) To analyze if H52 rIBV S F267C is able to replicate in cells, Eb66® cells were inoculated with a 1/10 dilution of the allantoic fluid stock. Propagation of the virus is detected by a decreased ct value after 72 hours in the first and following passages. Due to dilution of the virus for the next passage the ct value increases compared to the ct value measured at harvest of the inoculum before decreasing again during the 72 h culture due to virus replication. Replication becomes even more obvious in higher passages 6 and 7 for which the inoculation is conducted with a 1/1000 dilution of the previous passage (FIG. 2). The results clearly show replication of H52 rIBV F267C over 7 passages in Eb66® cells. Thus, it is apparent that the modification to a Cystein at Position 267 is genetically stable since the IBV still has the extended cell culture/tissue tropism after 7 passages.

    (39) In addition, the infectious titers for the allantoic fluid stock (10.sup.6.33 TCID.sub.50/ml, 10.sup.7.22 EID.sub.50/ml) and Eb66® passages P1 (10.sup.4.67 TCID.sub.50/ml), P5 (10.sup.5.33 TCID.sub.50/ml) and P7 (10.sup.6 TCID.sub.50/ml, 10.sup.584 EID.sub.50/ml) are determined. They confirm efficient replication of H52 rIBV S F267C during the Eb66® passaging process and sustained infectivity in SPF eggs. The F267C mutation therefore enables replication in cell lines without disturbing the ability to replicate in ovo.

    (40) Eb66® Cell Replication Kinetics

    (41) Passage 3 harvested from Eb66® cells is used to perform replication kinetics in Eb66® cells. Eb66® cells are seeded and incubated as described for passaging and infected with an MOI of 0.001 based on the TCID.sub.50 titer. Samples are taken directly after inoculation, as well as 8, 24, 48 and 72 hpi (hours post infection). Samples are analyzed for viral RNA content as described for the passaging experiment (FIG. 3). In addition, samples are analyzed for their infectivity via TCID.sub.50 assay (FIG. 4). Efficient replication is detected with both methods and a plateau phase for replication is reached as early as 48 hours post infection. Conclusively, the replication cycle in Eb66® cells is equally efficient as in embryonated chicken eggs.

    (42) Determination of Vaccine Efficacy

    (43) Fertilized SPF eggs are incubated for 18 days in an egg setter at 99.7° F. and 50% humidity with 1 turn per hour. At day 18 of incubation the eggs are candled and fertile eggs are transferred to the hatcher and incubated at 99° F. and 70% humidity until hatch. Chicks without clinical signs or deformation are randomly distributed into respective treatment groups and transferred into separate isolators. Three chicks serve as strict negative control (SNC) group, five chicks are enrolled in the challenge control (CC) group and at least 10 in groups which are vaccinated with the Eb66®-adapted recombinant IBV and are subsequently challenged. Animals are kept under housing conditions in compliance to local and national requirements for animal welfare recommendations. The light regime is adjusted to 16 hours light per day. Feed and water are provided ad libitum. After transfer to the isolator, chicks are vaccinated (1-day old) with 10.sup.3 EID.sub.50 per chicken via eye drop (total volume 50 μl, 25 μl per eye) while the SNC and CC groups remain untreated. At 21 days post vaccination chickens of the CC and vaccinated groups are challenged with 10.sup.3 to 10.sup.4 EID.sub.50 per chicken of the homologous challenge strain via eye drop (total volume 50 μl, 25 μl per eye). At 7 days post challenge all chickens are euthanized, kidneys are removed and stored in RNAlater Stabilization Solution (ThermoFisher) at 4° C. for IBV-specific RT-qPCR analysis. In addition, tracheas are removed and transferred into 50 ml tubes with warm cell culture medium. Afterwards, tracheas are cleaned from connective tissues and flushed with cell culture medium. The tracheas are cut into tracheal rings using the McIlwain tissue chopper set to 0.6-0.8 mm slice thickness. Per trachea three rings of the upper part, four rings of the middle part and three rings of the lower part are analyzed for ciliar beating by light microscopy and scored for ciliostasis (see table 3). A ring is recorded as normal if more than 50% of the internal ring shows vigorous ciliar movement (Score 2 and lower). A ring is recorded as positive for ciliostasis if less than 50% of the cilia are beating (Score 3 and 4). An animal is considered protected if not fewer than 9 out of 10 rings show normal ciliar activity.

    (44) For IBV-specific RT-qPCR analysis kidney tissue pieces are warmed up to room temperature and transferred to separate 2 ml Precellys tubes, which are filled with medium and PBS, respectively. Kidneys are homogenized with the Precellys® tissue homogenizer (Bertin Instruments) for 1×20 sec at 6800 rpm. Choanal wabs are eluted in 2 ml 1×PBS. Nucleic acids are isolated from 200 μl eluate and tissue homogenate respectively using the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher). RT-qPCR is performed as described for the in ovo kinetics above, except for using a StepOnePlus™ Real-Time PCR System (ThermoFisher).

    (45) TABLE-US-00003 TABLE 3 Scoring of ciliostasis in tracheal rings Ciliar activity [%] Ciliostasis score 100 0 75-99 1 50-74 2 25-49 3  0-25 4

    (46) The objective of the study is to demonstrate that the cell culture adapted H52 rIBV S F267C passaged eight times in Eb66® cells is able to confer protection against challenge with virulent M41 strain. All chickens are observed daily for clinical signs and no clinical signs are recorded after vaccination or challenge. Back titrations for the vaccination with H52 rIBV and H52 rIBV S F267C at 1-day of age determine a titer of 10.sup.32 EID.sub.50/animal and 10.sup.2.87 EID.sub.50/animal (target 10.sup.3 EID.sub.50/animal), respectively, and 10.sup.3 EID.sub.50/animal (target 10.sup.3 EID.sub.50/animal) for challenge with IBV M41 at 21 days post vaccination. Ciliostasis is scored as described in table 3 and results are depicted in FIG. 5.

    (47) The average ciliostasis value of the sum of the 10 individual scores for each animal and the protection rates are summarized in table 4. All animals of the strict negative control show normal ciliar movement (100% protection) while all animals of the challenge control group are positive for ciliostasis (0% protection). In contrast, 93% of the animals vaccinated with H52 rIBV are protected and equally well protected are the animals vaccinated with the Eb66®-passaged H52 rIBV S F267C.

    (48) TABLE-US-00004 TABLE 4 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0) For not affected animals, at least 9 of the 10 tracheal explants show normal ciliar activity. #animals/ Mean Not affected Vaccine Challenge not affected Ciliostasis Score [%] — — 3/3 3 100 — M41 5/0 40 0 H52 M41 14/13 8.9 93 rIBV H52 M41 14/13 11.8 93 rIBV S F267C

    (49) In addition, the viral load in the kidneys of animals vaccinated with H52 rIBV S F267C is as efficiently reduced as for H52 rIBV and compared to the M41 challenge control (FIG. 6). In summary, the H52 rIBV S F267C propagated in Eb66® cells protects as efficient against virulent M41 challenge as the H52 rIBV wild type. Further, the modification to a Cystein at Position 267 is genetically stable.

    (50) Infection of PBS-12SF Cells with rIBV

    (51) The ability to infect PBS-12SF cells is analyzed for the allantoic fluid stocks of H52 rIBV S F267C and H52 rIBV as negative control. PBS-12SF cells are seeded in OptiPRO SFM (ThermoFisher Scientific)+10% GlutaMAX (ThermoFisher Scientific) medium into 12-well plates to reach 80 to 90% confluence on the next day. The cells are incubated at 37° C. and 5% CO.sub.2. Before infection the allantoic fluid virus stocks are passed through a 0.45 μm pore sized filter. PBS-12SF cells are infected with 10.sup.5.74 EID.sub.50 of each virus per well for 4 hours at 37° C. and 5% CO.sub.2 before the supernatant is taken off and fresh medium is added for further incubation. After 72 hours the supernatant is taken off and the cells are washed with 1×PBS and 50 μl TrypLE Select (ThermoFisher Scientific) are added to detach cells. Cells are resuspended in supernatant and transferred to a T25 flask with 80-90% confluent PBS-12SF cells (P2), which is incubated for 72 hours. Again, the supernatant and cells are collected and transferred to a T75 flask with 80-90% confluent PBS-12SF cells, which is incubated for 72 hours (P3). The supernatant is harvested. The cells are detached by trypsin treatment and seeded into 12 well plates at a ratio of 1 to 3 in fresh medium and incubated until the next day. Medium is aspirated, cells are washed with 1×PBS, fixed with ice-cold 100% ethanol and air dried. Subsequently cells are rehydrated with 1×PBS and afterwards the primary chicken anti-IBV Mass serum (Boehringer Ingelheim) is added at a dilution of 1 to 200 and incubated for 45 minutes at room temperature. After removal of the antibody, cells are washed and the secondary Alexa Fluor 488 goat anti-chicken IgG antibody (ThermoFisher Scientific, 1:500 dilution in 1×PBS) is added for 45 minutes at room temperature in the dark. Finally, the cells are washed three times with 1×PBS and analyzed by fluorescence microscopy (FIG. 7). Infected cells are detected for H52 rIBV S F267C, while cells infected with H52 rIBV wild type and the uninfected negative control remain negative as expected. Furthermore, 250 μl of supernatant were stored after each of the passages 1, 2 and 3 for nucleic acid extraction and RT-qPCR as described above. A continuous decrease in the ct value (corresponding to replication and propagation of the virus) can be observed for H52 rIBV S F267C over the passaging process while the ct value for H52 rIBV wild type increases as expected. (FIG. 8).

    (52) In summary, these data confirm that the single mutation of Phenylalanine to Cysteine at position 267 of the H52 spike renders the virus capable to replicate in PBS12-SF cells, while the H52 wild type virus lacks this ability.

    (53) Infection of HEK-293T Cells with rIBV

    (54) The ability to infect HEK 293T cells is analyzed for the allantoic fluid stocks of H52 rIBV S F267C and H52 rIBV as negative control. 293T cells are seeded in DMEM (Lonza)+10% FCS (SAFC)+L-Glutamine (Lonza)+1% P/S (Gibco) medium into 12-well plates to reach 80 to 90% confluence on the next day. The cells are incubated at 37° C. and 5% CO.sub.2. Before infection the allantoic fluid virus stocks are passed through a 0.45 μm pore sized filter. HEK 293T cells are infected with roughly 10.sup.6 EID.sub.50 of each virus per well. After 72 hours the supernatant is taken off and the cells are washed with 1×PBS and 50 μl TrypLE Select (ThermoFisher Scientific) are added to detach cells. Cells are resuspended in supernatant and transferred to a T25 flask with 80-90% confluent HEK 293T cells and 5 ml fresh medium (P2), which is incubated for 72 hours. Again, the supernatant and cells are collected and transferred to a T75 flask with 80-90% confluent HEK 293T cells and 10 ml fresh medium, which is incubated for 72 hours (P3). The supernatant is harvested. The cells are detached by trypsin treatment and seeded into 12 well plates at a ratio of 1 to 3 in fresh medium and incubated until the next day. Medium is aspirated, cells are washed with 1×PBS, fixed with ice-cold 100% ethanol and air dried. Subsequently cells are rehydrated with 1×PBS and afterwards the primary chicken anti-IBV Mass serum (Boehringer Ingelheim) is added at a dilution of 1 to 200 and incubated for 45 minutes at room temperature. After removal of the antibody, cells are washed and the secondary Alexa Fluor 488 goat anti-chicken IgG antibody (ThermoFisher Scientific, 1:500 dilution in 1×PBS) is added for 45 minutes at room temperature in the dark. Finally, the cells are washed three times with 1×PBS and analyzed by fluorescence microscopy (FIG. 9). Infected cells are detected for the positive control as well as H52 rIBV S F267C, while cells infected with H52 rIBV wild type and the uninfected negative control remain negative as expected.

    (55) In summary, these data confirm that the single mutation of Phenylalanine to Cysteine at position 267 of the H52 spike renders the virus capable to replicate in HEK 293T cells, while the H52 wild type virus lacks this ability.

    Conclusion Example 1

    (56) The data show that the mutation to Cysteine at the position 267 of the spike sequence (reference sequence for the numbering is SEQ ID NO:1) in an IBV leads to an extended cell culture and tissue tropism. An H52 recombinant IBV having the F267C mutation in the spike protein can be efficiently cultured in different cell lines such as EB66, PBS-12SF and HEK 293T cells. It is assumed that said IBV can be cultured in other cell lines as well. Further, said mutation has no impact on in ovo replication of the virus and the replication kinetics in ovo and in vitro are similar. Finally, vaccine efficacy is sustained even after passaging in a cell line, laying the basis for successful IBV vaccine development without a need for in ovo culture but using cell lines instead.

    Example 2

    Generation of Recombinant IBV CR88 in which the Amino Acid 269 of the Spike Protein is Mutated to a Cysteine

    (57) In order to determine if the change to a Cysteine at position 267 in the IBV spike can also be applied to other genotypes or serotypes, the spike amino acid sequence (SEQ ID NO:11) of the CR88 IBV strain was aligned to the H52 Spike amino acid sequence (SEQ ID NO:1) to determine the position equivalent to amino acid position 267 of H52 spike for IBV CR88 spike, which was determined as the Leucine at position 269 of the CR88 spike.

    (58) Construction of an IBV CR88 Murinized Donor Plasmid

    (59) To generate the CR88 murinized (m)IBV donor plasmid the donor sequence is synthesized by a commercial supplier: 497 bases of the 5′ UTR of the CR88 genome are fused to the 3′ part of the lab region (752 bases) and the first 72 bases coding for the CR88 IBV spike, followed by 3753 bases of the MHV spike ectodomain, continuing with the terminal 210 bases of the CR88 IBV spike and the following sequence until the 3′ end of the genome. In addition, a SacI restriction site and the sequence of the T7 promoter are added to the 5′ end of the donor region, as well as a 100x polyA sequence, followed by a Not I restriction site for linearization at the 3′ end, respectively. A silent A to C mutation at position 5634 of the assembled sequence is introduced to generate an XhoI restriction site. The synthesized sequence is inserted into pUC57-simple to yield the pUC57-s CR88 mIBV donor plasmid (SEQ ID NO:12).

    (60) Rescue of CR88 mIBV

    (61) CR88 mIBV is rescued in analogy to H52 mIBV (van Beurden et al. Virol J. 2017; 14(1):109) with some alterations: The virus allantoic fluid stock is concentrated via ultracentrifugation before isolation of the viral RNA for electroporation. 18 ml of viral allantoic fluid are centrifuged at 50,000×g for 2 hours through a 2 ml 20% Sucrose cushion in TNE (Tris, NaCl, EDTA) buffer. The supernatant is discarded and the pellet resuspended in 150 μl TNE buffer followed by RNA isolation with QIAamp viral RNA mini kit (Qiagen). Further, chicken embryo fibroblasts (CEFs) instead of BHK cells are used for electroporation (2 pulses 250V/300 μF, 10 sec break) and 1.25% DMSO is added to the electroporation mixture.

    (62) Donor Plasmid Construction

    (63) The CR88 spike nucleic acid sequence with flanking sequences is synthesized by a commercial supplier and cloned into pGEM-T (SEQ ID NO:13). It is used as a template for site directed mutagenesis to change the leucine at amino acid position 269 of the IBV CR88 spike (SEQ ID NO:11) into a cysteine (SEQ ID NO:3). For this, the QuikChangeMulti Site-Directed Mutagenesis Kit (Agilent Technologies) according to the manufacturer's protocol and the primer PO1886 (table 5) designed by the corresponding online tool are used. Positive clones are identified by restriction digest and analyzed for the presence of the desired mutation by Sanger sequencing with primer PO618 and PO1410 (table 5). For the generation of the pUC57-s CR88 rIBV S L269C donor plasmid (SEQ ID NO:14), the pGEM-T CR88 S L269C plasmid containing the mutated CR88 spike sequence (SEQ ID NO:15) is digested with Pad, XhoI and PvuI. The band corresponding to the spike is cut from the gel and purified with the QIAquick gel extraction kit (Qiagen). Further, the CR88 mIBV donor plasmid (SEQ ID NO:12) is digested with PacI, XhoI and KpnI to obtain the donor plasmid backbone. The band with the highest molecular weight is cut from the gel and purified via QIAquick Gel Extraction Kit (Qiagen). The purified spike insert and CR88 donor plasmid backbone are ligated using T4 DNA ligase (ThermoFisher Scientific) at 16° C. over night. The ligation mixture is transformed into NEB 5-α competent E. coli (NEB) by heat shock. After GeneJET Plasmid Miniprep Kit (ThermoFisher Scientific), positive clones are identified by restriction digest and characterized for the targeted mutation by Sanger sequencing with primers PO618, PO1014 (table 5).

    (64) Targeted RNA Recombination and Rescue of Recombinant IBV

    (65) For rescue of CR88 rIBV S L269C, LR7 cells are infected with CR88 mIBV and electroporated with in vitro transcript generated from the NotI linearized pUC57-s CR88 S L269C donor plasmid, and subsequently injected into 8-day old embryonated SPF chicken eggs (VALO BioMedia). After up to 8 days of incubation, the allantoic fluids of all eggs are analyzed separately for the rescue of recombinant IBV after RNA isolation with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher) and by using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO1728 and PO1729 (Table 5) binding in CR88 IBV lab and CR88 IBV S spike are used to distinguish the recombinant IBV from mIBV. The positive allantoic fluid of the egg inoculated with the highest dilution of LR7 cells is used for an end-point dilution in 8-day old embryonated SPF eggs. Nucleic acid isolation is conducted as described above. Samples are analyzed via RT-qPCR conducted according to the protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2):60-5). Briefly, the same primers and probe are used and the thermoprofile is adapted for the use of TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the StepOnePlus or the ABI7900 HT Fast Real-Time PCR Systems (ThermoFisher Scientific). Afterwards, one positive-tested allantoic fluid of a high dilution is used for propagation in 8-day old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:100 in 1×PBS and 100 μl is injected per egg which are subsequently incubated at 37.5° C. and 60% humidity. Allantoic fluid is harvested at 48 hours post inoculation, cleared from debris and stored at −80° C.

    (66) TABLE-US-00005 TABLE 5  SDM primer to obtain the CR88 S L269C  mutation and sequencing primers for confirmation of the targeted mutation  and confirmation of CR88 rIBV rescue. SEQ ID NO: Name Sequence 43 PO1886 gtatatcgagaaagtagcac taacactacttgtaagttaa ctaatttcagttttactaatg 19 PO618 taaatggtgatcttgttt 44 PO1410 tttgtatacgagagccatca 45 PO1728 tcagcgtggacatgtggtta 46 PO1729 ccccatataggtgccaacct
    In Vitro and in Ovo Characterization of Recombinant IBV

    (67) The Embryo infectious dose 50% (EID.sub.50) and the tissue culture infectious dose 50% (TCID.sub.50) for CR88 rIBV S L269C are determined as described for H52 rIBV S F267C. Further, the in ovo and in vitro replication kinetics and the passaging was conducted as described for H52 rIBV S F267C.

    (68) Similar in ovo replication kinetics are observed for CR88 rIBV wild type and CR88 rIBV S L269C (FIG. 10). This suggests no disadvantage of the Cysteine mutation in the spike of CR88 rIBV S L269C for the in ovo replication efficiency of the mutated rIBV compared to the wild type rIBV CR88 as it was shown for H52 rIBV S F267C and H52 rIBV wild type.

    (69) To analyze if CR88 rIBV S L269C is able to replicate in cells, Eb66® cells are inoculated with a 1/100 dilution of the allantoic fluid stock. Propagation of the virus is detected by a decreased ct value after 72 hours in the first and following passages. Due to dilution of the virus for the next passage the ct value increases compared to the ct value measured at harvest of the inoculum before decreasing again during the 72 h culture due to virus replication. Replication of CR88 rIBV S L269C is clearly visible over the passaging process by a decreasing ct value for the 72h time point compared to the 0 h time point directly after infection. In contrast, the ct values of the CR88 rIBV wild type negative control confirm no replication for this virus in any of the analyzed passages and dilution of the initial inoculum during the passaging process (FIG. 11). The results clearly show replication of CR88 rIBV L269C over 7 passages in Eb66® cells while wild type virus is not able to replicate, highlighting that the L269C mutation in the spike is crucial for the extended cell or tissue tropism. Efficient replication for CR88 rIBV S L269C is also detected via RT-qPCR (FIG. 12) and TCID.sub.50 determination (FIG. 13) in a replication kinetic experiment in Eb66® cells.

    (70) In addition, the infectious titers for the allantoic fluid stock (10.sup.3 TCID.sub.50/ml, 10.sup.8 EID.sub.50/ml) and Eb66® passages P1 (10.sup.3.5 TCID.sub.50/ml, 10.sup.5.84 EID.sub.50/ml), P5 (10.sup.5.3 TCID.sub.50/ml) and P8 (10.sup.6 TCID.sub.50/ml, 10.sup.6 EID.sub.50/ml) are determined. They confirm efficient replication of CR88 rIBV S L269C during the Eb66® passaging process and sustained infectivity in SPF eggs. The L269C mutation therefore enables replication in cell lines without disturbing the ability to replicate in ovo.

    (71) Determination of Vaccine Efficacy

    (72) Testing for the efficacy of CR88 rIBV S L269C against challenge with IBV 793B was conducted as described for H52 rIBV S F269C above. The objective of the study is to demonstrate that the cell culture adapted CR88 rIBV S L269C passaged one time in Eb66® cells is able to confer protection against a virulent 793B strain. All chickens are observed daily for clinical signs. No clinical signs are recorded after vaccination or challenge. Back titrations for the vaccination with CR88 rIBV S L269C at 1-day of age determine a titer of 10.sup.3.6 EID.sub.50/animal (target 10.sup.3 EID.sub.50/animal), respectively, and 10.sup.4.1 EID.sub.50/animal (target 10.sup.4 EID.sub.50/animal) for challenge with IBV 793B at 21 days post vaccination. Ciliostasis is scored as described in table 3 and results are depicted in FIG. 14 and summarized in table 6. All animals of the strict negative control show normal ciliar movement while 4 of the 5 animals of the challenge control group are positive for ciliostasis. In contrast, 80% of the animals vaccinated with CR88 rIBV S L269C are protected.

    (73) TABLE-US-00006 TABLE 6 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score 0). For not affected animals, at least 9 of the 10 tracheal explants show normal ciliar activity. #animals/ Mean Not affected Vaccine Challenge not affected Ciliostasis Score [%] — — 3/3 3 100 — 793B 5/1 30.8 20 CR88 793B 10/8  13.2 80 rIBV S L269C

    (74) In addition, the viral RNA load is significantly reduced in kidneys of animals vaccinated with CR88 rIBV S L269C compared to the challenge control (FIG. 15). In summary, the CR88 rIBV S L269C propagated in Eb66® cells efficiently protects against virulent 793B challenge. The spike mutation L269C adapts the virus to propagation in cells while the in vivo efficacy is sustained.

    Conclusion Example 2

    (75) The data show that the mutation to Cysteine at position 267 of the spike (reference sequence for the numbering is SEQ ID NO:1) corresponding to position 269 in CR88 spike leads to an extended cell or tissue tropism in a recombinant IBV CR88, too. Further, said mutation has no impact on in ovo replication of the virus. Finally, vaccine efficacy is sustained even after propagation in a cell line, laying the basis for successful IBV vaccine development without a need for in ovo culture but using cell lines instead.

    Example 3

    Generation of Chimeric Recombinant IBV CR88 or H52 in which the CR88 or H52 Spike Gene is Replaced by a QX Spike Gene in which the Amino Acid 270 of the Spike Protein is Mutated to a Cysteine

    (76) In order to further elaborate if the change to a Cysteine at position 267 of the spike to achieve cell culture tropism can be transferred to additional IBV genotypes, the QX spike amino acid (SEQ ID NO:65) sequence was aligned to the H52 spike amino acid sequence (SEQ ID NO:1) to determine the position equivalent to amino acid position 267 of H52 spike for IBV QX spike, which was determined as the Leucine at position 270 of the QX spike.

    (77) In order to analyze the potential of a QX spike with a mutation at amino acid position 270 to Cysteine to infect cells, a recombinant IBV CR88 and a recombinant IBV H52 are generated in which the sequence encoding the CR88 spike or H52 spike respectively is replaced by the sequence encoding a QX spike with a Cysteine at position 270 of the spike protein (SEQ ID NO:4). For this the steps for the construction and rescue of an H52 mIBV and CR88 mIBV are conducted as described in example 1 and 2.

    (78) Cloning and Mutation of the QX Spike Gene

    (79) The QX spike sequence is amplified from IBV QX viral RNA via one step RT-PCR (SuperScript® III One-Step RT-PCR, Platinum® Taq) using the primers PO1367 and PO1347 (table 7) and cloned using the pGEM-T vector System (Promega). It serves as template for site directed mutagenesis using the primers PO2163 and PO2164 (table 7) designed with the NEBaseChanger to generate the a plasmid pGEM-T IBV QX S L270C (SEQ ID NO:66). To identify clones with plasmids carrying the desired mutation Sanger sequencing with the primers PO1398 and PO633 located in the region flanking the mutation is performed after a positive restriction digest (table 7).

    (80) TABLE-US-00007 TABLE 7 Primers for cloning and site-directed mutagenesis of the QX spike sequence SEQ ID NO Name Sequence 47 PO1367 cgcggatccgccaccatgtt ggtgaagtcactg 48 PO1347 gcggcggccgcttaaacaga ctlittaggtctg 49 PO2163 taatactacttgtgcgttaa ctaattttacttttagtaatg 50 PO2164 acactactttcacgatag 51 PO1398 aatttaaacagttagcgtatc 21 PO633 cgctcttagtaacataaac
    Donor Plasmid Construction

    (81) The pUC57-s H52 rIBV QX S L270C donor plasmid (SEQ ID NO:69) is constructed using the NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) and online tool for primer design. For this, the pUC57-s H52 rIBV donor plasmid (SEQ ID NO:9) is digested using the restriction sites EcoRV, PmlI and BlpI close to the H52 spike coding sequence to linearize the plasmid and remove the H52 spike and flanking sequences. The QIAquick gel extraction kit (Qiagen) is used to purify the band corresponding to the pUC57-s IBV H52 backbone without the H52 spike coding sequence. The QX S L270C nucleic acid coding sequence and the flanking 5′ and 3′ IBV H52 sequences are amplified in three separate PCR reactions with Q5® High-Fidelity DNA Polymerase (NEB; see table 8 for primers). The PCR products are purified by QIAquick gel extraction (Qiagen) and are used for Gibson assembly with the NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the kit protocol to generate the pUC57-s H52 rIBV QX S L270C (SEQ ID NO:69) donor plasmid.

    (82) The pUC57-s CR88 rIBV QX S L270C donor plasmid (SEQ ID NO:68) is constructed using the NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) and online tool for primer design. Two PCR fragments are generated: One for the CR88 backbone using pUC57-s CR88 rIBV (SEQ ID NO:67) as template and one for the mutated QX spike L270C using pGEM-T IBV CR88 S L270C (SEQ ID NO:66) as template for Q5 PCR with the primers in table 8. The PCR products are gel purified with the QIAquick gel extraction kit (Qiagen) before they were used for Gibson assembly according to the kit protocol to generate the pUC57-s CR88 rIBV QX S L270C donor plasmid (SEQ ID NO:68).

    (83) TABLE-US-00008 TABLE 8 Primers designed with the NEBuilder online    tool for Gibson assembly of pUC57-s CR88  rIBV QX L270C donor plasmid (PCR 1, 2) and  the pUC57-s H52 rIBV QX L270C (PCR 3, 4, 5)  SEQ Primer PCR ID NO name product Sequence 1 52 PO2207 QX spike aagtgtggtaagttactggtaaga gatgttggtgaagtcactg 53 PO2208 agaaaagatgtgggacttttaatc attaaacagactttttaggtctg 2 54 PO2209 CR88 tgattaaaagtcccacatcttttc backbone taatattattaattcttctttgg 55 PO2210 ctcttaccagtaacttaccacact taattaaattaaagactaagtc 3 70 PO1783 H52 5′ cagagcacaagtttgatcttgtga flank tATCTGATATGTATACAGACAATG ATTC 71 PO2062 acttcaccaacatCTCTTACCAGT AACTTACC 4 72 PO2063 QX S  ttactggtaagagATGTTGGTGAA L270C GTCACTG 73 PO2064 ggactttggatcaTTAAACAGACT TTTTAGGTCTG 5 74 PO2065 H52 3′ aaagtctgtttaaTGATCCAAAGT flank CCCACTAG 75 PO1788 cttaactcctggaattactaacca cGTGTACCAAAATAAACAACAAGC

    (84) Successful assembly of the pUC57-s CR88 rIBV QX S L270C and the pUC57-s H52 rIBV QX S L270C is identified by plasmid restriction digest with NheI and NotI or EcoRV, BlpI and PmlI respectively and characterized by sequencing with the primers in table 9.

    (85) TABLE-US-00009 TABLE 9 primers for sequencing of the pUC57-s CR88 rIBV QX S L270C and pUC57-s H52 rIBV QX S L270C donor plasmids. SEQ ID NO Primer name Sequence 56 PO1565 caggattgtgcatggtggac 51 PO1398 aatttaacagttagcgtatc 57 PO2090 gaagtgaayacaagatcaccattt 58 PO1420 tgactgattctgctgctaaa 44 PO1410 tttgtatacgagagccatca 59 PO1421 tcttgaaacccccaagtag 60 PO1425 tatattcagcatcagttggc 61 PO1422 ggattttgtggtagtggaag 62 PO1575 ccactattgcagtaacattaaca 63 PO1567 ctagactgtaagttactattg
    Targeted RNA Recombination and Rescue of Recombinant IBV

    (86) For rescue of CR88 rIBV QX S L270C and H52 rIBV QX S L270C, LR7 cells are infected with CR88 mIBV or H52 mIBV respectively and electroporated with in vitro transcript generated from the NotI or MssI linearized pUC57-s CR88 rIBV QX S L270C or pUC57-s H52 rIBV QX S L270C donor plasmid respectively, and subsequently injected into 8-day old embryonated SPF chicken eggs (VALO BioMedia). After up to 8 days of incubation, the allantoic fluids of some eggs are analyzed separately for the rescue of recombinant IBV after RNA isolation with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher) and by using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO1398 and PO633 (Table 7) binding in the QX spike sequence are used to identify the rescue of recombinant virus. The positive (defined by embryonic death or by a positive RT-PCR result) allantoic fluid of the egg inoculated with the highest dilution of LR7 cells is used for an end-point dilution in 8-day old embryonated SPF eggs. Nucleic acid isolation is conducted as described above. Samples are analyzed via RT-qPCR conducted according to the protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2):60-5). Briefly, the same primers and probe are used and the thermoprofile is adapted for the use of TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the StepOnePlus or the ABI7900 HT Fast Real-Time PCR Systems (ThermoFisher Scientific). Afterwards, one positive-tested allantoic fluid of a preferably high dilution is used for propagation in 8-day old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:100 in 1×PBS and 100 μl is injected per egg, which are subsequently incubated at 37.5° C. and 60% humidity. Allantoic fluid is harvested at 48 hours post inoculation, cleared from debris and stored at −80° C.

    (87) In Vitro and in Ovo Characterization of Recombinant IBV

    (88) The Embryo infectious dose 50% (EID50) and the tissue culture infectious dose 50% (TCID50) for CR88 rIBV QX S L270C and H52 rIBV QX S L270C is determined as described for H52 rIBV S F267C. Further, the in ovo and in vitro replication kinetics and the passaging was conducted as described for H52 rIBV S F267C.

    (89) Similar peak ct values after 48 hours with slightly different in ovo replication kinetics are observed for CR88 rIBV QX S L270C and H52 rIBV QX S L270C (FIG. 16). While CR88 rIBV QC L270C replicates very similar to CR88 rIBV and IBV QX wild type, H52 rIBV QX s L270C replicates more similar to H52 rIBV. This suggests no disadvantage of the Cysteine mutation in the spike of CR88 rIBV QX S L270C and H52 rIBV QX S L270C for the in ovo replication efficiency of the mutated rIBV compared to other rIBV or wild type IBV.

    (90) To analyze if CR88 rIBV QX S L270C and H52 rIBV QX S L270C are able to replicate in cells, EB66® cells are inoculated with a 1/100 dilution of the allantoic fluid stock. Propagation of the viruses is analyzed by isolation of viral RNA and subsequent RT-qPCR analysis. Replication of CR88 rIBV QX S L270C and H52 rIBV QX S L270C is clearly visible over the passaging process by a decreasing mean ct value for the 72h time point compared to the 0 h time point directly after infection (FIGS. 17 and 18). Due to dilution of the virus for the next passage the ct value increases compared to the ct value measured at harvest of the inoculum before decreasing again during the 72 h culture due to virus replication. Efficient replication for of CR88 rIBV QX S L270C and H52 rIBV QX S L270C is also detected via RT-qPCR (FIG. 19) in a replication kinetic experiment in Eb66® cells. Both viruses display similar replication patterns with peak CT values after 48 hours.

    (91) In addition, the infectious titers for the allantoic fluid stock of CR88 rIBV QX S L270C (10.sup.8 EID.sub.50/ml) and Eb66® passages P2 (10.sup.6 TCID.sub.50/ml, 10.sup.8.17 EID.sub.50/ml), P6 (10.sup.6 TCID.sub.50/ml, 10.sup.7.83 EID.sub.50/ml) and P9 (10.sup.6 TCID.sub.50/ml, 10.sup.85 EID.sub.50/ml) are determined. Further, the infectious titers for the allantoic fluid stock of H52 rIBV QX S L270C (10.sup.8 EID.sub.50/ml) and Eb66® passages P3 (10.sup.4.5 TCID.sub.50/ml, 10.sup.8.13 EID.sub.50/ml) and P6 (10.sup.5.5 TCID.sub.50/ml, 10.sup.8.13 EID.sub.50/ml) are determined. They confirm efficient replication of CR88 rIBV QX S L270C during the Eb66® passaging process and sustained infectivity in SPF eggs. The L270C mutation therefore enables replication in cell lines without disturbing the ability to replicate in ovo.

    (92) Determination of Vaccine Efficacy

    (93) Testing for the efficacy of CR88 rIBV QX S L270C and H52 rIBV QX S L270C against challenge with IBV D388 QX was conducted as described for H52 rIBV S F269C above. The objective of the study is to demonstrate that the cell culture adapted CR88 rIBV QX S L270C and H52 rIBV QX S L270C passaged six times in EB66® cells is able to confer protection against a virulent D388 QX strain. All chickens are observed daily for clinical signs. No clinical signs are recorded after vaccination or challenge. Back titrations for the vaccination with CR88 rIBV QX S L270C and H52 rIBV QX S L270C at 1-day of age determine a titer of 10.sup.4.2 EID.sub.50/animal and 10.sup.3.3 EID.sub.50/animal (target 10.sup.3 EID.sub.50/animal), respectively, and 10.sup.35 EID.sub.50/animal (target 10.sup.3 EID.sub.50/animal) for challenge with IBV D388 QX at 21 days post vaccination. Ciliostasis is scored as described in table 3 and results are depicted in FIG. 20 and summarized in table 10. All animals of the strict negative control show normal ciliar movement while all animals of the challenge control group are positive for ciliostasis. In contrast, 78% and 91% animals vaccinated with CR88 rIBV QX S L270C or H52 rIBV QX S L270C are protected.

    (94) TABLE-US-00010 TABLE 10 Summary of ciliostasis scoring for protection at 28 days post vaccination and 7 days post challenge. The mean ciliostasis score per group is calculated by adding up the sum score of the individual chickens per group and dividing the group sum by the number of animals (highest possible score 40, lowest possible score. 0). For not affected animals, at least 9 of the 10 tracheal explants show normal ciliar activity. #animals/ Mean Not affected Vaccine Challenge not affected Ciliostasis Score [%] — —  3/2* 0 100 — D388 QX 5/0 38.4 0 CR88 D388 QX 9/7 13.9 78 rIBV QXS L270C H52 D388 QX 11/10 8.1 91 rIBV QXS L270C *one animal of the strict negative control died, death was not associated to IBV clinical signs or lesions.

    (95) In addition, the viral RNA load is significantly reduced in kidneys of animals vaccinated with CR88 rIBV QX S L270C or H52 rIBV QX L270C compared to the challenge control animals (FIG. 21). In summary, CR88 rIBV QX S L270C and H52 rIBV QX S L270C propagated in EB66® cells efficiently protects against virulent D388 QX challenge. The spike mutation L270C adapts the virus to propagation in cells while the in vivo efficacy is sustained.

    Conclusion Example 3

    (96) The data show that the mutation to Cysteine at position 267 of the spike (reference sequence for the numbering is SEQ ID NO:1) corresponding to position 270 in IBV QX spike leads to an extended cell or tissue tropism, too. In addition, the tissue culture tropism of a spike with the Cysteine mutation is not restricted to the homologous genetic background, as the QX L270C spike is inserted into the CR88 and H52 genetic backbone and the CR88 rIBV QX S L270C and H52 rIBV QX S L270C efficiently replicate in cells and efficiently protect against virulent IBV D388 QX challenge.

    Example 4

    Generation of Chimeric Recombinant IBV H52 in which the H52 Spike Ectodomain Coding Sequence is Replaced by an ARKDPI Spike Ectodomain Coding Sequence in which the Amino Acid 274 of the Spike Protein is Mutated to a Cysteine

    (97) In order to further elaborate if the change to a Cysteine at position 267 of the spike to achieve cell culture tropism can be transferred to additional IBV genotypes, the ArkDPI spike amino acid (SEQ ID NO:76) sequence was aligned to the H52 spike amino acid sequence (SEQ ID NO:1) to determine the position equivalent to amino acid position 267 of H52 spike for IBV ArkDPI spike, which was determined as the Leucine at position 274 of the ArkDPI spike.

    (98) In order to analyze the potential of a ArkDPI spike with a mutation at amino acid position 274 to Cysteine to infect cells, a recombinant IBV H52 is generated in which the sequence encoding the H52 spike is replaced by the sequence encoding an ArkDPI spike with a Cysteine at position 274 of the ArkDPI spike protein (SEQ ID NO:77). For this the steps for the construction and rescue of an H52 mIBV are conducted as described in example 1.

    (99) Donor Plasmid Construction

    (100) The pUC57-s ArkDPI spike L274C plasmid (SEQ ID NO:78) is synthesized by a commercial supplier. The pUC57-s H52 rIBV ArkDPI S Ecto L274C donor plasmid (SEQ ID NO:79) is constructed using the NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) and online tool for primer design. For this, the pUC57-s H52 rIBV donor plasmid (SEQ ID NO:9) is digested using the restriction sites EcoRV, PmlI and BlpI close to the H52 spike coding sequence to linearize the plasmid and remove the H52 spike and flanking sequences. The QIAquick gel extraction kit (Qiagen) is used to purify the band corresponding to the pUC57-s IBV H52 backbone without the H52 spike coding sequence. The ArkDPI S Ecto L274C nucleic acid coding sequence and the flanking 5′ and 3′ IBV H52 sequences are amplified in three separate PCR reactions with Q5® High-Fidelity DNA Polymerase (NEB; see table 11 for primers). The PCR products are purified by QIAquick gel extraction (Qiagen) and are used for Gibson assembly with the NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the kit protocol to generate the pUC57-s H52 rIBV ArkDPI S Ecto L274C (SEQ ID NO:79) donor plasmid.

    (101) TABLE-US-00011 TABLE 11 Primers designed with the NEBuilder online   tool for Gibson assembly of the pUC57-s  H52 rIBV ArkDPI S Ecto L274C.  SEQ ID Primer PCR NO name product Sequence 1 70 PO1783 H52 5′  cagagcacaagtttgatcttgtg flank atatctgatatgtatacagacaa tgattc 80 PO2424 catataaattagcactacatagt gcacac 2 81 PO2425 ArkDPI  atgtagtgctaatttatatgaca S Ecto acgaatcttttg 82 PO2426 acacataccaaggccacttaata taagttttg 3 83 PO2427 H52 3′  taagtggccttggtatgtgtggc 75 PO1788 flank tagcccttaactcctggaattac taaccacgtgtaccaaaataaac aacaagc

    (102) Successful assembly of the pUC57-s H52 rIBV ArkDPI S Ecto L274C is identified by plasmid restriction digest with BlpI and XhoI.

    (103) Targeted RNA Recombination and Rescue of Recombinant IBV

    (104) For rescue of H52 rIBV ArkDPI S Ecto L274C, LR7 cells are infected with H52 mIBV respectively and electroporated with in vitro transcript generated from the MssI linearized pUC57-s H52 rIBV ArkDPI S Ecto L274C donor plasmid, and subsequently injected into 8-day old embryonated SPF chicken eggs (VALO BioMedia). After up to 8 days of incubation, the allantoic fluids of some eggs are analyzed separately for the rescue of recombinant IBV after RNA isolation with the MagMAX™ Core Nucleic Acid Purification Kit (ThermoFisher) and the KingFisher™ Duo Prime Purification System (ThermoFisher) and by using SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (ThermoFisher). Primers PO1317 and PO633 (Table 12) binding in the ArkDPI spike sequence are used to identify the rescue of recombinant virus. The positive (defined by embryonic death or by a positive RT-PCR result) allantoic fluid of the egg inoculated with the highest dilution of LR7 cells is used for an end-point dilution in 8-day old embryonated SPF eggs. Nucleic acid isolation is conducted as described above. Samples are analyzed via RT-qPCR conducted according to the protocol adapted from Callison et al. (J Virol Methods. 2006; 138(1-2):60-5). Briefly, the same primers and probe are used and the thermoprofile is adapted for the use of TaqMan® Fast Virus 1-Step Master Mix (ThermoFisher) and the StepOnePlus or the ABI7900 HT Fast Real-Time PCR Systems (ThermoFisher Scientific). Afterwards, one positive-tested allantoic fluid preferably of a high dilution is used for propagation in 8-day old embryonated SPF chicken eggs. The allantoic fluid is diluted 1:100 in 1×PBS and 100 μl is injected per egg, which are subsequently incubated at 37.5° C. and 60% humidity. Allantoic fluid is harvested at 48 hours post inoculation, cleared from debris and stored at −80° C.

    (105) TABLE-US-00012 TABLE 12 Primers for detection of H52 rIBV ArkDPI S Ecto L274C. SEQ ID Primer NO name Sequence 84 PO1317 taatactggyaatttttcaga 21 PO633 cgctcttagtaacataaac
    In Vitro Characterization of Recombinant IBV

    (106) The Embryo infectious dose 50% (EID50) and the tissue culture infectious dose 50% (TCID50) for H52 rIBV ArkDPI S Ecto L274C is determined as described for H52 rIBV S F267C. Further, the in vitro replication kinetics and the passaging was conducted as described for H52 rIBV S F267C.

    (107) To analyze if H52 rIBV ArkDPI S Ecto L274C is able to replicate in cells, EB66® cells are inoculated with a 1/10 dilution of the allantoic fluid stock for the first passage and with a 1/10 or 1/100 dilution for the subsequent passages. Propagation of the viruses is analyzed by isolation of viral RNA and subsequent RT-qPCR analysis. Replication of H52 rIBV ArkDPI S Ecto L274C is clearly visible after three passages by a decreasing mean ct value for the 72h time point (11.59) compared to the 0 h time point (21.09) directly after infection.

    Conclusion Example 4

    (108) The data show that the mutation to Cysteine at position 267 of the spike (reference sequence for the numbering is SEQ ID NO:1) corresponding to position 274 in IBV ArkDPI spike leads to an extended cell or tissue tropism, too. In addition, the tissue culture tropism of a spike with the Cysteine mutation is not restricted to the homologous genetic background, as the ArkDPI L274C spike ectodomain is inserted into the H52 genetic backbone and the H52 rIBV ArkDPI S Ecto L274C efficiently replicates in cells.