Acyltransferases and uses thereof in fatty acid production

10208270 ยท 2019-02-19

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to the recombinant manufacture of polyunsaturated fatty acids. Specifically, it relates to acyltransferase polypeptides, polynucleotides encoding said acyltransferases as well as vectors, host cells, non-human transgenic organisms containing said polynucleotides. Moreover, the present invention contemplates methods for the manufacture of polyunsaturated fatty acids as well as oils obtained by such methods.

Claims

1. A polynucleotide comprising an expression control sequence operatively linked to a heterologous nucleic acid sequence selected from the group consisting of: a) the nucleic acid sequence of SEQ ID NO: 52 or 54; b) a nucleic acid sequence encoding a diacylglycerol acyltransferase 2 (DGAT2) polypeptide comprising the amino acid sequence of SEQ ID NO: 53; c) a nucleic acid sequence having at least 85% sequence identity to the nucleic acid sequence of SEQ ID NO: 52 or 54 and encoding a DGAT2 polypeptide, wherein said polypeptide has diacylglycerol acyltransferase activity; and d) a nucleic acid sequence encoding a DGAT2 polypeptide having at least 85% sequence identity to the amino acid sequence of SEQ ID NO: 53, wherein said polypeptide has diacylglycerol acyltransferase activity.

2. The polynucleotide of claim 1, wherein said polynucleotide further comprises a terminator sequence operatively linked to the nucleic acid sequence.

3. A vector comprising the polynucleotide of claim 1.

4. A host cell comprising: a) the polynucleotide of claim 1; or b) a vector comprising said polynucleotide; wherein the host cell is a plant cell, a microorganism, or an insect cell.

5. The host cell of claim 4, wherein the host cell is a plant cell.

6. The host cell of claim 4, wherein the host cell is yeast, fungus, algae, or moss.

7. A method for the manufacture of a polypeptide, comprising: a) cultivating the host cell of claim 4 under conditions which allow for the production of said polypeptide; and b) obtaining the polypeptide from said host cell.

8. A non-human transgenic organism comprising: a) the polynucleotide of claim 1; or b) a vector comprising said polynucleotide, wherein the non-human transgenic organism is a plant or a microorganism.

9. The non-human transgenic organism of claim 8, wherein the microorganism is a fungus, algae, moss, or yeast.

10. A method for the manufacture of polyunsaturated fatty acids, comprising: a) cultivating the host cell of claim 4 under conditions which allow for the production of polyunsaturated fatty acids in said host cell; and b) obtaining said polyunsaturated fatty acids from said host cell.

11. A method for the manufacture of polyunsaturated fatty acids, comprising: a) cultivating the non-human transgenic organism of claim 8 under conditions which allow for the production of polyunsaturated fatty acids in said host cell; and b) obtaining said polyunsaturated fatty acids from said non-human transgenic organism.

12. The method of claim 11, wherein said polyunsaturated fatty acid is arachidonic acid (ARA), eicosapentaenoic acid (EPA), and/or docosahexaenoic acid (DHA).

13. A method for the manufacture of an oil, lipid, or fatty acid composition, comprising: a) cultivating the host cell of claim 4 under conditions which allow for the production of polyunsaturated fatty acids in said host cell; b) obtaining said polyunsaturated fatty acids from said host cell; and c) formulating the polyunsaturated fatty acid as an oil, lipid, or fatty acid composition.

14. The method of claim 13, wherein said oil, lipid, or fatty acid composition is to be used for feed, foodstuffs, cosmetics, or pharmaceuticals.

15. A method for the manufacture of polyunsaturated fatty acids, comprising: a) cultivating a plant comprising the polynucleotide of claim 1 or a vector comprising said polynucleotide under conditions which allow for the production of polyunsaturated fatty acids in said plant or seeds thereof; and b) obtaining said polyunsaturated fatty acids from said plant or seeds thereof.

16. The method of claim 15, wherein the polyunsaturated fatty acids are obtained from the seeds of said plant.

17. A method for the manufacture of an oil, lipid or fatty acid composition, comprising: a) providing a polyunsaturated fatty acid produced by the method of claim 15; and b) formulating said polyunsaturated fatty acid as an oil, lipid or fatty acid composition.

18. A method for the manufacture of an oil, lipid or tatty acid composition, comprising: a) cultivating a plant comprising the polynucleotide of claim 1 or a vector comprising said polynucleotide under conditions which allow for the production of polyunsaturated fatty acids in said plant or seeds thereof; and b) obtaining an oil, lipid or fatty acid composition from said plant or seeds thereof.

19. The method of claim 18, wherein the oil, lipid or fatty acid composition is obtained from the seeds of said plant.

20. A method for the production of feed, foodstuffs, cosmetics or pharmaceuticals, comprising: a) obtaining an oil, lipid or fatty acid composition produced by the method of claim 18; and b) processing said oil, lipid or fatty acid composition to produce feed, foodstuffs, cosmetics or pharmaceuticals.

21. A method for the manufacture of polyunsaturated fatty acids, comprising: a) obtaining an oil, lipid or fatty acid composition produced by the method of claim 18; and b) obtaining polyunsaturated fatty acids from said oil, lipid or fatty acid composition.

22. A plant, or a plant part, plant cell, or seed thereof, wherein said plant, or said plant part, plant cell, or seed thereof comprises: a) the polynucleotide of claim 1; or b) a vector comprising said polynucleotide.

23. The polynucleotide of claim 1, wherein said heterologous nucleic acid sequence encodes a DGAT2 polypeptide having diacylglycerol acyltransferase activity and has at least 90% sequence identity to the amino acid sequence of SEQ ID NO: 53.

24. The polynucleotide of claim 1, wherein said heterologous nucleic acid sequence encodes a polypeptide having diacylglycerol acyltransferase activity and has at least 95% sequence identity to the amino acid sequence of SEQ ID NO: 53.

Description

FIGURES

(1) FIG. 1: Cloning strategy employed for stepwise buildup of plant expression plasmids of the invention.

(2) FIG. 2: Vector map of the bbc construct used for Arabidopsis transformation.

(3) FIG. 3: GC chromatogram of fatty acids methyl esters of total fatty acids of Col-0, fae1 mutant and fae1 transformed with bbc. Total fatty acids were measured as described by Wu et al., 2005. The content of the different fatty is indicated in table 5.

(4) FIG. 4: Total ion count of 26 acyl CoA ESI-MS/MS MRM pairs for Arabidopsis (A) Col-0 and (B) fae1 harbouring EPA biosynthesis pathway. Maturing Arabidopsis seeds were harvested 18 days after flowering. Acyl-CoA was extracted according to Larson et al (2001) and LC conditions after Han et al. (2010).

(5) FIG. 5: Identification of Eicosapentaenoic and Arachidonic-CoA's in the acyl CoA pool of Arabidopsis Col-0 and EPA producing plants. MRM chromatograms of co-eluting acyl-CoA of interest in (A) wild type and (C) fae1 harbouring EPA biosynthetic pathway with recorded reactions shown for each transition, isotopic peaks (IP) of homologous long chain acyl CoA are shown. (B) Characteristic fragmentation of the protonated acyl-CoA by neutral loss of 507 to give the protonated acyl pantetheine group.

(6) FIG. 6: LPCAT activity assay.

(7) A yeast mutant lacking LPEAT and LPCAT activity (due to knockout of the gene YOR175c) was transformed with the empty vector pYES2.1 (lane marked ?) and with pYES2.1 harboring the cDNA of pLPAAT_c6316(No) (lane 1 and 2, SEQ-ID: 13). Microsomal isolations of these transformants and the wildtype yeast strain BY4742 (lane marked +) containing 5 ?g protein where incubated with alpha-linolenic acid-CoA and [.sup.14C]-18:1-lysophosphatidylcholine (LPC). Thin layer chromatography was performed to separate lipid classes. Like for wildtype yeast (lane marked +), phosphatidylcholine (PC) is observed for both yeast clones shown in lane 1 and 2, indicating the gene pLPAAT_c6316(No) has LPCAT activity and complements the missing LPCAT activity of the knockout strain.

(8) FIG. 7: LPAAT activity assay.

(9) A yeast mutant lacking LPAAT activity (due to knockout of the gene YDL052c) was transformed with the empty vector pYES2.1 (lane marked ?) and with pYES2.1 harboring the cDNA of pLPAAT_c6316(No) (lane 1 and 2, SEQ-ID: 13). Microsomal isolations of these transformants and the wildtype yeast strain BY4742 (lane marked +) containing 5 ?g protein where incubated with alpha-linolenic acid-CoA and [.sup.14C]-18:1-lysophosphatidic acid (LPA). Thin layer chromatography was performed to separate lipid classes. Like for wildtype yeast (lane marked +), phosphatidic acid (PA) is observed for both yeast clones shown in lane 1 and 2, indicating the gene pLPAAT_c6316(No) has LPAAT activity and complements the missing LPAAT activity of the knockout strain.

(10) FIG. 8: DGAT activity assay.

(11) A yeast mutant lacking the capability to synthesis TAG (due to knockout of the four genes YCR048W, YNR019W, YOR245C and YNR008W) was transformed with the empty vector pYES2.1 (lane marked ?) and with pYES2.1 harboring the cDNA of pDGAT2-c19425mod(Ta) (SEQ-ID 52, lane 1 and 2), pDGAT2_c4648(No) (SEQ-ID 34, lane 5 and 6), pDGAT2_c48271(No) (SEQ-ID 102, lane 7 and 8), BnDGAT1 (SEQ-ID 107, lane 9 and 10), AtDGAT1 (SEQ-ID 105, lane 11 and 12), pDGAT2_c699(No) (SEQ-ID 19, lane 13 and 14) and pDGAT2_c2959(No) (SEQ-ID 25, lane 15). Microsomal isolations of these transformants and the wildtype yeast strain G175 (lane marked +) where incubated with .sup.14C-labeled oleic acid and diacylglyerole (DAG). Thin layer chromatography was performed to separate lipid classes. Like for wildtype yeast (lane marked +), triacylglycerole (TAG) is observed in lane 1, 2, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 and 15, indicating pDGAT2-c19425mod(Ta), pDGAT2_c4648(No), pDGAT2_c48271(No), BnDGAT1, AtDGAT1, pDGAT2_c699(No) and pDGAT2_c2959(No) encode polypeptides having DGAT activity and complement the missing TAG-synthesis capability of the knockout.

(12) FIG. 9: Substrate specificity of AtDGAT1 and BnDGAT1. The specific activity of the enzymes AtDGAT1 and BnDGAT1 using the substrates indicated at the x-axis is given as the amount (in nmol) of substrate consumed in one minute per mg total protein and was determined as described in example 10.

(13) FIG. 10: Substrate specificity of pDGAT2-c19425(Ta) compared to AtDGAT1 and BnDGAT1. The specific activity of the enzymes pDGAT2-c19425(Ta), AtDGAT1 and BnDGAT1 using the substrates indicated at the x-axis is given as the amount (in nmol) of substrate consumed in one minute per mg total protein and was determined as described in example 10.

(14) FIG. 11: Substrate specificity of pDGAT2_c699(No) and pDGAT2_c4648(No) compared to AtDGAT1 and BnDGAT1. The specific activity of the enzymes pDGAT2_c699(No) and pDGAT2_c4648(No), AtDGAT1 and BnDGAT1 using the substrates indicated at the x-axis is given as the amount (in nmol) of substrate consumed in one minute per mg total protein and was determined as described in example 10.

EXAMPLES

Example 1: General Cloning Methods

(15) Cloning methods as e.g. use of restriction endonucleases to cut double stranded DNA at specific sites, agarose gel electrophoreses, purification of DNA fragments, transfer of nucleic acids onto nitrocellulose and nylon membranes, joining of DNA-fragments, transformation of E. coli cells and culture of bacteria where performed as described in Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press: ISBN 0-87965-309-6).

Example 2: Sequence Analysis of Recombinant DNA

(16) Sequencing of recombinant DNA-molecules was performed using a laser-fluorescence DNA sequencer (Applied Biosystems Inc, USA) employing the sanger method (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467). Expression constructs harboring fragments obtained by polymerase chain reactions were subjected to sequencing to confirm the correctness of expression cassettes consisting of promoter, nucleic acid molecule to be expressed and terminator to avoid mutations that might result from handling of the DNA during cloning, e.g. due to incorrect primers, mutations from exposure to UV-light or errors of polymerases.

Example 3: Cloning of Yeast Expression Construct Via Homologous Recombination

(17) The open reading frame listed in SEQ ID NOs: 52, 1, 4, 7, 10, 13, 16, 19, 22, 25, 28, 31, 34, 37, 40, 43, 46, 49, 55, 102, 105 and 107 encoding polypeptides with the amino acid sequence SEQ ID NOs: 53, 2, 5, 8, 11, 14, 17, 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 56,103, 106 and 108 that have acyltransferase activity can amplified using the primer listed in table 2 in a polymerase chain reaction. By doing so, the open reading frame is 5 fused to about 60 nucleotides of the 3 end of the GAL1 promotor sequence with simultaneous introduction of and Asc I and/or Nco I restriction site between the fusion site and 3 fused to about 60 nucleotides of the 5 end of the CYC1 terminator sequence with simultaneous introduction of and Pac I restriction site. To integrate these fragments into pYES2.1 TOPO downstream of the galactose inducible GAL1 Promotor via homologous recombination, the vector pYES2.1 (Invitrogen) can be digested using the restriction endonucleases Pvu II and Xba I, and Saccharomyces cerevisea can be transformed with 5 to 20 ng of linearized pYES2.1 TOPO vector and 20 to 100 ng PCR product per 50 ?l competent cells using the transformation method described by Schiestl et al. (Schiestl et al. (1989) Curr. Genet. 16(5-6), pp. 339-346), to obtain pYES-pLPLAT_c1216(No), pYES-pLPLAT_c3052(No), pYES-pLPEAT-c7109(Ta), pYES-pLPAAT_c2283(No), pYES-pLPAAT_c6316(No), pYES-pDGAT2_Irc24907(No), pYES-pDGAT2_c699(No), pYES-pDGAT2_c1910(No), pYES-pDGAT2_c2959(No), pYES-pDGAT2_c4857(No), pYES-pDGAT1_c21701(No), pYES-pDGAT2_c4648(No), pYES-pDGAT2_c1660(No), pYES-pDGAT2_c29432(No), pYES-pDGAT2_c1052(No), pYES-pDGAT2-c18182(Ta), pYES-pDGAT2-c5568(Ta), pYES-pDGAT2-c19425(Ta), pYES-pDGAT2_c48271(No), AtDGAT1, BnDGAT1 and pYES-pGPAT_c813(No) in various wildtype yeasts and yeast mutants. Positive transformants can be selected based on the complementation of the URA auxotrophy of the chosen S. cerevisia strain. To validate the correctness of the expression construct harbored by a particular yeast clone, plasmids can be isolated as described in Current Protocols in Molecular Biology (Hoffmann, Curr. Protoc. Mol. Biol. 2001 May; Chapter 13:Unit13.11), transformed into E. coli for amplification and subjected to sequencing of the expression cassette as described in example 2. For later cloning into plant expression plasmids, the introduced restrictions site for Asc I and/or Nco I in combination with Pac I can be used.

(18) TABLE-US-00002 TABLE2 Primersequencesforcloningacyltransferase-polynucleotidesoftheinvention foryeastexpression Gene-Name Primer SEQ-ID pLPLAT_c1216(No) Forward: 46 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggacaa ggcactggcaccgtt Reverse: 47 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaactaaactttcttccttccc tcta pLPLAT_c3052(No) Forward: 48 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgaccacg actgtcatctctag Reverse: 49 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcaaagcctcccgcac aacgagc pLPEAT-c7109(Ta) Forward: 50 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggaggg catcgagtcgatagt Reverse: 51 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaactataaggcttctcccg gcgcgg pLPAAT_c2283(No) Forward: 52 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgaagac gcccacgagcctggc Reverse: 53 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaattaagctctcgaatcgtc cttct pLPAAT_c6316(No) Forward: 54 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggtcagg aggaagatggacgt Reverse: 55 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcacgacgccggcgc cttgcagt pDGAT2_lrc24907(No) Forward: 56 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggcaccc tccccaccggcccc 57 Reverse: aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcatttgaccactaaggt ggcct pDGAT2_c699(No) Forward: 58 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgggtctat ttggcagcgggat Reverse: 59 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaactaaaagaaattcaac gtccgat pDGAT2_c1910(No) Forward: 60 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgttgagta tccccgagtcgtc Reverse: 61 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaactaaaagaaatccagc tccctgt pDGAT2_c2959(No) Forward: 62 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgacgccg caagccgatatcac Reverse: 63 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaattactcaatggacaacg ggcgcg pDGAT2_c4857(No) Forward: 64 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggcttacc tcttccgtcgtcg Reverse: 65 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaattaggcgatcgcaatg aactcct pDGAT1_c21701(No) Forward: 66 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgccttttg gacgggctgcatc Reverse: 67 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcacccgaaaatatcct ccttct pDGAT2_c4648(No) Forward: 68 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggccaa ggctaacttcccgcc Reverse: 69 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcactttataagcagctt cttgt pDGAT2_c1660(No) Forward: 70 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgttgttgc agggattaagctg Reverse: 71 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcacaacaggaccaat ttatgat pDGAT2_c29432(No) Forward: 72 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgttgatgg cgccgtcgcggcg Reverse: 73 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcagacgatgcgaagc gtcttgt pDGAT2_c1052(No) Forward: 74 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgggcgct accactgcgaccca Reverse: 75 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcacgacttcggacagt ccaaaa pDGAT2-c18182(Ta) Forward: 76 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgtcgttcg ttgagcacagcgc Reverse: 77 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaactacacaaatcgcatc gtcttgt pDGAT2-c5568(Ta) Forward: 78 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggtcttcct ctgccttcccta Reverse: 79 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaactacgagtccagccac ttgatgc pDGAT2-c19425(Ta) Forward: 80 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgtttcttcg catcgaacggga Reverse: 81 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaactaaccctcggtgtaca gcgccg pGPAT_c813(No) Forward: 82 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatgccatcc cgcagcaccattga Reverse: 83 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcagacaagctcctctt ccccct pDGAT2_c48271(No) Forward: 109 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggccgcc atctcaccgcgcaa Reverse: 110 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaactaccacacctccaact tcgccc AtDGAT1 Forward: 111 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggcgattt tggattctgctgg Reverse: 112 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaatcatgacatcgatcctttt cggt BnDGAT1 Forward: 113 ataaaagtatcaacaaaaaattgttaatatacctctatactttaacgt caaggagaaaaaaccccggatcggcgcgccaccatggagattt tggattctggagg Reverse: 114 aactataaaaaaataaatagggacctagacttcaggttgtctaact ccttccttttcggttagagcggatttaattaactatgacatctttcctttg cggt

(19) TABLE-US-00003 TABLE 3 Coding polynucleotide sequences, amino acid sequences encoded thereby and expressed sequences (mRNA) of the acyltransferases of the invention SEQ- SEQ- ORF SEQ- Amino ID mRNA ID Gene name Organism in bp ID No. acids No. in bp No. pLPLAT_c1216(No) Nannochloropsis 1485 1 494 2 1908 3 oculata pLPLAT_c3052(No) Nannochloropsis 1776 4 591 5 2247 6 oculata pLPEAT-c7109(Ta) Thraustochytrium 1134 7 377 8 1288 9 aureum pLPAAT_c2283(No) Nannochloropsis 1284 10 427 11 1826 12 oculata pLPAAT_c6316(No) Nannochloropsis 1395 13 464 14 1771 15 oculata pDGAT2_Irc24907 Nannochloropsis 1026 16 341 17 1100 18 (No) oculata pDGAT2_c699(No) Nannochloropsis 1206 19 401 20 1772 21 oculata pDGAT2_c1910(No) Nannochloropsis 1173 22 390 23 1239 24 oculata pDGAT2_c2959(No) Nannochloropsis 1089 25 362 26 1609 27 oculata pDGAT2_c4857(No) Nannochloropsis 1464 28 487 29 1682 30 oculata pDGAT1_c21701 Nannochloropsis 1539 31 512 32 1904 33 (No) oculata pDGAT2_c4648(No) Nannochloropsis 1083 34 360 35 1362 36 oculata pDGAT2_c1660(No) Nannochloropsis 1695 37 564 38 2074 39 oculata pDGAT2_c29432 Nannochloropsis 1029 40 342 41 1585 42 (No) oculata pDGAT2_c1052(No) Nannochloropsis 1251 43 416 44 1923 45 oculata pDGAT2- Thraustochytrium 930 46 309 47 1134 48 c18182(Ta) aureum pDGAT2- Thraustochytrium 1179 49 392 50 1303 51 c5568(Ta) aureum pDGAT2- Thraustochytrium 1389 52 462 53 1547 54 c19425(Ta) aureum pGPAT_c813(No) Nannochloropsis 1977 55 658 56 2460 57 oculata pDGAT2_c48271 Nannochloropsis 960 102 319 103 1265 104 (No) oculata

Example 4: Assembly of Genes Required for PUFA Synthesis within a T-Plasmid

(20) For synthesis of EPA in Arabidopsis seeds, the set of genes encoding the proteins of the metabolic EPA pathway (table 4) was combined with expression elements (promoter, terminators) and transferred into binary t-plasmids that were used for agrobacteria mediated transformation of plants as described in example 5. To this end, the general cloning strategy depicted in FIG. 1 was employed: Genes listed in table 4 were PCR-amplified using Phusion? High-Fidelity DNA Polymerase (NEB, Frankfurt, Germany) according to the manufactures instructions from cDNA using primer introducing a Nco I and/or Asc I restriction site at the 5 terminus, and a Pac I restriction site at the 3 terminus (FIG. 1B). To obtain the final expression modules, PCR-amplified genes were cloned between promoter and terminator via Nco I and/or Pac I restriction sites (FIG. 1C). Up to three of those expression modules were combined as desired to expression cassettes harbored by either one of pENTR/A, pENTR/B or pENTR/C (FIG. 1D). Finally, the Multisite Gateway? System (Invitrogen) was used to combine three expression cassette harbored by pENTR/A, pENTR/B and pENTR/C (FIG. 1E) to obtain the final binary T-plasmids bbc (SEQ-ID 101, FIG. 2).

(21) TABLE-US-00004 TABLE 4 Genes of the bbc construct for synthesis of EPA (20:5n-3) in Arabidopsis seeds. The elements controlling the expression of the respective genes are as well indicated. Name Source Organism Activity SEQ-ID Promoter Terminator d12Des(Ps) Phytophtora sojae d-12 Desaturase 96 p-BnNapin t-E9 d6Des(Ot) Ostreococcus tauri d-6 Desaturase 97 p-SBP t-CatpA d5Des(Tc) Traustochytrium ssp. d-5 Desaturase 98 p-LuCnl t-AgroOCS d6Elo(Pp) Physcomitrella patens d-6 Elongase 99 p-VfUSP t-CaMV35S o-3Des(Pi) Phytophthora o-3 Desaturase 100 p-Napin t-E9 infestans

Example 5: Plant Transformation

(22) The resulting binary vector bbc harboring the genes reconstituting EPA biosynthesis pathway were transformed into Agrobacterium tumefaciens (Hofgen and Willmitzer (1988) Nucl. Acids Res. 16: 9877). The transformation of A. thaliana was accomplished by means of the floral-dip method (Clough and Bent (1998) Plant Journal 16: 735-743), this method is known to the skilled person. Wild-type Arabidopsis seeds contain considerable amounts of eicosenoic acid (20:1) (Table 5). Biosynthesis of 20:1 competes for the substrates of the PUFA biosynthesis pathway. This competition was circumvented by transforming bbc into the Arabidopsis fae1 mutant (James et al., (1995) The Plant Cell 7:309-319).

Example 6: Quantification of Metabolic Fatty Acyl-CoAs in Wild-Type and EPA Producing Arabidopsis Seeds

(23) The selected transgenic Arabidopsis plants from example 3 were analyzed in respect to PUFA content in seeds. Seeds from wild-type, fae1 mutant and transgenics harboring the bbc construct were harvested 18 days after flowering. Total fatty acid, representing the fatty acids esterified to CoA, on lipids and as triacyl-glycerides were extracted and analyzed by gas chromatography as described in Wu et al., (2005) Nature Biotechnology 23(8): 1013-1017. In seeds of fae1 transformed with bbc the EPA accumulation was 12.2%, the seeds contained small amounts of intermediate or side products: ARA (3.2%), SDA (0.8%), GLA (2.6%) which were not present in wild-type or fae1 (FIG. 3, Table 5).

(24) TABLE-US-00005 TABLE 5 Content of fatty acids in seeds of wild-type (Col-0), fae1 mutant and fae1 transformed with bbc construct Fatty acid Common name of FA Col-0 fae1 bbc fae1 16:0 Palmitic acid 6.2 8.8 6.8 18:0 Stearic acid 3.1 4.1 5.3 18:1 Oleic acid 16.3 27.5 18.9 18:2 Linoleic acid 28.2 39.0 30.8 18:3n6 Gamma-Linolenic acid 0.0 0.0 2.6 18:3n3 Alpha-Linoleic acid 15.6 18.4 11.9 18:4n3 Stearidonic acid 0.0 0.0 0.8 20:1 Eicosenoic acid 22.8 0.4 0.3 20:4n6 Arachidonic acid 0.0 0.0 3.2 20:5n3 Eicosapentaenoic acid 0.0 0.0 12.2 Others 7.8 1.8 7.2

(25) For PUFA biosynthesis the acyl-moiety has to be shuffled between different metabolic pools. For example, the elongation of the acyl chain by two carbon atoms occurs specifically on acyl-CoA (Zank et al., (2002) The Plant Journal 318(3):255-268. The efficiency of the transfer of the acyl-residue between the metabolic pools may represent a bottleneck for PUFA production in plants. Therefore the accumulation of EPA or intermediates of EPA biosynthesis as CoA species was analyzed by LC/MS.sup.2. As a control CoA pool of wild-type seeds were as well analyzed. The Acyl-CoA metabolites were extracted from the seed tissue according to Larson and Graham, 2001. LC/MS.sup.2 was applied as described by Magnes et al., 2005. Briefly, CoA were separeted with high resolution by reversed-phase high performance liquid chromatography (HPLC) with a ammonium hydroxide and acetonitrile gradient. The acyl-CoA species were identified and quantified by multireaction monitoring using triple quadrupole mass spectrometry. Only a few methods using mass spectrometry for characterization of long chain acyl-CoA have been published, the majority of which employ negative ionisation mode showing abundant ions. In contrast, positive ionisation has only one abundant ion [M-H]+, furthermore the predominant ion in MS.sup.2 spectra is the fatty acyl-pantetheine fragment (m/z 507FIG. 5B), characteristic of CoA-activated substances. In choosing the acyl-pantetheine of interest in multireaction monitoring mode (MRM) a very sensitive, selective and reproducible method was established. CoA-activated substances can be monitored by scanning for the neutral loss of phosphoadenosine diphosphate. Generally for reliable analysis, all interfering peaks must be chromatographically separated; in the case of EPA and ARA this is not possible (FIG. 4B). However through the use of MRM, incorporating very short dwell times (15 ms), it is possible to follow the individual chromatograms of acyl-CoA of interest and demonstrate the presence of EPA and ARA in the acyl CoA pool (FIG. 5C). According to internal standards the eicosapentaenoyl-CoA was in the range of . . . % of the total Co-A pool.

(26) In conclusion these results show that PUFA accumulate in the metabolic CoA pool and are not transferred to DAG to be released as TAG into the seed oil. Such a bottleneck may be overcome by the co-expression of an acyltransferase from table 3, having the appropriate substrate specificity. The application of suitable acyltransferase may increase the flux of fatty acid between the metabolic pools and increase the PUFA biosynthesis rate.

Example 7: Activity Assays Using Yeast Extracts

(27) To characterize the functions of the acyltransferase polypeptides of the invention, yeast mutants can be employed that are defective in certain acyltransferase activities. For example, the yeast mutant Y13749 (Genotype: BY4742; Mat alpha; his3?1; leu2?0; lys2?0; ura3?0; YDL052c::kanMX4) lacking LPAAT activity can be transformed with expression constructs harboring candidate polypeptides to check for restoration (complementation) of LPAAT activity, the yeast mutant Y12431 (genotype BY4742; Mat alpha; his3?1; leu2?0; lys2?0; ura3?0; YOR175c::kanMX4) lacking LPLAT activity can be transformed with expression constructs harboring candidate polypeptides to check for restoration (complementation) of LPLAT activity, the yeast mutant H1246 (genotype MATa leu2-3, 112 trp1-1 can1-100 ura3-1 ade2-1 his3-11, 15 YOR245::KanMX4 YNR008W::TRP1 YCR048W::HIS3 YNR019W::LEU2) lacking the ability to synthesize triacylglycerole can be transformed with expression constructs harboring candidate polypeptides to check for restoration (complementation) of the ability to synthesis triacylglycerole. The yeast mutants can for example harbor the expression constructs listed in example 3 employing the transformation method described in example 3.

(28) For LPAAT activity assay, clones of the yeast mutant Y13749 harboring pYES-pLPAAT_c6316(No) can be grown at 28? C. in 10 ml selective media (SC-URA) with 2% raffinose as carbon source over night. The next day, expression of the acyltransferase polypeptide can be induced by transferring the cells to fresh media containing 2% galactose, for example by inoculating 100 ml of fresh culture to an optical density (measure at 600 nm) of OD.sub.600=0.1. Cells are harvested after 24 h incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 1 ml resuspention buffer (25 mM Tris/HCL pH 7.6) and disrupted using acid washed zirconium bead (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm. The supernatant is transferred to a fresh tube and centrifuged at 3000?g for 5 min. The obtained supernatant is the crude extract. Protein content is measured according to Bradford (Bradford, M. M. (1976), Anal. Biochem. Bd. 72, pp. 248-254) with bovine serum albumin as standard. Assay mixtures contain 1 to 50 ?g of protein, 10 ?l of 100 nM [.sup.14C]-18:1-LPA (giving about 2000 dpm/nmol), 10 ?l of 50 nM 18:1-CoA or 50 nM 18:3n-3-CoA in assay buffer (25 mM Tris/HCL pH 7.6, 0.5 mg/ml BSA) to give a total volume of 100 ?l. Samples are incubated for 10 min at 30? C. The assays are terminated by extraction of the lipids into chloroform according to Blight and Dyer (Bligh, E. G. and Dyer, W. J. (1959), Can. J. Biochem. Physiol. 37, pp. 911-917). Lipids are separated on thin layer chromatography (TLC) silica 60 plates (Merck) using chloroform/methanol/acetic acid/water (90:15:10:3), and autoradiographic pictures are taken using an instant imager (Packard). It can be seen by the formation of phosphatidic acid (PA) in FIG. 7, that pLPAAT_c6316(No) (SEQ-ID 13, lane 1 and 2) encodes a polypetide having LPAAT activity.

(29) For LPCAT and LPEAT activity assay, clones of the yeast mutant Y12431 harboring pYES-pLPAAT_c6316(No) can be grown at 28? C. in 10 ml selective media (SC-URA) with 2% raffinose as carbon source over night. The next day, expression of the acyltransferase polypeptide can be induced by transferring the cells to fresh media containing 2% galactose, for example by inoculating 100 ml of fresh culture to an optical density (measure at 600 nm) of OD.sub.600=0.1. Cells are harvested after 24 h incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 1 ml resuspention buffer (25 mM Tris/HCL pH 7.6) and disrupted using acid washed zirconium bead (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm. The supernatant is transferred to a fresh tube and centrifuged at 3000?g for 5 min. The obtained supernatant is the crude extract. Protein content is measured according to Bradford (Bradford, M. M. (1976), Anal. Biochem. Bd. 72, pp. 248-254) with bovine serum albumin as standard. Assay mixtures contain either 10 ?l 100 nM [.sup.14C]-LPC (LPCAT activity assay) or 10 ?l 100 nM [.sup.14C]-LPE (LPEAT activity assay), 1 to 50 ?g of protein, 10 ?l of 50 nM 18:1-CoA or 50 nM 18:3n-3-CoA in assay buffer (25 mM Tris/HCL pH 7.6, 0.5 mg/ml BSA) to give a total volume of 100 ?l. Samples are incubated for 10 min at 30? C. The assays are terminated by extraction of the lipids into chloroform according to Blight and Dyer (Bligh, E. G. and Dyer, W. J. (1959), Can. J. Biochem. Physiol. 37, pp. 911-917). Lipids are separated on thin layer chromatography (TLC) silica 60 plates (Merck) using chloroform/methanol/acetic acid/water (90:15:10:3), and autoradiographic pictures are taken using an instant imager (Packard). It can be seen by the formation of phosphatidylethanolamine (PC) in FIG. 6, that pLPAAT_c6316(No) (SEQ-ID 13, lane 1 and 2) encodes a polypeptide having LPCAT activity.

(30) For DGAT activity assay, clones of the yeast mutant H1246 harboring either one of pYES-pDGAT2_c699(No), pYES-pDGAT2_c2959(No), pYES-pDGAT2_c4648(No), pYES-pDGAT2_c48271(No), pYES-pDGAT2-c19425(Ta), pYES-AtDGAT1, or pYES-BnDGAT1 can be grown at 28? C. in 10 ml selective media (SC-URA) with 2% raffinose as carbon source over night. The next day, expression of the acyltransferase polypeptides can be induced by transferring the cells to fresh media containing 2% galactose, for example by inoculating 100 ml of fresh culture to an optical density (measure at 600 nm) of OD.sub.600=0.1. Activity as indicated by the formation of TAG (as indicated, the mutant H1246 is unable to synthesize TAG) can be measured either by relying on yeast-endogenous substrate-DAG, or by providing substrate in an in vitro assay.

(31) For the former type of assay, cells are harvested after reaching stationary phase during incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 2 ml resuspention buffer (phosphate buffered saline (PBS) pH 7.4, see Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory, 1989). The equivalent of 200 mg cell pellet is taken, the volume adjusted to 210 ?l using PBS and 790 ?l of methanol:chloroform (2:1) are added. Cells are disrupted using acid washed zirconium bead (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm and lipids are extracted according to Blight and Dyer (Bligh, E. G. and Dyer, W. J. (1959), Can. J. Biochem. Physiol. 37, pp. 911-917). The in vitro assay is the preferred way of testing for DGAT activity, when activity is known or expected to be week when relying on endogenous substrate. Instead, both the type and concentration of the DAG acceptor molecule, as well as the type and concentration of the fatty acid-CoA can be controlled. To do so, cells are harvested after 24 h incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 1 ml resuspention buffer (25 mM Tris/HCL pH 7.6) and disrupted using acid washed zirconium bead (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm. The supernatant is transferred to a fresh tube and centrifuged at 3000?g for 5 min. The obtained supernatant is the crude extract. Protein content is measured according to Bradford (Bradford, M. M. (1976), Anal. Biochem. Bd. 72, pp. 248-254) with bovine serum albumin as standard. Assay mixtures contain 10 ?l 50 nM [.sup.14C]-6:0-DAG (giving about 3000 dpm/nmol), 50 ?g of microsomal protein (the amount can be adjusted to stay within linear conditions without substrate limitation), 10 ?l of 50 nM 18:3n-3-CoA or 50 nM 22:6n-3-CoA in assay buffer (50 mM Hepes buffer pH 7.2, 1 mg/ml BSA) to give a total volume of 100 ?l. Samples are incubated for 10 min at 30? C.

(32) In either casein vivo or in vitro assaylipids are separated on thin layer chromatography (TLC) silica 60 plates (Merck) using hexane:diethylether:acetic acid (70:30:1), and stained in iodine vapor. It can be seen by the formation of triacylglycerole (TAG) using the in vitro assay-conditions in FIG. 8, that pDGAT2-c19425mod(Ta) (SEQ-ID 52, lane 1 and 2), pDGAT2_c4648(No) (SEQ-ID 34, lane 5 and 6), pDGAT2_c48271(No) (SEQ-ID 102, lane 7 and 8), BnDGAT1 (SEQ-ID 107, lane 9 and 10), AtDGAT1 (SEQ-ID 105, lane 11 and 12), pDGAT2_c699(No) (SEQ-ID 19, lane 13 and 14) and pDGAT2_c2959(No) (SEQ-ID 25, lane 15) encode polypeptides having DGAT activity.

(33) Table 6 summarizes the results of the LPCAT, LPAAT and DGAT activity tests.

(34) TABLE-US-00006 TABLE 6 Measured with microsomal protein and [14C]-18:1-LPA, [14C]-18:1-LPC or [14C]-6:0-1,2-DAG. Ofr the in vitro DGAT assay, 1 mg/ml of BSA was added to reduce activity for staying in the linear range. Activity in vitro Activity in SEQ-IDs using vitro using Enzyme (ORF/- 18:3-CoA 22:6-CoA Activity Class Candidate protein/mRNA) nmol/(mg*min) nmol/(mg*min in vivo LPAAT pLPAAT_c6316(No) 13/14/15 81 64 LPCAT pLPAAT_c6316(No) 13/14/15 38 9 DGAT pDGAT2_c699(No) 19/20/21 0.22 0.17 Yes DGAT pDGAT2_c2959(No) 25/26/27 0.95 0.67 Yes DGAT pDGAT2_c4648(No) 34/35/36 1.4 0.17 Yes DGAT pDGAT2_c48271(No) 102/103/104 1.6 0 Yes DGAT pDGAT2-c19425(Ta) 52/53/54 4.0 5.6 Yes DGAT AtDGAT1 105/106/ 1.6 1.2 Yes DGAT BnDGAT1 107/108/ 2.4 1.5 Yes

Example 8: Determination of Substrate Specificity for LPAAT

(35) For determination of substrate specificities of the LPAAT enzymes, clones of the yeast mutant Y13749 (described in example 7) harboring LPAAT genes in the pYES plasmid can be grown at 28? C. in 10 ml selective media (SC-URA) with 2% raffinose as carbon source over night. The next day, expression of the acyltransferase polypeptides can be induced by transferring the cells to fresh media containing 2% galactose, for example by inoculating 100 ml of fresh culture to an optical density (measure at 600 nm) of OD.sub.600=0.1. Cells are harvested after 24 h incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 1 ml disruption buffer (20 mM Tris/HCL pH 7.6, 10 mM MgCl.sub.2, 1 mM EDTA, 5% glycerol, 0.3 M (NH.sub.4).sub.2SO.sub.4) and disrupted using acid washed zirconium beads (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm. The supernatant and the beads are transferred to a fresh tube. Disruption buffer is added up to 20 ml and the tube is centrifuged at 8000?g for 5 min. The obtained supernatant is centrifuged for 2 hrs at 42000 rpm at 4? C. The pellet (microsomal fraction) is resuspended in a small volume of 0.1 M phosphate buffer pH 7.2. Protein content in the microsomal fraction is measured according to Bradford (Bradford, M. M. (1976), Anal. Biochem. Bd. 72, pp. 248-254) with bovine serum albumin as standard. Assay mixtures contain 1-5 ?g of microsomal protein (the amount is adjusted to achieve linear conditions without substrate limitation), 10 ?l of 1 mM [.sup.14C]-18:1-LPA (5000 dpm/nmol), 10 ?l of 1 mM acyl-CoA in assay buffer (0.1 M phosphate buffer pH 7.2., 10 mg/ml Bovine Serum Albumine (BSA)) to give a total volume of 100 ?l. Like to amount of microsomal protein added to the assay, also the amount of BSA has influence on observed anzmye activities, where higher amounts of BSA result on lower activities and lower amounts of BSA result in higher activities. The enzyme specificity can be tested for different acyl-CoA:s, e.g. 14:0-CoA, 16:0-CoA, 18:1-CoA, 18:2-CoA, 18:3-CoA, ?18:3-CoA, 18:4-CoA, 20:3-CoA, 20:4-CoA, 20:4(n-3)-CoA, 20:5-CoA, 22:5-CoA, 22:6-CoA. Samples are incubated for 4 min at 30? C. The assays are terminated by extraction of the lipids into chloroform according to Bligh and Dyer (Bligh, E. G. and Dyer, W. J. (1959), Can. J. Biochem. Physiol. 37, pp. 911-917). Lipids are separated on thin layer chromatography (TLC) silica 60 plates (Merck) using chloroform/methanol/acetic acid/water (90:15:10:3), and autoradiographic pictures are taken using an instant imager (Packard). The amount of phosphatidic acid (PA) produced in the reaction (and hence the enzyme activity) can be determined from the picture.

Example 9: Determination of Substrate Specificity for LPLAT

(36) For LPCAT and LPEAT activity assay, clones of the yeast mutant Y12431 harboring LPLAT genes in the pYES plasmid can be grown at 28? C. in 10 ml selective media (SC-URA) with 2% raffinose as carbon source over night. The next day, expression of the acyltransferase polypeptides can be induced by transferring the cells to fresh media containing 2% galactose, for example by inoculating 100 ml of fresh culture to an optical density (measure at 600 nm) of OD.sub.600=0.1 Cells are harvested after 24 h incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 1 ml disruption buffer (20 mM Tris/HCL pH 7.6, 10 mM MgCl.sub.2, 1 mM EDTA, 5% glycerol, 0.3 M (NH.sub.4).sub.2SO.sub.4) and disrupted using acid washed zirconium beads (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm. The supernatant and the beads are transferred to a fresh tube. Disruption buffer is added up to 20 ml and the tube is centrifuged at 8000?g for 5 min. The obtained supernatant is centrifuged for 2 hrs at 42000 rpm at 4? C. The pellet (microsomal fraction) is resuspended in a small volume of 0.1 M phosphate buffer pH 7.2. Protein content in the microsomal fraction is measured according to Bradford (Bradford, M. M. (1976), Anal. Biochem. Bd. 72, pp. 248-254) with bovine serum albumin as standard. Assay mixtures contain either 10 ?l 1 mM [.sup.14C]-18:1-Lysophosphatidlycholine (-LPC), 5000 dpm/nmol (LPCAT assay) or 10 ?l 1 mM [.sup.14C]-18:1-Lysophosphatidylethanolamine (-LPE), 5000 dpm/nmol (LPEAT assay), 1-10 ?g of microsomal protein (the amount is adjusted to achieve linear conditions without substrate limitation), 10 ?l of 1 mM acyl-CoA in assay buffer (0.1 M phosphate buffer pH 7.2., 10 mg/ml BSA) to give a total volume of 100 ?l. Like to amount of microsomal protein added to the assay, also the amount of BSA has influence on observed anzmye activities, where higher amounts of BSA result on lower activities and lower amounts of BSA result in higher activities. The enzyme specificity can be tested for different acyl-CoA:s, e.g. 14:0-CoA, 16:0-CoA, 18:1-CoA, 18:2-CoA, 18:3-CoA, ?18:3-CoA, 18:4-CoA, 20:3-CoA, 20:4-CoA, 20:4(n-3)-CoA, 20:5-CoA, 22:5-CoA, 22:6-CoA. Samples are incubated for 4 min at 30? C. The assays are terminated by extraction of the lipids into chloroform according to Bligh and Dyer (Bligh, E. G. and Dyer, W. J. (1959), Can. J. Biochem. Physiol. 37, pp. 911-917). Lipids are separated on thin layer chromatography (TLC) silica 60 plates (Merck) using chloroform/methanol/acetic acid/water (90:15:10:3), and autoradiographic pictures are taken using an instant imager (Packard). The amount of phosphatidyl choline (PC) or phosphatidyl ethanol amine (PE) produced in the reaction (and hence the enzyme activity) can be determined from the picture.

Example 10: Determination of Substrate Specificity for DGAT

(37) For DGAT activity assay, clones of the yeast mutant H1246 harboring either one of pYES-pDGAT2_c699(No), pYES-pDGAT2_c2959(No), pYES-pDGAT2_c4648(No), pYES-pDGAT2_c48271(No), pYES-pDGAT2-c19425(Ta), pYES-AtDGAT1, or pYES-BnDGAT1 can be grown at 28? C. in 10 ml selective media (SC-URA) with 2% raffinose as carbon source over night. The next day, expression of the acyltransferase polypeptides can be induced by transferring the cells to fresh media containing 2% galactose, for example by inoculating 100 ml of fresh culture to an optical density (measure at 600 nm) of OD.sub.600=0.1. Cells are harvested after 24 h incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 1 ml disruption buffer (20 mM Tris/HCL pH 7.6, 10 mM MgCl.sub.2, 1 mM EDTA, 5% glycerol, 0.3 M (NH.sub.4).sub.2SO.sub.4) and disrupted using acid washed zirconium beads (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm. The supernatant and the beads are transferred to a fresh tube. Disruption buffer is added up to 20 ml and the tube is centrifuged at 8000?g for 5 min. The obtained supernatant is centrifuged for 2 hrs at 42000 rpm at 4? C. The pellet (microsomal fraction) is resuspended in a small volume of 0.1 M phosphate buffer pH 7.2. Protein content in the microsomal fraction is measured according to Bradford (Bradford, M. M. (1976), Anal. Biochem. Bd. 72, pp. 248-254) with bovine serum albumin as standard. Assay mixtures contain 5 ?l 1 mM [.sup.14C]-6:0-DAG, 3000 dpm/nmol, 1-100 ?g of microsomal protein (the amount is adjusted to achieve linear conditions without substrate limitation), 5 ?l of 1 mM acyl-CoA in assay buffer (50 mM Hepes buffer pH 7.2, 1 mg/ml BSA) to give a total volume of 100 ?l. The enzyme specificity can be tested for different acyl-CoA:s, e.g. 14:0-CoA, 16:0-CoA, 18:1-CoA, 18:2-CoA, 18:3-CoA, ?18:3-CoA, 18:4-CoA, 20:3-CoA, 20:4-CoA, 20:4(n-3)-CoA, 20:5-CoA, 22:5-CoA, 22:6-CoA. Samples are incubated for 4 min at 30? C. The assays are terminated by extraction of the lipids into chloroform according to Bligh and Dyer (Bligh, E. G. and Dyer, W. J. (1959), Can. J. Biochem. Physiol. 37, pp. 911-917).Lipids are separated on thin layer chromatography (TLC) silica 60 plates (Merck) using hexane:diethylether:acetic acid (70:30:1), and autoradiographic pictures are taken using an instant imager (Packard). The amount of triacylglycerol (TAG) produced in the reaction (and hence the enzyme activity) can be determined from the picture. In Brassica napus and Arabidopsis, the DGAT involved in TAG-formation in seeds are of the DGAT1 type. The enzyme activity AtDGAT1 and BnDGAT1 for the different substrates can be seen in FIG. 9. The enzyme activity of pDGAT2-c19425(Ta) for the different substrates, compared to AtDGAT1 and BnDGAT1 is shown in FIG. 10. The enzyme activity of pDGAT2_c699(No) and pDGAT2_c4648(No) for the different substrates, compared to AtDGAT1 and BnDGAT1 is shown in FIG. 11. The data in FIGS. 10 and 11 show clearly, that all DGAT2 enzymes shown in these figures vary strongly towards their activities for the various substrates, whereas the DGAT1 involved in TAG formation in Arabidopsis and Brassica napus exhibit less variability towards these different substrates.

Example 11: Determination of Substrate Selectivity for LPAAT

(38) For determination of substrate selectivities of the LPAAT enzymes, clones of the yeast mutant Y13749 (described in example 7) harboring LPAAT genes can be grown at 28? C. in 10 ml selective media (SC-URA) with 2% raffinose as carbon source over night. The next day, expression of the acyltransferase polypeptides can be induced by transferring the cells to fresh media containing 2% galactose, for example by inoculating 100 ml of fresh culture to an optical density (measure at 600 nm) of OD.sub.600=0.1. Cells are harvested after 24 h incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 1 ml disruption buffer (20 mM Tris/HCL pH 7.6, 10 mM MgCl.sub.2, 1 mM EDTA, 5% glycerol, 0.3 M (NH.sub.4).sub.2SO.sub.4) and disrupted using acid washed zirconium beads (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm. The supernatant and the beads are transferred to a fresh tube. Disruption buffer is added up to 20 ml and the tube is centrifuged at 8000?g for 5 min. The obtained supernatant is centrifuged for 2 hrs at 42000 rpm at 4? C. The pellet (microsomal fraction) is resuspended in a small volume of 0.1 M phosphate buffer pH 7.2. Protein content in the microsomal fraction is measured according to Bradford (Bradford, M. M. (1976), Anal. Biochem. Bd. 72, pp. 248-254) with bovine serum albumin as standard. The substrate selectivity can be determined by mixing equimolar amounts of different acyl-CoA:s in the same reaction and measure the preference for using the different acyl groups as substrates. The assay is run as in the specificity studies (Example 5) but scaled up 18 times to get sufficient amount of PA for detection. Up to 4 different acyl-CoA:s can be used in the assay in equimolar amount instead of one single acyl-CoA. Samples are incubated for 4 min at 30? C. The assays are terminated by extraction of the lipids into chloroform according to Bligh and Dyer (Bligh, E. G. and Dyer, W. J. (1959), Can. J. Biochem. Physiol. 37, pp. 911-917). Lipids are separated on thin layer chromatography (TLC) silica 60 plates (Merck) using chloroform/methanol/acetic acid/water (90:15:10:3), and autoradiographic pictures are taken using an instant imager (Packard). The phosphatidic acid (PA) is recovered from the plate and the fatty acids methylated in situ on the gel with sulphuric acid (2%) in methanol. Fatty acid methyl esters are extracted with hexane and separated by gas-liquid chromatography (GLC) using a WCOT fused silica 50 m?0.32 mm ID capillary column coated with CP-Wax 58-CB DF=0.3 (Chrompack inc., The Netherlands) and quantified relative to methyl-heptadecanoate added as an internal standard. The selectivity can be determined by calculating the amount of each acyl group that has been acylated to LPA.

Example 12: Determination of Substrate Selectivity for LPLAT

(39) For LPCAT and LPEAT activity assay, clones of the yeast mutant Y12431 harboring LPLAt genes can be grown at 28? C. in 10 ml selective media (SC-URA) with 2% raffinose as carbon source over night. The next day, expression of the acyltransferase polypeptides can be induced by transferring the cells to fresh media containing 2% galactose, for example by inoculating 100 ml of fresh culture to an optical density (measure at 600 nm) of OD.sub.600=0.1 Cells are harvested after 24 h incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 1 ml disruption buffer (20 mM Tris/HCL pH 7.6, 10 mM MgCl.sub.2, 1 mM EDTA, 5% glycerol, 0.3 M (NH.sub.4).sub.2SO.sub.4) and disrupted using acid washed zirconium beads (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm. The supernatant and the beads are transferred to a fresh tube. Disruption buffer is added up to 20 ml and the tube is centrifuged at 8000?g for 5 min. The obtained supernatant is centrifuged for 2 hrs at 42000 rpm at 4? C. The pellet (microsomal fraction) is resuspended in a small volume of 0.1 M phosphate buffer pH 7.2. Protein content in the microsomal fraction is measured according to Bradford (Bradford, M. M. (1976), Anal. Biochem. Bd. 72, pp. 248-254) with bovine serum albumin as standard. The substrate selectivity can be determined by mixing equimolar amounts of different acyl-CoA:s in the same reaction and measure the preference for using the different acyl groups as substrates. The assay is run as in the specificity studies (Example 6) but scaled up 18 times to get sufficient amount of PC or PE for detection. Up to 4 different acyl-CoA:s can be used in the assay in equimolar amount instead of one single acyl-CoA. Samples are incubated for 4 min at 30? C. The assays are terminated by extraction of the lipids into chloroform according to Bligh and Dyer (Bligh, E. G. and Dyer, W. J. (1959), Can. J. Biochem. Physiol. 37, pp. 911-917). Lipids are separated on thin layer chromatography (TLC) silica 60 plates (Merck) using chloroform/methanol/acetic acid/water (90:15:10:3), and autoradiographic pictures are taken using an instant imager (Packard). The PC or PE is recovered from the plate and the fatty acids methylated in situ on the gel with sulphuric acid (2%) in methanol. Fatty acid methyl esters are extracted with hexane and separated by gas-liquid chromatography (GLC) using a WCOT fused silica 50 m?0.32 mm ID capillary column coated with CP-Wax 58-CB DF=0.3 (Chrompack inc., The Netherlands) and quantified relative to methyl-heptadecanoate added as an internal standard. The selectivity can be determined by calculating the amount of each acyl group that has been acylated to LPC or LPE.

Example 13: Determination of Substrate Selectivity for DGAT

(40) For DGAT activity assay, clones of the yeast mutant H1246 harboring DGAT genes can be grown at 28? C. in 10 ml selective media (SC-URA) with 2% raffinose as carbon source over night. The next day, expression of the acyltransferase polypeptides can be induced by transferring the cells to fresh media containing 2% galactose, for example by inoculating 100 ml of fresh culture to an optical density (measure at 600 nm) of OD.sub.600=0.1. Cells are harvested after 24 h incubation at 28? C. by centrifugation at 3000?g for 5 min and resuspended in 1 ml disruption buffer (20 mM Tris/HCL pH 7.6, 10 mM MgCl.sub.2, 1 mM EDTA, 5% glycerol, 0.3 M (NH.sub.4).sub.2SO.sub.4) and disrupted using acid washed zirconium beads (200 ?m average diameter) in a mill (Retsch, Germany) by three minutes agitation at 300 rpm. The supernatant and the beads are transferred to a fresh tube. Disruption buffer is added up to 20 ml and the tube is centrifuged at 8000?g for 5 min. The obtained supernatant is centrifuged for 2 hrs at 42000 rpm at 4? C. The pellet (microsomal fraction) is resuspended in a small volume of 0.1 M phosphate buffer pH 7.2. Protein content in the microsomal fraction is measured according to Bradford (Bradford, M. M. (1976), Anal. Biochem. Bd. 72, pp. 248-254) with bovine serum albumin as standard. The substrate selectivity can be determined by mixing equimolar amounts of different acyl-CoA:s in the same reaction and measure the preference for using the different acyl groups as substrates. The assay is run as in the specificity studies (Example 7) but scaled up 18 times to get sufficient amount of TAG for detection. Up to 4 different acyl-CoA:s can be used in the assay in equimolar amount instead of one single acyl-CoA. Samples are incubated for 4 min at 30? C. The assays are terminated by extraction of the lipids into chloroform according to Bligh and Dyer (Bligh, E. G. and Dyer, W. J. (1959), Can. J. Biochem. Physiol. 37, pp. 911-917). Lipids are separated on thin layer chromatography (TLC) silica 60 plates (Merck) using chloroform/methanol/acetic acid/water (90:15:10:3), and autoradiographic pictures are taken using an instant imager (Packard). The TAG is recovered from the plate and the fatty acids methylated in situ on the gel with sulphuric acid (2%) in methanol. Fatty acid methyl esters are extracted with hexane and separated by gas-liquid chromatography (GLC) using a WCOT fused silica 50 m?0.32 mm ID capillary column coated with CP-Wax 58-CB DF=0.3 (Chrompack inc., The Netherlands) and quantified relative to methyl-heptadecanoate added as an internal standard. The selectivity can be determined by calculating the amount of each acyl group that has been acylated to TAG.