Use of oligonucleotides for the treatment and prevention of pain
11510938 · 2022-11-29
Assignee
- Consejo Nacional de Investigaciones Científicas y Técnicas (Buenos Aires, AR)
- Fundacion Pablo Cassara (Buenos Aires, AR)
- Universidad Austral (Buenos Aires, AR)
Inventors
- Alejandro Daniel Montaner (Ciudad Autonoma de Buenos Aires, AR)
- Marcelo Jose Villar (Buenos Aires, AR)
- Pablo Rodolfo Brumovsky (Buenos Aires, AR)
- Candelaria Leiguarda (Ramal Pilar, AR)
- Maria Florencia Coronel (Ciudad Autónoma de Buenos Aires, AR)
- Inelia Mailín Lara Casadei (Santa Fe, AR)
- Sandra Sbrascini (Ciudad Autónoma de Buenos Aires, AR)
Cpc classification
A61K31/713
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
Method for preventing or treating neuropathic and/or inflammatory pain, wherein said method comprises administering at least one effective dose of the phosphorothioate oligonucleotide IMT504. The preventive method may be applied to a mammal to be subjected to a medical or surgical intervention, or to a mammal that may be injured performing a risky task (for example, a soldier in a battle) to prevent development of pain after a medical intervention or injury.
Claims
1. A method for preventing post-surgical neuropathic and/or inflammatory pain, wherein the method comprises administering at least one effective dose of the phosphorothioate oligonucleotide IMT504 to a human prior to a surgical procedure, wherein the oligonucleotide IMT504 has the nucleotide sequence set forth in SEQ ID NO. 1.
2. The method according to claim 1, wherein; at least one dose from 6 mg/kg to 20 mg/kg is applied in a time period between 24 hours and 5 days prior to onset of surgery.
3. The method according to claim 1, comprising the administration of two doses of 6 mg/kg, 48 and 24 hours prior to the surgery.
4. The method according to claim 1, wherein the administration is selected from the group consisting of intravenous, intramuscular, subcutaneous, epidural, and intrathecal.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
DETAILED DESCRIPTION OF THE INVENTION
Definitions
(24) The terms preventive and pre-emptive are used interchangeably and refer to a previous treatment intended to reduce the pain that an individual will suffer at a later time.
(25) The acronym ET means preventive or early treatment.
(26) The acronym LT refers to a late treatment to be performed after occurrence of pain symptoms.
(27) The method comprises administering a parenteral dosage form containing the oligonucleotide with phosphorothioate bonds, IMT504, for example, but not limited to, the oligonucleotide having the sequence (SEQ ID No. 1) TCATCATTTGTCATTTTGTCATT, to a mammal that will be subjected to a medical intervention (e.g. surgical intervention) or that may be injured due to a risky task (e.g. a soldier in a battle) to avoid development of pain after the medical intervention or injury. The method also comprises administering a parenteral dosage form containing the phosphorothioate oligonucleotide IMT504 having the sequence of SEQ ID No. 1, to a mammal suffering ongoing pain to achieve a long-lasting therapeutic effect.
(28) The method may be used for different central nervous system (consists of the brain and spinal cord) and peripheral nervous system (consists of all other neural elements, including the peripheral nerves and the autonomic nerves) disorders, associated with neuropathic or inflammatory pain, such as: infections, meningitis, encephalitis, poliomyelitis, epidural abscess, and shingles.
(29) In another embodiment, the method may be used for degeneration and autoimmune disorders, such as Parkinson disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), motor neuron disease (MND), Huntington chorea, and Alzheimer disease.
(30) In another embodiment the method may be used for structural defects, such as brain or spinal cord injury, myelopathy, sciatica, Bell's palsy, cervical spondylosis, carpal tunnel syndrome, brain or spinal cord tumors, peripheral neuropathy and Guillain-Barré syndrome, vascular disorders, such as stroke, transient ischemic attack (AIT), subarachnoid hemorrhage, subdural hemorrhage and functional disorders, such as headache, epilepsy/seizures, dizziness, neuralgia and hematoma, and extradural hemorrhage, autism, bipolar disorder, catalepsy, depression and neurofibromatosis.
(31) The invention provides a method for preventing neuropathic and/or inflammatory pain or achieving a long-lasting therapeutic effect in a mammal suffering neuropathic and/or inflammatory pain. The method comprises administering a parenteral dosage form containing the phosphorothioate oligonucleotide IMT504, to a mammal that will be subjected to a medical intervention or that will perform a risky task that may result in inflammation and potential nerve injury, in order to avoid development of acute and/or chronic pain. A typical example are surgical interventions, undergoing both of acute pain during the first week after the intervention, as well as the potential development of chronic neuropathic pain over time, a condition affecting up to 60% of operated patients. In addition to this example, this method may be employed in other relevant situations, such as pain and injuries induced by trauma resulting from military tasks in combat or injury produced as a result of any other risky task. Finally, debilitating conditions such as irritable bowel syndrome and interstitial cystitis, typically associated to chronic inflammation, are also within the scope of the invention. In a preferred embodiment, the method is used for preventing pain.
(32) Some examples of medical conditions associated with neuropathic pain are: trigeminal neuralgia, alcoholism, amputation, cancer, chemotherapy, diabetes, facial nerve problems, HIV infection, multiple myeloma, multiple sclerosis, nerve or spinal cord compression, shingles, syphilis, atypical facial pain and thyroid problems. Many other medical conditions are also associated with neuropathic pain, such as a number of rare genetic disorders, and are within the scope of the invention.
(33) Some embodiments of the invention include a dosage form comprising IMT504 in an isotonic buffer (e.g. buffered saline) adequate for parenteral use. Other embodiments of the invention include a method for preventing neuropathic pain comprising administering a parenteral dosage form containing IMT504 to a mammal before a medical intervention (e.g. surgical intervention or to a person that will perform a task that may likely result in an injury (e.g. military task in combat), in order to suppress or alleviate post-intervention or post-trauma-derived acute and/or chronic pain. In this case, the dosage form should be administered between 24-72 hours before the medical intervention.
(34) Another embodiment of the invention includes a method for long-lasting suppression or relieving of pain comprising administration of a parenteral dosage form containing IMT504 to a mammal suffering chronic inflammatory and/or neuropathic pain.
(35) Another embodiment of the invention includes a pharmaceutical product comprising one or more units of a parenteral dosage form described herein, wherein each unit contains from 0.1 mg to 100 mg of IMT504. Preferably the dosage unit contains between 10 to 50 mg of IMT504. The treatment may consist of as many parenteral doses as needed injected on consecutive days or every other day as needed. Preferably, the treatment consists of five doses injected on successive days. Preferred parenteral routes are intramuscular (i.m.) or subcutaneous (s.c.).
(36) Preventive Treatment with IMT504 in Rats with Chronic Inflammation:
(37) An assay was conducted to address the preventive effect of IMT504 in rats with chronic inflammation, as described in Example 2. Briefly, two groups of four rats each were used. One group received a daily dose of 20 mg/kg IMT504 for five consecutive days and four weeks later received one additional dose of 6 mg/kg of IMT504. The second group only received the dose of 6 mg/kg of IMT504, and an additional single administration of 3 mg/kg of IMT504, 28 days after injury. Both groups received intra-plantar CFA, three days after the single dose of 6 mg/kg and their mechanical and thermal withdrawal thresholds were tested 1, 3, 7, 14, 21, 29, and 35 days after injury (
(38) In both groups, rats exhibited lack of mechanical allodynia during the first three days after CFA-induced inflammation. Mechanical withdrawal thresholds began a progressive decrease by day 7 after injury and onwards, reaching allodynic levels 14 days after injury. Twenty-one days after injury, all animals reached basal allodynic levels (
(39) Concerning responses to cold stimulation, rats receiving a daily dose of 20 mg/kg IMT504 for five consecutive days plus a single dose of 6 mg/kg IMT504 three days before CFA injection, exhibited a slow progression towards cold allodynia (reaching a peak 21 days after injury). Rats only receiving a single dose of 6 mg showed milder protection against cold allodynia, and also reaching a peak of cold allodynia 21 days after injury. Interestingly, both groups, even twenty days after injury, only showed 60% frequency of cold allodynia (
(40) An additional administration of 3 mg/kg of IMT504, 28 days after injury, resulted in complete reduction in mechanical and cold allodynia, as observed one day after re-administration (
(41) Finally, both groups of rats showed consistently elevated hind paw dorsoventral thicknesses throughout the entire tested period, starting one day after injury (
(42) IMT504 parenteral treatment provides long-lasting therapeutic effect in models of inflammatory and neuropathic pain.
(43) Effects of a Daily Dose of 20 mg/kg IMT504 for Five Consecutive Days in ET and LT Protocols on Mechanical Withdrawal Threshold.
(44) An assay was conducted to address the effect of IMT504 at a concentration of 20 mg/kg (a daily injection for five consecutive days) on hind paw mechanical withdrawal thresholds.
(45) All CFA rats, regardless of their treatment, exhibited a clear reduction in ipsilateral mechanical withdrawal thresholds, reaching allodynic levels, as early as one day after injury (
(46) In contrast, CFA rats on the ET protocol exhibited a progressive increasing in withdrawal thresholds, starting on the third day after initiation of the treatment, reaching basal thresholds seven days after injury and onwards. On the other hand, CFA rats on the LT protocol showed recovery of basal mechanical withdrawal thresholds starting one week after treatment (two weeks after injury), and remaining normal from there on. Thus, significant differences were observed between untreated and IMT504-treated CFA animals, starting seven days after administration of the ODN (p<0.001) (
(47) Finally, in naïve rats (
(48) Effects of a Daily Dose of 20 mg/kg of IMT504 for Five Consecutive Days in Naïve Rats on Hind Paw Mechanical Withdrawal Threshold and Tail Heat Nociception:
(49) Naïve rats receiving a daily dose of 20 mg/kg IMT504 for five consecutive days did not show any evident changes in hind paw mechanical withdrawal or tail thermal withdrawal latencies, remaining always comparable to saline-treated naïve rats (
(50) Effects of Different Concentrations of IMT504 on Mechanical Withdrawal Threshold in LT Protocols Using a Daily Injection for Three or Five Consecutive Days:
(51) Assays focused on the LT protocol were carried out, exploring different IMT504 doses and number of injections on mechanical withdrawal thresholds in CFA rats. As observed during the test, all animals undergoing plantar CFA injection exhibited a dramatic decrease in withdrawal thresholds, showing mechanical allodynia already twelve hours after injury (
(52) On the other hand, CFA rats on LT protocols exhibited a progressive recovery towards basal mechanical withdrawal thresholds starting at day 10 after injury (p<0.001); the effect seemed to be dose-dependent. Thus, rats treated with three early doses or five early doses of 2 mg/kg IMT504 showed a faster recovery of basal withdrawal thresholds, reaching basal levels between 10 and 12 days after injury and maintaining such a condition throughout the entire assay (seven weeks). On the other hand, CFA rats a daily dose of 0.2 mg/kg IMT504 for five consecutive days also showed an increase in mechanical withdrawal threshold, albeit not reaching the basal level. Moreover, these rats showed no significant differences with the vehicle-treated CFA rats (p>0.05) towards the end of the assay (
(53) Comparisons between treatments showed differences between groups receiving a daily dose of 0.2 mg/kg of IMT504 for five consecutive days, and a daily dose of 2 mg/kg of IMT504 for three or five consecutive days, starting 10 days after injury and persisting throughout the assay (p<0.05) (
(54) Finally, and as observed during a previous assay, in naïve rats (
(55) Effects of a Single Dose of 6 mg/kg IMT504 in a LT Protocol, on Mechanical and Thermal Withdrawal Thresholds in Rats with SNI:
(56) All animals subjected to SNI developed quick and long-lasting mechanical (
(57) In the same manner, recovery from cold allodynia, as measured by the frequency of paw withdrawal (
(58)
(59)
(60)
(61) Effects of Two Preventive Doses of IMT504 (6 mg/kg; 48 and 24 hs Before Injury) on Mechanical Withdrawal Threshold and Cold Allodynia, in Rats with Post-Incisional Pain:
(62) An assay was conducted to address the effect of IMT504 at a concentration of 6 mg/kg (two injections, one at 48 h and a second at 24 h before injury) on hind paw mechanical withdrawal thresholds. All rats subjected to an incision of hind paw skin and that received vehicle 48 and 24 h before injury showed a clear reduction in ipsilateral mechanical withdrawal thresholds, reaching allodynic levels as soon as 6 h after injury (
(63) An analysis of cold allodynia showed that rats with post-incisional pain receiving preventive vehicle developed a transient cold allodynia, with one peak 3 days after injury (
(64) Finally, both mechanical withdrawal thresholds as well as responses to cold stimuli in contralateral hind paws of rats treated with IMT504 or treated with vehicle remained normal during these assays (data not shown).
(65) Parenteral preventive treatment with IMT504 transiently prevents chronic inflammatory pain without altering the inflammatory state of the affected hind paw.
(66) Effects of a Preventive Dose (6 mg/kg) and an Additional Booster Dose (2-3 Mg/Kg; 21 or 28 Days after Injury) of IMT504 on Mechanical Withdrawal Threshold and Cold Allodynia, in Rats with Chronic Inflammation
(67) An assay was conducted to address the preventive effect of IMT504 in rats with chronic inflammation. Two groups of four rats each were used. One group received a single dose of 6 mg/kg of IMT504 3 days before injury, with an additional booster dose of 3 mg/kg on day 28 after injury (
(68) When compared to injured untreated or vehicle-treated rats, both groups receiving preventive treatment with IMT504 showed lack of mechanical allodynia until 3 (
(69) Concerning responses to cold stimulation, rats receiving a single preventive dose of 6 mg/kg of IMT504, showed a slower progression towards cold allodynia which was significantly lower than that observed in injured vehicle-treated rats on days 1 and 3 after injury. Although differences were not statistically significant from day 7 on, rats treated with IMT504 always showed lower levels of cold allodynia than vehicle-treated rats (
(70) Finally, both mechanical withdrawal thresholds as well as responses to cold stimuli in contralateral hind paws of all experimental animals remained normal during these assays (data not shown).
(71) Effects of a Preventive Dose (6 mg/kg) of IMT504 on Dorsoventral Paw Thickness in Rats with Chronic Inflammation:
(72) Injured rats receiving or not IMT504 showed consistently elevated hind paw dorsoventral thicknesses throughout the entire testing period, starting 1 day after injury (
(73) Effects of Different Single Doses of IMT504 on Pain-Like Behavior in Rats with Hind Paw Inflammation.
(74) While naïve rats (n=5) virtually always exhibited basal withdrawal thresholds, all injured animal showed ipsilateral mechanical allodynia already 12 hours (h) after intraplantar CFA (a withdrawal threshold of less than 6 is considered as allodynia). Vehicle-treated CFA rats (n=4) remained allodynic throughout the whole tested period. In contrast, rats receiving a single dose of 6 mg/kg (n=9) or 10 mg/kg (n=9) of IMT504 were allodynic only during the first week after injury, before administration of IMT504, and began recovery 1 day after initiation of the treatment, reaching basal ipsilateral withdrawal thresholds 2-3 days later and onwards. Rats receiving a single dose of 2 mg/kg of IMT504 (n=9) showed a slower, but finally complete, recovery of basal withdrawal thresholds, from days 21 after injury and onwards. Statistically significant differences are shown between naïve and IMT504-treated rats (#) and CFA injured rats untreated and IMT504-treated (*) (see
(75) Effects of Treatment with a Single Dose of 6 mg/kg of IMT504 on Mechanical Thresholds in Rats in the Neuropathic Pain Model, Avoiding Nerve Injury.
(76) Statistical analysis shows differences between contralateral hind paw withdrawal thresholds (unified in one single curve due to lack of differences between groups) and ipsilateral thresholds using numeral markers (#; black, contralateral vs. untreated SNI; red, contralateral vs. ipsilateral IMT504-treated) (a withdrawal threshold of less than 6 is considered as allodynia). Asterisks (*) show differences between ipsilateral hind paw withdrawal thresholds in SNI-untreated rats and the ipsilateral withdrawal thresholds in rats receiving IMT504 (see
(77) This invention is better illustrated in the following examples, which should not be construed as a limitation of its scope. On the contrary, it should be clearly understood that, after reading the present description other embodiments, modifications and equivalents may be possible, and envisioned by a person of skill in the art without departing from the spirit of the present invention and/or the scope of the appended claims.
EXAMPLES
Example 1
(78) Experimental Animals:
(79) Adult Sprague-Dawley male rats (200-300 g, BioFucal, Argentina) were kept in a twelve h light-cycle, with water and food ad libitum. All experiments performed were approved by the Institutional Animal Care and Use Committee (IACUC-IIMT; #17-02 and #17-04) of the IIMT, and were carried out according to the policy of the Society for Neuroscience and the International Association for the Study of Pain for use of animals in pain research.
(80) Hind Paw Inflammation Model
(81) In fifty-two rats anesthetized with Isoflurane (5% induction, 2.5% maintenance, 0.8 L/min O2 flow rate; Piramal Healthcare, UK), the right hind paw was injected intra-dermally with 100 μl of CFA (1:1, dissolved in normal saline; Sigma-Aldrich, Mo., USA), using a 1 ml syringe with a 25G needle attached. The animals (from now on, called CFA rats) were left to recover from anesthesia in a warm and quiet environment before relocating them in their corresponding cages.
(82) Spared Nerve Injury Model (SNI)
(83) In twenty-six rats anesthetized with Isoflurane (5% induction, 2.5% maintenance, 0.8 L/min 02 flow rate; Piramal Healthcare, UK), the right sciatic nerve and its three distal branches were exposed by blunt dissection, and the tibial and common peronneal branches completely sectioned and ligated to prevent regeneration. The third branch, the sural nerve, was left intact. The animals received one single injection of ketoprofen for post-surgical pain control and were left to recover from anesthesia in a warm and quiet environment before relocating them in their corresponding cages.
(84) Experimental Drug
(85) In all experiments, the ODN IMT504, with sequence 5′-TCATCATTTTGTCATTTTGTCATT-3′) was used. The HPLC-grade phosphorothioate ODN (Oligos Etc. Inc., Integrated DNA Technologies, OR, USA) was suspended in sterile saline (0.9% NaCl; 20 mg/ml; storage concentration), and assayed for LPS contamination. For some experimental protocols the ODN was dissolved in saline solution to working concentrations (2 mg/ml (rats treated with 2 mg/kg)) or 0.2 mg/ml (rats treated with 0.2 mg/kg)), and administered at a final volume of 200-250 μl, depending on the animal weight.
Example 2: Treatment 1
(86) Treatment Protocols Using IMT504 in Rats with Hind Paw Inflammation
(87) In one set of experiments, called “preventive treatment”, four rats received a daily dose of 20 mg/kg IMT504 for five consecutive days and four weeks later one dose of 6 mg/kg (group a); a second group of four rats received one dose of 6 mg/kg of IMT504 (group b) (
(88) In a second set of experiments, groups of rats were allocated to early or late treatment protocols (ET and LT, respectively), using a daily dose of 20 mg/kg IMT504 for five consecutive days (
(89) In a third set of experiments, different concentrations and dosages of IMT504 were administered subcutaneously using the LT protocol (
(90) Treatment Protocols Using IMT504 in Rats with SNI
(91) Rats were administered subcutaneously using the LT protocol (
(92) Control Groups
(93) Naïve (uninjured and untreated; n=16), CFA injured untreated (n=10), and vehicle-treated CFA (n=9) or SNI rats (n=10) were used as controls. Eight naïve rats remained untreated, four were vehicle-treated, and four received a daily dose of 20 mg/kg IMT504 for five consecutive days. Untreated CFA rats received an intradermal hind paw injection of CFA and no further treatment. Vehicle-treated CFA rats received five daily subcutaneous injections of saline (200 μl), starting seven days after injury. Vehicle-treated SNI rats received one single dose of saline (200 ul), starting seven days after injury.
(94) Behavioral Assessment
(95) Behavioral assessment was performed during daytime in all animals before any intervention (basal responses) and at different time-points after injury and IMT504 or vehicle administration.
(96) For mechanical allodynia assessment, a set of von Frey filaments (Stoelting, Ill., USA) and the modified up-down method of Dixon were used, as described by Chaplan et al. (Chaplan S R, et, al., (1994) J. Neurosci Methods 53: 55-632) to establish the 50% withdrawal threshold. A withdrawal threshold of 6 g or less was considered an allodynic response.
(97) For acute thermal nociception assessment, the tail immersion test was used. The latency of tail-flick reflex to swift immersion of the last 3 cm of the tip of the tail of each rat on a hot bath (52° C.) was measured using a stopwatch (resolution of 0.01 s). This was repeated three times, with 10 s intervals, and an average response was obtained.
(98) For cold allodynia assessment, the reaction to the application of a drop of acetone onto the plantar surface of the hind paw was used. Both frequency of withdrawal and cold score (pain-like behavior intensity) were measured.
(99) Statistical Analysis
(100) All data was expressed as mean±S.E.M and evaluated using GraphPad Prism 7.0a (all data underwent standard normality analysis). Behavioral data was statistically analyzed using two-way repeated measures analysis of variance (two-way ANOVA), followed by the Bonferroni post-hoc test. P values are presented as follows: ns, p>0.05; *0.05>p>0.01; **0.01>p>0.001, ***p<0.001 and ****p<0.0001.
Example 3: Treatment 2
(101) Post-Incisional Pain Model
(102) In twenty-four rats anesthetized with Isoflurane (5% induction, 2.5% maintenance, 0.8 L/min 02 flow rate; Scott-Cassará, Argentina), the right hind paw plantar skin was cleaned and disinfected. This was followed by a 1-cm longitudinal incision distal to heel and extending towards the toes, as previously described (Xu J, et al., 2011, 24(5): 508-514). The incision involved both plantar skin and fascia. This was followed by identification and longitudinal incision of plantar extensor muscle, leaving its insertions intact. After achieving homeostdsica, skin was sutured using a 5-0 nylon suture, protected with an antibacterial cream and the animal was returned to its retention cage, under observation, until full recovery from anesthesia.
(103) Hind Paw Inflammation Model
(104) In seventeen rats anesthetized with Isoflurane (5% induction, 2.5% maintenance, 0.8 L/min 02 flow rate; Scott-Cassará, Argentina), the right hind paw was injected intra-dermally with 100 μl of CFA (1:1, dissolved in normal saline; Sigma-Aldrich, Mo., USA), using a 1 ml syringe with a 25G needle. The animals (called CFA rats) were left to recover from anesthesia in a warm and quiet environment before relocating in their corresponding cages.
(105) Treatment Protocols with IMT504 in Rats with Post-Incisional Pain
(106) Rats were subcutaneously administered 6 mg/kg of IMT504, 48 and 24 h before implementing the post-incisional pain model. This was followed by pain-like behavior testing for up to 21 days after injury.
(107) Treatment Protocols Using IMT504 in Rats with Hind Paw Inflammation
(108) Eight rats received a dose of 6 mg/kg IMT504 (
(109) Control Groups
(110) Naïve rats (non-injured and untreated; n=4), untreated CFA-injured rats (n=5) and vehicle-treated CFA rats (n=4) were used as controls. Untreated CFA rats received an intradermal hind paw injection of CFA and no further treatment. Vehicle-treated CFA rats received a subcutaneous injection of saline solution (200 μl).
(111) Behavioral Assessment
(112) Behavioral assessment was performed during daytime in all animals before any intervention (basal responses) and at different time-points after injury and IMT504 or vehicle administration.
(113) For mechanical allodynia assessment, a set of von Frey filaments (Stoelting, Ill., USA) and the modified up-down method of Dixon were used, to establish the 50% withdrawal threshold. A withdrawal threshold of 0.21 oz or less was considered an allodynic response.
(114) For cold allodynia assessment, the reaction to the application of a drop of acetone onto the plantar surface of the hind paw was used, as previously described. Frequency of withdrawal to cold stimuli was measured.