Double-stranded oligo RNA targeted to amphiregulin and pharmaceutical composition comprising same for preventing or treating fibrosis or respiratory diseases

10208309 ยท 2019-02-19

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a novel siRNA, and a high-efficiency double-stranded oligo RNA structure containing the same, and a nanoparticle containing the high-efficiency double-stranded oligo RNA structure. The double-stranded oligo RNA structure has a structure in which a hydrophilic material and a hydrophobic material are conjugated to both ends of a double-stranded oligo RNA (siRNA) via a simple covalent bond or linker-mediated covalent bond in order to be efficiently delivered into cells, and may be converted into a nanoparticle form in an aqueous solution by hydrophobic interactions of double-stranded oligo RNA structures. It is preferable that the siRNA contained in the double-stranded oligo RNA structure is an siRNA specific for fibrosis or respiratory disease-related gene, particularly, amphiregulin or stratifin. In addition, the present invention relates to a pharmaceutical composition for preventing or treating fibrosis or respiratory diseases, containing an siRNA, a high-efficiency double-stranded oligo RNA structure containing the siRNA, or a nanoparticle containing the high-efficiency double-stranded oligo RNA structure, as an active ingredient. In addition, the present invention relates to a method of preventing or treating fibrosis or respiratory diseases, including administering the pharmaceutical composition for preventing or treating fibrosis or respiratory diseases to a subject in need thereof.

Claims

1. An siRNA comprising a sense strand comprising a sequence of SEQ ID NO: 59, 75, 80, 92, 98, 102, or 107, wherein when the sense strand comprises the sequence of SEQ ID NO: 107, the sense strand contains no more than 19 nucleotides; and an antisense strand having a sequence complementary thereto.

2. The siRNA of claim 1, wherein SEQ ID NO: 107 is the sense strand.

3. The siRNA of claim 1, wherein the siRNA comprises a sense strand comprising a sequence of SEQ ID NO: 59, 75, 80, 92, 98, or 102, and an antisense strand comprising a sequence complementary thereto.

4. The siRNA of claim 1, wherein the sense strand or antisense strand of the siRNA comprise chemical modification wherein the chemical modification is any one or more selected from the group consisting of modification by substitution of a hydroxyl (OH) group at the 2 carbon position in a sugar structure in nucleotides with only one selected from the group consisting of methyl (CH.sub.3), methoxy (OCH.sub.3), amine (NH.sub.2), fluorine (F), O-2-methoxyethyl, O-propyl, O-2-methylthioethyl, O-3-aminopropyl, O-3-dimethylaminopropyl, ON-methylacetamido and O-dimethylamidooxyethyl groups; modification by substitution of oxygen in a sugar structure in nucleotides with sulfur; modification of a nucleotide bond into any one selected from the group consisting of a phosphorothioate bond, a boranophosphate bond, or a methyl phosphonate bond; and modification into a peptide nucleic acid (PNA) type, a locked nucleic acid (LNA) type, or a unlocked nucleic acid (UNA) type.

5. The siRNA of claim 1, wherein one or more phosphate groups are bound to a 5-end of the antisense strand of the siRNA.

6. A double-stranded oligo RNA structure comprising a structure represented by the following Structural Formula 1:
A-X-R-Y-B[Structural Formula 1] wherein A is a hydrophilic material, B is a hydrophobic material, X and Y are each independently a simple covalent bond or linker-mediated covalent bond, and R is the siRNA of claim 1.

7. The double-stranded oligo RNA structure of claim 6, wherein the structure comprises a structure represented by the following Structural Formula 2: ##STR00007## wherein S and AS are a sense strand and an antisense strand of the siRNA of claim 6, respectively, and A, B, X, and Y have the same definitions as those in claim 6.

8. The double-stranded oligo RNA structure of claim 7, wherein the structure comprises a structure represented by the following Structural Formula 3: ##STR00008## wherein A, B, X, Y, S, and AS have the same definitions as those in claims 6, and 5 and 3 are a 5-end and 3-end of the sense strand of the siRNA, respectively.

9. The double-stranded oligo RNA structure of claim 6, wherein the hydrophilic material is represented by the following Structural Formula 4:
(A.sub.m-J).sub.n[Structural Formula 4] wherein A is a hydrophilic material monomer, J is a linker linking m hydrophilic material monomers to each other or linking m hydrophilic material monomers and the siRNA to each other, m is an integer of 1 to 15, n is an integer of 1 to 10, wherein A is a compound selected from Compounds (1) to (3) represented as follows: ##STR00009## wherein G is selected for the group consisting of CH.sub.2, O, S and NH, ##STR00010## and wherein J is selected from the group consisting of PO.sub.3, SO.sub.3, and CO.sub.2.

10. The double-stranded oligo RNA structure of claim 6, wherein a molecular weight of the hydrophilic material is 200 to 10,000.

11. The double-stranded oligo RNA structure of claim 6, wherein the hydrophilic material is polyethylene glycol (PEG), polyvinylpyrrolidone, or polyoxazoline.

12. The double-stranded oligo RNA structure of claim 6, wherein a molecular weight of the hydrophobic material is 250 to 1,000.

13. The double-stranded oligo RNA structure of claim 6, wherein the hydrophobic material is a steroid derivative, a glyceride derivative, glycerol ether, polypropylene glycol, an unsaturated or saturated (C12-C50) hydrocarbon, diacylphosphatidylcholine, fatty acid, phospholipid, lipopolyamine, lipid, tocopherol, or tocotrienol.

14. The double-stranded oligo RNA structure of claim 13, wherein the steroid derivative is cholesterol, cholestanol, cholic acid, cholesteryl formate, chotestanyl formate, or cholestanyl amine.

15. The double-stranded oligo RNA structure of claim 13, wherein the glyceride derivative is a mono-, di- or tri-glyceride.

16. The double-stranded oligo RNA structure of claim 6, wherein each of the covalent bonds represented by X and Y is a non-degradable bond or degradable bond.

17. The double-stranded oligo RNA structure of claim 16, wherein the non-degradable bond is an amide bond or phosphorylation bond.

18. The double-stranded oligo RNA structure of claim 16, wherein the degradable bond is a disulfide bond, an acid degradable bond, an ester bond, an anhydride bond, a biodegradable bond or an enzymatically degradable bond.

19. A nanoparticle comprising the double-stranded oligo RNA structure of claim 6.

20. The nanoparticle of claim 19, wherein the nanoparticle comprises a mixture of double-stranded oligo RNA structures comprising siRNAs having different sequences from each other.

21. A pharmaceutical composition for preventing or treating fibrosis or respiratory diseases comprising the siRNA of claim 1 as an active ingredient.

22. A lyophilized formulation comprising the pharmaceutical composition of claim 21.

23. A pharmaceutical composition for preventing or treating fibrosis or respiratory diseases comprising the double-stranded oligo RNA structure of claim 6.

24. A lyophilized formulation comprising the pharmaceutical composition of claim 23.

25. A pharmaceutical composition for preventing or treating fibrosis or respiratory diseases comprising the nanoparticle of claim 19.

26. A lyophilized formulation comprising the pharmaceutical composition of claim 25.

27. A method of preventing or treating fibrosis or respiratory diseases, comprising administering a pharmaceutical composition comprising the siRNA of claim 1, a double-stranded oligo RNA structure comprising said siRNA, or a nanoparticle comprising said double-stranded oligo RNA structure.

28. The method of claim 27, wherein the respiratory disease is COPD, asthma, acute or chronic bronchitis, allergic rhinitis, cough and phlegm, bronchitis, bronchiolitis, pharyngitis, tonsillitis, or laryngitis.

29. The method of claim 27, wherein the fibrosis comprises IPF, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, or pulmonary fibrosis.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 is a mimetic view of a nanoparticle containing a double-stranded oligo RNA structure according to the present invention.

(2) FIG. 2, which illustrates results obtained by quantitatively analyzing expression amounts of amphiregulin mRNA in Example 4, is a graph illustrating relative expression amounts (%) of amphiregulin mRNA confirmed after transforming mouse fibroblast cell lines with 30 kinds of mice amphiregulin-specific siRNAs having the sequences of SEQ ID NOS: 1 to 30 according to the present invention as sense strands, respectively, at a concentration of 20 nM. NC indicates an expression amount of amphiregulin mRNA in a total RNA obtained in a cell line (control group) which was not treated with the mouse amphiregulin-specific siRNA, and relative expression amounts of the amphiregulin mRNA depending on the respective siRNAs measured based on the NC (100%) are illustrated in FIG. 2.

(3) FIG. 3, which illustrates results obtained by quantitatively analyzing expression amounts of amphiregulin mRNA in Example 6, is a graph illustrating relative expression amounts (%) of amphiregulin mRNA confirmed after transforming mouse fibroblast cell lines with siRNAs having the sequences of SEQ ID NOS: 8, 9, and 28 according to the present invention as sense strands, respectively, at different concentrations of the siRNAs (0.2, 1, and 5 nM).

(4) FIG. 4, which illustrates results obtained by quantitatively analyzing expression amounts of amphiregulin mRNA in Example 7, is a graph illustrating relative expression amounts (%) of amphiregulin mRNA confirmed after transforming human lung tumor cell lines with 100 kinds of human amphiregulin-specific siRNAs having the sequences of SEQ ID NOS: 31 to 130 according to the present invention as sense strands, respectively, at a concentration of 1 nM.

(5) FIG. 5, which illustrates results obtained by quantitatively analyzing expression amounts of stratifin mRNA in Example 7, is a graph illustrating relative expression amounts (%) of stratifin mRNA confirmed after transforming human lung tumor cell lines with 100 kinds of human stratifin-specific siRNAs having the sequences of SEQ ID NOS: 231 to 330 according to the present invention as sense strands, respectively, at a concentration of 1 nM.

(6) FIG. 6, which illustrates results obtained by quantitatively analyzing expression amounts of amphiregulin mRNA in Example 8, is a graph illustrating relative expression amounts (%) of amphiregulin mRNA in transformed cell lines after transforming lung cancer cell lines with 26 kinds of human amphiregulin-specific siRNAs having the sequences of SEQ ID NOS: 40, 42, 43, 45, 46, 52, 53, 58, 59, 61, 63, 65, 69, 75, 79, 80, 81, 91, 92, 94, 98, 102, 115, 117, 120, and 128 according to the present invention as sense strands, respectively, at a concentration of 0.2 nM.

(7) FIG. 7, which illustrates results obtained by quantitatively analyzing expression amounts of stratifin mRNA in Example 8, is a graph illustrating relative expression amounts (%) of stratifin mRNA in transformed cell lines after transforming lung cancer cell lines with 47 kinds of human stratifin-specific siRNAs having the sequences of SEQ ID NOS: 231, 234, 238, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 257, 258, 260, 261, 262, 263, 267, 268, 270, 272, 273, 275, 278, 283, 284, 290, 297, 299, 300, 302, 303, 307, 311, 314, 320, 324, 326, 327, and 328 according to the present invention as sense strands, respectively, at a concentration of 0.2 nM.

(8) FIG. 8, which illustrates results obtained by quantitatively analyzing expression amounts of amphiregulin mRNA in Example 9, is a graph illustrating relative expression amounts (%) of amphiregulin mRNA in transformed cell lines after transforming human lung cancer cell lines with 3 kinds of human amphiregulin-specific SAMiRNA having the sequences of SEQ ID NOS: 79, 80, and 91 according to the present invention as the sense strands, respectively, at different concentrations of 100, 200, and 500 nM.

(9) FIG. 9, which illustrates results obtained by quantitatively analyzing expression amounts of stratifin RNA in Example 9, is a graph illustrating relative expression amounts (%) of stratifin mRNA in transformed cell lines after transforming human lung cancer cell lines with 5 kinds of human stratifin-specific SAMiRNA having the sequences of SEQ ID NOS: 248, 257, 268, 290, and 327 as the sense strands, respectively, at different concentrations of 50, 100, and 200 nM.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(10) Unless otherwise defined herein, all of the technical and scientific terms used in the present specification have the same meanings as those generally understood by specialists in the skilled art to which the present invention pertains. Generally, nomenclature used in the present specification is well known and commonly used in the art.

(11) In order to achieve the above-mentioned object, the present invention provides an siRNA comprising a sense strand having any one sequence selected from the group consisting of SEQ ID NOS: 1 to 330 and an antisense strand having a sequence complementary thereto.

(12) In addition, the present invention provides a double-stranded oligo RNA structure comprising a structure represented by the following Structural Formula 1, wherein in the following Structural Formula 1, A is a hydrophilic material, B is a hydrophobic material, X and Y are each independently a simple covalent bond or linker-mediated covalent bond, and R is an siRNA.
A-X-R-Y-B[Structural Formula 1]

(13) Further, the present invention provides a nanoparticle comprising the double-stranded oligo RNA structure.

(14) In addition, the present invention provides a pharmaceutical composition for preventing or treating fibrosis or respiratory diseases, comprising the siRNA, the double-stranded oligo RNA structure, or the nanoparticle.

(15) Further, the present invention provides a method of preventing or treating fibrosis or respiratory diseases, comprising a step of administering the pharmaceutical composition for preventing or treating fibrosis or respiratory diseases to a subject in need thereof.

(16) In the present invention, a novel amphiregulin- or stratifin-specific siRNA was prepared. As a result, it was confirmed that since the novel amphiregulin- or stratifin-specific siRNA has a base sequence designed so as to complementarily bind to an mRNA encoding amphiregulin or stratifin, the novel amphiregulin- or stratifin-specific siRNA may effectively inhibit expression of amphiregulin or stratifin.

(17) In one aspect, the present invention relates to an siRNA comprising a sense strand (first oligonucleotide) having any one sequence selected from the group consisting of SEQ ID NOS: 1 to 330 and an antisense strand (second oligonucleotide) having a sequence complementary thereto.

(18) TABLE-US-00001 (SEQIDNO:1) 5-ggaguaugauaaugaacca-3, (SEQIDNO:2) 5-caguaguagcugucacuau-3, (SEQIDNO:3) 5-agacucacagcgaggauga-3, (SEQIDNO:4) 5-cacaaauauccggcuauau-3, (SEQIDNO:5) 5-caccauaagcgaaaugccu-3, (SEQIDNO:6) 5-gauuacuuuggugaacggu-3, (SEQIDNO:7) 5-caguugucacuuuuuauga-3, (SEQIDNO:8) 5-ggaccuauccaagauugca-3, (SEQIDNO:9) 5-cguuaucacagugcaccuu-3, (SEQIDNO:10) 5-ccuagcugaggacaaugca-3, (SEQIDNO:11) 5-ggaagagagguuuccacca-3, (SEQIDNO:12) 5-cucagaggaguaugauaau-3, (SEQIDNO:13) 5-cgguggacuugagcuuucu-3, (SEQIDNO:14) 5-gguggugacaugcaauugu-3, (SEQIDNO:15) 5-cagggaauaugaaggagaa-3, (SEQIDNO:16) 5-ggaggcuucgacaagaaaa-3, (SEQIDNO:17) 5-ccgguggaaccaaugagaa-3, (SEQIDNO:18) 5-ccggcuauauuauagauga-3, (SEQIDNO:19) 5-agaauccaugcacugccaa-3, (SEQIDNO:20) 5-caaggaccuauccaagauu-3, (SEQIDNO:21) 5-caaauauccggcuauauua-3, (SEQIDNO:22) 5-gggacuacgacuacucaga-3, (SEQIDNO:23) 5-gcgaaugcagauacaucga-3, (SEQIDNO:24) 5-gccacaccggaaaugacau-3, (SEQIDNO:25) 5-agaguugaacaggugauua-3, (SEQIDNO:26) 5-gaaccacaaauauccggcu-3, (SEQIDNO:27) 5-cauaagcgaaaugccuucu-3, (SEQIDNO:28) 5-guuuccaccauaagcgaaa-3, (SEQIDNO:29) 5-caggugauuaagcccaaga-3, (SEQIDNO:30) 5-ccacaccggaaaugacauu-3, (SEQIDNO:31) 5-gagtgaaatgccttctagt-3, (SEQIDNO:32) 5-cagagttgaacaggtagtt-3, (SEQIDNO:33) 5-ctggattggacctcaatga-3, (SEQIDNO:34) 5-gaaaactcacagcatgatt-3, (SEQIDNO:35) 5-gaaacttcgacaagagaat-3, (SEQIDNO:36) 5-caggaaatatgaaggagaa-3, (SEQIDNO:37) 5-gcaaatatatagagcacct-3, (SEQIDNO:38) 5-ggtgctgtcgctcttgata-3, (SEQIDNO:39) 5-tcagagttgaacaggtagt-3, (SEQIDNO:40) 5-gaaagaaacttcgacaaga-3, (SEQIDNO:41) 5-gacaatacgtcaggaaata-3, (SEQIDNO:42) 5-caggatatcacattggagt-3, (SEQIDNO:43) 5-ctctttccagtggatcata-3, (SEQIDNO:44) 5-cggctcaggccattatgct-3, (SEQIDNO:45) 5-ggaccacagtgctgatgga-3, (SEQIDNO:46) 5-gctgctggattggacctca-3, (SEQIDNO:47) 5-gttattacagtccagctta-3, (SEQIDNO:48) 5-tggacctcaatgacaccta-3, (SEQIDNO:49) 5-ctggctatattgtcgatga-3, (SEQIDNO:50) 5-gacggaaagtgaaaatact-3, (SEQIDNO:51) 5-gtatgataacgaaccacaa-3, (SEQIDNO:52) 5-acattggagtcactgccaa-3, (SEQIDNO:53) 5-ccaagtcatagccataaat-3, (SEQIDNO:54) 5-agtgaaatgccttctagta-3, (SEQIDNO:55) 5-gataacgaaccacaaatac-3, (SEQIDNO:56) 5-tgcattagcagccatagct-3, (SEQIDNO:57) 5-gcattcacggagaatgcaa-3, (SEQIDNO:58) 5-ggagtcactgccaagtcat-3, (SEQIDNO:59) 5-aggtgcacgaaggtaaaaa-3, (SEQIDNO:60) 5-cagcatgattgacagtagt-3, (SEQIDNO:61) 5-cttagaagacaatacgtca-3, (SEQIDNO:62) 5-agagttgaacaggtagtta-3, (SEQIDNO:63) 5-tgatgagtcggtcctcttt-3, (SEQIDNO:64) 5-atatatagagcacctggaa-3, (SEQIDNO:65) 5-gagttgaacaggtagttaa-3, (SEQIDNO:66) 5-cattcacggagaatgcaaa-3, (SEQIDNO:67) 5-ggaccctttttgttatgat-3, (SEQIDNO:68) 5-cagaagagtatgataacga-3, (SEQIDNO:69) 5-ccagtggatcataagacaa-3, (SEQIDNO:70) 5-gctgttattacagtccagc-3, (SEQIDNO:71) 5-gggaagcgtgaaccatttt-3, (SEQIDNO:72) 5-cacagtgctgatggatttg-3, (SEQIDNO:73) 5-agtcagagttgaacaggta-3, (SEQIDNO:74) 5-tggaagcagtaacatgcaa-3, (SEQIDNO:75) 5-cacgaaggtaaaaagtatt-3, (SEQIDNO:76) 5-agaagagtatgataacgaa-3, (SEQIDNO:77) 5-gaagcgtgaaccattttct-3, (SEQIDNO:78) 5-ggctatattgtcgatgatt-3, (SEQIDNO:79) 5-gagtcactgccaagtcata-3, (SEQIDNO:80) 5-caatggaccctttttgtta-3, (SEQIDNO:81) 5-gcacgaaggtaaaaagtat-3, (SEQIDNO:82) 5-tgaaatgccttctagtagt-3, (SEQIDNO:83) 5-tggatcataagacaatgga-3, (SEQIDNO:84) 5-gtgagtgaaatgccttcta-3, (SEQIDNO:85) 5-gacctcaatgacacctact-3, (SEQIDNO:86) 5-cctcaatgacacctactct-3, (SEQIDNO:87) 5-gctgatggatttgaggtta-3, (SEQIDNO:88) 5-ggaagcagtaacatgcaaa-3, (SEQIDNO:89) 5-cagtaacatgcaaatgtca-3, (SEQIDNO:90) 5-gctatagcataactgaaga-3, (SEQIDNO:91) 5-ggatatcacattggagtca-3, (SEQIDNO:92) 5-ccctttttgttatgatggt-3, (SEQIDNO:93) 5-gtatataaaggtgcacgaa-3, (SEQIDNO:94) 5-ggacctcaatgacacctac-3, (SEQIDNO:95) 5-gctcttgatactcggctca-3, (SEQIDNO:96) 5-tgctgctggattggacctc-3, (SEQIDNO:97) 5-gaaccacaaatacctggct-3, (SEQIDNO:98) 5-cggtcctctttccagtgga-3, (SEQIDNO:99) 5-ttccaacacccgctcgttt-3, (SEQIDNO:100) 5-agagcacctggaagcagta-3, (SEQIDNO:101) 5-tctttccagtggatcataa-3, (SEQIDNO:102) 5-cctttttgttatgatggtt-3, (SEQIDNO:103) 5-cacctggaagcagtaacat-3, (SEQIDNO:104) 5-ctgaggaacgaaagaaact-3, (SEQIDNO:105) 5-gtgaaatgccttctagtag-3, (SEQIDNO:106) 5-ctactctgggaagcgtgaa-3, (SEQIDNO:107) 5-ctgggaagcgtgaaccatt-3, (SEQIDNO:108) 5-actactcagaagagtatga-3, (SEQIDNO:109) 5-catgcaaatgtcagcaaga-3, (SEQIDNO:110) 5-tgaggttacctcaagaagt-3, (SEQIDNO:111) 5-actcggctcaggccattat-3, (SEQIDNO:112) 5-ttcacggagaatgcaaata-3, (SEQIDNO:113) 5-ctgctggattggacctcaa-3, (SEQIDNO:114) 5-tgattcagtcagagttgaa-3, (SEQIDNO:115) 5-tgccaagtcatagccataa-3, (SEQIDNO:116) 5-ctcaagaagtgagatgtct-3, (SEQIDNO:117) 5-gccaagtcatagccataaa-3, (SEQIDNO:118) 5-ctcagaagagtatgataac-3, (SEQIDNO:119) 5-ttctgcattcacggagaat-3, (SEQIDNO:120) 5-taagacaatggaccctttt-3, (SEQIDNO:121) 5-aggttacctcaagaagtga-3, (SEQIDNO:122) 5-aatgccttctagtagtgaa-3, (SEQIDNO:123) 5-atgattcagtcagagttga-3, (SEQIDNO:124) 5-aaacaagacggaaagtgaa-3, (SEQIDNO:125) 5-tttctgcattcacggagaa-3, (SEQIDNO:126) 5-caaatacctggctatattg-3, (SEQIDNO:127) 5-tcttccaacacccgctcgt-3, (SEQIDNO:128) 5-gaagcagtaacatgcaaat-3, (SEQIDNO:129) 5-gatgattcagtcagagttg-3, (SEQIDNO:130) 5-tgcattcacggagaatgca-3, (SEQIDNO:131) 5-ctcagtgaggactcctaca-3, (SEQIDNO:132) 5-cactacgagatagccaaca-3, (SEQIDNO:133) 5-cagtcttccactacgagat-3, (SEQIDNO:134) 5-agctcctgagagacaacct-3, (SEQIDNO:135) 5-tcagtcttccactacgaga-3, (SEQIDNO:136) 5-agagacaacctgacgctgt-3, (SEQIDNO:137) 5-ccgaacggtatgaagacat-3, (SEQIDNO:138) 5-ctgaacaggccgaacggta-3, (SEQIDNO:139) 5-ctcctgagagacaacctga-3, (SEQIDNO:140) 5-gacatggcagctttcatga-3, (SEQIDNO:141) 5-cgaacggtatgaagacatg-3, (SEQIDNO:142) 5-agtaccgggagaaggtaga-3, (SEQIDNO:143) 5-acttttcagtcttccacta-3, (SEQIDNO:144) 5-gcatcgagcagaagagcaa-3, (SEQIDNO:145) 5-gcgaaacctgctttccgta-3, (SEQIDNO:146) 5-gtgaaagagtaccgggaga-3, (SEQIDNO:147) 5-gcgatgacaagaagcgcat-3, (SEQIDNO:148) 5-agtcttccactacgagata-3, (SEQIDNO:149) 5-tcagtgaggactcctacaa-3, (SEQIDNO:150) 5-ggtagagaccgagctcaga-3, (SEQIDNO:151) 5-ccgaggtgaaagagtaccg-3, (SEQIDNO:152) 5-caggccgaacggtatgaag-3, (SEQIDNO:153) 5-cggtatgaagacatggcag-3, (SEQIDNO:154) 5-tgctggactcgcacctcat-3, (SEQIDNO:155) 5-aagaagcgcatcatcgatt-3, (SEQIDNO:156) 5-ctggactcgcacctcatca-3, (SEQIDNO:157) 5-ggactcgcacctcatcaaa-3, (SEQIDNO:158) 5-gaagcgcatcatcgattct-3, (SEQIDNO:159) 5-gtcttccactacgagatag-3, (SEQIDNO:160) 5-aaggtagagaccgagctca-3, (SEQIDNO:161) 5-agcgaaacctgctttccgt-3, (SEQIDNO:162) 5-gactactaccgctacctag-3, (SEQIDNO:163) 5-cagagagccgcgtcttcta-3, (SEQIDNO:164) 5-gatgacaagaagcgcatca-3, (SEQIDNO:165) 5-catcgagcagaagagcaac-3, (SEQIDNO:166) 5-tgcagctcctgagagacaa-3, (SEQIDNO:167) 5-acggtatgaagacatggca-3, (SEQIDNO:168) 5-tggactcgcacctcatcaa-3, (SEQIDNO:169) 5-ggcgatgacaagaagcgca-3, (SEQIDNO:170) 5-tgaacaggccgaacggtat-3, (SEQIDNO:171) 5-aggccgaacggtatgaaga-3, (SEQIDNO:172) 5-tcgagcagaagagcaacga-3, (SEQIDNO:173) 5-tccactacgagatagccaa-3, (SEQIDNO:174) 5-ggtgaaagagtaccgggag-3, (SEQIDNO:175) 5-gccgaacggtatgaagaca-3, (SEQIDNO:176) 5-aggagatgccgcctaccaa-3, (SEQIDNO:177) 5-ggagcgaaacctgctttcc-3, (SEQIDNO:178) 5-cagtgaggactcctacaag-3, (SEQIDNO:179) 5-agcgcatcatcgattctgc-3, (SEQIDNO:180) 5-catcatgcagctcctgaga-3, (SEQIDNO:181) 5-gccgcgtcttctacctgaa-3, (SEQIDNO:182) 5-gagacaacctgacgctgtg-3, (SEQIDNO:183) 5-cgatgacaagaagcgcatc-3, (SEQIDNO:184) 5-cttccactacgagatagcc-3, (SEQIDNO:185) 5-ccactacgagatagccaac-3, (SEQIDNO:186) 5-gctcctgagagacaacctg-3, (SEQIDNO:187) 5-atcatcgattctgcccggt-3, (SEQIDNO:188) 5-tgagagacaacctgacgct-3, (SEQIDNO:189) 5-agacatggcagctttcatg-3, (SEQIDNO:190) 5-tcttccactacgagatagc-3, (SEQIDNO:191) 5-gaacaggccgaacggtatg-3, (SEQIDNO:192) 5-atgcagctcctgagagaca-3, (SEQIDNO:193) 5-accgagctcagaggtgtgt-3, (SEQIDNO:194) 5-cctgagagacaacctgacg-3, (SEQIDNO:195) 5-cacaccctcagtgaggact-3, (SEQIDNO:196) 5-ttccactacgagatagcca-3, (SEQIDNO:197) 5-acatggcagctttcatgaa-3, (SEQIDNO:198) 5-tgacaagaagcgcatcatc-3, (SEQIDNO:199) 5-aaggagatgccgcctacca-3, (SEQIDNO:200) 5-cttttcagtcttccactac-3, (SEQIDNO:201) 5-tcctgagagacaacctgac-3, (SEQIDNO:202) 5-gcagctcctgagagacaac-3, (SEQIDNO:203) 5-agccgcgtcttctacctga-3, (SEQIDNO:204) 5-attctgcccggtcagccta-3, (SEQIDNO:205) 5-actcgcacctcatcaaagg-3, (SEQIDNO:206) 5-agaccgagctcagaggtgt-3, (SEQIDNO:207) 5-gactcgcacctcatcaaag-3, (SEQIDNO:208) 5-agaagcgcatcatcgattc-3, (SEQIDNO:209) 5-gggtgactactaccgctac-3, (SEQIDNO:210) 5-caagaccaccttcgacgag-3, (SEQIDNO:211) 5-ctacgagatagccaacagc-3, (SEQIDNO:212) 5-tttcagtcttccactacga-3, (SEQIDNO:213) 5-aggtgaaagagtaccggga-3, (SEQIDNO:214) 5-aagcgcatcatcgattctg-3, (SEQIDNO:215) 5-gcatcatcgattctgcccg-3, (SEQIDNO:216) 5-aacggtatgaagacatggc-3, (SEQIDNO:217) 5-atcgagcagaagagcaacg-3, (SEQIDNO:218) 5-actactaccgctacctagc-3, (SEQIDNO:219) 5-ttttcagtcttccactacg-3, (SEQIDNO:220) 5-acgagatagccaacagccc-3, (SEQIDNO:221) 5-actaccgctacctagccga-3, (SEQIDNO:222) 5-actacgagatagccaacag-3, (SEQIDNO:223) 5-cccgaggtgaaagagtacc-3, (SEQIDNO:224) 5-cagctcctgagagacaacc-3, (SEQIDNO:225) 5-catcgattctgcccggtca-3, (SEQIDNO:226) 5-gagagacaacctgacgctg-3, (SEQIDNO:227) 5-gcgcatcatcgattctgcc-3, (SEQIDNO:228) 5-gaaggtagagaccgagctc-3, (SEQIDNO:229) 5-tcatcgattctgcccggtc-3, (SEQIDNO:230) 5-gaacggtatgaagacatgg-3, (SEQIDNO:231) 5-cgtaggaattgaggagtgt-3, (SEQIDNO:232) 5-cactacgagatcgccaaca-3, (SEQIDNO:233) 5-gctgtccagtattgagcag-3, (SEQIDNO:234) 5-gaccatgtttcctctcaat-3, (SEQIDNO:235) 5-cgagacaacctgacactgt-3, (SEQIDNO:236) 5-cgtcttccactacgagatc-3, (SEQIDNO:237) 5-cctgcgaagagcgaaacct-3, (SEQIDNO:238) 5-gctgcctctgatcgtagga-3, (SEQIDNO:239) 5-ccaagaccactttcgacga-3, (SEQIDNO:240) 5-gtctgctgggtgtgaccat-3, (SEQIDNO:241) 5-ctctgatcgtaggaattga-3, (SEQIDNO:242) 5-gctgggtgtgaccatgttt-3, (SEQIDNO:243) 5-tggccaagaccactttcga-3, (SEQIDNO:244) 5-cgacaagaagcgcatcatt-3, (SEQIDNO:245) 5-ctgccgagaggactagtat-3, (SEQIDNO:246) 5-gcctctgatcgtaggaatt-3, (SEQIDNO:247) 5-gcgctgttcttgctccaaa-3, (SEQIDNO:248) 5-ctgcctctgatcgtaggaa-3, (SEQIDNO:249) 5-gccctgaacttttccgtct-3, (SEQIDNO:250) 5-tgcctctgatcgtaggaat-3, (SEQIDNO:251) 5-tgaccatgtttcctctcaa-3, (SEQIDNO:252) 5-ccatgtttcctctcaataa-3, (SEQIDNO:253) 5-ggtgacgacaagaagcgca-3, (SEQIDNO:254) 5-acttttccgtcttccacta-3, (SEQIDNO:255) 5-tccgtcttccactacgaga-3, (SEQIDNO:256) 5-ctctcctgcgaagagcgaa-3, (SEQIDNO:257) 5-ccaggaccaggctacttct-3, (SEQIDNO:258) 5-cctgctgcctctgatcgta-3, (SEQIDNO:259) 5-ccgaacgctatgaggacat-3, (SEQIDNO:260) 5-ccctgaacttttccgtctt-3, (SEQIDNO:261) 5-ccgtcttccactacgagat-3, (SEQIDNO:262) 5-gagacaacctgacactgtg-3, (SEQIDNO:263) 5-gcatgtctgctgggtgtga-3, (SEQIDNO:264) 5-tggctgagaactggacagt-3, (SEQIDNO:265) 5-gccgaacgctatgaggaca-3, (SEQIDNO:266) 5-ctgtccagtattgagcaga-3, (SEQIDNO:267) 5-gtattgagcagaaaagcaa-3, (SEQIDNO:268) 5-cagctgttgagcgcaccta-3, (SEQIDNO:269) 5-gacaacctgacactgtgga-3, (SEQIDNO:270) 5-tggagagagccagtctgat-3, (SEQIDNO:271) 5-cgaacgctatgaggacatg-3, (SEQIDNO:272) 5-ggtgctgtccagtattgag-3, (SEQIDNO:273) 5-gaagcgcatcattgactca-3, (SEQIDNO:274) 5-tcgtaggaattgaggagtg-3, (SEQIDNO:275) 5-gctgcgagacaacctgaca-3, (SEQIDNO:276) 5-tgctgtccagtattgagca-3, (SEQIDNO:277) 5-ctgttcttgctccaaaggg-3, (SEQIDNO:278) 5-cctctgatcgtaggaattg-3, (SEQIDNO:279) 5-ccaccggtgacgacaagaa-3, (SEQIDNO:280) 5-gtcttccactacgagatcg-3, (SEQIDNO:281) 5-ctacctgaagatgaagggt-3, (SEQIDNO:282) 5-ctataagaacgtggtgggc-3, (SEQIDNO:283) 5-ctctggccaagaccacttt-3, (SEQIDNO:284) 5-cgctgttcttgctccaaag-3, (SEQIDNO:285) 5-ccactttcgacgaggccat-3, (SEQIDNO:286) 5-tgagaactggacagtggca-3, (SEQIDNO:287) 5-ctggccaagaccactttcg-3, (SEQIDNO:288) 5-ttgagcagaaaagcaacga-3, (SEQIDNO:289) 5-tgcgagacaacctgacact-3, (SEQIDNO:290) 5-agctgttgagcgcacctaa-3, (SEQIDNO:291) 5-gaacttttccgtcttccac-3, (SEQIDNO:292) 5-aaaagcaacgaggagggct-3, (SEQIDNO:293) 5-tctcctgcgaagagcgaaa-3, (SEQIDNO:294) 5-ctgttgagcgcacctaacc-3, (SEQIDNO:295) 5-cctgaacttttccgtcttc-3, (SEQIDNO:296) 5-gctgttcttgctccaaagg-3, (SEQIDNO:297) 5-aggccgaacgctatgagga-3, (SEQIDNO:298) 5-attgaggagtgtcccgcct-3, (SEQIDNO:299) 5-gtgaccatgtttcctctca-3, (SEQIDNO:300) 5-caagaccactttcgacgag-3, (SEQIDNO:301) 5-aacttttccgtcttccact-3, (SEQIDNO:302) 5-tgatcgtaggaattgagga-3, (SEQIDNO:303) 5-ggagagagccagtctgatc-3, (SEQIDNO:304) 5-agcaggccgaacgctatga-3, (SEQIDNO:305) 5-aggacatggcagccttcat-3, (SEQIDNO:306) 5-acgacaagaagcgcatcat-3, (SEQIDNO:307) 5-accatgtttcctctcaata-3, (SEQIDNO:308) 5-tgccgagaggactagtatg-3, (SEQIDNO:309) 5-tctgatcgtaggaattgag-3, (SEQIDNO:310) 5-tgggtgtgaccatgtttcc-3, (SEQIDNO:311) 5-tgaacttttccgtcttcca-3, (SEQIDNO:312) 5-gaattgaggagtgtcccgc-3, (SEQIDNO:313) 5-tttccgtcttccactacga-3, (SEQIDNO:314) 5-ctgctgcctctgatcgtag-3, (SEQIDNO:315) 5-ggccctgaacttttccgtc-3, (SEQIDNO:316) 5-gccaagaccactttcgacg-3, (SEQIDNO:317) 5-tctggccaagaccactttc-3, (SEQIDNO:318) 5-ctgaacttttccgtcttcc-3, (SEQIDNO:319) 5-aagcgcatcattgactcag-3, (SEQIDNO:320) 5-tgttgagcgcacctaacca-3, (SEQIDNO:321) 5-tacctgaagatgaagggtg-3, (SEQIDNO:322) 5-accactttcgacgaggcca-3, (SEQIDNO:323) 5-acgaggccatggctgatct-3, (SEQIDNO:324) 5-gatcccactcttcttgcag-3, (SEQIDNO:325) 5-cttttccgtcttccactac-3, (SEQIDNO:326) 5-gccgagaggactagtatgg-3, (SEQIDNO:327) 5-gctgttgagcgcacctaac-3, (SEQIDNO:328) 5-caggaccaggctacttctc-3, (SEQIDNO:329) 5-cctataagaacgtggtggg-3, (SEQIDNO:330) 5-ctgggtgtgaccatgtttc-3,

(19) In the present specification, the term siRNA means an siRNA specific for a specific gene (for example, a respiratory disease-related gene), preferably, an mRNA encoding amphiregulin or stratifin protein. Further, it will be obvious to those skilled in the art that as long as specificity for the respiratory disease-related gene such as amphiregulin, stratifin, or the like, is maintained, an siRNA having sequences in which one or more bases are substituted, deleted, or inserted in the sense strands having the sequences of SEQ ID NOS: 1 to 330 or the antisense strands complementary thereto is also included in the scope of the present invention.

(20) Further, as long as specificity for amphiregulin or stratifin is maintained, the siRNA according to the present invention includes an siRNA of which a portion of the base sequence of the sense strand does not coincide with a binding site of an amphiregulin or stratifin gene, that is, the base sequence is partially mismatched, as well as an siRNA of which the base sequence of the sense strand is completely (100%) complementary to the binding site of the amphiregulin or stratifin gene, that is, the base sequence perfectly matches the binding site.

(21) The siRNA according to the present invention may include an overhang, which is a structure in which one or more unpaired nucleotides are included at the 3-end of a single strand or double strands.

(22) In the present invention, the sense or antisense strand is preferably comprised 19 to 31 nucleotides, but is not limited thereto.

(23) In the present invention, an siRNA including a sense strand having any one sequence selected from the group consisting of SEQ ID NOS: 1 to 130 and an antisense strand having the sequence complementary thereto may be specific for amphiregulin. Preferably, the amphiregulin-specific siRNA includes a sense strand having a sequence of SEQ ID NOS: 2, 6 to 9, 11, 17 to 21, 23, 24, 28, 29, 40, 42, 43, 45, 46, 52, 53, 58, 59, 61, 63, 65, 69, 75, 79, 80, 81, 91, 92, 94, 98, 102, 115, 117, 120, or 128, and an antisense strand having a sequence complementary thereto, but is not limited thereto. More preferably, the amphiregulin-specific siRNA comprises a sense strand having a sequence of SEQ ID NOS: 8, 9, 28, 59, 75, 79, 80, 91, 92, or 102, and an antisense strand having a sequence complementary thereto.

(24) In the present invention, an siRNA comprising a sense strand having any one sequence selected from the group consisting of SEQ ID NOS: 131 to 330 and the antisense strand having a sequence complementary thereto may be specific for stratifin. Preferably, the stratifin-specific siRNA comprises a sense strand having a sequence of SEQ ID NOS: 231, 234, 238, 241 to 255, 257, 258, 260 to 263, 267, 268, 270, 272, 273, 275, 278, 283, 284, 290, 297, 299, 300, 302, 303, 307, 311, 314, 320, 324, 326, 327, or 328, and an antisense strand having a sequence complementary thereto, but is not limited thereto. More preferably, the stratifin-specific siRNA comprises a sense strand having a sequence of SEQ ID NOS: 241, 248, 257, 258, 263, 268, 290, or 327, and an antisense strand having a sequence complementary thereto.

(25) In the present invention, the sense strand or antisense strand of the siRNA may include various chemical modifications for improving in vivo stability, imparting resistance against nuclease, and decreasing non-specific immune responses, wherein the chemical modification may be any one or more selected from the group consisting of modification by substitution of a hydroxyl (OH) group at the 2 carbon position in a sugar structure in nucleotides with only one selected from the group consisting of methyl (CH.sub.3), methoxy (OCH.sub.3), amine (NH.sub.2), fluorine (F), O-2-methoxyethyl, O-propyl, O-2-methylthioethyl, O-3-aminopropyl, O-3-dimethylaminopropyl, ON-methylacetamido and O-dimethylamidooxyethyl groups; modification by substitution of oxygen in a sugar structure in nucleotides with sulfur; modification of a nucleotide bond into any one selected from the group consisting of a phosphorothioate bond, a boranophosphate bond, or a methyl phosphonate bond; and modification into a peptide nucleic acid (PNA) type, a locked nucleic acid (LNA) type, or a unlocked nucleic acid (UNA) type (Ann. Rev. Med., 55, 61-65 2004; U.S. Pat. Nos. 5,660,985; 5,958,691; 6,531,584; 5,808,023; 6,326,358; 6,175,001; Bioorg. Med. Chem. Lett., 14:1139-1143, 2003; RNA, 9:1034-1048, 2003; Nucleic Acid Res., 31:589-595, 2003; Nucleic Acids Research, 38(17) 5761-773, 2010; Nucleic Acids Research, 39(5) 1823-1832, 2011), but the chemical modifications are not limited thereto.

(26) In the present invention, one or more phosphate groups, preferably, 1 to 3 phosphate groups are bound to a 5-end of the antisense strand of the siRNA.

(27) In another aspect, the present invention relates to a double-stranded oligo RNA structure comprising a structure represented by the following Structural Formula 1, wherein in the following Structural Formula 1, A is a hydrophilic material, B is a hydrophobic material, X and Y are each independently a simple covalent bond or linker-mediated covalent bond, and R is an siRNA.
A-X-R-Y-B[Structural Formula 1]

(28) A form of the double-stranded oligo RNA according to the present invention may be preferably a short interfering RNA (siRNA), a short hairpin RNA (shRNA), microRNA (miRNA), and the like, but is not limited thereto. A single-stranded miRNA inhibitor capable of serving as an antagonist for the miRNA may be also included therein.

(29) Hereinafter, the siRNA will be mainly described as the double-stranded oligo RNA according to the present invention, but it is obvious to those skilled in the art that another double-stranded oligo RNA having the same characteristics as those of the double-stranded oligo RNA according to the present invention may also be applied.

(30) In the present invention, the double-stranded oligo RNA structure may comprise a structure represented by the following Structural Formula 2, wherein, in the following Structural Formula 2, S and AS are a sense strand and an antisense strand of the siRNA of Structural Formula 1, respectively, and A, B, X, and Y have the same definitions as those in Structural Formula 1.

(31) ##STR00001##

(32) In the present invention, the double-stranded oligo RNA structure may comprise a structure represented by the following Structural Formula 3, wherein, in the following Structural Formula 3, A, B, X, Y, S, and AS have the same definitions as those in Structural Formula 2, and 5 and 3 are a 5-end and 3-end of the sense strand of the siRNA, respectively.

(33) ##STR00002##

(34) In the present invention, the double-stranded oligo RNA structure comprises a respiratory disease-related gene-specific siRNA according to the present invention. According to the present invention, in Structural Formulas 1 to 3, an shRNA may be used instead of the siRNA, which is obvious to those skilled in the art.

(35) In the present invention, the hydrophilic material may be polyethylene glycol (PEG), polyvinylpyrrolidone, or polyoxazoline, and preferably, a molecular weight of the hydrophilic material may be preferably 200 to 10,000, but the hydrophilic material is not limited thereto. Preferably, the hydrophilic material is a cationic or non-ionic polymer material.

(36) Particularly, the hydrophilic material A in Structural Formulas 1 to 3 may be used in a form of a hydrophilic material block as represented by the following Structural Formula 4, and problems caused by polydispersity that may occur in a case of using a general synthetic polymer material, or the like, may be significantly solved by using an appropriate number of hydrophilic material blocks as described above (the appropriate number is represented as n in Structural Formula 4) as needed.
(A.sub.m-J).sub.n[Structural Formula 4]

(37) In Structural Formula 4, A is a hydrophilic material monomer, J is a linker linking m hydrophilic material monomers to each other (the number of hydrophilic material monomers is m) or linking m hydrophilic material monomers and the siRNA to each other, m is an integer of 1 to 15, n is an integer of 1 to 10, and the repeating unit represented by (A.sub.m-J) corresponds to a base unit of the hydrophilic material block.

(38) In Structural Formula 4, as the hydrophilic material monomer A, any one of monomers of non-ionic hydrophilic polymers may be used as long as it may satisfy the object of the present invention. Preferably, a monomer selected from Compounds (1) to (3) illustrated in Table 1, more preferably, the monomer of Compound (1) may be used, wherein in Compound (1), it is preferable that G is selected from CH.sub.2, O, S, and NH.

(39) Particularly, among the hydrophilic material monomers, the monomer of Compound (1) has advantages in that various functional groups may be introduced thereinto, and the monomer of Compound (1) may have good affinity in vivo, and induce little immune response, etc. to thereby have excellent bio-compatibility, and increase stability in vivo of oligo nucleotides included in the structures represented by Structural Formulas 1 to 3 and increase delivery efficiency, such that the monomer of Compound (1) is significantly suitable for preparing the structure according to the present invention.

(40) TABLE-US-00002 TABLE 1 Structure of Hydrophilic Material Monomer in the Present Invention Compound (1) Compound (2) Compound (3) embedded image G is CH.sub.2, O, S or NH embedded image embedded image

(41) It is preferable that a total molecular weight of the hydrophilic material in Structural Formulas 1 to 3 is in a range of 1,000 to 2,000. Therefore, for example, in the case in which hexaethylene glycol is used as the monomer of Compound (1), since a molecular weight of a hexaethylene glycol spacer is 344, a repetition number (n) is preferably 3 to 5.

(42) Particularly, according to the present invention, if necessary, the repeating unit of the hydrophilic group represented by (A.sub.m-J) in Structural Formula 4, that is, the hydrophilic material block may be used in an appropriate number represented by n. A, which is the hydrophilic material monomer included in respective hydrophilic material blocks, and J are each independently the same as or different from those in respective hydrophilic material blocks. That is, when three hydrophilic material blocks are used (n=3), for example, the hydrophilic material monomer of Compound (1) may be used in the first block, the hydrophilic material monomer of Compound (2) may be used in the second block, and the hydrophilic material monomer of Compound (3) may be used in the third block. That is, different hydrophilic material monomers are used in the respective hydrophilic material blocks. Alternatively, any one selected from the hydrophilic material monomers of Compounds (1) to (3) may also be equally used in all of the hydrophilic material blocks. Similarly, in the case of the linker mediating the binding between the hydrophilic material monomers, linkers used in the respective hydrophilic material blocks may also be the same as each other or different from each other. In addition, m, the number of hydrophilic material monomers, may be the same as each other or different from each other in the respective hydrophilic material blocks. That is, for example, three hydrophilic material monomers are linked in a first hydrophilic material block (m=3), five hydrophilic material monomers are linked in a second hydrophilic material block (m=5), four hydrophilic material monomers are linked in a third hydrophilic material block (m=4), etc. That is, different numbers of hydrophilic material monomers may be used in all of the hydrophilic material blocks. Alternatively, the same number of hydrophilic material monomers may be used in all of the hydrophilic material blocks.

(43) Further, it is preferable that the linker J is selected from the group consisting of PO.sub.3.sup.?, SO.sub.3, and CO.sub.2, but is not limited thereto. It is obvious to those skilled in the art that any linker may be used depending on the used hydrophilic material monomer, or the like, as long as it may satisfy the object of the present invention.

(44) In the present invention, the hydrophobic material may be a steroid derivative, a glyceride derivative, glycerol ether, polypropylene glycol, an unsaturated or saturated (C12-C50) hydrocarbon, diacylphosphatidylcholine, fatty acid, phospholipid, lipopolyamine, lipid, tocopherol, or tocotrienol, wherein the steroid derivative may be cholesterol, cholestanol, cholic acid, cholesteryl formate, chotestanyl formate, or cholestanyl amine, the glyceride derivative may be mono-, di- or tri-glyceride, the lipid may be cationic lipid, anionic lipid, or hydrophobic lipid. In addition, a molecular weight of the hydrophobic material may be preferably 250 to 1,000, but is not limited thereto.

(45) In the present invention, the hydrophobic material is bound to an opposite distal end of the hydrophilic material, and it does not matter if the hydrophobic material is bound to any position of the sense strand or the antisense strand of the siRNA.

(46) In the present invention, the covalent bonds represented by X and Y may be a non-degradable bond or degradable bond. The non-degradable bond may be an amide bond or phosphorylation bond, and the degradable bond may be a disulfide bond, an acid degradable bond, an ester bond, an anhydride bond, a biodegradable bond or an enzymatically degradable bond, but the present invention is not limited thereto. The linker mediating the covalent bond is not particularly limited as long as the linker may be covalently bound to the hydrophilic material or the hydrophobic material and the end of the amphiregulin or stratifin-specific siRNA, and the bond capable of being decomposed in a specific environment is provided. Therefore, any compound binding the hydrophilic material or hydrophobic material in order to activate the amphiregulin or stratifin-specific siRNA may be used.

(47) In another aspect, the present invention relates to a nanoparticle comprising a double-stranded oligo RNA structure according to the present invention. The double-stranded oligo RNA structure according to the present invention forms self-assembling nanoparticles by a hydrophobic interaction of the hydrophobic materials (Korean Patent Pulication No. 1224828), and since these nanoparticles have significantly excellent delivery in vivo, excellent stability in vivo, and excellent uniformity in particle size, quality control (QC) may be easy, such that a preparation process of the nanoparticles as a drug is simple.

(48) More specifically, the double-stranded oligo RNA structure comprising the amphiregulin or stratifin-specific siRNA is amphipathic structure containing both of the hydrophobic material and the hydrophilic material, wherein hydrophilic portions have affinity through an interaction such as a hydrogen bond, and the like, with water molecules present in the body to be toward the outside and the hydrophobic materials are toward the inside by the hydrophobic interaction therebetween, thereby forming a thermodynamically stable nanoparticle. That is, the hydrophobic material is positioned in the center of the nanoparticle and the hydrophilic material is positioned in an outward direction of the amphiregulin or stratifin-specific siRNA, thereby forming the nanoparticle in a form in which the nanoparticle protects the amphiregulin or stratifin-specific siRNA. The nanoparticle formed as described above may improve intracellular delivery of the amphiregulin or stratifin-specific siRNA and efficiency of the amphiregulin or stratifin-specific siRNA.

(49) In the present invention, the nanoparticle may comprised only a double-stranded oligo RNA structure comprising an siRNA having the same sequence, or formed of a mixture of double-stranded oligo RNA structures comprising siRNAs having different sequences from each other.

(50) In another aspect, the present invention provides a pharmaceutical composition for preventing or treating fibrosis or respiratory diseases, comprising the siRNA, the double-stranded oligo RNA structure, or the nanoparticle according to the present invention as an active ingredient.

(51) The pharmaceutical composition for preventing or treating fibrosis or respiratory diseases may have an effect of preventing or treating fibrosis or respiratory diseases by suppressing connective tissue remodeling, particularly, pulmonary artery remodeling and air way remodeling.

(52) In the present invention, the respiratory disease may be selected from COPD, asthma, acute or chronic bronchitis, allergic rhinitis, cough and phlegm, bronchitis, bronchiolitis, pharyngitis, tonsillitis, and laryngitis, and fibrosis may be selected from IPF, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, pulmonary fibrosis, lung cancer, and the like, but the respiratory disease and fibrosis are not limited thereto.

(53) The composition according the present invention may be prepared by additionally adding one or more pharmaceutically acceptable carriers for administration in addition to the active ingredient as described above. The pharmaceutically acceptable carrier needs to be compatible with the active ingredient according to the present invention, and a mixture of one or two or more ingredients selected from saline, sterile water, Ringer's solution, buffered saline, a dextrose solution, a maltodextrin solution, glycerol, and ethanol, may be used. In addition, other conventional additives such as an antioxidant, a buffer, a bacteriostatic agent, and the like, may be added thereto as needed. In addition, the composition may be formulated as a formulation for injection, such as an aqueous solution, suspension, emulsion, and the like, by additionally adding a diluent, a dispersant, a surfactant, a binder, and a lubricant thereto. Particularly, it is preferred to provide the composition prepared as a lyophilized formulation. In order to prepare the lyophilized formulation, any method generally known in the technical field to which the present invention pertains may be used, wherein a stabilizer for lyophilization may be added thereto. In addition, the composition may be preferably formulated depending on each disease or ingredient using appropriate methods in the art or a method disclosed in Remington's Pharmaceutical Science (Mack Publishing Company, Easton Pa.).

(54) The composition according to the present invention may be determined by those skilled in the art based on the condition of the patient and the severity of the disease. Further, the composition may be formulated into various forms including powders, tablets, capsules, solutions, injections, ointments, syrups, and the like, and may be provided as a unit-dose container or a multi-dose container, for example, a sealed ampoule, bottle, and the like.

(55) The composition according to the present invention may be, for example, orally or parenterally administered. An example of an administration route of the composition according to the present invention may include oral, intravenous, intramuscular, intra-arterial, intramedullary, intradural, intracardiac, transdermal, subcutaneous, intraperitoneal, intestinal, sublingual or topical administration route, but is not limited thereto. Particularly, the composition according to the present invention may also be administered into the lung via drip infusion in the bronchus for treatment of respiratory diseases. An administration dose of the composition according to the present invention may have various ranges depending on a weight, an age, gender, a health condition, diet, an administration time, an administration method, an excretion rate, or severity of a disease, and the like, of a patient, and be easily determined by a general expert skilled in the art. Further, the composition according to the present invention may be formulated into an appropriate formulation for clinical administration using a method known in the art.

(56) In another aspect, the present invention relates to a lyophilized formulation comprising the pharmaceutical composition according to the present invention.

(57) In another aspect, the present invention relates to a method of preparing a double-stranded oligo RNA structure comprising a respiratory disease-related gene-specific siRNA, the method including: (a) binding a hydrophilic material based on a solid support; (b) synthesizing an RNA single strand based on the solid support containing the hydrophilic material bonded thereto; (c) covalently binding a hydrophobic material to a 5 end of the RNA single strand; (d) synthesizing an RNA single strand having a sequence complementary to a sequence of the RNA single strand; (e) separating and purifying an RNA-polymer structure and the RNA single strand from the solid support when the synthesizing of the RNA single strand is completed; and (f) producing the double-helix oligo RNA structure by annealing the prepared RNA-polymer structure and an RNA single strand having a complementary sequence thereto.

(58) In the present invention, the solid support is controlled pore glass (CPG), polystyrene, silica gel, cellulose paper, but is not limited thereto. In the case in which the solid supporter is the CPG, a diameter is preferably 40 to 180 ?m, and a pore size is preferably 500 to 3000 ?, but the solid supporter is not limited thereto.

(59) In the present invention, step (d) is performed before step (a), or during any one step during steps (a) to (c) and step (e).

(60) In the present invention, it may be confirmed whether the desired RNA-polymer structure and the desired RNA single strand were prepared by measuring molecular weights of the purified RNA-polymer structure and the purified RNA single strand after step (e) using a matrix assisted laser desorption/Ionization-time of flight (MALDI-TOF) mass spectrometer. Further, the RNA single strand having a sequence complementary to the sequence of the RNA single strand synthesized in step b) is used in a form in which a phosphate group is bound to a 5-end thereof.

(61) In another aspect, the present invention relates to a method of preventing or treating fibrosis or respiratory diseases, comprising a step of administering the pharmaceutical composition for preventing or treating fibrosis or respiratory diseases according to the present invention to a subject in need thereof.

(62) In the present invention, the respiratory disease may be COPD, asthma, acute or chronic bronchitis, allergic rhinitis, cough and phlegm, bronchitis, bronchiolitis, pharyngitis, tonsillitis, and laryngitis, and fibrosis may be selected from IPF, cirrhosis, myelofibrosis, myocardial fibrosis, renal fibrosis, pulmonary fibrosis, or lung cancer, but is not limited thereto.

EXAMPLE

(63) Hereinafter, the present invention will be described in detail through the Examples. However, these Examples are only to illustrate the present invention, and those skilled in the art will appreciate that these Examples are not to be construed as limiting a scope of the present invention. Therefore, the substantial scope of the present invention is defined by the accompanying claims and equivalent thereof.

Example 1

Design of Target Base Sequence and Preparation of siRNA

(64) Target base sequences (sense strands) capable of binding to an mRNA sequence (NM_001657.2) of amphiregulin gene (Homo sapiens), an mRNA sequence (NM 006142.2) of stratifin gene (Homo sapiens), an mRNA sequence (NM 009704.2) of amphiregulin gene (Mus musculus), and an mRNA sequence (NM 018754.2) of stratifin gene (Mus musculus) were designed, and siRNAs of antisense strands having sequences complementary to the target base sequences were prepared.

(65) First, a gene design program (Turbo si-Designer) developed by Bioneer Co., was used to design the target base sequences to which the siRNA may bind from mRNA sequences of the corresponding genes. The amphiregulin and stratifin-specific siRNAs according to the present invention have a double stranded structure including a sense strand consisting of 19 nucleotides and an antisense strand complementary thereto. Further, siCONT (CUUACGCUGAGUACUUCGA (SEQ ID NO: 331) as a sense strand), an siRNA having a sequence which does not cause inhibition of expression of any gene, was prepared. The siRNA was prepared by linking phosphodiester bonds forming an RNA backbone structure using ?-cyanoethyl phosphoramidite (Nucleic Acids Research, 12: 4539-4557, 1984). Specifically, a reaction product including an RNA having a desired length was obtained by repeatedly performing a series of processes of deblocking, coupling, oxidation and capping, on a solid support to which nucleotide was attached, using an RNA synthesizer (384 Synthesizer, BIONEER, Korea). The RNA of the reaction product was separated and purified by HPLC LC918 (Japan Analytical Industry, Japan) equipped with a Daisogel C18 (Daiso, Japan) column, and it was confirmed whether or not the purified RNA meets the target base sequence by MALDI-TOF mass spectrometer (Shimadzu, Japan). Then, an siRNA having any one sequence selected from SEQ ID NOS: 1 to 331 to be desired as a sense strand was prepared by binding the RNA sense and antisense strands to each other.

Example 2

Preparation of Double-stranded Oligo RNA Structure (SAMiRNA LP)

(66) A double-stranded oligo RNA structure (SAMiRNA LP) prepared in the present invention has a structure represented by the following Structural Formula 5.

(67) ##STR00006##

(68) In Structural Formula 5, S is a sense strand of the siRNA; AS is an antisense strand of the siRNA; PEG, which is a hydrophilic material, is polyethylene glycol; C24, which is a hydrophobic material, is tetradocosane including a disulfide bond; and 5 and 3 mean directions of the double-stranded oligo RNA end.

(69) In order to prepare the sense strand of the siRNA of Structural Formula 5, after a double-stranded oligo RNA-hydrophilic material structure of a sense strand of which polyethylene glycol was bound to a 3-end was synthesized by a method of linking phosphodiester bonds forming an RNA backbone structure using ?-cyanoethyl phosphoramidite as in the above-mentioned method, based on 3 polyethylene glycol (PEG, Mn=2,000)-CPG prepared by a method in Example 1 disclosed in the existing Patent Document (Korean Patent Laid-Open Publication No. 10-2012-0119212) as a supporter, and tetradocosane including a disulfide bond was bound to the 5 end thereof, thereby preparing a sense strand of a desired RNA-polymer structure. For the antisense strand to be subjected to annealing together with the strand, the antisense strand having the sequence complementary to that of the sense strand was prepared by the above-mentioned reaction.

(70) When the synthesis was completed, the RNA single strand and the RNA-polymer structure synthesized by treating 28% (v/v) ammonia in a water bath at 60? C. were separated from the CPG, and protecting moieties were removed therefrom by a deprotection reaction. The RNA single strand and the RNA-polymer structure from which the protecting moieties were removed were treated with N-methylpyrrolidone, triethylamine, and triethylaminetrihydrofluoride at a volume ratio of 10:3:4 in an oven at 70? C., thereby removing tert-butyldimethylsilyl (2TBDMS).

(71) The RNA of the reaction product was separated and purified by HPLC LC918 (Japan Analytical Industry, Japan) equipped with a Daisogel C18 (Daiso, Japan) column, and it was confirmed whether or not the purified RNA meets the target base sequence by MALDI-TOF mass spectrometer (Shimadzu, Japan). Then, in order to prepare each of the double-stranded oligo RNA structures, the sense strand and the antisense strand each having the same amount were mixed with each other, put into a 1? annealing buffer (30 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), 100 mM potassium acetate, 2 mM magnesium acetate, pH 7.0 to 7.5), reacted in a constant-temperature water bath at 90? C. for 3 minutes, and reacted again at 37? C., thereby preparing each of the double-stranded oligo RNA structures including siRNAs having the sequences of SEQ ID NO: 6, 9, 28, 59, 75, 79, 80, 91, 92, 102, 241, 248, 257, 258, 263, 268, 290, and 327 as the sense strands, respectively, (hereinafter, referred to as SAMiRNALP-mAR, SAMiRNALP-hAR, SAMiRNALP-hSFN, and SAMiRNALP-CONT, respectively). It was confirmed that the prepared double-stranded oligo RNA structure was annealed by electrophoresis.

Example 3

Preparation of Nanoparticle (SAMiRNA) Made of Double-stranded Oligo RNA Structure (SAMiRNA LP) and Measurement of Size Thereof

(72) The double-stranded oligo RNA structure (SAMiRNA LP) prepared by Example 2 formed a nanoparticle, that is, a micelle by a hydrophobic interaction between the hydrophobic materials bound to the end of the double-stranded oligo RNA (FIG. 1).

(73) It was confirmed by analyzing polydispersity indexes (PDI) of the nanoparticles formed of SAMiRNALP-hAR, SAMiRNALP-hSFN, SAMiRNALP-mAR, SAMiRNALP-mSFN, and SAMiRNALP-CONT that the nanoparticle (SAMiRNA) formed of the corresponding SAMiRNA LP was formed.

(74) 3-1: Preparation of Nanoparticle

(75) The SAMiRNALP-hAR was dissolved in 1.5 ml Dulbecco's phosphate buffered saline (DPBS) at a concentration of 50 ?g/ml, the obtained mixture was freeze-dried at ?75? C. and 5 mTorr condition for 48 hours to prepare nanoparticle powder, and the nanoparticle powder was dissolved in DPBS (solvent), thereby preparing homogenized nanoparticles.

(76) Nanoparticles formed of SAMiRNALP-hSFN, SAMiRNALP-mAR, SAMiRNALP-mSFN, and SAMiRNALP-CONT were prepared by the same method.

(77) 3-2: Measurement of Size and Polydispersity Index (PDI) of Nanoparticles

(78) Sizes of the nanoparticles were measured by zeta-potential measurement. A size of the homogenized nanoparticles prepared by Example 3-1 was measured by zeta-potential measurement (Nano-ZS, MALVERN, England), under conditions in which a refractive index to the material was 1.459, an absorption index was 0.001, a temperature of DPBS (solvent) was 25? C., and the corresponding viscosity and refractive index were 1.0200 and 1.335, respectively. Once measurement was conducted by repeatedly measuring the size 15 times, and the measurement was repeated six times.

(79) The lower the PDI value, the more uniformly distributed the corresponding particles, and thus, it could be appreciated that the nanoparticles according to the present invention were formed to have a significantly uniform size.

Example 4

Inhibition of Expression of Amphiregulin Using Target Gene-Specific siRNA for Mouse in Mouse Fibroblast Cell Line (NIH3T3)

(80) Mouse fibroblast (NIH3T3), which is a fibroblast cell line, was transformed with the amphiregulin-specific siRNAs having sequences of SEQ ID NOS: 1 to 30 as the sense strands, respectively, prepared by Example 1, and an expression pattern of amphiregulin, that is, a degree of inhibition of expression by the siRNA was analyzed in the transformed fibroblast cell line (NIH3T3).

(81) 4-1: Culture of Fibroblast Cell Line

(82) The mouse fibroblast cell line (NIH3T3) obtained from American Type Culture Collection (ATCC) was cultured in a RPMI 1640 culture medium (GIBCO/Invitrogen, USA, 10% (v/v) fetal bovine serum, 100 units/ml of penicillin, and 100 ?g/ml of streptomycin) under condition of 37? C. and 5% (v/v) CO.sub.2.

(83) 4-2: Transfection of Target siRNA into Mouse Fibroblast Cell Line

(84) After 1?10.sup.5 fibroblast cell lines cultured in Example 4-1 were cultured in a RPMI 1640 culture medium in a 12-well plate under condition of 37? C. and 5% (v/v) CO.sub.2 for 18 hours, the medium was removed, and 500 ?l of Opti-MEM medium (GIBCO, USA) for each well was dispensed.

(85) Meanwhile, a mixed solution was prepared by mixing 1.5 ?l of Lipofectamine? RNAi Max (Invitrogen, USA) and 248.5 ?l of Opti-MEM medium with each other, and the mixed solution was reacted at room temperature for 5 minutes. Then, 20 ?l of siRNAs (1 pmole/?l) each having any one sequence of SEQ ID NOS: 1 to 30 as the sense strand, prepared in Example 1, were added to 230 ?l of Opti-MEM medium, thereby preparing siRNA solutions each having a final concentration of 20 nM. The mixed solution of Lipofectamine? RNAi Max was mixed and reacted with the siRNA solution at room temperature for 20 minutes, thereby preparing a transfection solution.

(86) Then, 500 ?l of each transfection solution was dispensed in each well containing the tumor cell line and Opti-MEME and incubated for 6 hours, and the Opti-MEM medium was removed. Here, 1 ml of RPMI 1640 culture medium was dispensed into each well, and incubated for 24 hours under condition of 37? C. and 5% (v/v) CO.sub.2.

(87) 4-3: Quantitative Analysis of Amphiregulin mRNA

(88) After preparing cDNA by extracting a total RNA from the cell line transfected in Example 4-2, an expression amount of the amphiregulin mRNA was relatively quantified using real-time polymerase chain reaction (PCR).

(89) 4-3-1: Separation of RNA from Transfected Cell and Preparation of cDNA

(90) The total RNA was extracted from the cell line transfected in Example 4-2 using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), and the extracted RNA was used to prepare cDNA by RNA reverse transcriptase (AccuPower CycleScript RT Premix/dT20, Bioneer, Korea) according to the following method. Specifically, the extracted RNA (1 ?g/tube) was added to AccuPower CycleScript RT Premix/dT20 (Bioneer, Korea) contained in 0.25 ml Eppendorf tube, and distilled water treated with diethyl pyrocarbonate (DEPC) was added thereto so as to have a total volume of 20 ?l. A process of hybridizing the RNA and primers at 30? C. for 1 minute by a gene amplifier (MyGenie? 96 Gradient Thermal Block, BIONEER, Korea) and a process of preparing the cDNA at 52? C. for 4 minutes were repeated 6 times, and then, an amplification reaction was terminated by inactivating an enzyme at 95? C. for 5 minutes.

(91) 4-3-2: Relative Quantitative Analysis of Amphiregulin mRNA

(92) A relative amount of the amphiregulin mRNA was quantified by the following method through real-time PCR using the cDNA prepared by Example 4-3-1 as a template. The cDNA prepared in Example 4-3-1 was diluted 5 times with distilled water in each well of a 96-well plate. Then, in order to analyze an expression amount of the amphiregulin mRNA, 3 ?l of the diluted cDNA, 10 ?l of 2? GreenStar? PCR master mix (BIONEER, Korea), 6 ?l of distilled water, and 1 ?l of amphiregulin qPCR primers (SEQ ID NOS: 336 and 337 (Table 2); each 10 pmole/?l; BIONEER, Korea) were added thereto to prepare each mixed solution. Meanwhile, in order to normalize the expression amount of the amphiregulin mRNA, RPL13A (60S ribosomal protein L13a), which is a housekeeping gene (hereinafter, referred to as HK gene) was used as a reference gene. The following reaction was performed on the 96-well plate containing the mixed solution using Exicycler? 96 Real-Time Quantitative Thermal Block (BIONEER, Korea). After performing the reaction at 95? C. for 15 minutes to activate an enzyme and remove a secondary structure of the cDNA, four processes composed of a process of denaturing at 94? C. for 30 seconds, a process of annealing at 58? C. for 30 seconds, a process of extension at 72? C. for 30 seconds, and a process of SYBR green scan were repeated 42 times, and final extension was performed at 72? C. for 3 minutes. Then, the temperature was maintained at 55? C. for 1 minute, and a melting curve was analyzed from 55? C. to 95? C.

(93) After PCR was terminated, for a threshold cycle (Ct) value of each of the obtained target genes, Ct values of the target genes corrected through the RPL13A gene were calculated, and then a Ct value difference (?Ct) was obtained using a test group treated with the siRNA (siCONT) having a control sequence, not causing inhibition of gene expression, as a control group. The expression amount of the target gene in the cell treated with each of the amphiregulin-specific siRNAs (having sequences of SEQ ID NOS: 1 to 30 as the sense strands, respectively) was relatively quantified by using the ?Ct value and Calculation Equation, 2(??Ct)?100 (FIG. 2).

(94) In order to select a high-efficiency siRNA, 15 kinds of siRNAs in which the expression amount of the amphiregulin mRNA was significantly decreased by 70% or more, as compared to the control group at a final concentration of 20 nM, and which had sequences of SEQ ID NOS: 2, 6 to 9, 11, 17 to 21, 23, 24, 28, and 29 as the sense strands, respectively, were selected.

(95) TABLE-US-00003 TABLE2 SequenceInformationofPrimerforqPCR Primer Sequence SEQIDNO mRPL13A-F CGATAGTGCATCTTGGCCTTT 332 mRPL13A-R CCTGCTGCTCTCAAGGTTGTT 333 hRPL13A-F AGCTCATGAGGCTACGGAAA 334 hRPL13A-R CGTACATTCCAGGGCAACA 335 mAR-F GGTCTTAGGCTCAGGCCATTA 336 mAR-R CGCTTATGGTGGAAACCTCT 337 hAR-F ACACCTACTCTGGGAAGCGT 338 hAR-R GCCAGGTATTTGTGGTTCGT 339 mSFN-F GTGTGTGCGACACCGTACT 340 mSFN-R CTCGGCTAGGTAGCGGTAG 341 hSFN-F AGAAGCGCATCATTGACTCAG 342 hSFN-R TCTCGTAGTGGAAGACGGAAA 343

(96) (Here, m indicates a mouse-specific sequence; h indicates a human-specific sequence, AR indicates an amphiregulin-specific sequence, SFN indicates a stratifin-specific sequence, F indicates a forward primer, and R indicates a reverse primer)

Example 5

Inhibition of Expression of Amphiregulin Using siRNA Selected from Fibroblast Cell Line (NIH3T3)

(97) Mouse fibroblast cells (NIH3T3), which are the fibroblast cell lines, were transformed with the siRNAs having the sequences of SEQ ID NOS: 2, 6 to 9, 11, 17 to 21, 23, 24, 28, and 29 as the sense strands, respectively, selected in Example 4, and an expression profile of the amphiregulin mRNA in the transformed fibroblast cell line (NIH3T3) was analyzed.

(98) 5-1: Culture of Fibroblast Cell Line

(99) The mouse fibroblast cell line (NIH3T3) obtained from American Type Culture Collection (ATCC) was cultured in a RPMI 1640 culture medium (GIBCO/Invitrogen, USA, 10% (v/v) fetal bovine serum, 100 units/ml of penicillin, and 100 ?g/ml of streptomycin) under condition of 37? C. and 5% (v/v) CO.sub.2.

(100) 5-2: Transfection of Target siRNA into Fibroblast Cell Line

(101) After 1?10.sup.5 fibroblast cell lines cultured in Example 5-1 were cultured in a RPMI 1640 culture medium in a 12-well plate under condition of 37? C. and 5% (v/v) CO.sub.2 for 18 hours, the medium was removed, and 500 ?l of Opti-MEM medium (GIBCO, USA) for each well was dispensed.

(102) Meanwhile, a mixed solution was prepared by mixing 2 ?l of Lipofectamine? RNAi Max (Invitrogen, USA) and 248 ?l of Opti-MEM medium with each other, and the mixed solution was reacted at room temperature for 5 minutes. Then, 5 ?l of siRNAs (1 pmole/?l) each having any one sequence of SEQ ID NOS: 2, 6 to 9, 11, 17 to 21, 23, 24, 28, and 29 as the sense strand, selected in Example 4, were added to 245 ?l of Opti-MEM medium, thereby preparing siRNA solutions each having a final concentration of 5 nM. The mixed solution of Lipofectamine? RNAi Max was mixed and reacted with the siRNA solution at room temperature for 20 minutes, thereby preparing a transfection solution.

(103) Then, 500 ?l of each transfection solution was dispensed in each well of the tumor cell line containing Opti-MEM dispensed therein, and cultured for 6 hours, and the Opti-MEM medium was removed. Here, 1 ml of RPMI 1640 culture medium was dispensed therein and cultured under condition of 37? C. and 5% (v/v) CO.sub.2 for 24 hours.

(104) 5-3: Quantitative Analysis of Amphiregulin mRNA

(105) After preparing cDNA by extracting a total RNA from the cell line transfected in Example 5-2, an expression amount of the amphiregulin mRNA was relatively quantified using real-time PCR.

(106) 5-3-1: Separation of RNA from Transfected Cell and Preparation of cDNA

(107) The total RNA was extracted from the cell line transfected in Example 5-2 using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), and the extracted RNA was used to prepare cDNA by RNA reverse transcriptase (AccuPower CycleScript RT Premix/dT20, Bioneer, Korea) according to the following method. Specifically, the extracted RNA (1 ?g/tube) was added to AccuPower CycleScript RT Premix/dT20 (Bioneer, Korea) contained in 0.25 ml Eppendorf tube, and distilled water treated with diethyl pyrocarbonate (DEPC) was added thereto so as to have a total volume of 20 ?l. A process of hybridizing the RNA and primers at 30? C. for 1 minute by a gene amplifier (MyGeniem? 96 Gradient Thermal Block, BIONEER, Korea) and a process of preparing the cDNA at 52? C. for 4 minutes were repeated 6 times, and then, an amplification reaction was terminated by inactivating an enzyme at 95? C. for 5 minutes.

(108) 5-3-2: Relative Quantitative Analysis of Amphiregulin mRNA

(109) A relative amount of the amphiregulin mRNA was quantified by the following method through real-time PCR using the cDNA prepared by Example 5-3-1 as a template. The cDNA prepared in Example 5-3-1 was diluted 5 times with distilled water in each well of a 96-well plate. Then, in order to analyze an expression amount of the amphiregulin mRNA, 3 ?l of the diluted cDNA, 10 ?l of 2? GreenStar? PCR master mix (BIONEER, Korea), 6 ?l of distilled water, and 1 ?l of amphiregulin qPCR primers (SEQ ID NOS: 336 and 337 (Table 2); each 10 pmole/?l; BIONEER, Korea) were added thereto to prepare each mixed solution. Meanwhile, in order to normalize the expression amount of the amphiregulin mRNA, RPL13A, which is a housekeeping gene, was used as a reference gene. The following reaction was performed on the 96-well plate containing the mixed solution using Exicycler? 96 Real-Time Quantitative Thermal Block (BIONEER, Korea). After performing the reaction at 95? C. for 15 minutes to activate an enzyme and remove a secondary structure of the cDNA, four processes composed of a process of denaturing at 94? C. for 30 seconds, a process of annealing at 58? C. for 30 seconds, a process of extension at 72? C. for 30 seconds, and a process of SYBR green scan were repeated 42 times, and final extension was performed at 72? C. for 3 minutes. Then, the temperature was maintained at 55? C. for 1 minute, and a melting curve was analyzed from 55? C. to 95? C. After PCR was terminated, for a threshold cycle (Ct) value of each of the obtained target genes, Ct values of the target genes corrected through the RPL13A gene were calculated, and then a Ct value difference (?Ct) was obtained using a test group treated with the siRNA (siCONT) having a control sequence, not causing inhibition of gene expression, as a control group. The expression amount of the target gene in the cell treated with each of the amphiregulin-specific siRNAs was relatively quantified by using the ?Ct value and Calculation Equation, 2(??Ct)?100, such that changes in Expression amount of the mRNA by the amphiregulin-specific siRNAs having sequences of SEQ ID NOS: 2, 6 to 9, 11, 17 to 21, 23, 24, 28, and 29 as the sense strands, respectively, were relatively quantified.

(110) In order to select high-efficiency siRNAs, an IC50, which is a value at which expression of a target gene is inhibited by 50% after treatment with an siRNA, was confirmed, thereby selecting three kinds of siRNAs having the sequences of SEQ ID NOS: 8, 9, and 28 as the sense strands, respectively, showing the largest decrease in the expression amount of the amphiregulin mRNA at the final concentration of 5 nM as compared to the control group.

Example 6

Inhibition of Expression of Amphiregulin Using siRNA Selected from Fibroblast Cell Line (NIH3T3)

(111) Mouse fibroblast cells (NIH3T3), which are the fibroblast cell lines, were transformed with the siRNAs having the sequences of SEQ ID NOS: 8, 9, and 29 as the sense strands, respectively, selected in Example 5, and an expression profile of the amphiregulin mRNA in the transformed fibroblast cells (NIH3T3) was analyzed, thereby confirming an IC.sub.50 value of the siRNA.

(112) 6-1: Culture of Fibroblast Cell Line

(113) The mouse fibroblast cell line (NIH3T3) obtained from American Type Culture Collection (ATCC) was cultured in a RPMI 1640 culture medium (GIBCO/Invitrogen, USA, 10% (v/v) fetal bovine serum, 100 units/ml of penicillin, and 100 ?g/ml of streptomycin) under condition of 37? C. and 5% (v/v) CO.sub.2.

(114) 6-2: Transfection of Target siRNA into Fibroblast Cell Line

(115) After 1?10.sup.5 fibroblast cell lines cultured in Example 6-1 were cultured in a RPMI 1640 culture medium in a 12-well plate under condition of 37? C. and 5% (v/v) CO.sub.2 for 18 hours, the medium was removed, and 500 ?l of Opti-MEM medium (GIBCO, USA) for each well was dispensed.

(116) Meanwhile, a mixed solution was prepared by mixing 2 ?l of Lipofectamine? RNAi Max (Invitrogen, USA) and 248 ?l of Opti-MEM medium with each other, and the mixed solution was reacted at room temperature for 5 minutes. Then, 0.2, 1, and 5 ?l of siRNAs (1 pmole/?l) having sequences of SEQ ID NOS: 8, 9, and 28 as the sense strands, respectively, selected in Example 4, were added to 249.8, 249, and 245 ?l of Opti-MEM medium, respectively, thereby preparing siRNA solutions each having a final concentration of 0.2, 1, and 5 nM. The mixed solution of Lipofectamine? RNAi Max was mixed and reacted with the siRNA solution at room temperature for 20 minutes, thereby preparing a transfection solution.

(117) Then, 500 ?l of each transfection solution was dispensed in each well of the tumor cell line containing Opti-MEM dispensed therein, and cultured for 6 hours, and the Opti-MEM medium was removed. Here, 1 ml of RPMI 1640 culture medium was dispensed therein and cultured under condition of 37? C. and 5% (v/v) CO.sub.2 for 24 hours.

(118) 6-3: Quantitative Analysis of Amphiregulin mRNA

(119) After preparing cDNA by extracting a total RNA from the cell line transfected in Example 6-2, an expression amount of the amphiregulin mRNA was relatively quantified using real-time polymerase chain reaction (PCR).

(120) 6-3-1: Separation of RNA from Transfected Cell and Preparation of cDNA

(121) The total RNA was extracted from the cell line transfected in Example 6-2 using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), and the extracted RNA was used to prepare cDNA by RNA reverse transcriptase (AccuPower CycleScript RT Premix/dT20, Bioneer, Korea) according to the following method. Specifically, the extracted RNA (1 ?g/tube) was added to AccuPower CycleScript RT Premix/dT20 (Bioneer, Korea) contained in 0.25 ml Eppendorf tube, and distilled water treated with diethyl pyrocarbonate (DEPC) was added thereto so as to have a total volume of 20 ?l. A process of hybridizing the RNA and primers at 30? C. for 1 minute by a gene amplifier (MyGenie? 96 Gradient Thermal Block, BIONEER, Korea) and a process of preparing the cDNA at 52? C. for 4 minutes were repeated 6 times, and then, an amplification reaction was terminated by inactivating an enzyme at 95? C. for 5 minutes.

(122) 6-3-2: Relative Quantitative Analysis of Amphiregulin mRNA

(123) A relative amount of the amphiregulin mRNA was quantified by the following method through real-time PCR using the cDNA prepared by Example 6-3-1 as a template. The cDNA prepared in Example 6-3-1 was diluted 5 times with distilled water in each well of a 96-well plate. Then, in order to analyze an expression amount of the amphiregulin mRNA, 3 ?l of the diluted cDNA, 10 ?l of 2? GreenStar? PCR master mix (BIONEER, Korea), 6 ?l of distilled water, and 1 ?l of amphiregulin qPCR primers (SEQ ID NOS: 336 and 337 (Table 2); each 10 pmole/?l; BIONEER, Korea) were added thereto to prepare each mixed solution. Meanwhile, in order to normalize the expression amount of the amphiregulin mRNA, RPL13A, which is a housekeeping gene, was used as a reference gene. The following reaction was performed on the 96-well plate containing the mixed solution using Exicycler? 96 Real-Time Quantitative Thermal Block (BIONEER, Korea). After performing the reaction at 95? C. for 15 minutes to activate an enzyme and remove a secondary structure of the cDNA, four processes composed of a process of denaturing at 94? C. for 30 seconds, a process of annealing at 58? C. for 30 seconds, a process of extension at 72? C. for 30 seconds, and a process of SYBR green scan were repeated 42 times, and final extension was performed at 72? C. for 3 minutes. Then, the temperature was maintained at 55? C. for 1 minute, and a melting curve was analyzed from 55? C. to 95? C. After PCR was terminated, for a threshold cycle (Ct) value of each of the obtained target genes, Ct values of the target genes corrected through the RPL13A gene were calculated, and then a Ct value difference (?Ct) was obtained using a test group treated with the siRNA (siCONT) having a control sequence, not causing inhibition of gene expression, as a control group. The expression amount of the target gene in the cell treated with each of the amphiregulin-specific siRNAs was relatively quantified by using the ?Ct value and Calculation Equation, 2(??Ct)?100 (FIG. 3).

(124) As a result, in the cases of all of the amphiregulin-specific siRNAs having the sequences of SEQ ID NOS: 8, 9, and 28 as the sense strands, respectively, the expression amount of the amphiregulin mRNA was decreased by 50% or more even at a low concentration of 0.2 nM. Therefore, it was confirmed that the amphiregulin-specific siRNAs had an effect highly efficiently inhibiting expression of amphiregulin.

Example 7

Design of Target Base Sequence and Preparation of siRNA

(125) Human lung cancer cell line (A549), which is a lung tumor cell line, was transformed using the siRNAs having the sequences of SEQ ID NOS: 31 to 130 and 231 to 330 as the sense strands, respectively, prepared in Example 1, and an expression profile of a target gene in the transformed lung cancer cell line (A549) was analyzed.

(126) 7-1: Culture of Human Lung Cancer Cell Line

(127) The human lung cancer cell line (A549) obtained from American Type Culture Collection (ATCC) was cultured in a DMEM culture medium (GIBCO/Invitrogen, USA, 10% (v/v) fetal bovine serum, 100 units/ml of penicillin, and 100 ?g/ml of streptomycin) under condition of 37? C. and 5% (v/v) CO.sub.2.

(128) 7-2: Transfection of Target siRNA into Human Lung Cancer Cell Line

(129) After 1.2?10.sup.5 lung cancer cell lines (A549) cultured in Example 7-1 were cultured in a DMEM medium in a 6-well plate under condition of 37? C. and 5% (v/v) CO.sub.2 for 18 hours, the medium was removed, and 500 ?l of Opti-MEM medium (GIBCO, USA) for each well was dispensed.

(130) Meanwhile, a mixed solution was prepared by mixing 3.5 ?l of Lipofectamine? RNAi Max (Invitrogen, USA) and 246.5 ?l of Opti-MEM medium with each other, and the mixed solution was reacted at room temperature for 5 minutes. Then, 1 ?l of the siRNAs (1 pmole/?l) having sequences of SEQ ID NOS: 31 to 130 and 231 to 330 as the sense strands, respectively, prepared in Example 1, were added to 230 ?l of Opti-MEM medium, thereby preparing siRNA solutions each having a final concentration of 1 nM. The mixed solution of Lipofectamine? RNAi Max was mixed and reacted with the siRNA solution at room temperature for 15 minutes, thereby preparing a transfection solution.

(131) Then, 500 ?l of each transfection solution was dispensed in each well of the tumor cell line containing Opti-MEM dispensed therein, and cultured for 6 hours, and the Opti-MEM medium was removed. Here, 1 ml of RPMI 1640 culture medium was dispensed therein and cultured under condition of 37? C. and 5% (v/v) CO.sub.2 for 24 hours.

(132) 7-3: Quantitative Analysis of Target Gene mRNA

(133) After preparing cDNA by extracting a total RNA from the cell line transfected in Example 7-2 by the same method as in Example 4-3, an expression amount of the target gene mRNA was relatively quantified using real-time polymerase chain reaction (PCR).

(134) 7-4: Separation of RNA from Transfected Cell and Preparation of cDNA

(135) The total RNA was extracted from the cell line transfected in Example 7-2 using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), and the extracted RNA was used to prepare cDNA by RNA reverse transcriptase (AccuPower CycleScript RT Premix/dT20, Bioneer, Korea) according to the following method. Specifically, the extracted RNA (1 ?g/tube) was added to AccuPower CycleScript RT Premix/dT20 (Bioneer, Korea) contained in 0.25 ml Eppendorf tube, and distilled water treated with diethyl pyrocarbonate (DEPC) was added thereto so as to have a total volume of 20 ?l. A process of hybridizing the RNA and primers at 30? C. for 1 minute by a gene amplifier (MyGenie? 96 Gradient Thermal Block, BIONEER, Korea) and a process of preparing the cDNA at 52? C. for 4 minutes were repeated 6 times, and then, an amplification reaction was terminated by inactivating an enzyme at 90? C. for 5 minutes.

(136) 7-5: Relative Quantitative Analysis of Target Gene mRNA

(137) A relative amount of a respirator disease-related gene mRNA was quantified by the following method through real-time PCR using the cDNA prepared by Example 7-4 as a template. The cDNA prepared in Example 7-4 was diluted 5 times with distilled water in each well of a 96-well plate. Then, in order to analyze an expression amount of the target gene mRNA, 3 ?l of the diluted cDNA, 25 ?l of 2? GreenStar? PCR master mix (BIONEER, Korea), 19 ?l of distilled water, and 3 ?l of qPCR primers (amphiregulin gene, SEQ ID NOS: 338 and 339; stratifin gene, SEQ ID NOS: 342 and 343 (Table 2), F and R: each 10 pmole/?l; BIONEER, Korea) were added thereto to prepare each mixed solution. Meanwhile, in order to normalize the expression amount of the target gene mRNA, RPL13A, which is a housekeeping gene (hereinafter, referred to as HK gene) was used as a reference gene. The following reaction was performed on the 96-well plate containing the mixed solution using Exicycler? 96 Real-Time Quantitative Thermal Block (BIONEER, Korea). After performing the reaction at 95? C. for 15 minutes to activate an enzyme and remove a secondary structure of the cDNA, four processes composed of a process of denaturing at 94? C. for 30 seconds, a process of annealing at 58? C. for 30 seconds, a process of extension at 72? C. for 30 seconds, and a process of SYBR green scan were repeated 42 times, and final extension was performed at 72? C. for 3 minutes. Then, the temperature was maintained at 55? C. for 1 minute, and a melting curve was analyzed from 55? C. to 95? C. After PCR was terminated, for a threshold cycle (Ct) value of each of the obtained target genes, Ct values of the target genes corrected through the RPL13A gene were calculated, and then a Ct value difference (?Ct) was obtained using a test group treated with the siRNA (siCONT) having a control sequence, not causing inhibition of gene expression, as a control group.

(138) The expression amount of the target gene in the cell treated with each of the amphiregulin (Homo sapiens)-specific siRNAs (having sequences of SEQ ID NOS: 31 to 130 as the sense strands, respectively) was relatively quantified by using the ?Ct value and Calculation Equation, 2(??Ct)?100 (FIG. 4).

(139) Further, the expression amount of the target gene in the cell treated with each of the stratifin (Homo sapiens)-specific siRNAs (having sequences of SEQ ID NOS: 231 to 330 as the sense strands, respectively) was relatively quantified.

(140) As a result, in the cases of 26 kinds of human amphiregulin-specific siRNA and 47 kinds of human stratifin-specific siRNAs, expression of the target gene was inhibited by 50% or more at a concentration of 1 nM in the present invention, and thus it may be confirmed that these siRNAs highly efficiently inhibited expression of the target gene (see FIGS. 6 and 7).

Example 8

Selection of High-Efficiency Amphiregulin and Stratifin-Specific siRNAs for Human in Human Lung Cancer Cell Line (A549)

(141) Human lung cancer cell line (A549) was transformed using 26 kinds of human amphiregulin-specific siRNAs and 47 kinds of human stratifin-specific siRNAs having the sequences selected in Example 7-5 as the sense strands, respectively, and an expression profile of a target gene in the transformed lung cancer cell line (A549) was analyzed, thereby selecting high-efficiency siRNAs.

(142) 8-1: Culture of Human Lung Cancer Cell Line

(143) Human lung cancer cell line (A549) obtained from American Type Culture Collection (ATCC) was cultured under the same conditions as those in Example 7-1.

(144) 8-2: Transfection of Target siRNA into Human Lung Cancer Cell Line

(145) After 1.2?10.sup.5 lung cancer cell lines (A549) cultured in Example 8-1 were cultured in a DMEM medium in a 6-well plate under condition of 37? C. and 5% (v/v) CO.sub.2 for 18 hours, the medium was removed, and 500 ?l of Opti-MEM medium (GIBCO, USA) for each well was dispensed.

(146) Meanwhile, a mixed solution was prepared by mixing 3.5 ?l of Lipofectamine? RNAi Max (Invitrogen, USA) and 246.5 ?l of Opti-MEM medium with each other, and the mixed solution was reacted at room temperature for 5 minutes. Then, 0.2 ?l of siRNAs (that is, 26 kinds of human amphiregulin-specific siRNAs and 47 kinds of human stratifin-specific siRNAs, 1 pmole/?l) having the sequences selected in Example 7-5 as the sense strands, respectively, were added to 230 ?l of Opti-MEM medium, thereby preparing siRNA solutions each having a final concentration of 0.2 nM. The mixed solution of Lipofectamine? RNAi Max was mixed and reacted with the siRNA solution at room temperature for 15 minutes, thereby preparing a transfection solution.

(147) Then, 500 ?l of each transfection solution was dispensed in each well of the tumor cell line containing Opti-MEM dispensed therein, and cultured for 6 hours, and the Opti-MEM medium was removed. Here, 1 ml of RPMI 1640 culture medium was dispensed therein and cultured under condition of 37? C. and 5% (v/v) CO.sub.2 for 24 hours.

(148) 8-3: Quantitative Analysis of Target Gene mRNA

(149) After preparing cDNA by extracting a total RNA from the cell line transfected in Example 8-2 by the same method as in Example 4-3, an expression amount of the target gene mRNA was relatively quantified using real-time polymerase chain reaction (PCR).

(150) 8-4: Separation of RNA from Transfected Cell and Preparation of cDNA

(151) The total RNA was extracted from the cell line transfected in Example 8-2 using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), and the extracted RNA was used to prepare cDNA by RNA reverse transcriptase (AccuPower CycleScript RT Premix/dT20, Bioneer, Korea) according to the following method. Specifically, the extracted RNA (1 ?g/tube) was added to AccuPower CycleScript RT Premix/dT20 (Bioneer, Korea) contained in 0.25 ml Eppendorf tube, and distilled water treated with diethyl pyrocarbonate (DEPC) was added thereto so as to have a total volume of 20 ?l. A process of hybridizing the RNA and primers at 30? C. for 1 minute by a gene amplifier (MyGenie? 96 Gradient Thermal Block, BIONEER, Korea) and a process of preparing the cDNA at 52? C. for 4 minutes were repeated 6 times, and then, an amplification reaction was terminated by inactivating an enzyme at 90? C. for 5 minutes.

(152) 8-5: Relative Quantitative Analysis of Target Gene mRNA

(153) A relative amount of a respirator disease-related gene mRNA was quantified by the following method through real-time PCR using the cDNA prepared by Example 8-4 as a template. The cDNA prepared in Example 8-4 was diluted 5 times with distilled water in each well of a 96-well plate. Then, in order to analyze an expression amount of the target gene mRNA, 3 ?l of the diluted cDNA, 25 ?l of 2? GreenStar? PCR master mix (BIONEER, Korea), 19 ?l of distilled water, and 3 ?l of qPCR primers (amphiregulin gene, SEQ ID NOS: 338 and 339; stratifin gene, SEQ ID NOS: 342 and 343 (Table 2), F and R: each 10 pmole/?l; BIONEER, Korea) were added thereto to prepare each mixed solution. Meanwhile, in order to normalize an expression amount of the target gene mRNA, RPL13A, which is a housekeeping gene, was used as a reference gene. The following reaction was performed on the 96-well plate containing the mixed solution using Exicyclerm ? 96 Real-Time Quantitative Thermal Block (BIONEER, Korea). After performing the reaction at 95? C. for 15 minutes to activate an enzyme and remove a secondary structure of the cDNA, four processes composed of a process of denaturing at 94? C. for 30 seconds, a process of annealing at 58? C. for 30 seconds, a process of extension at 72? C. for 30 seconds, and a process of SYBR green scan were repeated 42 times, and final extension was performed at 72? C. for 3 minutes. Then, the temperature was maintained at 55? C. for 1 minute, and a melting curve was analyzed from 55? C. to 95? C. After PCR was terminated, for a threshold cycle (Ct) value of each of the obtained target genes, Ct values of the target genes corrected through the RPL13A gene were calculated, and then a Ct value difference (?Ct) was obtained using a test group treated with the siRNA (siCONT) having a control sequence, not causing inhibition of gene expression, as a control group.

(154) The expression amount of the target gene in the cell treated with each of the amphiregulin (Homo sapiens)-specific siRNAs was relatively quantified by using the ?Ct value and Calculation Equation, 2(??Ct)?100 (FIG. 6).

(155) In addition, the expression amount of the target gene in the cell treated with each of the stratifin (Homo sapiens)-specific siRNAs was relatively quantified (FIG. 7).

(156) As a result, in the cases of 7 kinds of high-efficiency human amphiregulin-specific siRNAs (SEQ ID NOS: 59, 75, 79, 80, 91, 92, and 102), expression of human amphiregulin was inhibited by 70% or more at a concentration of 0.2 nM in the present invention, and in the cases of 8 kinds of high-efficiency human stratifin-specific siRNAs (SEQ ID NOS: 241, 248, 257, 258, 263, 268, 290, and 327), expression of human stratifin was inhibited by 60% or more at a concentration of 0.2 nM in the present invention. Therefore, it may be confirmed that these siRNAs may highly efficiently inhibit expression of the target gene.

Example 9

Inhibition of Expression of Target Gene in Tumor Cell Line Using Nanoparticle Made of SAMiRNA

(157) Human lung cancer cell line (A549) was transformed using nanoparticles made of SAMiRNAs prepared in Example 3-1 using 3 kinds of human amphiregulin-specific siRNAs having the sequences of SEQ ID NOS: 79, 80, and 91 and 5 kinds of human stratifin-specific siRNAs having the sequences of SEQ ID NOS: 248, 257, 268, 290, and 327 selected in Example 8-5 as the sense strands, respectively, and an expression profile of a target gene in the transformed lung cancer cell line (A549) was analyzed.

(158) 9-1: Culture of Human Lung Cancer Cell Line

(159) Human lung cancer cell line (A549) obtained from American Type Culture Collection (ATCC) was cultured under the same conditions as those in Example 7-1.

(160) 9-2: Transformation of Human Lung Cancer Cell Line Using Nanoparticle Made of SAMiRNA

(161) After 0.8?10.sup.5 human lung cancer cell lines (A549) cultured in Example 9-1 were cultured in a DMEM medium in a 12-well plate under condition of 37? C. and 5% (v/v) CO.sub.2 for 18 hours. In order to prepare transfection solutions of SAMiRNA containing the amphiregulin-specific siRNAs (SEQ ID NOS: 79, 80, and 91) and the stratifin-specific siRNAs (SEQ ID NOS: 248, 257, 268, 290, and 327) at concentrations of 50 nM, 100 nM, 200 nM, 500 nM, 13.3 ?l, respectively, 26.6 ?l, 53.2 ?l, and 133.0 ?l of SAMiRNAs and 986.7 ?l, 973.4 ?l, 976.8 ?l, and 867.0 ?l of Opti-MEM medium (GIBCO, USA) were mixed with each other so as to have a total volume of 1 ml. After the cell culture medium was removed, 1 ml of each transfection solution was treated in each well, and the cells were cultured under condition of 37? C. and 5% (v/v) CO.sub.2. The transfection solution was replaced with a new solution every 12 hours, and this process was repeated 4 times for 48 hours.

(162) 9-3: Quantitative Analysis of Target Gene mRNA

(163) After preparing cDNA by extracting a total RNA from the cell line transfected in Example 9-2 by the same method as in Example 4-3, an expression amount of the target gene mRNA was relatively quantified using real-time polymerase chain reaction (PCR).

(164) 9-4: Separation of RNA from Transfected Cell and Preparation of cDNA

(165) The total RNA was extracted from the cell line transfected in Example 9-2 using an RNA extraction kit (AccuPrep Cell total RNA extraction kit, BIONEER, Korea), and the extracted RNA was used to prepare cDNA by RNA reverse transcriptase (AccuPower RocketScript RT Premix/dT20, Bioneer, Korea) according to the following method. Specifically, the extracted RNA (1 ?g/tube) was added to AccuPower RocketScript RT Premix/dT20 (Bioneer, Korea) contained in 0.25 ml Eppendorf tube, and distilled water treated with diethyl pyrocarbonate (DEPC) was added thereto so as to have a total volume of 20 ?l. A process of hybridizing the RNA and primers at 30? C. for 1 minute by a gene amplifier (MyGenie? 96 Gradient Thermal Block, BIONEER, Korea) and a process of preparing the cDNA at 52? C. for 4 minutes were repeated 6 times, and then, an amplification reaction was terminated by inactivating an enzyme at 90? C. for 5 minutes.

(166) 9-5: Relative Quantitative Analysis of Target Gene mRNA

(167) A relative amount of a respirator disease-related gene mRNA was quantified by the following method through real-time PCR using the cDNA prepared by Example 9-4 as a template. The cDNA prepared in Example 9-4 was diluted 5 times with distilled water in each well of a 96-well plate. Then, in order to analyze an expression amount of the target gene mRNA, 3 ?l of the diluted cDNA, 25 ?l of 2? GreenStar ? PCR master mix (BIONEER, Korea), 19 ?l of distilled water, and 3 ?l of qPCR primers (amphiregulin gene, SEQ ID NOS: 338 and 339; stratifin gene, SEQ ID NOS: 342 and 343 (Table 2), F and R: each 10 pmole/?l; BIONEER, Korea) were added thereto to prepare each mixed solution. Meanwhile, in order to normalize an expression amount of the target gene mRNA, RPL13A, which is a housekeeping gene, was used as a reference gene. The following reaction was performed on the 96-well plate containing the mixed solution using Exicyclerm ? 96 Real-Time Quantitative Thermal Block (BIONEER, Korea). After performing the reaction at 95? C. for 15 minutes to activate an enzyme and remove a secondary structure of the cDNA, four processes composed of a process of denaturing at 94? C. for 30 seconds, a process of annealing at 58? C. for 30 seconds, a process of extension at 72? C. for 30 seconds, and a process of SYBR green scan were repeated 42 times, and final extension was performed at 72? C. for 3 minutes. Then, the temperature was maintained at 55? C. for 1 minute, and a melting curve was analyzed from 55? C. to 95? C. After PCR was terminated, for a threshold cycle (Ct) value of each of the obtained target genes, Ct values of the target genes corrected through the RPL13A gene were calculated, and then a Ct value difference (?Ct) was obtained using a test group treated with the SAMiRNA-CONT (siCONT) having a control sequence, not causing inhibition of gene expression, as a control group.

(168) The expression amount of the target gene in the cell treated with each of the amphiregulin (Homo sapiens)-specific SAMiRNAs was relatively quantified by using the ?Ct value and Calculation Equation, 2(??Ct)?100 (FIG. 8).

(169) In addition, the expression amount of the target gene in the cell treated with each of the stratifin (Homo sapiens)-specific SAMiRNAs was relatively quantified (FIG. 9).

(170) As a result, it was confirmed that at the time of treating the human lung cancer cell line (A549) with SAMiRNA-hAR (#80), and SAMiRNA-hSFN (#248, #290) at a concentration of 500 nM or 200 nM, expression of the target gene of the human lung cancer cell line (A549) was inhibited by 70%.

INDUSTRIAL APPLICABILITY

(171) Since an siRNA according to the present invention may significantly efficiently inhibit expression of a respiratory disease-related gene, particularly, amphiregulin or stratifin, the siRNA according to the present invention, a double-stranded oligo RNA structure containing the same, and a nanoparticle containing the double-stranded oligo RNA structure may be usefully used to prevent or treat fibrosis or respiratory diseases.

(172) Although the present invention has been described in detail based on particular features thereof, and it is obvious to those skilled in the art that these specific technologies are merely preferable embodiments and thus the scope of the present invention is not limited to the embodiments. Therefore, the substantial scope of the present invention is defined by the accompanying claims and equivalent thereof.