Glucoamylase mutant GA3 with improved specific activity and thermal stability, and gene and application thereof

11512298 · 2022-11-29

Assignee

Inventors

Cpc classification

International classification

Abstract

Glucoamylase mutant GA3 with improved specific activity and thermal stability, and its gene and application are provided, belonging to the field of gene engineering. The glucoamylase mutant GA3 of the present invention obtained by sequentially mutation at fixed points starting from wild glucoamylase processes both improved thermal stability and catalytic efficiency, and can be applied to the industries of feed, food, medicine and the like.

Claims

1. A glucoamylase mutant GA3 with improved specific activity and thermal stability, the amino acid sequence is set forth in SEQ ID NO: 4.

2. A method for preparing the glucoamylase mutant GA3 with improved specific activity and thermal stability of claim 1, comprising steps of: (1) performing mutation based on glucoamylase TlGA1931, mutating the amino acid residue at position 132 in the amino acid sequence from Ser to Cys, the amino acid residue at position 492 from Tyr to Cys, the amino acid residue at position 548 from Leu to Cys, and the amino acid residue at position 562 from Ala to Cys, to obtain a glucoamylase mutant GA1 of glucoamylase TlGA1931, wherein the amino acid sequence of glucoamylase TlGA1931 is set forth in SEQ ID NO.1; (2) performing mutation based on the glucoamylase mutant GA1, mutating the amino acid residue at position 108 in the amino acid sequence from Gln to Glu, to obtain a glucoamylase mutant GA2; (3) performing mutation based on the glucoamylase mutant GA2, mutating amino acids at position 468 from Ala to Asp, position 469 from Tyr to Pro and omitting the amino acid at position 470 respectively, to obtain the glucoamylase mutant GA3.

3. A glucoamylase mutant gene encoding the glucoamylase mutant GA3 with improved specific activity and thermal stability of claim 1.

4. The glucoamylase mutant gene according to claim 3, the nucleotide sequence is set forth in SEQ ID NO: 8.

5. A recombinant vector comprising the glucoamylase mutant gene of claim 3.

6. An isolated recombinant host cell comprising the glucoamylase mutant gene of claim 3.

7. A method for preparing a glucoamylase with improved specific activity and thermal stability using the glucoamylase mutant GA3 of claim 1, comprising steps of: (1) transforming a host cell with a recombinant vector comprising a gene encoding the glucoamylase mutant GA3 of claim 1, to obtain a recombinant strain; (2) cultivating the recombinant strain to induce expression of the glucoamylase mutant; (3) recovering and purifying the expressed mutant glucoamylase, to prepare a glucoamylase with improved specific activity and thermal stability.

8. A method of applying the glucoamylase mutant GA3 of claim 1 for preparing a glucoamylase with improved specific activity and thermal stability.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the thermal stability analysis results of glucoamylase mutants GA1 to GA3 of the present disclosure at 70° C.;

(2) FIG. 2 shows the thermal stability analysis results of glucoamylase mutants GA1 to GA3 of the present disclosure at 75° C.;

(3) FIG. 3 shows the analysis results of glucoamylase mutants GA1 to GA3 of the present disclosure at the optimum temperature.

DETAILED DESCRIPTION OF EMBODIMENTS

(4) Test Materials and Reagents

(5) 1. Strains and vectors: Pichia pastoris GS115, Pichia expression vector pPIC9 and strain GS115.

(6) 2. Enzymes and other biochemical reagents: the ligase was purchased from Invitrogen, the site-directed mutagenesis kit was purchased from Quanshijin Company, and the others were domestic reagents (all available from ordinary biochemical reagent companies).

(7) 3. Culture Medium:

(8) (1) E. coli culture medium LB (1% peptone, 0.5% yeast powder, 1% NaCl, pH 7.0).

(9) (2) BMGY medium: 1% yeast powder, 2% peptone, 1.34% YNB, 0.000049<Biotin, 1% glycerol (v/v).

(10) (3) BMMY medium: replacement of glycerol with 0.5% methanol, and the other components were identical with BMGY medium.

(11) Note: The molecular biology experiment methods that were not specifically explained in the following embodiments were all carried out with reference to the specific methods listed in the “Molecular Cloning Experiment Guide” (Version 3) J. Sambrook, or according to the kit and the product instruction.

Embodiment 1—Site-Directed Mutagenesis of Glucoamylase

(12) Using the glucoamylase TlGA1931 plasmid pPIC9-Tlga1931 sequence as a template, the base at position 132 in the glucoamylase TlGA1931 amino acid sequence was mutated from Ser to Cys, the base at position 492 was mutated from Tyr to Cys, the base at position 548 was mutated from Leu to Cys, the base at position 562 was mutated from Ala to Cys, to obtain a glucoamylase mutant GA1; the base at position 108 in the amino acid sequence of the glucoamylase TlGA1931 mutant GA1 was mutated from Gln to Glu to obtain a glucoamylase Mutant GA2; the bases at positions 468, 469, 470 in the amino acid sequence of the glucoamylase TlGA1931 mutant GA2 were mutated from Ala, Tyr, Ser to either Asp or Pro respectively, to obtain a glucoamylase mutant GA3. The primers for each round of site-directed mutation were shown in the table below:

(13) TABLE-US-00009 TABLE 1  Primers required for the experiment Primer SEQ Primer length ID name Primer sequence (5′.fwdarw.3′).sup.a (bp) NO: S132CF CTCTGGCGGCCTGTGTACTGGAGGTC 26  9 S132CR ACACAGGCCGCCAGAGGGGTTGGACAC 27 10 Y492CF CTGCCTCAGGCCCCTGTGCCACCGCGAC 28 11 Y492CR ACAGGGGCCTGAGGCAGACGAGGCCGA 27 12 L548CF AGTTCCGCTATCCCGTGTAGCGCGGCCGA 29 13 L548CR ACACGGGATAGCGGAACTAGGACTCCAA 28 14 A562CF CGCCGTTGTGGTATTGTATCGTGACGTT 28 15 A562CR ACAATACCACAACGGCGTCTGTGAGTT 27 16 Q108EF TGGGGATGCGAACCTGGAGTCGGTGAT 27 17 Q108ER TCCAGGTTCGCATCCCCAGTCGAGAT 26 18 AY5468- ATTTCTCCGTCCCCGATCCATGGGGCGAA 29 19 470DPF AYS468- ATGGATCGGGGACGGAGAAATTTCTGCGC 29 20 470DPR

Embodiment 2 Construction of Glucoamylase Engineering Strain

(14) (1) Construction of Expression Vector and Expression in Yeast

(15) Using the glucoamylase recombinant plasmid pPIC9-Tlga1931 as a template, the mutant was amplified using site-directed mutagenesis reagents. After verification by nucleic acid gel, 1 μL DMT enzyme was added to the PCR product, mixed and incubated at 37° C. for 1 h. The PCR product digested with 2-5 μL DMT enzyme was transformed by heat shock into competent cell DMT. The positive transformants were selected for DNA sequencing. The transformants with the correct sequence were used to prepare large quantities of recombinant plasmids. Plasmid vector DNA was linearized expressed with restriction enzyme BglII, and yeast GS115 competent cells were transformed by electroporation followed by culture at 30° C. for 2-3 days, then transformants grown on MD plates were picked out for further expression experiments. Please refer to the Pichia pastoris expression manual for specific operations. Then the glucoamylase positive clone strains, which were GS115/GA1, GA2, GA3 in sequence, were screened by the color reaction on the MM plate.

Embodiment 3 Preparation of Recombinant Glucoamylase

(16) (1) A Large Amount of Glucoamylase Expression in Pichia pastoris at Shake Flask Level

(17) The transformants with higher enzyme activity were selected and inoculated into 300 mL BMGY liquid medium in a 1 L Erlenmeyer flask, and cultured with shaking at 30° C., 220 rpm for 48 h; centrifuged at 4500 rpm for 5 min followed by discarding the supernatant, and then addition of 200 mL BMMY liquid medium containing 0.5% methanol to the bacteria with induction culture at 30° C. for 48 h. During the induction culture period, methanol solution was added once every 24 h to compensate for the loss of methanol to keep the methanol concentration at about 0.5%; followed by centrifuging at 12,000×g for 10 min, collecting the supernatant fermentation broth, detecting enzyme activity and performing SDS-PAGE protein electrophoresis analysis.

(18) (2) Purification of Recombinant Glucoamylase

(19) The supernatant of recombinant glucoamylase cultured in shake flask fermentation was collected, and the fermentation broth was concentrated using a 10 kDa membrane package. Meanwhile, the medium was replaced with 10 mM disodium hydrogen phosphate-citrate buffer at pH 6.3, followed by passing through an anion exchange column to purify.

Embodiment 4 Determination of the Enzymatic Property of Purified Glucoamylase Mutant

(20) The activity of the glucoamylase of the present invention was analyzed by the DNS method. The specific method was as follows:

(21) under the optimal pH and temperature conditions of each mutant (the optimal pH was 4.5, the optimal temperature was GA1-70° C., GA2, GA3-75° C., respectively), 1 mL reaction system including 100 μL of appropriate diluted enzyme solution, 900 μL of substrate was reacted for 30 min, with addition of 1.5 mL DNS to stop the reaction, followed by boiling for 5 min. OD value was measured at 540 nm after cooling. Definition of glucoamylase activity unit: under the corresponding optimal temperature and optimal pH conditions, the amount of enzyme required to catalyze the hydrolysis of substrates and release 1 μmol of reducing sugars per minute was an enzyme activity unit (U).

(22) Identification and Determination of the three glucoamylase mutants GA1, GA2, and GA3 of the present disclosure and their enzyme activity and thermal stability:

(23) 1. Determination of the Enzyme Activity of the Three Glucoamylase Mutants GA1, GA2 and GA3.

(24) Each mutant of the purified glucoamylase of the present invention was subjected to an enzymatic reaction at pH 4.5, under 70° C. and 75° C. to determine its enzyme activity.

(25) The glucoamylase mutant GA1 had the specific activity of 806 U/mg, the glucoamylase mutant GA2 had the specific activity of 1054 U/mg, and the glucoamylase mutant GA3 had the specific activity of 1540 U/mg. Compared with the wild-type glucoamylase TlGA1931 (496 U/mg), their specific activities were increased by 62.5%, 112% and 210%, respectively.

(26) 2. Determination of the Stability of the Three Glucoamylase Mutants GA1, GA2 and GA3 at 70° C. and 75° C.:

(27) In a 0.1 mol/L citric acid-disodium hydrogen phosphate buffer (pH 6.3) buffer system, glucoamylase mutants GA1, GA2, and GA3 were treated at 70° C. for 0, 2, 5, 10, 20, 30, 60 min, and treated at 75° C. for 0, 2, 5, 10, 20, 30, 60 min, followed by determination of the relative remaining enzyme activity at the corresponding optimum temperature.

(28) As shown in FIG. 1, the relative remaining enzyme activity of the wild type was 14% after being treated at 70° C. for 10 min, which was close to inactivation. The remaining enzyme activities of the modified glucoamylase mutants GA1, GA2, and GA3 were 70%, 90%, 86%, respectively.

(29) As shown in FIG. 2, the relative remaining enzyme activity of the wild type after treatment at 75° C. for 2 min was 13%, which was close to inactivation. The remaining enzyme activities of the modified glucoamylase mutants GA1, GA2, and GA3 were 80%, 95%, 80%, respectively.

(30) 3. Determination of the Optimum Temperature:

(31) The three mutants of glucoamylase GA1, GA2, GA3 were tested for their enzyme activity at 20, 30, 40, 50, 55, 60, 65, 70, 80, 85, 90° C. and pH 4.5, respectively. As shown in FIG. 3, the optimum temperature for glucoamylase mutants GA1, GA2, and GA3 were 70° C., 75° C., and 75° C., respectively.

(32) 4. The Optimum pH and pH Stability of the Three Mutants of Glucoamylase GA1, GA2 and GA3 were Substantially Consistent with Those of the Wild Type.