METHOD FOR EXTRACTING 2',3'-CYCLIC NUCLEOSIDE MONOPHOSPHATES
20190048044 ยท 2019-02-14
Assignee
Inventors
- Xiulan CHEN (Jinan, CN)
- Yuzhong ZHANG (Jinan, CN)
- Ang Liu (Jinan, CN)
- Yang Yu (Jinan, CN)
- Binbin Xie (Jinan, CN)
- Qilong Qin (Jinan, CN)
- Xiaoyan SONG (Jinan, CN)
- Mei Shi (Jinan, CN)
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
C12Q1/6876
CHEMISTRY; METALLURGY
C12P19/32
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
Abstract
It relates to a method for preparation of four kinds of 2, 3-cNMPs (2, 3-cAMP, 2, 3-cGMP, 2, 3-cCMP and 2, 3-cUMP), comprising steps of: (1) extract genomic DNA and amplify gene If3; (2) ligate If3 gene to expression plasmid to construct a recombinant vector, and transfer the recombinant vector to E. coli to obtain a recombinant strain. Cultivate the recombinant strain and collect the fermentation broth; (3) collect the cells form the fermentation broth and disrupt the cells, and then purify the recombinant protein IF3 from the cell extract by Ni.sup.2+-nitrilotriacetic acid resin. Incubate the recombinant protein IF3 solution at 0 C. for 3 days to release 2, 3-cNMPs from IF3, and centrifuge the solution; (4) Ultrafiltrate the supernatant to remove proteins, and prepare four kinds of 2, 3-cNMPs by high-performance liquid chromatographic (HPLC) on a C.sub.18 reversed-phase column.
Claims
1. A method for preparation of 2, 3-cNMPs comprising steps of: (1) extract the genomic DNA from Escherichia coli K12, and amplify gene If3 which encodes protein IF3 by PCR, the sequences of PCR primers are as follows: F-GGAATTCCATATGATTAAAGGCGGAAAACG (SEQ ID NO: 1) and R-CCGCTCGAGCTGTTTCTTCTTAGG SEQ ID NO: 2); (2) digest the obtained gene If3 from step (1) with specific restriction enzymes, insert the digested If3 gene into vector pET-22b (+) digested with the same enzymes to generate the expression vector, then transform the expression vector into E. coli BL21 (DE3) to obtain the recombinant strain. Cultivate the recombinant strain and collect the fermentation broth; (3) collect the cells from the fermentation broth from step (2) by centrifugation, break the cells and purify the recombinant protein IF3 from the cell extract by Ni.sup.2+-nitrilotriacetic acid resin, incubate the recombinant protein IF3 solution at 0 C. for 2.5-3.5 days to release 2, 3-cNMPs from protein IF3, centrifuge the solution and collect the supernatant containing 2, 3-cNMPs; (4) ultra-filtrate the supernatant from step (3) to remove proteins, and prepare four kinds of 2, 3-cNMPs from the filtrate by high-performance liquid chromatographic (HPLC) on a C.sub.18 reversed-phase column.
2. The method of claim 1 wherein the PCR amplification system in step (1) is as follows: TABLE-US-00008 sterilized distilled water 32.2 l 5 TransStart FastPfu buffer 10 l dNTP mix 5 l primer F (50 M) 0.4 l primer R (50 M) 0.4 l genomic DNA 1 l transStart FastPfu DNA polymerase 1 l PCR reaction conditions in step (1) are as follows: pre-denature at 95 C. for 5 min; denature at 95 C. for 30 sec; anneal at 55 C. for 30 sec; extend at 72 C. for 30 sec; 30 cycles; finally extend at 72 C. for 5 min.
3. The method of claim 1 wherein the digestion in step (2) is performed by restriction enzymes Nde I and Xho I, and the digestion reaction system is as follows: TABLE-US-00009 buffer 2 l expression plasmid pET-22b/gene If3 8 l restriction enzyme Nde I 1 l restriction enzyme Xho I 1 l sterilized distilled water 8 l reaction condition: water bath at 37 C. for 30 min.
4. The method of claim 1 wherein the ligation reaction system in step (2) is: TABLE-US-00010 digested vector pET-22b 1 l digested gene If3 4 l solution I 5 l reaction condition: incubation at 16 C. overnight.
5. The method of claim 1 wherein the strain cultivation procedure in step (2) comprises steps of: cultivate the recombinant strain at 150-200 rpm and 35-38 C. until the OD.sub.600 of the culture reaches 0.8; then incubate the culture at 100-140 rpm and 18-22 C. for 30 min; add 0.1 mM isopropul--D-thiogalactopyranoside into the culture as an inducer and continue to cultivate the strain at 100-140 rpm and 18-22 C. for 22-25 hours; the preferred culture medium is freshwater Luria-Bertani (LB) medium (1 liter medium contains 10 g NaCl, 10 g peptone and 5 g yeast extract dissolved in distilled water, pH 8.0); the preferred cell disruption procedure in step (3) is as follows: collect the cells and suspend them in lysis buffer, then break the cells under the pressure of 950-1050 bar; after centrifugation at 12,000 rpm for 50 min, collect the supernatant containing the recombinant protein IF3; the components of the lysis buffer are as follows: 50 mM Tris-HCl, and 150 mM NaCl, pH 8.0.
6. The method of claim 1 wherein the procedure for recombinant protein IF3 purification by Ni.sup.2+-nitrilotriacetic acid resin in step (3) comprises steps of: load the supernatant from the cell extract from step (3) on a nickel column containing 2 ml gel; after the supernatant flowed through the nickel column, equilibrate the column with 20 ml lysis buffer, wash the column with 20 ml washing buffer, elute the column with 10 ml elution buffer and collect the eluent containing recombinant protein IF3; the components of the lysis buffer are as follows: 50 mM Tris-HCl, 150 mM NaCl, pH 8.0; the components of the washing buffer are as follows: 50 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0; the components of the elution buffer are as follows: 50 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 8.0.
7. The method of claim 1 wherein the molecular weight cutoff for ultrafiltration in step (4) is 3000 Da.
8. The method of claim 1 wherein the purification protocol in step (4) is as follows (the values are times in minutes and percentage of buffer B used): 0.0, 0; 2.5, 0; 5.0, 30; 10.0, 60; 14.0, 100; 21.0, 100; 22.0, 50 and 23.0, 0 at a flow rate of 10 ml/min. The detection wavelength is 254 nm; the mobile phases in step (4) used in the gradient program are as follows: buffer A (10 mM ammonium acetate, pH 5.0) and buffer B (75% (v/v) buffer A, 25% (v/v) methanol).
Description
FIGURE LEGENDS
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
ILLUSTRATIVE EMBODIMENTS
[0037] The following comprises a list of illustrative embodiments according to the present invention which represent various embodiments of the present invention. These examples are offered to illustrate, but not to limit the present invention. E. coli K12 was purchased from China Center of Industrial Culture Collection (CICC) in these examples. The address is: the 6.sup.th building, 24.sup.th courtyard of the Jiuxianqiao middle road, Chaoyang district, Beijing, China. The accession number is CICC 10424.
[0038] E. coli BL21 (DE3) competent cell in these examples was purchased from Beijing TransGen Biotech Co., Ltd. The address is: the 4.sup.th floor of the B-3 building, Dongsheng Science Park of Zhongguancun, 66.sup.th of Xixiaokou Road, Haidian District, Beijing, China.
EXAMPLE 1
[0039] The method to construct the recombinant strain includes the following steps:
[0040] 1. Cloning Gene If3 from E. coli K12.
[0041] 1.1 Extraction of Genomic DNA from E. coli K12
[0042] The genomic DNA was extracted according to the instructions of genome extraction kit from Bioteke Corporation, China.
[0043] 1.2 Design and Synthesis of the Primers
[0044] Primers were designed according to the If3 gene sequence. The primer sequences were as follows:
TABLE-US-00004 F: (SEQIDNO:1) GGAATTCCATATGATTAAAGGCGGAAAACG; R: (SEQIDNO:2) CCGCTCGAGCTGTTTCTTCTTAGG.
[0045] Primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd, China.
[0046] 1.3 Amplification of Gene If3 by PCR and its Recovery
[0047] (1) Gene If3 was amplified with primers F and R, using the genomic DNA as a template. Conditions for PCR reaction were as follows: pre-denaturing at 95 C. for 5 min; denaturing at 95 C. for 30 sec; annealing at 55 C. for 30 sec; extending at 72 C. for 30 sec; 30 cycles; finally extending at 72 C. for 5 min.
[0048] The PCR amplification system (50 l) was as follows:
TABLE-US-00005 Sterilized distilled water 32.2 l 5 TransStart FastPfu buffer 10 l dNTP mix 5 l Primer F (50 M) 0.4 l Primer R (50 M) 0.4 l Genomic DNA 1 l TransStart FastPfu DNA polymerase 1 l
[0049] (2) The PCR products were separated by 1% agarose gel electrophoresis. The DNA fragment of gene If3 was recovered from the gel with DNA purification kit from Omega.
[0050] 2. Construction of the Recombinant Expression Vector and Recombinant Expression Strain.
[0051] (1) Digestion of the Gene and Expression Vector
[0052] The If3 gene obtained from step 1 and vector pET-22b were digested with restriction enzymes Nde I and Xho I. The reaction system for digestion was as follows:
TABLE-US-00006 Buffer 2 l Expression plasmid pET-22b/gene If3 8 l Restriction enzyme NdeI 1 l Restriction enzyme XhoI 1 l Sterilized distilled water 8 l
[0053] The sample was mixed smoothly, centrifuged for 2 sec and then incubated at 37 C. for 30 min. The digested products were separated by 1% agarose gel electrophoresis, and the target DNA segments of gene If3 and vector pET-22b were recovered from the gel using DNA purification kit from Omega.
[0054] (2) Ligation of Gene If3 and Vector pET-22b to Construct the Recombinant pET-22b-If3 Vector
[0055] The reaction system was as follows:
TABLE-US-00007 Digested vector pET-22b 1 l Digested gene If3 4 l Solution I 5 l
[0056] The sample was mixed smoothly, centrifuged for 2 sec and incubated at 16 C. overnight. Then the recombinant pET-22b-If3 vector was constructed.
[0057] (4) The recombinant pET-22b-If3 vector was transformed into E. coli BL21 (DE3) according to the method described in Molecular Cloning Manual, and transformed E. coli cells were obtained.
[0058] (5) The transformed E. coli cells were spread on LB agar plate containing 100 g/ml ampicilin and cultivated at 37 C. overnight.
[0059] (6) The recombinant strain was screened from the plate and verified by recombinant plasmid extraction and sequencing in Sangon Biotech (Shanghai) Co., Ltd.
EXAMPLE 2
[0060] 1. Fermentation of the Recombinant Strain
[0061] (1) Cultivation of Inoculum
[0062] The recombinant E. coli strain was inoculated in liquid LB medium containing 100 g/ml ampicillin and incubated at 180 rpm and 37 C. overnight to obtain inoculum.
[0063] (2) The inoculum was inoculated in 1 L fermentation medium with 1% inoculum size and cultivated at 180 rpm and 35-38 C. until the OD.sub.600 reached 0.8. Then, 0.1 mM isopropul--D-thiogalactopyranoside (IPTG) was added in the culture, which was further cultivated at 120 rpm and 20 C. for 24 hours.
[0064] 2. Purification of Recombinant Protein IF3
[0065] (1) Buffers used for Purification
[0066] Lysis buffer: 50 mM Tris-HCl, 150 mM NaCl, pH 8.0
[0067] Washing buffer: 50 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 8.0
[0068] Elution buffer: 50 mM Tris-HCl, 150 mM NaCl, 250 mM imidazole, pH 8.0
[0069] (2) The cells of the fermented recombinant E. coli strain from step (1) were collected by centrifugation at 10,000 rpm, resuspended in 50 ml lysis buffer (for 1 liter broth), and broken at the pressure of 1,000 bar.
[0070] (3) The solution from step (2) was centrifuged at 12,000 rpm and 4 C. for 50 min.
[0071] (4) The supernatant from step (3) was loaded on a nickel column containing 2 ml nickel gel. After the supernatant flowed through the nickel column, equilibrate the column with 20 ml lysis buffer. Wash the column with washing buffer 20 ml, and elute the recombinant protein IF3 from the column with 10 ml elution buffer. Collect the eluent, which was the recombinant protein IF3 solution.
EXAMPLE 3
[0072] 1. Extraction of 2, 3-cNMPs
[0073] (1) The recombinant protein IF3 solution obtained in example 2 was incubated at 0 C. for 3 days to release 2, 3-cNMPs from IF3, then centrifuged at 12,000 rpm for 20 min, and the supernatant was collected.
[0074] (2) The supernatant obtained from step (1) was ultrafiltrated by using an ultrafiltration tube with a molecular weight cut-off of 3,000 Da to remove proteins. The filtrate containing four kinds of 2, 3-cNMPs was collected.
[0075] 2. Purification of Four Kinds of 2, 3-cNMPs (2, 3-cAMP, 2, 3-cGMP, 2, 3-cCMP and 2, 3-cUMP).
[0076] (1) Four kinds of 2, 3-cNMPs in the filtrate were separated by high-performance liquid chromatographic (HPLC) on a C.sub.18 reversed-phase column and collected separately.
[0077] The mobile phases used in the gradient program were as follows: buffer A (10 mM ammonium acetate, pH 5.0) and buffer B (75% (v/v) buffer A, 25% (v/v) methanol).
[0078] (2) The protocol used for purification was as follows (the values are times in minutes and percentage of buffer B used): 0.0, 0; 2.5, 0; 5.0, 30; 10.0, 60; 14.0, 100; 21.0, 100; 22.0, 50 and 23.0, 0 at a flow rate of 10 ml/min. The detection wavelength was 254 nm.
[0079] The result of HPLC separation of four kinds of 2, 3-cNMPs was shown in