METHODS FOR REACTIVATING GENES ON THE INACTIVE X CHROMOSOME
20190048339 ยท 2019-02-14
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N2310/3231
CHEMISTRY; METALLURGY
C12N2310/113
CHEMISTRY; METALLURGY
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Methods for reactivating genes on the inactive X chromosome that include administering one or both of a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, e.g., etoposide and/or 5-azacytidine (aza), optionally in combination with an inhibitor of XIST RNA and/or an Xist-interacting protein, e.g., a chromatin-modifying protein, e.g., a small molecule or an inhibitory nucleic acid (such as a small inhibitory RNA (siRNAs) or antisense oligonucleotide (ASO)) that targets XIST RNA and/or a gene encoding an Xist-interacting protein, e.g., a chromatin-modifying protein.
Claims
1. A composition comprising a DNMT Inhibitor and/or topoisomerase inhibitor, and optionally an inhibitor of Xist RNA and/or Xist-interacting protein.
2. A method of activating an inactive X-linked allele in a cell, preferably a cell of a female heterozygous subject or male hemizygous subject, the method comprising administering to the cell (i) one or both of a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor; and optionally (ii) an inhibitor of Xist RNA and/or Xist-interacting protein.
3. The method of claim 2, wherein the X-linked allele is an epigenetically silenced or hypomorphic allele on the active X-chromosome.
4. The method of claim 2, wherein the inhibitor of XIST is an inhibitory nucleic targeting XIST lncRNA or a gene encoding XIST lncRNA.
5. The method of claim 2, wherein the inhibitor of an Xist-interacting protein inhibits a protein shown in Tables 5 or 6 or 7, e.g., SMC1a; SMC3; WAPL; RAD21; KIF4; PDS5a/b; CTCF; TOP1; TOP2a; TOP2b; SMARCA4 (BRG1); SMARCA5; SMARCC1; SMARCC2; SMARCB1; RING1a/b (PRC1); PRC2 (EZH2, SUZ12, RBBP7, RBBP4, EED); AURKB; SPEN/MINT/SHARP; DNMT1; SmcHD1; CTCF; MYEF2; ELAV1; SUN2; Lamin-B Receptor (LBR); LAP; hnRPU/SAF-A; hnRPK; hnRPC; PTBP2; RALY; MATRIN3; MacroH2A; and ATRX.
6. The method of claim 2, wherein the inhibitor of an Xist-interacting protein is a small molecule inhibitor or an inhibitory nucleic acid that targets a gene encoding the Xist-interacting protein.
7. The method of claim 6, wherein the inhibitor of an Xist-interacting protein is a small molecule inhibitor of cohesin or a cohesin subunit.
8. The method of claim 2, wherein the inactive X-linked allele is associated with an X-linked disorder, and the DNMT Inhibitor and/or topoisomerase inhibitor, and optionally the inhibitor of Xist RNA or an Xist-interacting protein are administered in a therapeutically effective amount.
9. The method of claim 2, wherein the active X-linked allele is associated with an X-linked disorder, and the DNMT Inhibitor and/or topoisomerase inhibitor, and optionally the inhibitor of Xist RNA or an Xist-interacting protein are administered in a therapeutically effective amount.
10. The method of claim 2, wherein the cell is in a living subject.
11. The method of claim 2, comprising administering: (iii) one or more of: (a) an inhibitory nucleic acid targeting a strong or moderate RNA-binding protein binding site on the X chromosome, and/or (b) an inhibitory nucleic acid targeting a suppressive RNA (supRNA) associated with the X-linked allele.
12. The composition of claim 1, further comprising: (iii) one or more of: (a) an inhibitory nucleic acid targeting a strong or moderate RNA-binding protein binding site on the X chromosome, and/or (b) an inhibitory nucleic acid targeting a suppressive RNA (supRNA) associated with the X-linked allele.
13. (canceled)
14. The method of claim 4, wherein the inhibitory nucleic acid does not comprise three or more consecutive guanosine nucleotides or does not comprise four or more consecutive guanosine nucleotides; wherein the inhibitory nucleic acid is 8 to 30 nucleotides in length; and/or wherein at least one nucleotide of the inhibitory nucleic acid is a nucleotide analogue; wherein at least one nucleotide of the inhibitory nucleic acid comprises a 2 O-methyl; wherein the inhibitory nucleic acid comprises at least one ribonucleotide, at least one deoxyribonucleotide, or at least one bridged nucleotide; wherein one or more of the nucleotides of the inhibitory nucleic acid comprise 2-fluoro-deoxyribonucleotides and/or 2-O-methyl nucleotides; and/or wherein the nucleotides of the inhibitory nucleic acid comprise comprising phosphorothioate internucleotide linkages between at least two nucleotides, or between all nucleotides.
15. (canceled)
16. (canceled)
17. (canceled)
18. (canceled)
19. The method of claim 14, wherein the bridged nucleotide is a LNA nucleotide, a cEt nucleotide or a ENA modified nucleotide.
20. (canceled)
21. (canceled)
22. (canceled)
23. (canceled)
24. (canceled)
25. (canceled)
26. (canceled)
27. (canceled)
28. A method for identifying proteins that interact with a selected nucleic acid, the method comprising: providing a sample comprising a living cell expressing the selected nucleic acid; exposing the living cell to ultraviolet radiation sufficient to crosslink proteins to DNA, to provide protein-DNA complexes; isolating a nucleus from the cell; treating the isolated nucleus with DNase; solubilizing chromatin in the nucleus; contacting the DNA-protein complexes with capture probes specific for the selected nucleic acid; treating the DNA-protein complexes with DNase, and isolating the DNA-protein complexes from the sample using the capture probes.
29. The method of claim 28, wherein the capture probes comprise a sequence that hybridizes specifically to the selected nucleic acid, and an isolation moiety.
30. The method of claim 29, wherein the isolation moiety is biotin, and isolating the DNA-protein complexes comprises contacting the sample with streptavidin or avidin.
31. The method of claim 28, comprising washing the sample comprising DNA-protein complexes to eliminate protein factors covalently linked by UV to the selected nucleic acid.
Description
DESCRIPTION OF DRAWINGS
[0036]
[0042]
[0046]
[0052]
[0061]
[0067]
[0069]
[0070]
[0071]
[0073]
[0076]
[0079]
[0081]
[0083]
[0085]
[0087]
[0092]
[0094]
[0096]
[0098]
[0100]
[0102]
[0105]
DETAILED DESCRIPTION
[0109] The mammalian X chromosome is unique in its ability to undergo whole-chromosome silencing. In the early female embryo, X-chromosome inactivation (XCI) enables mammals to achieve gene dosage equivalence between the XX female and the XY male (1-3). XCI depends on Xist RNA, a 17-kb long noncoding RNA (lncRNA) expressed only from the inactive X-chromosome (Xi)(4) and that implements whole-chromosome silencing by recruiting repressive complexes (5-8). While XCI initiates only once during development, the female mammal stably maintains the Xi through her lifetime. In mice, a germline deletion of Xist results in peri-implantation lethality due to a failure of Xi establishment (9), whereas a lineage-specific deletion of Xist causes a lethal blood cancer due to a failure of Xi maintenance (10). Thus, both the de novo establishment and proper maintenance of the Xi are crucial for viability and homeostasis. There are therefore two critical phases to XCI: (i) A one-time initiation/establishment phase that occurs in pen-implantation embryonic development that is recapitulated by differentiating embryonic stem (ES) cells in culture, and (ii) a life-long maintenance phase that persists in all somatic lineages.
[0110] Once established, the Xi is extremely stable and difficult to disrupt genetically and pharmacologically (11-13). In mice, X-reactivation is programmed to occur only twiceonce in the blastocyst to erase the imprinted XCI pattern and a second time in the germline prior to meiosis (14, 15). Although the Xi's epigenetic stability is a homeostatic asset, an ability to unlock this epigenetic state is of great current interest. The X-chromosome is home to nearly 1000 genes, at least 50 of which have been implicated in X-linked diseases, such as Rett syndrome and Fragile X syndrome. The Xi is therefore a reservoir of functional genes that could be tapped to replace expression of a disease allele on the active X (Xa). A better understanding of repression would inform both basic biological mechanisms and treatment of X-linked diseases.
[0111] It is believed that Xist RNA silences the Xi through conjugate protein partners. A major gap in current understanding is the lack of a comprehensive Xist interactome. In spite of multiple attempts to define the complete interactome, only four directly interacting partners have been identified over the past two decades, including PRC2, ATRX, YY1, and HNRPU: Polycomb repressive complex 2 (PRC2) is targeted by Xist RNA to the Xi; the ATRX RNA helicase is required for the specific association between Xist and PRC2 (16, 17); YY1 tethers the Xist-PRC2 complex to the Xi nucleation center (18); and the nuclear matrix factor, HNRPU/SAF-A, enables stable association of Xist with the chromosomal territory (19). Many additional interacting partners are expected, given the large size of Xist RNA and its numerous conserved modular domains. Here, we develop a new RNA-based proteomic method and implement an unbiased screen for Xist's comprehensive interactome. We identify a large number of high-confidence candidates, demonstrate that it is possible to destabilize Xi repression by inhibiting multiple interacting components, and then delve into a focused set of interactors with the cohesins.
[0112] Using iDRiP, we have identified a comprehensive Xist interactome and revealed multiple synergistic pathways to Xi repression (
[0113] The robustness of Xi silencing is demonstrated by the observation that we destabilized the Xi only after pharmacologically targeting two or three distinct pathways. The fact that the triple-drug treatments varied with respect to reactivated loci and depth of de-repression creates the possibility of treating X-linked disease in a locus-specific manner by administering unique drug combinations. Given the existence of many other disease-associated lncRNAs, the iDRiP technique could be applied systematically towards identifying new drug targets for other diseases and generally for elucidating mechanisms of epigenetic regulation by lncRNA.
[0114] Based on the perturbation experiments, it is proposed that Xist interacting factors act synergistically to repress the Xi, possibly explaining why it has been difficult historically to achieve X reactivation by disrupting single genes (11-13). The present data show that drug combinations that hit three distinct pathways are required to achieve reactivation levels that approximate half to full levels of the Xa (
Methods of Reactivating Genes on the Inactive X Chromosome (Xi)
[0115] The present disclosure provides methods for reactivating genes on Xi by combining inhibitors for two or three Xist-interacting factors (listed in Tables 5 and 6). The methods include co-administering a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, optionally with an inhibitor of another Xist-interacting factor (listed in Tables 5-6), e.g., a small molecule or a nucleic acid such as a small inhibitory RNA (siRNAs) that targets Xist RNA and/or a gene encoding Xist or an Xist-interacting protein, e.g., a chromatin-modifying protein or a small molecule. These methods can be used, e.g., to reactivate genes in single cells, e.g., isolated cells in culture, or in tissues, organs, or whole animals. In some embodiments, the methods are used to reactivate genes on Xi in a cell or subject that has an X-linked disease. X-reactivation can be achieved in various cell types, including proliferating fibroblasts and post-mitotic neurons.
[0116] The methods described herein can be also be used to specifically re-activate one or more genes on Xi, by co-administering an inhibitory nucleic acid targeting a suppressive RNA or genomic DNA at strong and/or moderate binding sites as described in WO 2012/065143, WO 2012/087983, and WO 2014/025887 or in U.S. Ser. No. 62/010,342 (which are incorporated herein in their entirety), to disrupt RNA-mediated silencing in cis on the inactive X-chromosome. The suppressive RNAs can be noncoding (long noncoding RNA, lncRNA) or occasionally part of a coding mRNA; for simplicity, we will refer to them together as suppressive RNAs (supRNAs) henceforth. supRNAs that mediate silencing of genes on the X chromosome are known in the art; see, e.g., WO 2012/065143, WO 2012/087983, WO 2014/025887 and U.S. Ser. No. 62/010,342, and inhibitory nucleic acids and small molecules targeting (e.g., complementary to) the sRNAs, or complementary or identical to a region within a strong or moderate binding site in the genome, e.g., as described in WO 2014/025887, can be used to modulate gene expression in a cell, e.g., a cancer cell, a stem cell, or other normal cell types for gene or epigenetic therapy. The nucleic acids targeting supRNAs that are used in the methods described herein are termed inhibitory (though they increase gene expression) because they inhibit the supRNAs-mediated repression of a specified gene, either by binding to the supRNAs itself (e.g., an antisense oligo that is complementary to the supRNAs) or by binding to a strong or moderate binding site for an RNA-binding protein (e.g., PRC2also termed an EZH2 or SUZ12 binding site- or CTCF) in the genome, and (without wishing to be bound by theory) preventing binding of the RNA-binding protein complex and thus disrupting silencing in the region of the strong or moderate binding site. The inhibitory nucleic acids that bind to a strong or moderate RNA-binding protein binding site can bind to either strand of the DNA, but preferably bind to the same strand to which the supRNAs binds. See, e.g., WO 2012/065143, WO 2012/087983, WO 2014/025887 and U.S. Ser. No. 62/010,342.
[0117] The cells can be in vitro, including ex vivo, or in vivo (e.g., in a subject who has cancer, e.g., a tumor).
[0118] In some embodiments, the methods include introducing into the cell (or administering to a subject) a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, optionally with an inhibitor of XIST RNA or an Xist-interacting protein, e.g., a chromatin-modifying protein, e.g., a small molecule inhibitor of Xist or an Xist-interacting protein.
[0119] In some embodiments, the methods include introducing into the cell (or administering to a subject) a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, optionally with an inhibitory nucleic acid (e.g., targeting Xist RNA or a gene encoding Xist or an Xist-interacting protein, e.g., a chromatin-modifying protein as described herein) that is modified in some way, e.g., an inhibitory nucleic acid that differs from the endogenous nucleic acids at least by including one or more modifications to the backbone or bases as described herein for inhibitory nucleic acids. Such modified nucleic acids are also within the scope of the present invention.
[0120] In some embodiments, the methods include introducing into the cell (or administering to a subject) a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, optionally with an inhibitor of Xist RNA or an Xist-interacting protein, e.g., a chromatin-modifying protein, e.g., a small molecule inhibitor or an inhibitory nucleic acid such as a small inhibitory RNA (siRNA) or LNA that targets XIST or a gene encoding XIST or an Xist-interacting protein, e.g., a chromatin-modifying protein, and optionally an inhibitory nucleic acid that specifically binds, or is complementary, to a strong or moderate binding site or a supRNA described in WO 2012/065143, WO 2012/087983, WO 2014/025887 and U.S. Ser. No. 62/010,342. A nucleic acid that binds specifically binds primarily to the target, i.e., to the target DNA, mRNA, or supRNA to inhibit regulatory function or binding of the DNA, mRNA, or supRNA, but does not substantially inhibit function of other non-target nucleic acids. The specificity of the nucleic acid interaction thus refers to its function (e.g., inhibiting gene expression) rather than its hybridization capacity. Inhibitory nucleic acids may exhibit nonspecific binding to other sites in the genome or other RNAs without interfering with binding of other regulatory proteins and without causing degradation of the non-specifically-bound RNA. Thus this nonspecific binding does not significantly affect function of other non-target RNAs and results in no significant adverse effects. These methods can be used to treat an X-linked condition in a subject by administering to the subject a composition or compositions (e.g., as described herein) comprising a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, optionally with an inhibitor of Xist RNA or an Xist-interacting protein, e.g., a chromatin-modifying protein, e.g., a small molecule inhibitor or an inhibitory nucleic acid such as a small inhibitory RNA (siRNA) or LNA that targets a gene encoding Xist or an Xist-interacting protein, e.g., a chromatin-modifying protein, and optionally an inhibitory nucleic acid that specifically binds, or is complementary, to a strong or moderate binding site or a supRNA (e.g., as described in WO 2012/065143, WO 2012/087983, WO 2014/025887 and U.S. Ser. No. 62/010,342) that is associated with an X-linked disease gene. Examples of genes involved in X-linked diseases are shown in Table 8.
[0121] As used herein, treating includes prophylactic treatment which means reducing the incidence of or preventing (or reducing risk of) a sign or symptom of a disease in a patient at risk for the disease, and therapeutic treatment, which means reducing signs or symptoms of a disease, reducing progression of a disease, reducing severity of a disease, in a patient diagnosed with the disease.
[0122] In some embodiments, the methods described herein include administering a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, and optionally a composition, e.g., a sterile composition, comprising an inhibitory nucleic acid that is complementary to Xist or a gene encoding Xist RNA or an Xist-interacting protein, e.g., a chromatin-modifying protein, and optionally an inhibitory nucleic acid that is complementary to a supRNA as known in the art, e.g., as described in WO 2012/065143, WO 2012/087983, and/or WO 2014/025887. Inhibitory nucleic acids for use in practicing the methods described herein can be an antisense or small interfering RNA, including but not limited to an shRNA or siRNA. In some embodiments, the inhibitory nucleic acid is a modified nucleic acid polymer (e.g., a locked nucleic acid (LNA) molecule).
[0123] Inhibitory nucleic acids have been employed as therapeutic moieties in the treatment of disease states in animals, including humans. Inhibitory nucleic acids can be useful therapeutic modalities that can be configured to be useful in treatment regimens for the treatment of cells, tissues and animals, especially humans.
[0124] For therapeutics, an animal, preferably a human, who has an X-linked disorder is treated by administering a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, an optionally inhibitor of XIST RNA and/or an Xist-interacting protein, e.g., a chromatin-modifying protein, e.g., a small molecule inhibitor or an inhibitory nucleic acid such as a small inhibitory RNA (siRNA) or LNA that targets a gene encoding Xist RNA and/or an Xist-interacting protein, e.g., a chromatin-modifying protein, and optionally an inhibitory nucleic acid that is complementary to a supRNA. For example, in some embodiments, the methods comprise the step of administering to the animal in need of treatment, a therapeutically effective amount of a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor and optionally an inhibitory nucleic acid that is complementary to XIST RNA or a gene encoding XIST and/or an Xist-interacting protein, e.g., a chromatin-modifying protein as described herein.
DNA Methyltransferase (DNMT) Inhibitors
[0125] A number of DNMT inhibitors (against DNMT1, DNMT2, DNMT3a/b, as several examples) are known in the art, including 5-azacytidine (azacytidine, Azacitidine, 4-amino-1-beta-D-ribofuranosyl-s-triazin-2(1H)-one, Vidaza), decitabine (5-aza-2-deoxycytidine, Dacogen), Zebularine (pyrimidin-2-one beta-ribofuranoside), procainamide, procaine, hydralazine, NSC14778, Olsalazine, Nanaomycin, SID 49645275, .sup.2-isoxazoline, epigallocatechin-3-gallate (EGCG), MG98, SGI-110 (2-deoxy-5-azacytidylyl-(3.fwdarw.5)-2-deoxyguanosine), RG108 (N-phthalyl-L-tryptophan), SGI-1027, SW155246, SW15524601, SW155246-2, and DZNep (SGI-1036, 3-deazaneplanocin A). See also Medina-Franco et al., Int. J. Mol. Sci. 2014, 15(2), 3253-3261; Yoo et al., Computations Molecular Bioscience, 1(1):7-16 (2011)
Topoisomerase Inhibitors
[0126] A number of topoisomerase inhibitors (against TOP1, TOP2a/b, as examples) are known in the art; in some embodiments, the topoisomerase inhibitor is an inhibitor of topoisomerase II. Exemplary inhibitors of topoisomerase I include camptothecin and its derivatives such as topotecan, irinotecan, lurtotecan, exatecan, diflometecan, S39625, CPT 11, SN38, gimatecan and belotecan; stibogluconate; indenoisoquinolines (e.g., 2,3-dimethoxy-12h-[1,3]dioxolo[5,6]indeno[1,2-c]isoquinolin-6-ium and 4-(5,11-dioxo-5h-indeno[1,2-c]isoquinolin-6(11h)-yl)butanoate) and indolocarbazoles. See, e.g., Pommier, Chem Rev. 2009 July; 109(7): 2894-2902; Pommier, Nat Rev Cancer. 2006 October; 6(10):789-802; Sheng et al., Curr Med Chem. 2011; 18(28):4389-409. Exemplary inhibitors of topoisomerase II include etoposide, teniposide, mitoxantrone, amsacrine, saintopin, ICRF-193, genistein, CP-115,953, ellipticine, banoxantrone, Celastrol, NU 2058, Dexrazoxane, and anthracyclines (e.g., doxorubicin, daunorubicin, epirubicin, and idarubicin). See, e.g., Froelich-Ammon and Osheroff, Journal of Biological Chemistry, 270:21429-21432 (1995); Hande, Update on Cancer Therapeutics 3:13-26 (2008).
Inhibitor of XIST RNA
[0127] The methods can optionally include administering an inhibitor of an XIST RNA itself, e.g., an inhibitory nucleic acid targeting XIST RNA. (Although in typical usage XIST refers to the human sequence and Xist to the mouse sequence, in the present application the terms are used interchangeably). The human XIST sequence is available in the ensemble database at ENSG00000229807; it is present on Chromosome X at 73,820,651-73,852,753 reverse strand (Human GRCh38.p2). The full sequence is shown in SEQ ID NO:66; XIST exons correspond to 601-11972 (exon 1); 15851-15914 (exon 2); 19593-20116 (exon 3); 21957-21984 (exon 4); 22080-22288 (exon 5); and 23887-33304 (exon 6). Alternatively, see NCBI Reference Sequence: NR 001564.2, Homo sapiens X inactive specific transcript (non-protein coding) (XIST), long non-coding RNA, wherein the exons correspond to 1-11372, 11373-11436, 11437-11573, 11574-11782, 11783-11946, and 11947-19280. The inhibitory nucleic acid targeting XIST RNA can be any inhibitory nucleic acid as described herein, and can include modifications described herein or known in the art. In some embodiments, the inhibitory nucleic acid is an antisense oligonucleotide (ASO) that targets a sequence in XIST RNA, e.g., a sequence within an XIST exon as shown in SEQ ID NO:66 or within the RNA sequence as set forth in NR 001564.2. In some embodiments, the inhibitory nucleic includes at least one locked nucleotide, e.g., is a locked nucleic acid (LNA).
Xist-Interacting Proteins
[0128] The methods can optionally include administering an inhibitor of an Xist-interacting protein. Tables 5 and 6 list Xist-interacting proteins, e.g., chromatin-modifying proteins that can be targeted in the methods described herein.
[0129] Small molecule inhibitors of many of these Xist interactors are known in the art; see, e.g., Table 7, for strong examples. In addition, small molecule inhibitors of PRc1 or PRC2 components can be used; for example, inhibitors of EZH2 include UNC1999, E7438, N-[(4,6-dimethyl-2-oxo-1,2-dihydro-3-pyridinyl)methyl]-3-methyl-1-[(1S)-1-methylpropyl]-6-[6-(1-piperazinyl)-3-pyridinyl]-1H-indole-4-carboxamide, EPZ-6438 (N-((4,6-dimethyl-2-oxo-1,2-dihydropyridin-3-yl)methyl)-5-(ethyl(tetrahyd-ro-2H-pyran-4-yl)amino)-4-methyl-4-(morpholinomethyl)-[1,1-biphenyl]-3-c-arboxamide), GSK-126 ((S)-1-(sec-butyl)-N-(4,6-dimethyl-2-oxo-1,2-dihydropyridin-3-yl)methyl)-3-methyl-6-(6-(piperazin-1-yl)pyridin-3-yl)-1H-indole-4-carboxamide), GSK-343 (1-Isopropyl-N-((6-methyl-2-oxo-4-propyl-1,2-dihydropyridin-3-yl)-methyl)-6-(2-(4-methylpiperazin-1-yl)pyridine-4-yl)-1H-indazole-4-carboxam-ide), E11, 3-deazaneplanocin A (DNNep, 5R-(4-amino-1H-imidazo[4,5-c]pyridin-1-yl)-3-(hydroxymethyl)-3-cyclopente-ne-1S,2R-diol), isoliquiritigenin, and those provided in, for example, U.S. Publication Nos. 2009/0012031, 2009/0203010, 2010/0222420, 2011/0251216, 2011/0286990, 2012/0014962, 2012/0071418, 2013/0040906, US20140378470, US20140275081, US20140357688, and 2013/0195843; see also PCT/US2011/035336, PCT/US2011/035340, PCT/US2011/035344.
[0130] Cohesin is a multisubunit chromosome-associated protein complex that is highly conserved in eukaryotes; subunits include SMC1, SMC1b, SMC3, Scc1/RAD21, Rec8, SA-1/STAG-1, SA-2/STAG-2, SA-3/STAG-3, Pds5A, Pds5B, Wap1, and Sororin. See, e.g., Peters et al., Genes & Dev. 22:3089-3114 (2008); Lyons and Morgan, Mol Cell. 2011 May 6; 42(3):378-89; Jahnke et al., Nucleic Acids Res. 2008 November; 36(20): 6450-6458. In some embodiments, inhibitors of a cohesin are used, e.g., small molecule inhibitors of ECO-I and HDAC6, which in are a part of a cycle of acetylation-deacetylation that regulates the cohesins; inhibitors include, e.g., PCI34051, tubacin, apicidin, MS275, TSA, or saha. In some embodiments, of the methods described herein, an inhibitor of cohesin is used alone, e.g., without the DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, or in combination with one or both of them.
[0131] Tables 5 and 6, at the end of the Examples, provide the full list of possible Xist-interacting targets.
TABLE-US-00001 TABLE 7 Exemplary Xist-Interacting Proteins and Chromatin-Modifying Proteins Xist-Interacting Protein Small molecule inhibitor WAPL SNC1a See above SMC3 See above RAD21 See above KIF4 PDS5a/b See above CTCF 3-aminobenzamide TOP1 See above TOP2a See above TOP2b See above SMARCA4 (BRG1) PFI3 ((E)-1-(2-Hydroxyphenyl)-3-((1R,4R)-5-(pyridin-2-yl)-2,5- diazabicyclo[2.2.1]heptan-2-yl)prop-2-en-1-one); JQ1(+); AGN-PC- 0DAUWN SMARCA5 SMARCC1 SMARCC2 SMARCB1 CBX2 CBX4 CBX5 CBX6 CBX7 MS37452 CBX8 RINB1a PRT4165 (2-pyridine-3-yl-methylene-indan-1,3-dione) RING1b AURKB ZM447439, Hesperadin, VX-680/MK-0457 (4,6-diaminopyrimidine), AT9283, AZD1152, AKI-001, PHA-680632, VE-465, JNJ-7706621, CCT129202, MLN8237, ENMD-2076, MK-5108, PHA-739358, CYC116, SNS-314, R763, PF-03814375, GSK1070916, AMG-900 (see Kollareddy et al., Invest New Drugs. 2012 Dec; 30(6): 2411- 2432) SPEN/MINT/SHARP MG132 DNMT1 See above SmcHD1 CTCF MYEF2 ELAVL1 SUN2 mevinolin Lamin-B Receptor (LBR) LAP bestatin hnRPU/SAF-A -DPQ hnPRK hnRPC PTBP2 RALY MATRIN3 plumbagin MacroH2A ATRX Berberine, Inhibitors of histone deacteylases (HDAC) such as trichostatin A (TSA), depsipeptide, vorinostat, RYBP YY1 EZH2 See above SUZ12 EED Astemizole (inhibits EZH2-EED interaction) RBBP7 RBBP4 JARID2
Inhibitory Nucleic Acids
[0132] The methods and compositions described herein can include nucleic acids such as a small inhibitory RNA (siRNA) or LNA that targets (specifically binds, or is complementary to) XIST RNA or to a gene encoding XIST or an XIST-interacting protein, e.g., a chromatin-modifying protein, and optionally an inhibitory nucleic acid that targets a strong or moderate binding site or a supRNA described in WO 2012/065143, WO 2012/087983, WO 2014/025887 and U.S. Ser. No. 62/010,342. Inhibitory nucleic acids useful in the present methods and compositions include antisense oligonucleotides, ribozymes, external guide sequence (EGS) oligonucleotides, siRNA compounds, single- or double-stranded RNA interference (RNAi) compounds such as siRNA compounds, molecules comprising modified bases, locked nucleic acid molecules (LNA molecules), antagomirs, peptide nucleic acid molecules (PNA molecules), and other oligomeric compounds or oligonucleotide mimetics which hybridize to at least a portion of the target nucleic acid and modulate its function. In some embodiments, the inhibitory nucleic acids include antisense RNA, antisense DNA, chimeric antisense oligonucleotides, antisense oligonucleotides comprising modified linkages, interference RNA (RNAi), short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA); small RNA-induced gene activation (RNAa); small activating RNAs (saRNAs), or combinations thereof. See, e.g., U.S. Ser. No. 62/010,342, WO 2012/065143, WO 2012/087983, and WO 2014/025887. However, in some embodiments the inhibitory nucleic acid is not an miRNA, an stRNA, an shRNA, an siRNA, an RNAi, or a dsRNA.
[0133] In some embodiments, the inhibitory nucleic acids are 10 to 50, 10 to 20, 10 to 25, 13 to 50, or 13 to 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having complementary portions of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or any range therewithin. In some embodiments, the inhibitory nucleic acids are 15 nucleotides in length. In some embodiments, the inhibitory nucleic acids are 12 or 13 to 20, 25, or 30 nucleotides in length. One having ordinary skill in the art will appreciate that this embodies inhibitory nucleic acids having complementary portions of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides in length, or any range therewithin (complementary portions refers to those portions of the inhibitory nucleic acids that are complementary to the target sequence).
[0134] The inhibitory nucleic acids useful in the present methods are sufficiently complementary to the target RNA, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect. Complementary refers to the capacity for pairing, through hydrogen bonding, between two sequences comprising naturally or non-naturally occurring bases or analogs thereof. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a RNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.
[0135] Routine methods can be used to design an inhibitory nucleic acid that binds to the target sequence with sufficient specificity. In some embodiments, the methods include using bioinformatics methods known in the art to identify regions of secondary structure, e.g., one, two, or more stem-loop structures, or pseudoknots, and selecting those regions to target with an inhibitory nucleic acid. For example, gene walk methods can be used to optimize the inhibitory activity of the nucleic acid; for example, a series of oligonucleotides of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the target sequences to reduce the number of oligonucleotides synthesized and tested. GC content is preferably between about 30-60%. Contiguous runs of three or more Gs or Cs should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) oligonucleotides).
[0136] In some embodiments, the inhibitory nucleic acid molecules can be designed to target a specific region of the RNA sequence. For example, a specific functional region can be targeted, e.g., a region comprising a known RNA localization motif (i.e., a region complementary to the target nucleic acid on which the RNA acts). Alternatively or in addition, highly conserved regions can be targeted, e.g., regions identified by aligning sequences from disparate species such as primate (e.g., human) and rodent (e.g., mouse) and looking for regions with high degrees of identity. Percent identity can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656), e.g., using the default parameters.
[0137] Once one or more target regions, segments or sites have been identified, e.g., within a sequence known in the art or provided herein, inhibitory nucleic acid compounds are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity (i.e., do not substantially bind to other non-target RNAs), to give the desired effect.
[0138] In the context of this invention, hybridization means hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases. For example, adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds. Complementary, as used herein, refers to the capacity for precise pairing between two nucleotides. For example, if a nucleotide at a certain position of an oligonucleotide is capable of hydrogen bonding with a nucleotide at the same position of a RNA molecule, then the inhibitory nucleic acid and the RNA are considered to be complementary to each other at that position. The inhibitory nucleic acids and the RNA are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleotides which can hydrogen bond with each other. Thus, specifically hybridisable and complementary are terms which are used to indicate a sufficient degree of complementarity or precise pairing such that stable and specific binding occurs between the inhibitory nucleic acid and the RNA target. For example, if a base at one position of an inhibitory nucleic acid is capable of hydrogen bonding with a base at the corresponding position of a RNA, then the bases are considered to be complementary to each other at that position. 100% complementarity is not required.
[0139] It is understood in the art that a complementary nucleic acid sequence need not be 100% complementary to that of its target nucleic acid to be specifically hybridisable. A complementary nucleic acid sequence for purposes of the present methods is specifically hybridisable when binding of the sequence to the target RNA molecule interferes with the normal function of the target RNA to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the sequence to non-target RNA sequences under conditions in which specific binding is desired, e.g., under physiological conditions in the case of in vivo assays or therapeutic treatment, and in the case of in vitro assays, under conditions in which the assays are performed under suitable conditions of stringency. For example, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, preferably less than about 500 mM NaCl and 50 mM trisodium citrate, and more preferably less than about 250 mM NaCl and 25 mM trisodium citrate. Low stringency hybridization can be obtained in the absence of organic solvent, e.g., formamide, while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and more preferably at least about 50% formamide. Stringent temperature conditions will ordinarily include temperatures of at least about 30 C., more preferably of at least about 37 C., and most preferably of at least about 42 C. Varying additional parameters, such as hybridization time, the concentration of detergent, e.g., sodium dodecyl sulfate (SDS), and the inclusion or exclusion of carrier DNA, are well known to those skilled in the art. Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30 C. in 750 mM NaCl, 75 mM trisodium citrate, and 1% SDS. In a more preferred embodiment, hybridization will occur at 37 C. in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 g/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42 C. in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 g/ml ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
[0140] For most applications, washing steps that follow hybridization will also vary in stringency. Wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature. For example, stringent salt concentration for the wash steps will preferably be less than about 30 mM NaCl and 3 mM trisodium citrate, and most preferably less than about 15 mM NaCl and 1.5 mM trisodium citrate. Stringent temperature conditions for the wash steps will ordinarily include a temperature of at least about 25 C., more preferably of at least about 42 C., and even more preferably of at least about 68 C. In a preferred embodiment, wash steps will occur at 25 C. in 30 mM NaCl, 3 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 42 C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. In a more preferred embodiment, wash steps will occur at 68 C. in 15 mM NaCl, 1.5 mM trisodium citrate, and 0.1% SDS. Additional variations on these conditions will be readily apparent to those skilled in the art. Hybridization techniques are well known to those skilled in the art and are described, for example, in Benton and Davis (Science 196:180, 1977); Grunstein and Hogness (Proc. Natl. Acad. Sci., USA 72:3961, 1975); Ausubel et al. (Current Protocols in Molecular Biology, Wiley Interscience, New York, 2001); Berger and Kimmel (Guide to Molecular Cloning Techniques, 1987, Academic Press, New York); and Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York.
[0141] In general, the inhibitory nucleic acids useful in the methods described herein have at least 80% sequence complementarity to a target region within the target nucleic acid, e.g., 90%, 95%, or 100% sequence complementarity to the target region within an RNA. For example, an antisense compound in which 18 of 20 nucleobases of the antisense oligonucleotide are complementary, and would therefore specifically hybridize, to a target region would represent 90 percent complementarity. Percent complementarity of an inhibitory nucleic acid with a region of a target nucleic acid can be determined routinely using basic local alignment search tools (BLAST programs) (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656). Inhibitory nucleic acids that hybridize to an RNA can be identified through routine experimentation. In general the inhibitory nucleic acids must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.
[0142] For further disclosure regarding inhibitory nucleic acids, please see US2010/0317718 (antisense oligos); US2010/0249052 (double-stranded ribonucleic acid (dsRNA)); US2009/0181914 and US2010/0234451 (LNAs); US2007/0191294 (siRNA analogues); US2008/0249039 (modified siRNA); and WO2010/129746 and WO2010/040112 (inhibitory nucleic acids), as well as WO 2012/065143, WO 2012/087983, and WO 2014/025887 (inhibitory nucleic acids targeting non-coding RNAs/supRNAss), all of which are incorporated herein by reference in their entirety.
[0143] Antisense
[0144] In some embodiments, the inhibitory nucleic acids are antisense oligonucleotides. Antisense oligonucleotides are typically designed to block expression of a DNA or RNA target by binding to the target and halting expression at the level of transcription, translation, or splicing. Antisense oligonucleotides of the present invention are complementary nucleic acid sequences designed to hybridize under stringent conditions to an RNA. Thus, oligonucleotides are chosen that are sufficiently complementary to the target, i.e., that hybridize sufficiently well and with sufficient specificity, to give the desired effect.
[0145] siRNA/shRNA
[0146] In some embodiments, the nucleic acid sequence that is complementary to an target RNA can be an interfering RNA, including but not limited to a small interfering RNA (siRNA) or a small hairpin RNA (shRNA). Methods for constructing interfering RNAs are well known in the art. For example, the interfering RNA can be assembled from two separate oligonucleotides, where one strand is the sense strand and the other is the antisense strand, wherein the antisense and sense strands are self-complementary (i.e., each strand comprises nucleotide sequence that is complementary to nucleotide sequence in the other strand; such as where the antisense strand and sense strand form a duplex or double stranded structure); the antisense strand comprises nucleotide sequence that is complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., an undesired gene) and the sense strand comprises nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. Alternatively, interfering RNA is assembled from a single oligonucleotide, where the self-complementary sense and antisense regions are linked by means of nucleic acid based or non-nucleic acid-based linker(s). The interfering RNA can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self-complementary sense and antisense regions, wherein the antisense region comprises a nucleotide sequence that is complementary to nucleotide sequence in a separate target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof. The interfering can be a circular single-stranded polynucleotide having two or more loop structures and a stem comprising self-complementary sense and antisense regions, wherein the antisense region comprises nucleotide sequence that is complementary to nucleotide sequence in a target nucleic acid molecule or a portion thereof and the sense region having nucleotide sequence corresponding to the target nucleic acid sequence or a portion thereof, and wherein the circular polynucleotide can be processed either in vivo or in vitro to generate an active siRNA molecule capable of mediating RNA interference.
[0147] In some embodiments, the interfering RNA coding region encodes a self-complementary RNA molecule having a sense region, an antisense region and a loop region. Such an RNA molecule when expressed desirably forms a hairpin structure, and is referred to herein as an shRNA. The loop region is generally between about 2 and about 10 nucleotides in length. In some embodiments, the loop region is from about 6 to about 9 nucleotides in length. In some embodiments, the sense region and the antisense region are between about 15 and about 20 nucleotides in length. Following post-transcriptional processing, the small hairpin RNA is converted into a siRNA by a cleavage event mediated by the enzyme Dicer, which is a member of the RNase III family. The siRNA is then capable of inhibiting the expression of a gene with which it shares homology. For details, see Brummelkamp et al., Science 296:550-553, (2002); Lee et al, Nature Biotechnol., 20, 500-505, (2002); Miyagishi and Taira, Nature Biotechnol 20:497-500, (2002); Paddison et al. Genes & Dev. 16:948-958, (2002); Paul, Nature Biotechnol, 20, 505-508, (2002); Sui, Proc. Natl. Acad. Sd. USA, 99(6), 5515-5520, (2002); Yu et al. Proc Natl Acad Sci USA 99:6047-6052, (2002).
[0148] The target RNA cleavage reaction guided by siRNAs is highly sequence specific. In general, siRNA containing a nucleotide sequences identical to a portion of the target nucleic acid are preferred for inhibition. However, 100% sequence identity between the siRNA and the target gene is not required to practice the present invention. Thus the invention has the advantage of being able to tolerate sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. For example, siRNA sequences with insertions, deletions, and single point mutations relative to the target sequence have also been found to be effective for inhibition. Alternatively, siRNA sequences with nucleotide analog substitutions or insertions can be effective for inhibition. In general the siRNAs must retain specificity for their target, i.e., must not directly bind to, or directly significantly affect expression levels of, transcripts other than the intended target.
[0149] Ribozymes
[0150] Trans-cleaving enzymatic nucleic acid molecules can also be used; they have shown promise as therapeutic agents for human disease (Usman & McSwiggen, 1995 Ann. Rep. Med. Chem. 30, 285-294; Christoffersen and Marr, 1995 J. Med. Chem. 38, 2023-2037). Enzymatic nucleic acid molecules can be designed to cleave specific RNA targets within the background of cellular RNA. Such a cleavage event renders the RNA non-functional.
[0151] In general, enzymatic nucleic acids with RNA cleaving activity act by first binding to a target RNA. Such binding occurs through the target binding portion of a enzymatic nucleic acid which is held in close proximity to an enzymatic portion of the molecule that acts to cleave the target RNA. Thus, the enzymatic nucleic acid first recognizes and then binds a target RNA through complementary base pairing, and once bound to the correct site, acts enzymatically to cut the target RNA. Strategic cleavage of such a target RNA will destroy its ability to direct synthesis of an encoded protein. After an enzymatic nucleic acid has bound and cleaved its RNA target, it is released from that RNA to search for another target and can repeatedly bind and cleave new targets.
[0152] Several approaches such as in vitro selection (evolution) strategies (Orgel, 1979, Proc. R. Soc. London, B 205, 435) have been used to evolve new nucleic acid catalysts capable of catalyzing a variety of reactions, such as cleavage and ligation of phosphodiester linkages and amide linkages, (Joyce, 1989, Gene, 82, 83-87; Beaudry et al., 1992, Science 257, 635-641; Joyce, 1992, Scientific American 267, 90-97; Breaker et al, 1994, TIBTECH 12, 268; Bartel et al, 1993, Science 261:1411-1418; Szostak, 1993, TIBS 17, 89-93; Kumar et al, 1995, FASEB J., 9, 1183; Breaker, 1996, Curr. Op. Biotech., 1, 442). The development of ribozymes that are optimal for catalytic activity would contribute significantly to any strategy that employs RNA-cleaving ribozymes for the purpose of regulating gene expression. The hammerhead ribozyme, for example, functions with a catalytic rate (kcat) of about 1 min.sup.1 in the presence of saturating (10 mM) concentrations of Mg.sup.2+ cofactor. An artificial RNA ligase ribozyme has been shown to catalyze the corresponding self-modification reaction with a rate of about 100 min.sup.1. In addition, it is known that certain modified hammerhead ribozymes that have substrate binding arms made of DNA catalyze RNA cleavage with multiple turn-over rates that approach 100 min.sup.1.
[0153] Modified Inhibitory Nucleic Acids
[0154] In some embodiments, the inhibitory nucleic acids used in the methods described herein are modified, e.g., comprise one or more modified bonds or bases. A number of modified bases include phosphorothioate, methylphosphonate, peptide nucleic acids, or locked nucleic acid (LNA) molecules. Some inhibitory nucleic acids are fully modified, while others are chimeric and contain two or more chemically distinct regions, each made up of at least one nucleotide. These inhibitory nucleic acids typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target) and a region that is a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. Chimeric inhibitory nucleic acids of the invention may be formed as composite structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide mimetics as described above. Such compounds have also been referred to in the art as hybrids or gapmers. Representative United States patents that teach the preparation of such hybrid structures comprise, but are not limited to, U.S. Pat. Nos. 5,013,830; 5,149,797; 5, 220,007; 5,256,775; 5,366,878; 5,403,711; 5,491,133; 5,565,350; 5,623,065; 5,652,355; 5,652,356; and 5,700,922, each of which is herein incorporated by reference.
[0155] In some embodiments, the inhibitory nucleic acid comprises at least one nucleotide modified at the 2 position of the sugar, most preferably a 2-O-alkyl, 2-O-alkyl-O-alkyl or 2-fluoro-modified nucleotide. In other preferred embodiments, RNA modifications include 2-fluoro, 2-amino and 2 O-methyl modifications on the ribose of pyrimidines, abasic residues or an inverted base at the 3 end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than; 2-deoxyoligonucleotides against a given target.
[0156] A number of nucleotide and nucleoside modifications have been shown to make the inhibitory nucleic acid into which they are incorporated more resistant to nuclease digestion than the native oligodeoxynucleotide; these modified oligos survive intact for a longer time than unmodified inhibitory nucleic acids. Specific examples of modified inhibitory nucleic acids include those comprising modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Most preferred are inhibitory nucleic acids with phosphorothioate backbones and those with heteroatom backbones, particularly CH2-NHOCH2, CH, N(CH3)OCH2 (known as a methylene(methylimino) or MMI backbone], CH2-ON(CH3)-CH2, CH2-N(CH3)-N(CH3)-CH2 and ON(CH3)-CH2-CH2 backbones, wherein the native phosphodiester backbone is represented as OPOCH); amide backbones (see De Mesmaeker et al. Ace. Chem. Res. 1995, 28:366-374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the inhibitory nucleic acid is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen et al., Science 1991, 254, 1497). Phosphorus-containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates comprising 3alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates comprising 3-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3-5 linkages, 2-5 linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3-5 to 5-3 or 2-5 to 5-2; see U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455, 233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563, 253; 5,571,799; 5,587,361; and 5,625,050.
[0157] Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510); Genesis, volume 30, issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991.
[0158] Cyclohexenyl nucleic acid inhibitory nucleic acid mimetics are described in Wang et al., J. Am. Chem. Soc., 2000, 122, 8595-8602.
[0159] Modified inhibitory nucleic acid backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These comprise those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts; see U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264, 562; 5, 264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.
[0160] One or more substituted sugar moieties can also be included, e.g., one of the following at the 2 position: OH, SH, SCH.sub.3, F, OCN, OCH.sub.3OCH.sub.3, OCH.sub.3O(CH.sub.2)n CH.sub.3, O(CH.sub.2)n NH.sub.2 or O(CH.sub.2)n CH.sub.3 where n is from 1 to about 10; Ci to C10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3; SO2 CH3; ONO2; NO2; N3; NH2; heterocycloalkyl; heterocycloalkaryl; aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an inhibitory nucleic acid; or a group for improving the pharmacodynamic properties of an inhibitory nucleic acid and other substituents having similar properties. A preferred modification includes 2-methoxyethoxy [2-0-CH.sub.2CH.sub.2OCH.sub.3, also known as 2-O-(2-methoxyethyl)] (Martin et al, Helv. Chim. Acta, 1995, 78, 486). Other preferred modifications include 2-methoxy (2-OCH.sub.3), 2-propoxy (2-OCH.sub.2CH.sub.2CH.sub.3) and 2-fluoro (2-F). Similar modifications may also be made at other positions on the inhibitory nucleic acid, particularly the 3 position of the sugar on the 3 terminal nucleotide and the 5 position of 5 terminal nucleotide. Inhibitory nucleic acids may also have sugar mimetics such as cyclobutyls in place of the pentofuranosyl group.
[0161] Inhibitory nucleic acids can also include, additionally or alternatively, nucleobase (often referred to in the art simply as base) modifications or substitutions. As used herein, unmodified or natural nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C) and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2 deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2-(imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl)adenine and 2,6-diaminopurine. Kornberg, A., DNA Replication, W. H. Freeman & Co., San Francisco, 1980, pp 75-77; Gebeyehu, G., et al. Nucl. Acids Res. 1987, 15:4513). A universal base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2<0>C. (Sanghvi, Y. S., in Crooke, S. T. and Lebleu, B., eds., Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions.
[0162] It is not necessary for all positions in a given inhibitory nucleic acid to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single inhibitory nucleic acid or even at within a single nucleoside within an inhibitory nucleic acid.
[0163] In some embodiments, both a sugar and an internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an inhibitory nucleic acid mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an inhibitory nucleic acid is replaced with an amide containing backbone, for example, an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds comprise, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254, 1497-1500.
[0164] Inhibitory nucleic acids can also include one or more nucleobase (often referred to in the art simply as base) modifications or substitutions. As used herein, unmodified or natural nucleobases comprise the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases comprise other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine.
[0165] Further, nucleobases comprise those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. I., ed. John Wiley & Sons, 1990, those disclosed by Englisch et al., Angewandle Chemie, International Edition, 1991, 30, page 613, and those disclosed by Sanghvi, Y. S., Chapter 15, Antisense Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B. ea., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, comprising 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2<0>C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., eds, Antisense Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2-O-methoxyethyl sugar modifications. Modified nucleobases are described in U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,302; 5,134,066; 5,175, 273; 5, 367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091; 5,614,617; 5,750,692, and 5,681,941, each of which is herein incorporated by reference.
[0166] In some embodiments, the inhibitory nucleic acids are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the inhibitory nucleic acid. Such moieties comprise but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Let., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al, Ann. N. Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Mancharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937). See also U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552, 538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486, 603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762, 779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082, 830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5, 245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391, 723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5, 565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599, 928 and 5,688,941, each of which is herein incorporated by reference.
[0167] These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups. Conjugate groups of the invention include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this invention, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this invention, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-5-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.
[0168] Locked Nucleic Acids (LNAs)
[0169] In some embodiments, the modified inhibitory nucleic acids used in the methods described herein comprise locked nucleic acid (LNA) molecules, e.g., including [alpha]-L-LNAs. LNAs comprise ribonucleic acid analogues wherein the ribose ring is locked by a methylene bridge between the 2-oxygen and the 4-carboni.e., inhibitory nucleic acids containing at least one LNA monomer, that is, one 2-O,4-C-methylene--D-ribofuranosyl nucleotide. LNA bases form standard Watson-Crick base pairs but the locked configuration increases the rate and stability of the basepairing reaction (Jepsen et al., Oligonucleotides, 14, 130-146 (2004)). LNAs also have increased affinity to base pair with RNA as compared to DNA. These properties render LNAs especially useful as probes for fluorescence in situ hybridization (FISH) and comparative genomic hybridization, as knockdown tools for miRNAs, and as antisense oligonucleotides to target mRNAs or other RNAs, e.g., RNAs as described herein.
[0170] The LNA molecules can include molecules comprising 10-30, e.g., 12-24, e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in each strand, wherein one of the strands is substantially identical, e.g., at least 80% (or more, e.g., 85%, 90%, 95%, or 100%) identical, e.g., having 3, 2, 1, or 0 mismatched nucleotide(s), to a target region in the RNA. The LNA molecules can be chemically synthesized using methods known in the art.
[0171] The LNA molecules can be designed using any method known in the art; a number of algorithms are known, and are commercially available (e.g., on the internet, for example at exiqon.com). See, e.g., You et al., Nuc. Acids. Res. 34:e60 (2006); McTigue et al., Biochemistry 43:5388-405 (2004); and Levin et al., Nuc. Acids. Res. 34:e142 (2006). For example, gene walk methods, similar to those used to design antisense oligos, can be used to optimize the inhibitory activity of the LNA; for example, a series of inhibitory nucleic acids of 10-30 nucleotides spanning the length of a target RNA can be prepared, followed by testing for activity. Optionally, gaps, e.g., of 5-10 nucleotides or more, can be left between the LNAs to reduce the number of inhibitory nucleic acids synthesized and tested. GC content is preferably between about 30-60%. General guidelines for designing LNAs are known in the art; for example, LNA sequences will bind very tightly to other LNA sequences, so it is preferable to avoid significant complementarity within an LNA. Contiguous runs of more than four LNA residues, should be avoided where possible (for example, it may not be possible with very short (e.g., about 9-10 nt) inhibitory nucleic acids). In some embodiments, the LNAs are xylo-LNAs.
[0172] For additional information regarding LNAs see U.S. Pat. Nos. 6,268,490; 6,734,291; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,060,809; 7,084,125; and 7,572,582; and U.S. Pre-Grant Pub. Nos. 20100267018; 20100261175; and 20100035968; Koshkin et al. Tetrahedron 54, 3607-3630 (1998); Obika et al. Tetrahedron Lett. 39, 5401-5404 (1998); Jepsen et al., Oligonucleotides 14:130-146 (2004); Kauppinen et al., Drug Disc. Today 2(3):287-290 (2005); and Ponting et al., Cell 136(4):629-641 (2009), and references cited therein.
[0173] Making and Using Inhibitory Nucleic Acids
[0174] The nucleic acid sequences used to practice the methods described herein, whether RNA, cDNA, genomic DNA, vectors, viruses or hybrids thereof, can be isolated from a variety of sources, genetically engineered, amplified, and/or expressed/generated recombinantly. Recombinant nucleic acid sequences can be individually isolated or cloned and tested for a desired activity. Any recombinant expression system can be used, including e.g. in vitro, bacterial, fungal, mammalian, yeast, insect or plant cell expression systems.
[0175] Nucleic acid sequences of the invention can be inserted into delivery vectors and expressed from transcription units within the vectors. The recombinant vectors can be DNA plasmids or viral vectors. Generation of the vector construct can be accomplished using any suitable genetic engineering techniques well known in the art, including, without limitation, the standard techniques of PCR, oligonucleotide synthesis, restriction endonuclease digestion, ligation, transformation, plasmid purification, and DNA sequencing, for example as described in Sambrook et al. Molecular Cloning: A Laboratory Manual. (1989)), Coffin et al. (Retroviruses. (1997)) and RNA Viruses: A Practical Approach (Alan J. Cann, Ed., Oxford University Press, (2000)). As will be apparent to one of ordinary skill in the art, a variety of suitable vectors are available for transferring nucleic acids of the invention into cells. The selection of an appropriate vector to deliver nucleic acids and optimization of the conditions for insertion of the selected expression vector into the cell, are within the scope of one of ordinary skill in the art without the need for undue experimentation. Viral vectors comprise a nucleotide sequence having sequences for the production of recombinant virus in a packaging cell. Viral vectors expressing nucleic acids of the invention can be constructed based on viral backbones including, but not limited to, a retrovirus, lentivirus, adenovirus, adeno-associated virus, pox virus or alphavirus. The recombinant vectors capable of expressing the nucleic acids of the invention can be delivered as described herein, and persist in target cells (e.g., stable transformants).
[0176] Nucleic acid sequences used to practice this invention can be synthesized in vitro by well-known chemical synthesis techniques, as described in, e.g., Adams (1983) J. Am. Chem. Soc. 105:661; Belousov (1997) Nucleic Acids Res. 25:3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19:373-380; Blommers (1994) Biochemistry 33:7886-7896; Narang (1979) Meth. Enzymol. 68:90; Brown (1979) Meth. Enzymol. 68:109; Beaucage (1981) Tetra. Lett. 22:1859; U.S. Pat. No. 4,458,066.
[0177] Nucleic acid sequences of the invention can be stabilized against nucleolytic degradation such as by the incorporation of a modification, e.g., a nucleotide modification. For example, nucleic acid sequences of the invention includes a phosphorothioate at least the first, second, or third internucleotide linkage at the 5 or 3 end of the nucleotide sequence. As another example, the nucleic acid sequence can include a 2-modified nucleotide, e.g., a 2-deoxy, 2-deoxy-2-fluoro, 2-O-methyl, 2-O-methoxyethyl (2-O-MOE), 2-O-aminopropyl (2-O-AP), 2-O-dimethylaminoethyl (2-O-DMAOE), 2-O-dimethylaminopropyl (2-O-DMAP), 2-O-dimethylaminoethyloxyethyl (2-O-DMAEOE), or 2-ON-methylacetamido (2-O-NMA). As another example, the nucleic acid sequence can include at least one 2-O-methyl-modified nucleotide, and in some embodiments, all of the nucleotides include a 2-O-methyl modification. In some embodiments, the nucleic acids are locked, i.e., comprise nucleic acid analogues in which the ribose ring is locked by a methylene bridge connecting the 2-O atom and the 4-C atom (see, e.g., Kaupinnen et al., Drug Disc. Today 2(3):287-290 (2005); Koshkin et al., J. Am. Chem. Soc., 120(50):13252-13253 (1998)). For additional modifications see US 20100004320, US 20090298916, and US 20090143326.
[0178] Techniques for the manipulation of nucleic acids used to practice this invention, such as, e.g., subcloning, labeling probes (e.g., random-primer labeling using Klenow polymerase, nick translation, amplification), sequencing, hybridization and the like are well described in the scientific and patent literature, see, e.g., Sambrook et al., Molecular Cloning; A Laboratory Manual 3d ed. (2001); Current Protocols in Molecular Biology, Ausubel et al., eds. (John Wiley & Sons, Inc., New York 2010); Kriegler, Gene Transfer and Expression: A Laboratory Manual (1990); Laboratory Techniques In Biochemistry And Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Tijssen, ed. Elsevier, N.Y. (1993).
Pharmaceutical Compositions
[0179] The methods described herein can include the administration of pharmaceutical compositions and formulations comprising a DNMT inhibitor and/or topoisomerase inhibitor, and optionally an inhibitor of XIST RNA and/or an Xist-interacting protein, e.g., a chromatin-modifying protein, e.g., a small molecule inhibitor or an inhibitory nucleic acid such as a small inhibitory RNA (siRNA) or LNA that targets XIST RNA and/or a gene encoding Xist or an Xist-interacting protein, e.g., a chromatin-modifying protein, and optionally an inhibitory nucleic acid that specifically binds, or is complementary, to a strong or moderate binding site or a supRNA described in WO 2012/065143, WO 2012/087983, WO 2014/025887 and U.S. Ser. No. 62/010,342. The methods can include administration of a single composition comprising a DNMT inhibitor and/or topoisomerase inhibitor, and an optional inhibitor of Xist or an Xist-interacting protein, e.g., a chromatin-modifying protein, or multiple compositions, e.g., each comprising one, two, or all three of a DNMT inhibitor, a topoisomerase inhibitor, and an optional inhibitor of Xist or an Xist-interacting protein, e.g., a chromatin-modifying protein.
[0180] In some embodiments, the compositions are formulated with a pharmaceutically acceptable carrier. The pharmaceutical compositions and formulations can be administered parenterally, topically, orally or by local administration, such as by aerosol or transdermally. The pharmaceutical compositions can be formulated in any way and can be administered in a variety of unit dosage forms depending upon the condition or disease and the degree of illness, the general medical condition of each patient, the resulting preferred method of administration and the like. Details on techniques for formulation and administration of pharmaceuticals are well described in the scientific and patent literature, see, e.g., Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
[0181] The inhibitory nucleic acids can be administered alone or as a component of a pharmaceutical formulation (composition). The compounds may be formulated for administration, in any convenient way for use in human or veterinary medicine. Wetting agents, emulsifiers and lubricants, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants can also be present in the compositions.
[0182] Formulations of the compositions of the invention include those suitable for intradermal, inhalation, oral/nasal, topical, parenteral, rectal, and/or intravaginal administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. The amount of active ingredient (e.g., nucleic acid sequences of this invention) which can be combined with a carrier material to produce a single dosage form will vary depending upon the host being treated, the particular mode of administration, e.g., intradermal or inhalation. The amount of active ingredient which can be combined with a carrier material to produce a single dosage form will generally be that amount of the compound which produces a therapeutic effect, e.g., an antigen specific T cell or humoral response.
[0183] Pharmaceutical formulations can be prepared according to any method known to the art for the manufacture of pharmaceuticals. Such drugs can contain sweetening agents, flavoring agents, coloring agents and preserving agents. A formulation can be admixtured with nontoxic pharmaceutically acceptable excipients which are suitable for manufacture. Formulations may comprise one or more diluents, emulsifiers, preservatives, buffers, excipients, etc. and may be provided in such forms as liquids, powders, emulsions, lyophilized powders, sprays, creams, lotions, controlled release formulations, tablets, pills, gels, on patches, in implants, etc.
[0184] Pharmaceutical formulations for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in appropriate and suitable dosages. Such carriers enable the pharmaceuticals to be formulated in unit dosage forms as tablets, pills, powder, dragees, capsules, liquids, lozenges, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Pharmaceutical preparations for oral use can be formulated as a solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable additional compounds, if desired, to obtain tablets or dragee cores. Suitable solid excipients are carbohydrate or protein fillers include, e.g., sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxy-methylcellulose; and gums including arabic and tragacanth; and proteins, e.g., gelatin and collagen. Disintegrating or solubilizing agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate. Push-fit capsules can contain active agents mixed with a filler or binders such as lactose or starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active agents can be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycol with or without stabilizers.
[0185] Aqueous suspensions can contain an active agent (e.g., nucleic acid sequences of the invention) in admixture with excipients suitable for the manufacture of aqueous suspensions, e.g., for aqueous intradermal injections. Such excipients include a suspending agent, such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia, and dispersing or wetting agents such as a naturally occurring phosphatide (e.g., lecithin), a condensation product of an alkylene oxide with a fatty acid (e.g., polyoxyethylene stearate), a condensation product of ethylene oxide with a long chain aliphatic alcohol (e.g., heptadecaethylene oxycetanol), a condensation product of ethylene oxide with a partial ester derived from a fatty acid and a hexitol (e.g., polyoxyethylene sorbitol mono-oleate), or a condensation product of ethylene oxide with a partial ester derived from fatty acid and a hexitol anhydride (e.g., polyoxyethylene sorbitan mono-oleate). The aqueous suspension can also contain one or more preservatives such as ethyl or n-propyl p-hydroxybenzoate, one or more coloring agents, one or more flavoring agents and one or more sweetening agents, such as sucrose, aspartame or saccharin. Formulations can be adjusted for osmolarity.
[0186] In some embodiments, oil-based pharmaceuticals are used for administration of nucleic acid sequences of the invention. Oil-based suspensions can be formulated by suspending an active agent in a vegetable oil, such as arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin; or a mixture of these. See e.g., U.S. Pat. No. 5,716,928 describing using essential oils or essential oil components for increasing bioavailability and reducing inter- and intra-individual variability of orally administered hydrophobic pharmaceutical compounds (see also U.S. Pat. No. 5,858,401). The oil suspensions can contain a thickening agent, such as beeswax, hard paraffin or cetyl alcohol. Sweetening agents can be added to provide a palatable oral preparation, such as glycerol, sorbitol or sucrose. These formulations can be preserved by the addition of an antioxidant such as ascorbic acid. As an example of an injectable oil vehicle, see Minto (1997) J. Pharmacol. Exp. Ther. 281:93-102.
[0187] Pharmaceutical formulations can also be in the form of oil-in-water emulsions. The oily phase can be a vegetable oil or a mineral oil, described above, or a mixture of these. Suitable emulsifying agents include naturally-occurring gums, such as gum acacia and gum tragacanth, naturally occurring phosphatides, such as soybean lecithin, esters or partial esters derived from fatty acids and hexitol anhydrides, such as sorbitan mono-oleate, and condensation products of these partial esters with ethylene oxide, such as polyoxyethylene sorbitan mono-oleate. The emulsion can also contain sweetening agents and flavoring agents, as in the formulation of syrups and elixirs. Such formulations can also contain a demulcent, a preservative, or a coloring agent. In alternative embodiments, these injectable oil-in-water emulsions of the invention comprise a paraffin oil, a sorbitan monooleate, an ethoxylated sorbitan monooleate and/or an ethoxylated sorbitan trioleate.
[0188] The pharmaceutical compounds can also be administered by in intranasal, intraocular and intravaginal routes including suppositories, insufflation, powders and aerosol formulations (for examples of steroid inhalants, see e.g., Rohatagi (1995) J. Clin. Pharmacol. 35:1187-1193; Tjwa (1995) Ann. Allergy Asthma Immunol. 75:107-111). Suppositories formulations can be prepared by mixing the drug with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at body temperatures and will therefore melt in the body to release the drug. Such materials are cocoa butter and polyethylene glycols.
[0189] In some embodiments, the pharmaceutical compounds can be delivered transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols.
[0190] In some embodiments, the pharmaceutical compounds can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug which slowly release subcutaneously; see Rao (1995) J. Biomater Sci. Polym. Ed. 7:623-645; as biodegradable and injectable gel formulations, see, e.g., Gao (1995) Pharm. Res. 12:857-863 (1995); or, as microspheres for oral administration, see, e.g., Eyles (1997) J. Pharm. Pharmacol. 49:669-674.
[0191] In some embodiments, the pharmaceutical compounds can be parenterally administered, such as by intravenous (IV) administration or administration into a body cavity or lumen of an organ. These formulations can comprise a solution of active agent dissolved in a pharmaceutically acceptable carrier. Acceptable vehicles and solvents that can be employed are water and Ringer's solution, an isotonic sodium chloride. In addition, sterile fixed oils can be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can likewise be used in the preparation of injectables. These solutions are sterile and generally free of undesirable matter. These formulations may be sterilized by conventional, well known sterilization techniques. The formulations may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate and the like. The concentration of active agent in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight, and the like, in accordance with the particular mode of administration selected and the patient's needs. For IV administration, the formulation can be a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated using those suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a suspension in a nontoxic parenterally-acceptable diluent or solvent, such as a solution of 1,3-butanediol. The administration can be by bolus or continuous infusion (e.g., substantially uninterrupted introduction into a blood vessel for a specified period of time).
[0192] In some embodiments, the pharmaceutical compounds and formulations can be lyophilized. Stable lyophilized formulations comprising an inhibitory nucleic acid can be made by lyophilizing a solution comprising a pharmaceutical of the invention and a bulking agent, e.g., mannitol, trehalose, raffinose, and sucrose or mixtures thereof. A process for preparing a stable lyophilized formulation can include lyophilizing a solution about 2.5 mg/mL protein, about 15 mg/mL sucrose, about 19 mg/mL NaCl, and a sodium citrate buffer having a pH greater than 5.5 but less than 6.5. See, e.g., U.S. 20040028670.
[0193] The compositions and formulations can be delivered by the use of liposomes. By using liposomes, particularly where the liposome surface carries ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the active agent into target cells in vivo. See, e.g., U.S. Pat. Nos. 6,063,400; 6,007,839; Al-Muhammed (1996) J. Microencapsul. 13:293-306; Chonn (1995) Curr. Opin. Biotechnol. 6:698-708; Ostro (1989) Am. J. Hosp. Pharm. 46:1576-1587. As used in the present invention, the term liposome means a vesicle composed of amphiphilic lipids arranged in a bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles that have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes that are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH-sensitive or negatively-charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells.
[0194] Liposomes can also include sterically stabilized liposomes, i.e., liposomes comprising one or more specialized lipids. When incorporated into liposomes, these specialized lipids result in liposomes with enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome comprises one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860.
[0195] The formulations of the invention can be administered for prophylactic and/or therapeutic treatments. In some embodiments, for therapeutic applications, compositions are administered to a subject who is need of reduced triglyceride levels, or who is at risk of or has a disorder described herein, in an amount sufficient to cure, alleviate or partially arrest the clinical manifestations of the disorder or its complications; this can be called a therapeutically effective amount. For example, in some embodiments, pharmaceutical compositions of the invention are administered in an amount sufficient to decrease serum levels of triglycerides in the subject.
[0196] The amount of pharmaceutical composition adequate to accomplish this is a therapeutically effective dose. The dosage schedule and amounts effective for this use, i.e., the dosing regimen, will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient's physical status, age and the like. In calculating the dosage regimen for a patient, the mode of administration also is taken into consideration.
[0197] The dosage regimen also takes into consideration pharmacokinetics parameters well known in the art, i.e., the active agents' rate of absorption, bioavailability, metabolism, clearance, and the like (see, e.g., Hidalgo-Aragones (1996) J. Steroid Biochem. Mol. Biol. 58:611-617; Groning (1996) Pharmazie 51:337-341; Fotherby (1996) Contraception 54:59-69; Johnson (1995) J. Pharm. Sci. 84:1144-1146; Rohatagi (1995) Pharmazie 50:610-613; Brophy (1983) Eur. J. Clin. Pharmacol. 24:103-108; Remington: The Science and Practice of Pharmacy, 21st ed., 2005). The state of the art allows the clinician to determine the dosage regimen for each individual patient, active agent and disease or condition treated. Guidelines provided for similar compositions used as pharmaceuticals can be used as guidance to determine the dosage regiment, i.e., dose schedule and dosage levels, administered practicing the methods of the invention are correct and appropriate.
[0198] Single or multiple administrations of formulations can be given depending on for example: the dosage and frequency as required and tolerated by the patient, the degree and amount of therapeutic effect generated after each administration (e.g., effect on tumor size or growth), and the like. The formulations should provide a sufficient quantity of active agent to effectively treat, prevent or ameliorate conditions, diseases or symptoms.
[0199] In alternative embodiments, pharmaceutical formulations for oral administration are in a daily amount of between about 1 to 100 or more mg per kilogram of body weight per day. Lower dosages can be used, in contrast to administration orally, into the blood stream, into a body cavity or into a lumen of an organ. Substantially higher dosages can be used in topical or oral administration or administering by powders, spray or inhalation. Actual methods for preparing parenterally or non-parenterally administrable formulations will be known or apparent to those skilled in the art and are described in more detail in such publications as Remington: The Science and Practice of Pharmacy, 21st ed., 2005.
[0200] Various studies have reported successful mammalian dosing using complementary nucleic acid sequences. For example, Esau C., et al., (2006) Cell Metabolism, 3(2):87-98 reported dosing of normal mice with intraperitoneal doses of miR-122 antisense oligonucleotide ranging from 12.5 to 75 mg/kg twice weekly for 4 weeks. The mice appeared healthy and normal at the end of treatment, with no loss of body weight or reduced food intake. Plasma transaminase levels were in the normal range (AST 45, ALT 35) for all doses with the exception of the 75 mg/kg dose of miR-122 ASO, which showed a very mild increase in ALT and AST levels. They concluded that 50 mg/kg was an effective, non-toxic dose. Another study by Krtzfeldt J., et al., (2005) Nature 438, 685-689, injected anatgomirs to silence miR-122 in mice using a total dose of 80, 160 or 240 mg per kg body weight. The highest dose resulted in a complete loss of miR-122 signal. In yet another study, locked nucleic acids (LNAs) were successfully applied in primates to silence miR-122. Elmen J., et al., (2008) Nature 452, 896-899, report that efficient silencing of miR-122 was achieved in primates by three doses of 10 mg kg-1 LNA-antimiR, leading to a long-lasting and reversible decrease in total plasma cholesterol without any evidence for LNA-associated toxicities or histopathological changes in the study animals.
[0201] In some embodiments, the methods described herein can include co-administration with other drugs or pharmaceuticals, e.g., compositions for providing cholesterol homeostasis. For example, the inhibitory nucleic acids can be co-administered with drugs for treating or reducing risk of a disorder described herein.
Disorders Associated with X-Inactivation
[0202] The present disclosure provides methods for treating X-linked diseases formulated by administering a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, optionally with an inhibitor of an Xist interacting protein, e.g., a small molecule inhibitor or an inhibitory nucleic acid such as a small inhibitory RNA (siRNA) or LNA that targets XIST or a gene encoding XIST or an Xist-interacting protein, e.g., a chromatin-modifying protein, and optionally an inhibitory nucleic acid that specifically binds, or is complementary, to a strong or moderate binding site or a supRNA described in WO 2012/065143, WO 2012/087983, WO 2014/025887 and U.S. Ser. No. 62/010,342, to disrupt silencing of genes controlled by the PRC2 sites (e.g., all of the genes within a cluster), or to disrupt silencing of one specific gene. This methodology is useful in X-linked disorders, e.g., in heterozygous women who retain a wildtype copy of a gene on the Xi (See, e.g., Lyon, Acta Paediatr Sunni. 2002; 91(439):107-12; Carrell and Willard, Nature. 434(7031):400-4 (2005); den Veyver, Semin Reprod Med. 19(2):183-91 (2001)). In females, reactivating a non-disease silent allele on the Xi would be therapeutic in many cases of X-linked disease, such as Rett Syndrome (caused by MECP2 mutations), Fabry's Disease (caused by GLA mutations), or X-linked hypophosphatemia (caused by mutation of PHEX). The methodology may also be utilized to treat male X-linked disease. In both females and males, upregulation of a hypomorphic or epigenetically silenced allele may alleviate disease phenotype, such as in Fragile X Syndrome, where the mechanism of epigenetic silencing of FMK/may be similar to epigenetic silencing of a whole Xi in having many different types of heterochromatic marks.
[0203] As a result of X-inactivation, heterozygous females are mosaic for X-linked gene expression; some cells express genes from the maternal X and other cells express genes from the paternal X. The relative ratio of these two cell populations in a given female is frequently referred to as the X-inactivation pattern. One cell population may be at a selective growth disadvantage, resulting in clonal outgrowth of cells with one or the other parental X chromosome active; this can cause significant deviation or skewing from an expected mean X-inactivation pattern (i.e., 50:50). See, e.g., Plenge et al., Am. J. Hum. Genet. 71:168-173 (2002) and references cited therein.
[0204] The present methods can be used to treat disorders associated with X-inactivation, which includes those listed in Table 8. The methods include administering a DNA methyltransferase (DNMT) Inhibitor and/or a topoisomerase inhibitor, optionally with an inhibitor of XIST RNA an Xist-interacting protein, e.g., a chromatin-modifying protein, e.g., a small molecule inhibitor or an inhibitory nucleic acid such as a small inhibitory RNA (siRNA) or LNA that targets Xist or a gene encoding Xist or an Xist-interacting protein, e.g., a chromatin-modifying protein, and optionally an inhibitory nucleic acid that specifically binds, or is complementary, to a strong or moderate binding site or a supRNA described in WO 2012/065143, WO 2012/087983, WO 2014/025887 and U.S. Ser. No. 62/010,342, i.e., a supRNA associated with the gene that causes the disorder, as shown in Table 8 and WO 2012/065143, WO 2012/087983, and WO 2014/025887.
TABLE-US-00002 TABLE 8 X Linked Disorders and Associated Genes Disorder OMIM # Locus Gene Dent's disease 1 300009 Xp11.22 CLCN5 Testicular feminization syndrome 300068 Xq11-q12 AR Addison's disease with cerebral 300100 Xq28 ABCD1 sclerosis Adrenal hypoplasia 300200 XP21.3-p21.2 DAX1 siderius X-linked mental 300263 Xp11.22 PHF8 retardation syndrome Agammaglobulinaemia, Bruton 300300 Xq21.3-q22 BTK type Choroidoretinal degeneration 300389 Xp21.1 RPGR Choroidoaemia 300390 Xq21.2 CHM Albinism, ocular 300500 Xp22.3 OA1 Dent's disease 2 300555 Xq25-q26 OCRL fragile X syndrome 300624 Xq27.3 FMR1 Rett/Epileptic encephalopathy, 300672 Xp22.13 CDKL5 early infantile, 2 Albinism-deafness syndrome 300700 Xq26.3-q27.1 ADFN paroxysmal nocturnal 300818 Xp22.2 PIGA hemoglobulinuria Aldrich syndrome 301000 Xp11.23-p11.22 WAS Alport syndrome 301050 Xq22.3 COL4A5 Anaemia, hereditary hypochromic 301300 Xp11.21 ALAS2 Anemia, sideroblastic, with ataxia 301310 Xq13.3 ABCB7 Fabry disease 301500 Xq22 GLA Spinal muscular atrophy 2 301830 Xp11.23 UBA1 Cataract, congenital 302200 Xp CCT Charcot-Marie-Tooth, peroneal 302800 Xq13.1 GJB1 Spastic paraplegia 303350 Xq28 L1CAM Colour blindness 303800 Xq28 OPN1MW Diabetes insipidus, nephrogenic 304800 Xq28 AVPR2 Dyskeratosis congenita 305000 Xq28 DKC1 Ectodermal dysplasia, anhidrotic 305100 Xq12-q13.1 ED1 Faciagenital dysplasia (Aarskog 305400 Xp11.21 FGD1 syndrome) Glucose-6-phosphate 305900 Xq28 G6PD dehydrogenase deficiency Glycogen storage disease type 306000 Xp22.2-p22.1 PHKA2 VIII Gonadal dysgenesis (XY female 306100 Xp22.11-p21.2 GDXY type) Granulomatous disease (chronic) 306400 Xp21.1 CYBB Haemophilia A 306700 Xq28 F8 Haemophilia B 306900 Xq27.1-q27.2 F9 Hydrocephalus (aqueduct stenosis) 307000 Xq28 L1CAM Hydrophosphataemic rickets 307800 Xp22.2-p22.1 PHEX Lesch-Nyhan syndrome 308000 Xq26-q27.2 HPRT1 (hypoxanthine-guanine- phosphoribosyl transferase deficiency) Incontinentia pigmenti 308300 Xq28 IBKBG Kallmann syndrome 308700 Xp22.3 KAL1 Keratosis follicularis spinulosa 308800 Xp22.1 SAT Lowe (oculocerebrorenal) 309000 Xq26.1 OCRL syndrome Menkes syndrome 309400 Xq12-q13 ATP7A Renpenning syndrome 309500 Xp11.23 PQBP1 Mental retardation, with or 309530 Xp11.3-q21.1 MRX1 without fragile site (numerous specific types) Coffin-Lowry syndrome 309580 Xq13 ATRX Microphthalmia with multiple 309800 Xq27-q28 MAA anomalies (Lenz syndrome) Muscular dystrophy (Becker, 310300 Xq28 EMD Duchenne and Emery-Dreifuss types) Myotubular myopathy 310400 Xq28 MTM1 Night blindness, cogenital 310500 Xp11.4 CSNB1 stationary Norrie's disease (pseudoglioma) 310600 Xp11.4 NDP Nystagmus, oculomotor or jerky 310700 Xq26-q27 NYS1 Orofaciodigital syndrome (type I) 311200 Xp22.2-p22.2 OFD1 Ornithine transcarbamylase 311250 Xp21.1 OTC deficiency (type I hyperammonaemia) Phosphoglycerate kinase 311800 Xq13 PGK1 deficiency Phosphoribosylpyrophosphate 311850 Xq22-q24 PRPS1 synthetase deficiency Retinitis pigmentosa 312610 Xp21.1 RPGR Retinoschisis 312700 Xp22.2-p22.1 RS1 Rett syndrome 312750 Xq28, Xp22 MECP2 Muscular atrophy/ 313200 Xq11-q12 AR Dihydrotestosterone receptor deficiency Spinal muscular atrophy 313200 Xq11-q12 AR Spondyloepiphyseal dysplasia 313400 Xp22.2-p22.1 SEDL tarda Thrombocytopenia, hereditary 313900 Xp11.23-p11.22 WAS Throxine-binding globulin, 314200 Xq22.2 TBG absence McLeod syndrome 314850 Xp21.1 XK Table 8 was adapted in part from Germain, Chapter 7: General aspects of X-linked diseases in Fabry Disease: Perspectives from 5 Years of FOS. Mehta A, Beck M, Sunder-Plassmann G, editors. (OXford: Oxford PharmaGenesis; 2006).
Identification of Direct Rna Interacting Proteins (iDRIP)
[0205] Also described herein is a method for identifying proteins that interact with a selected nucleic acid, e.g., an RNA such as an supRNA. The methods include in vivo UV crosslinking the proteins to the DNA in a living cell, preparing the nuclei, solubilizing the chromatin (e.g., by DNase I digestion), creating protein-RNA complexes through hybridization to capture probes specific for the selected RNA, treating the protein-RNA complexes with DNase, isolating the protein-RNA complexes using the capture probes (e.g., capture probes bound to beads) and washing, preferably under denaturing conditions to eliminate protein factors that were not covalently linked by UV to the selected RNA. To minimize background due to DNA-bound proteins, a critical DNase I treatment can be performed prior to elution. These methods can be used to identify proteins bound to any nucleic acid, e.g., RNA, e.g., any non-coding or coding RNA.
EXAMPLES
[0206] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
[0207] Materials and Methods
[0208] The following materials and methods were used in the Examples, below.
[0209] Identification of Direct RNA interacting Proteins (iDRiP)
[0210] Mouse Embryonic Fibroblasts (MEFs) were irradiated with UV light at 200 mJ energy (Stratagene 2400) after rinsing with PBS. The pellets were resuspended in CSKT-0.5% (10 mM PIPES, pH 6.8, 100 mM NaCl, 3 mM MgCl.sub.2, 0.3 M sucrose, 0.5% Triton X-100, 1 mM PMSF) for 10 min at 4 C. followed by a spin. The pellets were again resuspended in Nuclear Isolation Buffer (10 mM Tris pH 7.5, 10 mM KCl, 0.5% Nonidet-P 40, 1 protease inhibitors, 1 mM PMSF), and rotated at 4 C. for 10 min. The pellets were collected after a spin, weighed, flash frozen in liquid nitrogen, and stored at 80 C. until use.
[0211] Approximately, equal amounts of female and male UV cross linked pellets were thawed and resuspended for treatment with Turbo DNase I in the DNase I digestion buffer (50 mM Tris pH 7.5, 0.5% Nonidet-P 40, 0.1% sodium lauroyl sarcosine, 1 protease inhibitors, SuperaseIn). The tubes were rotated at 37 C. for 45 min. The nuclear lysates were further solubilized by adding 1% sodium lauroyl sarcosine, 0.3 M lithium chloride, 25 mM EDTA and 25 mM EGTA to final concentrations and continued incubation at 37 C. for 15 min. The lysates were mixed with biotinylated DNA probes (Table 1A) prebound to the streptavidin magnetic beads (MyOne streptavidin C1 Dyna beads, Invitrogen) and incubated at 55 C. for 1 hr before overnight incubation at 37 C. in the hybridization chamber. The beads were washed three times in Wash Buffer (10 mM Tris, pH 7.5, 0.3 M LiCl, 1% LDS, 0.5% Nonidet-P 40, 1 protease inhibitor) at room temperature followed by treatment with Turbo DNase I in DNase I digestion buffer with the addition of 0.3 M LiCl, protease inhibitors, and superaseIn at 37 C. for 20 min. Then, beads were washed two more times in the Wash Buffer. For MS analysis, elution was done in Elution Buffer (10 mM Tris, pH 7.5, 1 mM EDTA) at 70 C. for 4 min followed by brief sonication in Covaris. For the quantification of pulldown efficiency, MEFs, without crosslinking, were used and elution was done at 95 C. The elute was used for RNA isolation and RT-qPCR. When crosslinked MEFs were used, elute was subjected for proteinase-K treatment (50 mM Tris pH 7.5, 100 mM NaCl, 0.5% SDS, 10 g proteiase K) for 1 hr at 55 C. RNA were isolated by Trizol and quantified with SYBR green qPCR. Input samples were used to make standard curve by 10 fold dilutions, to which the RNA pulldown efficiencies were compared and calculated. The efficiency of Xist pulldown was relatively lower after UV crosslinking, similar to (48, 49).
TABLE-US-00003 TABLE1A BiotinylatedOligosusedinXist interactomecapture SEQ ID Sequence NO: X1 CAGTTTAAGAGCAAAGTCGTTTTTC 1 X2 AATATGTTTACATTACAGGTGGCAA 2 X3 TAAAGACCAAGCAAAGATACTTGTC 3 X4 ATGCTTCATATATTCAGTGGTTCAC 4 X5 TGTATTAAGTGAAATTCCATGACCC 5 X6 AACTTAGCAATTAATTCTGGGACTC 6 X7 ATGCATATCTGTATGCATGCTTATT 7 X8 CATATTACTTGGGGACTAAGGACTA 8 X9 ATGGGCACTGCATTTTAGCAATA 9
TABLE-US-00004 TABLE1B PrimersusedinqPCR SEQ ID Sequence NO: U1snRNA-F CCAGGGCGAGGCTTATCCATT 10 U1snRNA-R GCAGTCCCCCACTACCACAAAT 11 eGFP-F GACGTAAACGGCCACAAGTT 12 eGFP-R AAGTCGTGCTGCTTCATGTG 13 U6snRNA-F CTCGCTTCGGCAGCACA 14 U6snRNA-R AACGCTTCACGAATTTGCGT 15 Smc1a-F TCGGACCATTTCAGAGGTTTACC 16 Smc1a-R CAGGTGCTCCATGTATCAGGT 17 Smc3-F CGAAGTTACCGAGACCAAACA 18 Smc3-R TCACTGAGAACAAACTGGATTGC 19 Rad21-F ATGTTCTACGCACATTTTGTCCT 20 Rad21-R TGCACTCAAATACATGGGCTTT 21 Kif4-F AGGTGAAGGGGATTCCCGTAA 22 Kif4-R AAACACGCCTTTTATGAGTGGA 23 Pds5a-F TTGGGAAACTGATGACCATAGC 24 Pds5a-R ACACAAACGTCAGCCTGCTT 25 Aurkb-F CAGAAGGAGAACGCCTACCC 26 Aurkb-R GAGAGCAAGCGCAGATGTC 27 Top2b-F CTGACCTGGGTGAACAATGCT 28 Top2b-R TGGCTCCACTGATCCAATGTAT 29 Top2a-F GAGAGGCTACGACTCTGACC 30 Top2a-R CTCCAGGTAGGGGGATGTTG 31 Top1-F AAGATCGAGAACACCGGCATA 32 Top1-R CTTTTCCTCCTTCGGTCTTTCC 33 Ctcf-F GATCCTACCCTTCTCCAGATGAA 34 Ctcf-R GTACCGTCACAGGAACAGGT 35 Smarca4-F CAAAGACAAGCATATCCTAGCCA 36 Smarca4-R CACGTAGTGTGTGTTAAGGACC 37 Smarca5-F GACACCGAGATGGAGGAAGTA 38 Smarca5-R CGAACAGCTCTGTCTGCTTTA 39 Smarcc1-F AGCTAGATTCGGTGCGAGTCT 40 Smarcc1-R CCACCAGTCCAGCTAGTGTTTT 41 Smarcc2-F GCTGCCTACAAATTCAAGAGTGA 42 Smarcc2-R AGGAAAATGTTAGGTCGTGACAG 43 Smarcb1-F TCCGAGGTGGGAAACTACCTG 44 Smarcb1-R CAGAGTGAGGGGTATCTCTTGT 45 Sun2-F ATCCAGACCTTCTATTTCCAGGC 46 Sun2-R CCCGGAAGCGGTAGATACAC 47
[0212] Quantitative Proteomics
[0213] Proteins co-enriched with Xist from female or male cells were quantitatively analyzed either using a label-free approach based on spectral-counting (21) or by multiplexed quantitative proteomics using tandem-mass tag (TMT) reagents (50, 51) on an Orbitrap Fusion mass spectrometer (Thermo Scientific). Disulfide bonds were reduced with ditheiothreitol (DTT) and free thiols alkylated with iodoacetamide as described previously (22). Proteins were then precipitated with tricholoracetic acid, resuspended in 50 mM HEPES (pH 8.5) and 1 M urea and digested first with endoproteinase Lys-C(Wako) for 17 hours at room temperature and then with sequencing-grade trypsin (Promega) for 6 hours at 37 C. Peptides were desalted over Sep-Pak C.sub.18 solid-phase extraction (SPE) cartridges (Waters), the peptide concentration was determined using a BCA assay (Thermo Scientific). For the label-free analysis peptides were then dried and re-suspended in 5% formic acid (FA) and 5% acetonitrile (ACN) and 5 g of peptides were analyzed by mass spectrometry as described below. For the multiplexed quantitative analysis a maximum of 50 g of peptides were labeled with one out of the available TMT-10plex reagents (Thermo Scientific) (51). To achieve this, peptides were dried and resuspended in 50 l of 200 mM HEPES (pH 8.5) and 30% (ACN) and 10 g of the TMT in reagent in 5 l of anhydrous ACN was added to the solution, which was incubated at room temperature (RT) for one hour. The reaction was then quenched by adding 6 l of 5% (w/v) hydroxylamine in 200 mM HEPES (pH 8.5) and incubation for 15 min at RT. The labeled peptide mixture was then subjected to a fractionation using basic pH reversed phase liquid chromatography (bRPLC) on an Agilent 1260 Infinity HPLC system equipped with an Agilent Extend-C18 column (4.6250 mm; particle size, 5 m) basically as described previously (52). Peptides were fractionated using a gradient from 22-35 ACN in 10 mM ammonium bicarbonate over 58 min at a flowrate of 0.5 ml/min. Fractions of 0.3 ml were collected into a 96-well plate to then be pooled into a total twelve fractions (A1-A12, B1-B12, etc.) that were dried and re-suspended in 8 l of 5% FA and 5% ACN, 3 of which were analyzed by microcapillary liquid chromatography tandem mass spectrometry on an Orbitrap Fusion mass spectrometer and using a recently introduced multistage (MS3) method to provide highly accurate quantification (53).
[0214] The mass spectrometer was equipped with an EASY-nLC 1000 integrated autosampler and HPLC pump system. Peptides were separated over a 100 m inner diameter microcapillary column in-house packed with first 0.5 cm of Magic C4 resin (5 m, 100 , Michrom Bioresources), then with 0.5 cm of Maccel C.sub.18 resin (3 m, 200 , Nest Group) and 29 cm of GP-C18 resin (1.8 m, 120 , Sepax Technologies). Peptides were eluted applying a gradient of 8-27% ACN in 0.125% formic acid over 60 min (label-free) and 165 min (TMT) at a flow rate of 300 nl/min. For label-free analyses we applied a tandem-MS method where a full-MS spectrum (MS1; m/z 375-1500; resolution 610.sup.4; AGC target, 510.sup.5; maximum injection time, 100 ms) was acquired using the Orbitrap after which the most abundant peptide ions where selected for linear ion trap CID-MS2 in an automated fashion. MS2 scans were done in the linear ion trap using the following settings: quadrupole isolation at an isolation width of 0.5 Th; fragmentation method, CID; AGC target, 110.sup.4; maximum injection time, 35 ms; normalized collision energy, 30%). The number of acquired MS2 spectra was defined by setting the maximum time of one experimental cycle of MS1 and MS2 spectra to 3 sec (Top Speed). To identify and quantify the TMT-labeled peptides we applied a synchronous precursor selection MS3 method (22, 53, 54) in a data dependent mode. The scan sequence was started with the acquisition of a full MS or MS1 one spectrum acquired in the Orbitrap (m/z range, 500-1200; other parameters were set as described above), and the most intense peptide ions from detected in the full MS spectrum were then subjected to MS2 and MS3 analysis, while the acquisition time was optimized in an automated fashion (Top Speed, 5 sec). MS2 scans were performed as described above. Using synchronous precursor selection the 10 most abundant fragment ions were selected for the MS3 experiment following each MS2 scan. The fragment ions were further fragmented using the HCD fragmentation (normalized collision energy, 50%) and the MS3 spectrum was acquired in the Orbitrap (resolution, 60,000; AGC target, 510.sup.4; maximum injection time, 250 ms).
[0215] Data analysis was performed on an on an in-house generated SEQUEST-based (55) software platform. RAW files were converted into the mzXML format using a modified version of ReAdW.exe. MS2 spectra were searched against a protein sequence database containing all protein sequences in the mouse UniProt database (downloaded Feb. 4, 2014) as well as that of known contaminants such as porcine trypsin. This target component of the database was followed by a decoy component containing the same protein sequences but in flipped (or reversed) order (56). MS2 spectra were matched against peptide sequences with both termini consistent with trypsin specificity and allowing two missed trypsin cleavages. The precursor ion m/z tolerance was set to 50 ppm, TMT tags on the N-terminus and on lysine residues (229.162932 Da, only for TMT analyses) as well as carbamidomethylation (57.021464 Da) on cysteine residues were set as static modification, and oxidation (15.994915 Da) of methionines as variable modification. Using the target-decoy database search strategy (56) a spectra assignment false discovery rate of less than 1% was achieved through using linear discriminant analysis with a single discriminant score calculated from the following SEQUEST search score and peptide sequence properties: mass deviation, XCorr, dCn, number of missed trypsin cleavages, and peptide length (57). The probability of a peptide assignment to be correct was calculated using a posterior error histogram and the probabilities for all peptides assigned to a protein were combined to filter the data set for a protein FDR of less than 1%. Peptides with sequences that were contained in more than one protein sequence from the UniProt database were assigned to the protein with most matching peptides (57).
[0216] For a quantitative estimation of protein concentration using spectral-counts we simply counted the number of MS2 spectra assigned to a given protein (Tables 5-6). TMT reporter ion intensities were extracted as that of the most intense ion within a 0.03 Th window around the predicted reporter ion intensities in the collected MS3 spectra. Only MS3 with an average signal-to-noise value of larger than 28 per reporter ion as well as with an isolation specificity (22) of larger than 0.75 were considered for quantification. Reporter ions from all peptides assigned to a protein were summed to define the protein intensity. A two-step normalization of the protein TMT-intensities was performed by first normalizing the protein intensities over all acquired TMT channels for each protein based to the median average protein intensity calculated for all proteins. To correct for slight mixing errors of the peptide mixture from each sample a median of the normalized intensities was calculated from all protein intensities in each TMT channel and the protein intensities were normalized to the median value of these median intensities.
[0217] UV RIP
[0218] The protocol followed is similar to the one described in (18). Briefly, MEFs were crosslinked with UV light at 200 mJ and collected by scraping in PBS. Cell pellets were resuspended in CSKT-0.5% for 10 min at 4 C. followed by a spin. The nuclei were resuspended in the UV RIP buffer (PBS buffer containing 300 mM NaCl (total), 0.5% Nonidet-P 40, 0.5% sodium deoxycholate, and 1 protease inhibitors) with Turbo DNase I 30 U/IP for 30 min at 37 C. Supernatants were collected after a spin and incubated with 5 g specific antibodies prebound to 40 l protein-G magnetic beads (Invitrogen) at 4 C. overnight. Beads were washed three times with cold UV RIP buffer. The beads were resuspended in 200 l Turbo DNase I buffer with 20 U Turbo DNase, SuperaseIN, 1 protease inhibitors) for 30 min at 37 C. The beads were resuspended and washed three more times in the UV RIP washing buffer containing 10 mM EDTA. The final 3 washes were given after three fold dilution of UV RIP washing buffer. The beads were resuspended in 200 l proteinase-K buffer with 10 g proteinase-K and incubated at 55 C. for 1 hr. RNA was isolated by Trizol and pulldown efficiencies were calculated by SYBR qPCR using input for the standard curve.
[0219] Generation of Xi-TgGFP Clonal Fibroblasts
[0220] Xi-TgGFP (68-5-11) tail-tip fibroblasts (TTF) were initially derived from a single female pup, a daughter of a cross between a M. castaneus male and a M. musculus female, homozygous for an X-linked GFP transgene driven by a strong, ubiquitous promoter (58). The fibroblasts were immortalized by SV40 transformation, and clonal lines were derived from individual GFP-negative cells selected by fluorescence-activated cell sorting. In our experience, occasional clones with undetectable GFP expression nevertheless have the transgene located on the active X chromosome. Thus, we confirmed the GFP transgene location on the inactive X for the particular clone used here, 68-5-11 (see
[0221] Generation of Stable KD of Xi-TgGFP TTF and 16.7 ES Cells
[0222] A cocktail of 3 shRNA viruses were used for infections (Table 2) followed with puromycin selection using standard methodology. In all the experiments, polyclonal knock down cells were used.
TABLE-US-00005 TABLE 2 Lentiviral shRNA constructs used for stable knockdowns of candidate Xist interactors. RefSeq_shRNA viruses Xist interacting candidates TRCN0000011883 Top1 TRCN0000321370 Ctcf TRCN0000071385 Smarca4 TRCN0000295773 Smarca5 TRCN0000321371 Ctcf TRCN0000109008 SMc3 TRCN0000276847 Rad21 TRCN0000174832 Rad21 TRCN0000321718 Aurkb TRCN0000317702 Smarcb1 TRCN0000071383 SMarca4 TRCN0000325493 Top2a TRCN0000295713 Smarca5 TRCN0000309135 Kif4 TRCN0000321651 Aurkb TRCN0000109007 Smc3 TRCN0000090909 Kif4 TRCN0000321444 Ctcf TRCN0000071388 Smarcc1 TRCN0000288446 Smarca5 TRCN0000072181 GFP TRCN0000071389 Smarcc1 TRCN0000070988 Top2b TRCN0000011884 Top1 TRCN0000070990 Top2b TRCN0000229486 Pds5a TRCN0000011886 Top1 TRCN0000085541 Smarcc2 TRCN0000317622 Smarcb1 TRCN0000324673 Smc1a TRCN0000229484 Pds5a TRCN0000085540 Smarcc2 TRCN0000070987 Top2a TRCN0000071386 Smarca4 TRCN0000109009 Smc3 TRCN0000246806 Sun2 TRCN0000276903 Rad21 TRCN0000071391 Smarcc1 TRCN0000070992 Top2b TRCN0000317701 Smarcb1 TRCN0000085542 Smarcc2 TRCN0000321719 Aurkb TRCN0000246805 Sun2 TRCN0000246804 Sun2 TRCN0000217996 Pds5a TRCN0000090908 Kif4 TRCN0000324674 Smc1a TRCN0000324672 Smc1a TRCN0000353984 Top2a TRCN0000231782_pLKO_TRC021 control TRCN0000231782_pLKO_TRC021 control
[0223] Assay for the Reactivation of Xi-TgGFP
[0224] Approximately, 125,000-150,000 Xi-TgGFP (68-5-11) cells were plated along with control (shNegative control, i.e., shNC) cells treated with DMSO or stable KD cells treated with 0.3 M azacytidine and 0.3 M Etoposide for 3 days in 6 well plates. RNA was isolated by Trizol twice, with an intermittent TurboDNase treatment after the first isolation for 30 min at 37 C. One g RNA was used for each of the RT+ and RT reactions (Superscript III, Invitrogen) followed by the SYBR green qPCR using the primers listed in Table 3, with annealing temperature of 60 C. for 45 cycles. The relative efficiency of Xi-TgGFP reactivations was calculated by comparing to U1 snRNA as the internal control.
TABLE-US-00006 TABLE3 PrimersusedinPCRforgeneration ofXi-TgGFPcellline SEQ ID Sequence NO: MeCP2-F ATGGTAGCTGGGATGTTAGGG 48 MeCP2-R GAGCGAAAAGCTTTTCCCTGG 49
[0225] ImmunoFISH
[0226] Cells were grown on coverslips, rinsed in PBS, pre-extracted in 0.5% CSKT on ice, washed once in CSK, followed by fixation with 4% paraformaldehyde in PBS at room temperature. After blocking in 1% BSA in PBS for 20 min supplemented to with 10 mM VRC (New England Biolabs) and RNase inhibitor (Roche), incubation was carried out with primary antibodies (Table 4) at room temperature for 1 hr. Cells were washed three times in PBST-0.02% Tween-20. After incubating with secondary antibody at room temperature for 30 min, cells were washed three times by PBS/0.02% Tween-20. Cells were fixed again in 4% paraformaldehyde and dehydrated in ethanol series. RNA FISH was performed using a pool of Cy3B or Alexa 568 labeled Xist oligonucleotides for 4-6 hours at 42 C. in a humid chamber. Cells were washed three times in 2SSC and nuclei were counter-stained by Hoechst 33342. Cells were observed under Nikon 90i microscope equipped with 60/1.4 N.A. objective lens, Orca ER CCD camera (Hamamatsu), and Volocity software (Perkin Elmer). Xist RNA FISH probes, a set of total 37 oligonucleotides with 5 amine modification (IDT), were labeled with NHS-Cy3B (GE Healthcare) overnight at room temperature followed by ethanol precipitation. In the case of confirmation of Xi-TgGFP cells, probes were made by nick-translation of a GFP PCR product with Cy3-dUTP and of a plasmid containing the first exon of the mouse Xist gene, with FITC-dUTP.
TABLE-US-00007 TABLE 4 Antibodies Brand Antibodies and Catalog # NOVUS BIOLOGICALS INC SMC3 antibody (NB100-207) NOVUS BIOLOGICALS INC SMC1 Antibody (A300-055A) BETHYL LABORATORIES INC TOP1 Antibody (A302-589A) SIGMA-ALDRICH INC ANTI-SUN2 antibody (HPA001209-100UL) ABCAM INC Anti-BRG1 antibody [EPNCIR111A] (ab110641) PROTEINTECH GROUP INC TOP2A-Specific Antibody (20233-1-AP) ABCAM INC Anti-Aurora B Kinase antibody (ab2254) ABCAM INC Anti-Rad21 antibody - ChIP Grade (ab992) ACTIVE MOTIF Histone H3K27me3 antibody (pAb) (39155) PROTEINTECH GROUP INC TOP2B Polyclonal Antibody (20549-1-AP) CELL SIGNALING TECHNOLOGY SMARCC2/BAF170 (D8O9V) Rabbit mAb (12760) E M D MILLIPORE Anti-CTCF Antibody (07-729)
[0227] Allelic ChIP-Seq
[0228] Allele-specific ChIP-seq was performed according to the method of Kung et al (25), in two biological replicates. To increase available read depth, we pooled together two technical replicates for Xi.sup.xist/Xa.sup.WT Rad21 replicate 1 sequenced on a 250 bp HiSeq2500 rapid run and we also pooled two technical replicates of wild-type Rad21 replicate 1, one sequenced on a HiSeq 250 bp run and one on a MiSeq 250 bp run. All other libraries were sequenced on using 250 bp HiSeq2500 rapid runs. To visualize ChIP binding signal, we generated fpm-normalized bigWig files from the raw ChIP read counts for all reads (comp), mus-specific (mus) and cas-specific reads separately. For Smc1a, CTCF and Rad21, peaks were called using macs2 with default settings. To generate consensus peak sets for all three epitopes, peaks for the two wild-type and Xi.sup.xist/Xa.sup.WT replicates were pooled and peaks present in at least two experiments were used as the common peak set. To make comparisons between allelic read counts between different experiments, we defined a scaling factor as the ratio of the total read numbers for the two experiments and multiplied the allelic reads for each peak in the larger sample by the scaling factor. We plotted the number of reads on Xi vs Xa in wild-type for all peaks on the X-chromosome to determine if there is a general bias towards binding to the Xa or the Xi. To evaluate allelic skew on an autosome, we generated plots of mus read counts vs cas read counts for all peaks on chromosome 5 from 1-140,000,000. We used this particular region of chromosome 5 because Xi.sup.xist/Xa.sup.WT is not fully hybrid, and this is a large region of an autosome that is fully hybrid based on even numbers of read counts from input and from our Hi-Cs over this region in Xi.sup.xist/Xa.sup.WT (data not shown). To identify peaks that are highly Xa-skewed in wild-type but bind substantially to the Xi in Xi.sup.xist/Xa.sup.WT (restored peaks), for Xa-skewed peaks in wild-type, we plotted normalized read counts on Xi in Xi.sup.xist/Xa.sub.WT versus read counts on Xa in wild-type. We defined restored peaks as peaks that are 1.) more than 3Xa-skewed in wild-type 2.) have at least 5 allelic reads in wild-type 3.) exhibit normalized read counts on Xi in Xi.sup.xist/Xa.sup.WT that are at least half the level of Xa in wild-type. This threshold ensures that all restored peaks have at least a 2 increase in binding to the Xi in Xi.sup.xist/Xa.sup.WT relative to wild-type. We identified restored peaks using these criteria in both replicates of Smc1a and Rad21 ChIP separately, and to merge these calls into a consensus set for each epitope, we took all peaks that met criteria for restoration in at least one replicate and had at least 50% wild-type Xa read counts on Xi in Xi.sup.xist/Xa.sup.WT in both replicates.
[0229] Allele Specific RNA-Seq
[0230] Xi-TgGFP TTFs (68-5-11) with the stable knock down of candidates were treated with 5-azacytidine and etoposide at 0.3 M each for 3 days. Strand-specific RNA-seq, the library preparation, deep sequencing, and data analysis was followed as described in (25). Two biological replicates of each drug treatment were produced. All libraries were sequenced with Illumina Hiseq 2000 or 2500 using 50 cycles to obtain paired end reads. To determine the allelic origin of each sequencing read from the hybrid cells, reads were first depleted of adaptors dimers and PCR duplicates, followed by the alignment to custom mus/129 and cas genomes to separate mus and cas reads. After removal of PCR duplicates, 90% of reads were mappable. Discordant pairs and multi-mapped reads were discarded. Reads were then mapped back to reference mm9 genome using Tophat v2.0.10 (-g 1no-coverage-searchread-edit-dist 3read-mismatches 3read-gap-length 3b2-very-sensitivemate-inner-dist 50mate-std-dev 50library-type fr-firststrand), as previously described (59, 32, 25). Following alignment, gene expression levels within each library were quantified using Homer v4.7 (rna mm9-count genes-strand+-noadj-condenseGenes) (59) and the normalized differential expression analyses across samples were performed by using EdgeR (60).
[0231] HiC Library Preparation and Analysis
[0232] Hi-C libraries were generated according to the protocol in Lieberman-Aiden et al., 2009 (61). Two biological replicate libraries were prepared for wild-type and Xi.sup.xist/Xa.sup.WT fibroblasts each. We obtained 150-220 million 250 bp paired-end reads per library. The individual ends of the read-pairs were aligned to the mus and cas reference genomes separately using novoalign with default parameters for single-end alignments, and the quality score of the alignment was used to determine whether each end could be assigned to either the mus or the cas haplotype (62). The single-end alignments were merged into a Hi-C summary file using custom scripts. Reads were filtered for self-ligation events and short fragments (less than 1.5 the estimated insert length) likely to be random shears using Homer (59, 63). Hi-C contact maps were generated using Homer. Comp maps were made from all reads. Xi and Xa reads were from reads where at least one read-end could be assigned to either the mus or cas haplotype, respectively. A small fraction of reads (5% of all allelic reads) aligned such that one end aligned to mus, the other to cas. These discordant reads were excluded from further analysis, as they are likely to be noise arising due to random ligation events and/or improper SNP annotation (64, 46). All contact maps were normalized using the matrix balancing algorithm of Knight and Ruiz (65), similar to iterative correction (66, 46), using the MATLAB script provided at the end of their paper. We were able to generate robust contact maps using the comp reads in one replicate at 40 kb resolution, but due to the fact that only 44% of reads align allele-specifically, we were only able to generate contact maps for the cas and mus haplotypes at 200 kb. To increase our resolution, we pooled together both biological replicates and analyzed the comp contact map at 40 kb resolution and the mus and cas contact maps at 100 kb. We called TADs at 40 kb on chrX, chr5 and chr13 using the method of Dixon et al. (27). specifically, we processed the normalized comp 40 kb contact maps separately into a vector of directionality indices using DI_from_matrix.pl with a bin size of 40000 and a window size of 200000. We used this vector of directionality indices as input for the HMM_calls.m script and following HMM_generation, we processed the HMM and generated TAD calls by passing the HMM output to file_ends_cleaner.pl, converter_7col.pl, hmm_probablity_correcter.pl, hmm-state_caller.pl and finally hmm-state_domains.pl. We used parameters of min=2, prob=0.99, binsize=40000 as input to the HMM probability correction script.
[0233] To create a general metric describing interaction frequencies within TADs at resolution available in the allele-specific interaction maps, for each TAD, on chrX and chr5 we averaged the normalized interaction scores for all bins within each TAD, excluding the main diagonal. To make comparisons between interaction frequency over TADs between the cas (Xa) and mus (Xi) haplotypes at the resolution available with our current sequencing depth, we defend the fraction mus as the average interaction score for a TAD in the mus contact map divided by the sum of the average interaction scores in the mus and cas contact maps.
[0234] To discover TADs that show significantly increased interaction frequency in Xi.sup.xist/Xa.sup.WT, we generated a null distribution of changes in average normalized interaction scores for all TADs on chromosome 5, 1-140 Mb using the cas and mus contact maps. We reasoned that there would be few changes in interaction frequency on an autosome between the mus or cas contact maps for wild-type and Xi.sup.xist/Xa.sup.WT, thus the distribution of fold changes in interaction score on an autosome constitutes a null distribution. Using this distribution of fold changes allowed us to calculate a threshold fold change for an empirical FDR of 0.05, and all TADs that had a greater increase in average normalized interaction score on Xi between wild-type and Xi.sup.xist/Xa.sup.WT were considered restored TADs. We preformed this analysis of restored TADs separately in each biological replicate using the 200 kb contact maps to generate interaction scores over TADs, and using the combined data at 100 kb resolution.
REFERENCES FOR MATERIALS AND METHODS SECTION ONLY
[0235] 1. A. Castello et al., Insights into RNA biology from an atlas of mammalian mRNA-binding proteins. Cell 149, 1393-1406 (2012). [0236] 2. S. C. Kwon et al., The RNA-binding protein repertoire of embryonic stem cells. Nature structural & molecular biology 20, 1122-1130 (2013). [0237] 3. D. H. Lundgren, S. I. Hwang, L. Wu, D. K. Han, Role of spectral counting in quantitative proteomics. Expert review of proteomics 7, 39-53 (2010). [0238] 4. G. C. McAlister et al., Increasing the multiplexing capacity of TMTs using reporter ion isotopologues with isobaric masses. Analytical chemistry 84, 7469-7478 (2012). [0239] 5. A. Thompson et al., Tandem mass tags: a novel quantification strategy for comparative analysis of complex protein mixtures by MS/MS. Analytical chemistry 75, 1895-1904 (2003). [0240] 6. L. Ting, R. Rad, S. P. Gygi, W. Haas, MS3 eliminates ratio distortion in isobaric multiplexed quantitative proteomics. Nature methods 8, 937-940 (2011). [0241] 7. A. C. Tolonen, W. Haas, Quantitative proteomics using reductive dimethylation for stable isotope labeling. Journal of visualized experiments: JoVE, (2014). [0242] 8. G. C. McAlister et al., MultiNotch MS3 enables accurate, sensitive, and multiplexed detection of differential expression across cancer cell line proteomes. Analytical chemistry 86, 7150-7158 (2014). [0243] 9. M. P. Weekes et al., Quantitative temporal viromics: an approach to investigate host-pathogen interaction. Cell 157, 1460-1472 (2014). [0244] 10. J. K. Eng, A. L. McCormack, J. R. Yates, An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. Journal of the American Society for Mass Spectrometry 5, 976-989 (1994). [0245] 11. J. E. Elias, S. P. Gygi, Target-decoy search strategy for increased confidence in large-scale protein identifications by mass spectrometry. Nature methods 4, 207-214 (2007). [0246] 12. E. L. Huttlin et al., A tissue-specific atlas of mouse protein phosphorylation and expression. Cell 143, 1174-1189 (2010). [0247] 13. Y. Jeon, J. T. Lee, YY1 tethers Xist RNA to the inactive X nucleation center. Cell 146, 119-133 (2011). [0248] 14. A. K. Hadjantonakis, L. L. Cox, P. P. Tam, A. Nagy, An X-linked GFP transgene reveals unexpected paternal X-chromosome activity in trophoblastic giant cells of the mouse placenta. Genesis 29, 133-140 (2001). [0249] 15. J. T. Kung et al., Locus-Specific Targeting to the X Chromosome Revealed by the RNA Interactome of CTCF. Molecular cell 57, 361-375 (2015). [0250] 16. J. T. Kung et al., Locus-specific targeting to the X chromosome revealed by the RNA interactome of CTCF. Molecular cell 57, 361-375 (2015). [0251] 17. S. F. Pinter et al., Spreading of X chromosome inactivation via a hierarchy of defined Polycomb stations. Genome research 22, 1864-1876 (2012). [0252] 18. S. Heinz et al., Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Molecular cell 38, 576-589 (2010). [0253] 19. M. D. Robinson, D. J. McCarthy, G. K. Smyth, edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 26, 139-140 (2010). [0254] 20. E. Lieberman-Aiden et al., Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science (New York, N.Y.) 326, 289-293 (2009). [0255] 21. E. Yildirim, R. Sadreyev, S. Pinter, J. Lee, X-chromosome hyperactivation in mammals via nonlinear relationships between chromatin states and transcription. Nature structural & molecular biology 19, 56-61 (2012). [0256] 22. C. L. Yin et al., Global changes in the nuclear positioning of genes and intra- and interdomain genomic interactions that orchestrate B cell fate. Nature Immunology 13, 1196-1204 (2012). [0257] 23. H. Sven et al., Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Molecular Cell 38, (2010). [0258] 24. S. Selvaraj, J. R Dixon, V. Bansal, B. Ren, Whole-genome haplotype reconstruction using proximity-ligation and shotgun sequencing. Nature biotechnology, (2013). [0259] 25. S. S. Rao et al., A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping. Cell 159, 1665-1680 (2014). [0260] 26. P. A. Knight, D. Ruiz, A fast algorithm for matrix balancing. IMA Journal of Numerical Analysis, (2012). [0261] 27. I. Maxim et al., Iterative correction of Hi-C data reveals hallmarks of chromosome organization. Nature Methods 9, 999-1003 (2012). [0262] 28. J. Dixon et al., Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature 485, 376-380 (2012).
Example 1. iDRiP Identifies Multiple Classes of Xist-Interacting Proteins
[0263] A systematic identification of interacting factors has been challenging because of Xist's large size, the expected complexity of the interactome, and the persistent problem of high background with existing biochemical approaches (20). A high background could be particularly problematic for chemical crosslinkers that create extensive covalent networks of proteins, which could in turn mask specific and direct interactions. We developed iDRiP (identification of direct RNA interacting proteins) using the zero-length crosslinker, UV light, to implement an unbiased screen of directly interacting proteins in female mouse fibroblasts expressing physiological levels of Xist RNA (
[0264] From three independent replicates, iDRiP-MS revealed a large Xist protein interactome (
[0265] To study their function, we first performed RNA immunoFISH of female cells and observed several patterns of Xi coverage relative to the surrounding nucleoplasm (
[0266] To ask if the factors intersect the PRC2 pathway, we stably knocked down (KD) top candidates using shRNAs (Table 2) and performed RNA immunoFISH to examine trimethylation of histone H3-lysine 27 (H3K27me3;
Example 2. Xi-Reactivation Via Targeted Inhibition of Synergistic Interactors
[0267] Given the large number of interactors, we created a screen to analyze effects on Xi gene expression. We derived clonal fibroblast lines harboring a transgenic GFP reporter on the Xi (
[0268] We then performed allele-specific RNA-seq to investigate native Xi genes. In an F1 hybrid fibroblast line in which the Xi is of Mus musculus (mus) origin and the Xa of Mus casteneus (cas) origin, >600,000 X-linked sequence polymorphisms enabled allele-specific calls (32). Two biological replicates of each of the most promising triple-drug treatments showed good correlation (
Example 3. Xist Interaction Leads to Cohesin Repulsion
[0269] To investigate mechanism, we focused on one group of interactorsthe cohesinsbecause they were among the highest-confidence hits and their knockdowns consistently destabilized Xi repression. To obtain Xa and Xi binding patterns, we performed allele-specific ChIP-seq for two cohesin subunits, SMC1a and RAD21, and for CTCF, which works together with cohesins (33, 34, 28, 35). In wildtype cells, CTCF binding was enriched on Xa (cas), but also showed a number of Xi (mus)-specific sites (
[0270] Cohesin's Xa preference was unexpected in light of Xist's physical interaction with cohesinsan interaction suggesting that Xist might recruit cohesins to the Xi. We therefore conditionally ablated Xist from the Xi (Xi.sup.Xist) and repeated ChIP-seq analysis in the Xi.sup.Xist/Xa.sup.WT fibroblasts (37). Surprisingly, Xi.sup.Xist acquired 106 SMC1a and 48 RAD21 sites in cis, at positions that were previously Xa-specific (
Example 4. Xist RNA Directs an Xi-Specific Chromosome Conformation
[0271] Cohesins and CTCF have been shown to facilitate formation of large chromosomal domains called TADs (topologically associated domains)(27, 40, 34, 28, 35, 41, 42). The function of TADs is currently not understood, as TADs are largely invariant across development. However, X-linked domains are exceptions to this rule and are therefore compelling models to study function of topological structures (43-46). By carrying out allele-specific Hi-C, we asked whether cohesin restoration altered the chromosomal architecture of Xi.sup.Xist. First, we observed that, in wildtype cells, our TADs called on autosomal contact maps at 40-kb resolution resembled published composite (non-allelic) maps (27)(
[0272] When Xist was ablated, however, TADs were restored in cis and the Xi reverted to an Xa-like conformation (
Example 5. Xist Knockdown with an LNA Results in Increased Reactivation
[0273] To determine whether an LNA targeting XIST could also be used in addition to or as an alternative to an agent described herein, experiments were performed in the following cells: immortalized monoclonal MEFs with the reporter GFP (Bird) or LUC (Bedalov) fused to Mecp2, on the Xi or Xa, immortalized human fibroblasts from a 3 year old female with Rett syndrome (Coriell) and primary mouse cortical neurons.
[0274] The LNAs were designed with the Exiqon web tool. Xist LNA for mouse (TCTTGGTTACTAACAG; SEQ ID NO:50) targets exon 1 between rep C and rep D. The human Xist LNAs target the following sequences: A1: GAAGAAGCAGAGAACA; SEQ ID NO:51; A2: AGTAGCTCGGTGGAT; SEQ ID NO:52; A3: TGAGTCTTGAGGAGAA; SEQ ID NO:53. The LNAs were delivered into the cells (0.5 105/ml) with Lipofectamine LTX with Plus (Life Technologies), and incubated for 3 days. 5-azadeoxycitidine (in DMSO) was added to a final concentration of 0.5 uM (except in the titration experiment 0.1-2.5 uM). Synergistic reactivation could be observed with AzadC or EED knockdown.
[0275] qPCR was performed with Sybr chemistry (SybrGreen supermix Bio-Rad), with the primers shown in Table 9. RNA for these experiments was extracted with Triazol (Ambion), DNAse treated (Turbo DNAse kit from Ambion) and reverse transcribed with Superscript III.
TABLE-US-00008 TABLE9 SEQ ID Target Sequence NO: XistF GCTGGTTCGTCTATCTTGTGGG 54 XistR CAGAGTAGCGAGGACTTGAAGAG 55 GapdHF ATGAATACGGCTACAGCAACAGG 56 GapdHR CTCTTGCTCAGTGTCCTTGCTG 57 LucF TCTAAGGAAGTCGGGGAAGC 58 LucR CCCTCGGGTGTAATCAGAAT 59 TBPF ACGGACAACTGCGTTGATTTT 60 TBPR ACTTAGCTGGGAAGCCCAAC 61 GFPF ACCATCTTCTTCAAGGACGA 62 GFPR GGCTGTTGTAGTTGTACTCC 63 hXistF TAGGCTCCTCTTGGACATT 64 hXistR GCAACCCATCCAAGTAGATT 65
[0276]
[0277] Luciferase experiments were performed on a Microbeta2 LumiJet with a luciferase assay system (Promega). Mecp2-Luc fusion Xi and Xa cell lines (0.5 10.sup.5 cells/ml) were contacted with 20 nM Xist LNA administered with Lipofectamine LTX with Plus reagent, with or without 5-aza-deoxycitidine 0.5 uM, for three days. Afterwards, the cells were trypsinized, washed, and lysed using cell culture lysis reagent. Normalized measurements were performed in 96 well plates, during 10 seconds after a 2 second incubation period. Table 11 shows the results of the luciferase screen, demonstrating a significant level of reactivation with an XIST LNA plus Aza.
TABLE-US-00009 TABLE 11 20 uM LNA, 0.5 uM aza 20 uM LNA, 0.5 uM aza 20 uM LNA, 0.5 uM aza 3 days, New 1 10.sup.5 cells/ml 3 days, NEW 0.5 10.sup.5 cells/ml 3 days, new 0.5 10.sup.5 cells/ml 24-well 6-well 6-well trial 1 trial 3 trial 6 LCPS raw CPS LCPS raw CPS LCPS raw CPS buffer 0.0/0.0 39.4/ 0/0 25.4/19.2 0/0 32.8/24.4 26.6 xa 656.4 65947.8 No 0 35.6 0 30 ctrl 0 31 ctrl + aza 1.1 140.6 0.8 130 xist 0 29.8 xist + aza 67.4 7187.6 44.7 4518.4 26.1 2814.2 smchd1 0 29.2 smchd1 + aza 2.2 273.4 ctcf + aza 0.3 78.4 xist + ctcf + aza 6.8 718 eed + aza 1.7 207 1.6 213.6 eed + xist + aza 28.9 2933.8 dxz + aza 0.7 122.8 xist + dxz4 0 27 xist + dxz4 + aza 32.9 3536.6 firre + aza 0.5 98.6 firre + xist 0 24.2
[0278] Reactivation of Mecp2 was measured in the immortalized monoclonal MEFs with the reporter GFP (Bird) or LUC (Bedalov) fused to Mecp2 on the Xi; as shown in
REFERENCES
[0279] 1. J. Starmer, T. Magnuson, Development 136, 1 (2009). [0280] 2. C. M. Disteche, Annual review of genetics 46, 537 (2012). [0281] 3. A. Wutz, R. Agrelo, Dev Cell 23, 680 (2012). [0282] 4. C. J. Brown et al., Cell 71, 527 (1992). [0283] 5. J. Wang et al., Nat Genet 28, 371 (2001). [0284] 6. A. Kohlmaier et al., PLoS Biol 2, E171 (2004). [0285] 7. K. Plath et al., J Cell Biol 167, 1025 (2004). [0286] 8. J. Zhao et al., Molecular cell 40, 939 (2010). [0287] 9. Y. Marahrens, et al., Genes Dev 11, 156 (1997). [0288] 10. E. Yildirim et al., Cell 152, 727 (2013). [0289] 11. C. J. Brown, H. F. Willard, Nature 368, 154 (1994). [0290] 12. G. Csankovszki, A. Nagy, R. Jaenisch, J Cell Biol 153, 773 (2001). [0291] 13. S. Bhatnagar et al., Proc Natl Acad Sci USA 111, 12591 (2014). [0292] 14. W. Mak et al., Science 303, 666 (2004). [0293] 15. M. Sugimoto, K. Abe, PLoS Genet 3, el16 (2007). [0294] 16. J. Zhao, B. K. Sun, J. A. Erwin, J. J. Song, J. T. Lee, Science 322, 750 (2008). [0295] 17. K. Sarma et al., Cell 159, 869 (2014). [0296] 18. Y. Jeon, J. T. Lee, Cell 146, 119 (2011). [0297] 19. Y. Hasegawa et al., Dev Cell 19, 469 (2010). [0298] 20. A. Wutz, Nat Rev Genet 12, 542 (2011). [0299] 21. D. H. Lundgren, et al., Expert Rev Proteomics 7, 39 (2010). [0300] 22. L. Ting, R. Rad, S. P. Gygi, W. Haas, Nat Methods 8, 937 (2011). [0301] 23. S. Schoeftner et al., The EMBO journal 25, 3110 (2006). [0302] 24. M. E. Blewitt et al., Nat Genet 40, 663 (2008). [0303] 25. J. T. Kung et al., Molecular cell 57, 361 (2015). [0304] 26. M. H. Kagey et al., Nature 467, 430 (2010). [0305] 27. J. R. Dixon et al., Nature 485, 376 (2012). [0306] 28. M. Merkenschlager, D. T. Odom, Cell 152, 1285 (2013). [0307] 29. L. L. Hall, M. Byron, G. Pageau, J. B. Lawrence, J Cell Biol 186, 491 (2009). [0308] 30. V. Singh, P. Sharma, N. Capalash, Current cancer drug targets 13, 379 (2013). [0309] 31. M. E. Ashour, et al, Nature reviews. Cancer 15, 137 (2015). [0310] 32. S. F. Pinter et al., Genome Res 22, 1864 (2012). [0311] 33. S. Lin, et al., Molecular and cellular biology 31, 3094 (2011). [0312] 34. W. Li et al., Nature 498, 516 (2013). [0313] 35. J. M. Dowen et al., Cell 159, 374 (2014). [0314] 36. J. M. Calabrese et al., Cell 151, 951 (2012). [0315] 37. L. F. Zhang, K. D. Huynh, J. T. Lee, Cell 129, 693 (2007). [0316] 38. L. Carrel, H. F. Willard, Nature 434, 400 (2005). [0317] 39. J. B. Berletch et al., Human genetics 130, 237 (2011). [0318] 40. C. Feig, D. T. Odom, The EMBO journal 32, 3114 (2013). [0319] 41. C. T. Ong, V. G. Corces, Nat Rev Genet 15, 234 (2014). [0320] 42. M. Vietri Rudan et al., Cell reports 10, 1297 (2015). [0321] 43. E. Splinter et al., Genes Dev 25, 1371 (2011). [0322] 44. E. P. Nora et al., Nature 485, 381 (2012). [0323] 45. T. Nagano et al., Nature 502, 59 (2013). [0324] 46. S. S. Rao et al., Cell 159, 1665 (2014). [0325] 47. S. Sun et al., Cell 153, 1537 (2013). [0326] 48. A. Castello et al., Cell 149, 1393 (2012). [0327] 49. S. C. Kwon et al., Nature structural & molecular biology 20, 1122 (2013). [0328] 50. A. Thompson et al., Anal Chem 75, 1895 (2003). [0329] 51. G. C. McAlister et al., Anal Chem 84, 7469 (2012). [0330] 52. A. C. Tolonen, W. Haas, J Vis Exp, (2014). [0331] 53. G. C. McAlister et al., Anal Chem 86, 7150 (2014). [0332] 54. M. P. Weekes et al., Cell 157, 1460 (2014). [0333] 55. J. K. Eng, et al., J Am Soc Mass Spectrom 5, 976 (1994). [0334] 56. J. E. Elias, S. P. Gygi, Nat Methods 4, 207 (2007). [0335] 57. E. L. Huttlin et al., Cell 143, 1174 (2010). [0336] 58. A. K. Hadjantonakis, L. L. Cox, P. P. Tam, A. Nagy, Genesis 29, 133 (2001). [0337] 59. S. Heinz et al., Molecular cell 38, 576 (2010). [0338] 60. M. D. Robinson, D. J. McCarthy, G. K. Smyth, Bioinformatics 26, 139 (2010). [0339] 61. E. Lieberman-Aiden et al., Science 326, 289 (2009). [0340] 62. E. Yildirim, et al., Nat Struct Mol Biol 19, 56 (2012). [0341] 63. Y. C. Lin et al., Nat Immunol 13, 1196 (2012). [0342] 64. S. Selvaraj, R. D. J, V. Bansal, B. Ren, Nat Biotechnol 31, 1111 (2013). [0343] 65. P. A. Knight, D. Ruiz, I M A Journal of Numerical Analysis 33, 1029 (2012). [0344] 66. M. Imakaev et al., Nat Methods 9, 999 (2012).
TABLE-US-00010 TABLE 5 iDRiP proteomics results-Spectral counts of proteins pulled down by iDRiP and identified by mass spectrometry. UniProt Entry Human Human Human Gene Name Gene ID Protein symbol Gene Synonyms Accession numbers PLIN1_MOUSE 5346 PLIN1 PLIN1 PLIN; FPLD4; PERI; perilipin NM_001145311; NM_002666; XM_005254934; Q3UJB0_MOUSE 10992 SF3B2 SF3B2 SF3b1; Cus1; SF3b150; SAP145; XM_005273726; XM_011544740; NM_006842 SF3B145 NM_003292; XM_011509955; TPR_MOUSE 7175 TPR TPR GUITHDRAFT_135836 NM_003292; XM_011509955; PLIN4_MOUSE 729359 PLIN4 PLIN4 KIAA1881; S3-12; XM_011528237; XM_006722866; MDA_GLEAN10011097 XM_011528235; XM_006722868; NM_001080400; XM_011528233; XM_011528236; XM_011528234 NB5R3_MOUSE 1727 NBR5 CYB5R3 B5R; DIA1; CB5R NM_007326; NM_000398; NM_001129819; NM_001171660; NM_001171661; ATRX_MOUSE 546 ATRX ATRX ATR2; SFM1; ZNF-HX; SHS; XH2; XM_005262155; XM_005262154; RAD54; JMS; MRXHF1; RAD54L; XM_006724667; XM_006724668; XM_000489; XNP; ATIG8600; CHR20; XM_005262156; XM_005261253; F22O13.8; F22O13_8 XR_938400; ; NM_138270; XM_005262157; NM_138271; XM_006724666 MPP10_MOUSE 10199 MPP10 MPHOSPH10 CT90; PPP1R106; MPP10P; NM_005791 MPP10; PANDA_013440 RFA1_MOUSE 6117 RFA1 RPA1 P1CST_79093; LMJF_28_1820; NM_002945 LINJ_28_1940; GUITHDRAFT_166372; REPA1; RF-A; RP-A; MST075; HSSB; RPA70; PHATRDRAFT_14457; NGA_0366300; LPMP_28_1930; CHLREDRAFT_176094; LBRM_28_1990; THAPSDRAFT_40884; GUITHDRAFT_79993 DDX50_MOUSE 79009 DDX50 DDX50 DDX21; PAL_GLEAN10020554; NM_024045; XM_005270148; XM_011540143; RH-1I/GuB; mcdrh; GU2; GUB XM_011540144 RFC1_MOUSE 5981 RFC1 RFC1 YOR217W; CDC44; CaO19.14180; NM_001204747; XM_011513730; XM_002913; GUITHDRAFT_100231; XM_011513731 GUITHDRAFT_160531; RFC140; PO-GA; RECC1; A1; MHCBFB; RFC; CHLREDRAFT_150793; AtRFC1; replication factor C1; AT5G22010; replication factor C 1; EMIHUDRAFT_558179; CaO19.6891 HP1B3_MOUSE 50809 HP1B3 HP1BP3 HP1BP74; HP1-BP74; Anapl_13059 XM_005245875; XM_005245879; XM_005245876; XM_005245878; XM_005245877; NM_016287; XM_011541535; XM_011541532; XM_011541533; XM_011541534 TOP2B_MOUSE 7155 TOP2B TOP2B top2bets; TOPIIB XR_940497; NM_001068; XM_005265427; XM_011534057 RIF1_MOUSE 55183 RIF1 RIF1 PICST_28386; YBR275C XR_922954; NM_001177663; XM_005246665; XR_922957; XR_022055; XR_922956; XM_011511393; NM_001177664; NM_001177665; XM_011511394; NM_018151; XM_011511395 EPIPL_MOUSE 83481 EPIPL EPPK1 EPIPL1; EPIPL XM_011517325; NM_031308; PSPC1_MOUSE 55269 PSPC1 PSPC1 PANDA_015253; XM_006719844; XM_011535140; XR_941619; MDA_GLEAN10004221; PSP1 XM_011535142; XM_011535139; XM_011535137; XR_941616; ; NM_001042414; XR_941617; XM011535138; XM_011535141; XM_011535143; NR_003272; NR_044998 HNRLL_MOUSE 92906 HNRLL HNRNPLL HNRPLL; SRRF XM_005264640; XM_011533165; XM_005264639; XR_939744; NM_138934; XM_011533166; NM_001142650 RRBP1_MOUSE RL14_MOUSE 9045 RL14 RPL14 OSTLU_9318; CAG-ISL-7; L14; NM_001034996; NM_003973 CTG-B33; RL14; hRL14; CHLREDRAFT_145271 SMC1A_MOUSE 8243 SMC1A SMC1A SMC1; PANDA_016538; SMC1L1; ; NM_006306; NM_001281463 SMCB; SB1.8; SMC1alpha; DXS423E; CDLS2; SMC-1A NOC2L_MOUSE 26155 NOC2L NOC2L NIR; PPP1R112; NET15; NET7 NM_015658 A2AJ72_MOUSE 8939 FUBP3 FUBP3 FBP3 XM_011519172; XM_006717314; XM_005272232; XM_006717312; XM_011519173; XM_006717313; NM_003934; XM_011519174; XM_011519171; XR_929871 DNJB6_MOUSE 10049 DNJ DNAJB6 DJ4; HHDJ1; LGMDIE; MRJ; ; XM_005249515; XM_005249516; MSJ-1; HSJ2; HSJ-2; DnaJ; XM_058246; NM_005494; XM_006715823; LGMID1D XM_011515704 KIF4_MOUSE 24137 KIF4A KIF4A PANDA_006442; XM_01130893; ; NM_012310 MDA_GLEAN10002731; PAL_GLEAN10005701; KIF4; KIF4G1; MRX100 1433T_MOUSE 10971 1433T YWHAQ IC5; 14-3-3; HSI;; NM_006826 TREES_T100010476 SURF6_MOUSE 6838 SURF6 SURF6 RRP14; EGK_07243 NR_103874; NM_006753; NM_001278942 KI20A_MOUSE 10112 KI20A KIF20A MDA_GLEAN10012479; NM_005733; XR_948224 Anap_l14151; PANDA_011785; PAL_GLEAN10016825; RAB6KIFL; MKLP2 PDS5B_MOUSE 23047 PDS5B PDS5B APRIN; AS3; CG008 XM_011535002; XM_005266298; XM_011535001; NM_015032; NM_015928; XM_011534999; XM_011535000; ZN638_MOUSE 27332 ZN638 ZNF638 ZFML; Zfp638; NP220 XM_011532767; XR_939678; NM_001014972; NM_001252613; XM_006711989; XM_011532769; XM_011523768; NM_001252612; NM_014497; XM_005264263 RAD21_MOUSE 5885 RAD21 RAD21 HRAD21; SCC1; MCD1; NXP1; NM_006265 CDLS4; HR21; hHR21; PANDA_018369; PAL_GLEAN10021417; MDA_GLEAN10024618 SMHD1_MOUSE 23347 SMHD1 SMCHD1 XM_011525645; NM_015295; XM_011525646; ; XM_011525643; XM_011525644; XR_935054; XM_011525642; XM_011525647; XR_935055; XR_430039 DDX10_MOUSE 1662 DDX10 DDX10 HRH-J8 XM_011542646; NM_004398 PDIP3_MOUSE 84271 PDIP3 POLDIP3 SKAR; PDIP46 XM_011530457; NM_032311; NM_178136; NM_001278657; XR_937942; NR_103820 K0020_MOUSE 9933 K0020 KIAA0020 PUF6; HA-8; HLA-HA8; PEN; NM_001031691; NM_014878 XTP5; PUF-A CPSF7_MOUSE 79869 CPFS7 CPSF7 CFIm59; PAL_GLEAN10011510; XM_011545257; XM_011545263; UY3_12626 XM_005274303; NM_001142565; XM_011545258; XM_011545262; XM_005274299; XM_011545260; NM_024811; XM_011545261; NM_001136040; XM_005274298; XM_011545259 ELYS_MOUSE 25909 ELYS AHCTF1 MSTP108; MST108; ELYS; XM_006711758; XR_949137; NM_015446; TMBS62 XM_011544156; XR_426916; XM_006711759; XM_011544157; XR_949136 APE_HMOUSE 327 ACPH APEH AARE; D3S48E; D3F15S2; ACPH; XM_005265097; XM_011533658; DNF15S2; APH; OPH; XM_005265098; XM_011533656; CB1_000145050; XM_011533660; XM_011533657; PAL_GLEAN10009189; AAP XM_011533659; XM_011533662; ; XM_011533661; XM_011533663; NM_001640 TDIF2_MOUSE 30836 TDIF2 DNTTIP2 LPTS-RP2; ERBP; FCF2; NM_014597 HSU15552; TdIF2; MDA_GLEAN10013834 NXF1_MOUSE 10482 NXF1 NXF1 TREES_T100020891; MEX67; NM_001081491; NM_006362 TAP; PAL_GLEAN10011461 PRP19_MOUSE 27339 PRP19 PRPF19 hPSO4; PSO4; UBOX4; PRP19; NM_014502 SNEV; NMP200; TREES_T100002308; EGK_06157; CB_1002300027; nmp-200 SF3A3_MOUSE 10946 SF3A3 SF3A3 TREES_T100000917; GB11549; NM_006802; XM_005270390 PRP9; PRPF9; SAP61; SF3a60; NGZ_0471300 PSA1_MOUSE 5682 B4E0X6 PSMA1 CC2; NU; HC2; HEL-S-275; NM_001143937; NM_002786; NM_148976 PROS30 WDR46_MOUSE 9277 WDR46 WDR46 PANDA002273; C6orf11; FP221; XM_011547332; XM_011548316; BING4; UTP7; XM_011548317; XM_011514993; PAL_GLEAN10007103 XM_011547730; XM_011547729; NM_005452; XM_011547333; XM_011514992; XM_011548119; XM_0111548118; NM_001164267 RED_MOUSE 3550 RED IK RED; CSA2 NM_006083 SNUT1_MOUSE 9092 SNUT1 SART1 Snu66; SART1259; SNRNP110; XM_011535345; XM_011535344; XR_950099; Ara1; HOMS1 NM_005146 Q0VBL3_MOUSE 64783 RBM15 RBM15 SPEN; OTT; OTT1 XM_011541967; NM_001201545; XM_011541965; XM_011541966; XM_011541964; XM_011541969; NM_022768; XM_011541968 Q8BK35_MOUSE 29997 GSCR2 GLTSCR2 P1CT1; P1CT-1 NM_015710 TPX2_MOUSE 22974 TPX2 TPX2 MDA_GLEAN10014018; XM_011528697; XM_011528698; NM_0121112; AacL_AAEL004112; DIL-2; XM_011528700; XM_011528699 REPP86; C20orf1; p100; GD:C20orf1; C20orf2; DIL2; FLS353; HCA519; HCTP4; AT1G03780; targeting protein for XKLP2; F21M11_31; F21M11.31; PAL_GLEAN10024200; AgaP_AGAP011054; ENSANGG00000017293; AgaP_ENSANGG00000017293; F12P19_13; thioredocin-dependent peroxidase 2; AT1G65970; PROXIREDOXIN TPX2; F12P19.13; ARALYDRAFT475704 LAS1L_MOUSE 81887 LAS1L LAS1L Las1-like; dJ475B7.2; LAS1-like XM_005262304; XM_005262305; NM_001170649; NM_001170650; XM_005262306; XR_430522; XM_011531045; XM_005262301; XM_005262307; XM_011531046; NM_031206; XR_244504; ; XR_938411; XR_938412 ZFR_MOUSE 51663 ZFR ZFR SPG71; ZFR1; XR_427659; NM_016107 PAL_GLEAN10014079 AMY1_MOUSE RL27A_MOUSE 6157 RL27A RPL27A L27A; RPL27; YHR010W NM_032650; NM_000990 UBF1_MOUSE 7343 UBF1 UBTF NPOR-90; UBF-1; UBF2; UBF1; XM_006722061; NM_014233; XM_006722059; UNF XM_006722060; XM_011525177; NM_001076683; NM_001076684; NR_045058 VP26A_MOUSE 9559 VP26A VPS26A MDA_GLEAN10020826; NM_001035260; NM_004896; XM_011540378 GUITHDRAFT_135609; MNC6_7; AT5G53530; MNC6.7; vacuolar protein sorting 26A; Hbeta58; HB58; PEP8A; VPS26 ALDH2_MOUSE 217 ALDH2 ALDH2 LINJ_25_1160; LMJF_25_1120; NM_001204889; NM_000690; PAL_GLEAN10008876; ALDH1; ALDH-E2; ALDM; EMIHUDRAFT_350230; LPMP_251150 DHB4_MOUSE 3295 DHB4 HSD17B4 MFE-2; PRLTS1; SCR8C1; DBP; NM_001292028; NM_001292027; MPF-2 NM_001199292; ; NM_001199291; NM_000414 IMA1_MOUSE 3838 IMA1 KPNA2 UY3_02579; IPOA1; QIP2; XM_011524783; NM_002266 SRP1alpha; RCH1; Anapl_03182; PANDA_014057; PAL_GLEAN10014864 SPB5_MOUSE 5268 SPB5 SERPINB5 maspin; P15 NM_002639; XM_006722483 TIAR_MOUSE 7073 TIAR TIAL1 TIAR; TCBP XM_005270108; XR_428715; XM_005270109; ; XM_005270110; XR_945808; NM_003252; NM_001033925 SMRC1_MOUSE 6599 SMRC1 SMARCC1 BAF155; Rsc8; CRACC1; SW13; XM_011534034; XM_011534035; NM_003074 SRG3 LARP7_MOUSE 51574 LARP7 LARP7 UY3_01935; ALAZS; P1P7S; ; NM_015454; NM_016648; NR_049768; HDCMA18P NM_001267039 NSUN2_MOUSE 54888 NSUN2 NSUN2 TRM4; SALI; MRT5; M1SU NM_017755; ; NM_001193455; NR_037947 NOL8_MOUSE 55035 NOL8 NOL8 C9orf34; NOP132; bA62C3.4; XM_006717169; XM_006717170; bA62C3.3 XM_011518824; XM_011518828; NR_046106; XM_006717168; XM_006717173; XM_011518825; XM_006717166; XM_011518826; XM_011518827; NM_017948; XM_006717172; XR_929816; XM_006717167; NM_001256394 ERMP1_MOUSE 79956 ERMP1 ERMP1 FXNA; KIAA1815; bA207C16.3; XR_9293338; NM_024896; XM_011518034; PAL_GLEAN10021042 XR_428431; XM_005251587; XR_929337; XR_929340 NPA1P_MOUSE 9875 NPA1P URB1 C21orf108; NPA1; YKL014C NM_014825 UTP20_MOUSE 27340 UTP20 UTP20 P1CST_74252; CaO19.9301; NM_014503; XM_006719343 CaO19.10668; DRIM; YBL004W; CaO19.1733; MICPUN_107415; CaO19.3159; PAL_GLEAN10015492 LAP2A_MOUSE 7112 LAP2B TMPO LAP2beta; LAP2; CMD1T; ; NM_001032284; XM_005269132; LEMD4; TP; PRO0868 XM_005269130; NM_001032283; NM_003276 REQU_MOUSE 5977 REQU DPF2 REQ; MDA_GLEAN10017910; XR_950008; XM_005274149; NM_006268 UB1D4; ubi-d4; PAL_GLEAN10011379 PLSL_MOUSE 3936 PLSL LCP1 plastin-2; CP64; LC64P; L- XM_005266374; NM_002298 PLASTIN; LPL; PLS2; HEL-S-37; LCP-1; EGK_09301; Plastibn-2 SCAF8_MOUSE 22828 SCAF8 SCAF8 RBM16 NM_014892; NM_001286194; NM_001286189; NM_001286199; NM_001286188 ABCF1_MOUSE 23 ABCF1 ABCF1 D1CPUDRAFT_157052; NM_001025091; NM_001090 PAL_GLEAN10001332; ABC27; ABC50; LMJF_03_0160; LINJ_03_0150 DCA13_MOUSE 25879 DCA13 DCAF13 WDSOF1; HSPC064; GM83 NM_015420 SMRC2_MOUSE 6601 SMRC2 SMARCC2 CRACC2; BAF170; Rsc8 NM_139067; NM_001130420; XM_005269101; XM_005269104; XM_005269102; XM_011538693; XM_005269103; XM_011538694; NM_003075 TRA2A_MOUSE 29896 TRA2A TRA2A AWMS1; HSU53209 NM_013293; NM_001282757; NM_001282759; XM_005249725; XM_011515331; XM_006715713; NM_001282758 POGZ_MOUSE 23126 POGZ POGZ ZNF635; ZNF635m; ZNF280E; XM_011509331; NM_015100; XM_005244999; PANDA_007985 XR_921760; NM_001194938; XM_005245006; XM_011509330; XM_145796; NM_207171; XM_005245000; XM_005245001; XM_005245005; XM_001194937 CHERP_MOUSE 10523 CHERP CHERP MDA_GLEAN10007202; SCAF6; NM_006387 SRA1; DAN16 RBM12_MOUSE 10137 RBM12 RBM12 CPNE1; Anapl_04462; NM_001198838; NM_001198840; NM_152838; AS27_09836; EGK_02457; SWAN; NM_006047 HR1HFB2091; PANDA_004540; TREES_T100008592 PHIP_MOUSE 55023 PHIP PHIP WDR11; DCAF14; BRWD2; ndrp XM_011535919; NM_017934; XM_005248729; XM_011535917; XM_011535918; XR_942499 ATPG_MOUSE 509 ATPG; ATP5C1 ATP5CL1; ATP5C NM_005174; NM_001001973; XM_011519490 Q8TAS0 LRC59_MOUSE 55379 LRC59 LRRC59 p34; PRO1855; NM_018509 PAL_GLEAN10019724; UY3_00259; TREES_T100015351 MFAP1_MOUSE 4236 MFAP1 MFAP1 AMF; PAL_GLEAN10023540; NM_005926 PANDA_001004; EGK_17436 SNW1_MOUSE 22938 SNW1 SNW1 SKIIP; SKIP; PRPF45; Prp45; NM_012245; XM_005267414; XM_005267413 Bx42; NCOA-62; NGA_0680000 RAVR1_MOUSE 125950 RAVR1 RAVER1 NM_133452; XM_011527671; XM_011527672 EMC4_MOUSE 51234 EMC4 EMC4 PIG17; TMEM85; EGK_17318; NM_001286420; NM_016454 PAL_GLEAN10023658; PANDA_014713; YGL231C BRX1_MOUSE 55299 BRX1 BRIX1 BXDC2; BRIX; PANDA_008108; NM_018321 PAL_GLEAN10001729 DAZP1_MOUSE 26528 DAZP1 DAZAP1 XM_005259535; XM_005259536; NM_170711; XM_011527906; XM_011527904; XM_011527908; XM_005259534; XM_011527909; NM_018959; XM_005259531; ; XM_011527907; XM_011527910; XM_011527905 WDR12_MOUSE 55759 Q53T99; WDR12 PAL_GLEAN10026133; YTM1; XM_011511469; NM_018256 WDR12 MDA_GLEAN10017295 CELF2_MOUSE 10659 CELF2 CELF2 CUGBP2; NAPOR; BRUNOL3; NM_001083591; NM_006561; XM_006717373; ETR-3; ETR3; XM_011519294; XM_011519295; PAL_GLEAN10015786 XM_011519297; XM_011519298; XM_005252534; XM_006717371; NM_001025076; XM_006717374; XM_006717375; XM_011519299; NM_001025077; XM_005252357; XM_005252358; XM_006717369; XM_011519296; XM_006717370 ADNP_MOUSE 23394 ADNP ADNP EGK_02296; MED28; ADNP1; ; NM_181442; NM_001282531; PANDA_000791 NM_001282532; NM_015339; XM_011528747; XM_011528748 B9EJ54_MOUSE 23165 NU205 NUP205 C7orf14 XM_005250235; NM_015135 E9PW12_MOUSE Q3TA68_MOUSE 134430 WDR36 WDR36 TA-WDRP; GLC1G; UTP21; NM_139281; XM_011543163; TAWDRP DEGS1_MOUSE 8560 DEGS1 DEGS1 DES1; MLD; DEGS-1; Des-1; XM_011544317; NM_003676; XM_011544318; MIG15; DEGS; FADS7 NM_144780 RPA1_MOUSE 25885 RPA1 POLR1A A190; RPO14; RPA194; RPA1; XM_006711983; NM_015425 RPO1-4 PTRF_MOUSE 284119 PTRF PTRF PANDA_011158; cavin-1; CAVIN; ; NM_012232; XM_005257242 CAVIN1; CGL4; FKSG13 COPB2_MOUSE 9276 COPB2 COPB2 beta-COP; NM_004766; XM_011513317; NR_023350 CHLREDRAFT_154280; PAL_GLEAN10015932; Beta-COP SPT5H_MOUSE 6829 SPT5H SUPT5H Tat_CT1; SPT5H; SPT5; NM_003169; XM_005259183; NM_001111020; PAL_GLEAN10001502; NM_001130824; NM_001130825; CB1_000338026 XM_006723337 AURKB_MOUSE 9212 AURKB AURKB STK5; aurkb-sv2; AurB; ARK2; XM_011524070; XR_934118; NM_001256834; PPP1R48; aurkb-sv1; AIM-1; A1K2; XM_011524071; XR_934117; NM_001284526; IPL1; A1M1; STK12; STK-1; ARK- NM_004217; XM_011524072 2 PSA3_MOUSE 5684 PSA3 PSMA3 EGK_18227; PSC3; HC8; NM_152132; NM_002788; NR_038123 NGA_0516100 ACTN3_MOUSE 49860 CRNN CRNN DRC1; SEP53; C1orf10; PDRC1 NM_016190 AATM_MOUSE 2806 AATM GOT2 mitAAT; KAT1V; KAT4; FABPpm; NM_001286220; NM_002080 mAspAT; FABP-1; PAL_GLEAN10016182 CATL1_MOUSE 1515 CATL2 CTSV CTSL1; CTSL; CTSL2; NM_001333; NM_001201575 PANDA_020645; CATL2; CTSU TRFL_MOUSE 4057 TRFL LTF LF; PLF; Lf; HEL110; HLF2; ; NM_002343; NM_001199149 GIG12 SODC_MOUSE 6647 V9HWC9 SOD 1 YJR104C; CRS4; SOD1L1; ; NM_000454 ; SODC DKFZP469M1833; hSod1; HEL-S- 44; ALS1; 1POA; ALS; SOD; homodimer; EMIHUDRAFT_96386; PHATRDRAFT_12583; SPAPADRAFT_146717; PICST_89018; CU/ZN-SOD HSPB1_MOUSE 3315 HSPB1 HSPB1 Hsp25; HEL-S-102; SRP27; NM_001540; HS.76067; HSP27; CMT2F; HSP28; HMN28; PAL_GLEAN10012025; UY3_14010 SBP1_MOUSE 8991 SBP1 SELENBP1 SBP; SBP56; SP56; HEL-S-134P; XM_011510110; XM_011510111; hSBP; LPSB NM_001258288; XR_921993; NM_001258289; NM_003944 RL13A_MOUSE 23521 RL13A RPL13A YDL082W; TSTA1; L13A NR_073024; NM_001270491; NM_012423 HEXB_MOUSE 3074 HEXB; HEXB ENC-1AS; HEL-248; ; NM_001292004; NM_000521 A0A024R PAL_GLEAN10024890; AJ6 EGK_16586 PNPH_MOUSE 4860 PNPH; PNP NP; PRO1837; PUNP; NM_000270; V9HWH6 CB1_001481042 H2AX_MOUSE 3014 H2AX H2AFX H2A/X; H2A.X; H2AX; NM_002105 EGK_06977 ACADM_MOUSE 34 ACADM ACADM ACAD1; MCAD; MCADH NM_001127328; NM_001286042; NM_001286043; ; NM_000016; NM_001286044; NR_022013 EXOSX_MOUSE 5394 EXOSX EXOSC10 Rrp6p; p4; PMSCL2; PM-Scl; XM_005263475; NM_002685; XM_005263476; PMSCL; p2; PM/Scl-100l RRP6; p3 NM_001001998; XM_011541595 PAXB1_MOUSE 94104 PAXB1 PAXBP1 GCFC1; GCFC; FSAP105; XM_006724066; XM_011529804; C21orf66; BM020 XM_011529805; NM_016631; NR_027873; NM_013329; NM_145328; XM_006724067; NM_058191 CSRN3_MOUSE 80034 CSRN3 CSRNP3 FAM130A2; PA1P-2; TA1P2; NM_024969; XM_005246865; NM_001172173 PPP1R73 NUP43_MOUSE 348995 NUP43 NUP43 p42; bA350J20.1 XM_011535799; XM_005266961; XM_011535798; NM_198887; XM_005266960; XM_005266962; XR_942420; NM_024647; NR_104456 KDM2A_MOUSE 22992 KDM2A KDM2A CXXC8; FBL11; FBL7; JHDM1A; NR_027473; NM_012308; XM_011544860; FBXL11; LILINA XM_006718479; XM_006718480; XM_011544861; XM_011544862; NM_001256405 SUMO2_MOUSE 6613 SUMO2; SUMO2 Smt3A; HSMT3; SMT3H2; NM_001005849; NM_006937 A0A024R SMT3B; SUMO3 8S3 RUXE_MOUSE 6635 RUXE SNRPE SME; Sm-E; B-raf; HYPT11 NM_001304464; NR_130746; NM_003094 RS30_MOUSE 2197 UB1M FAU FAU1; MNSFbeta; RPS30l Fub1; NM_001997 Fubi; S30; asr1 RL32_MOUSE 6161 RL32 RPL32 L32; PP9932 NM_000994; NM_001007073; NM_001007074 PP1G_MOUSE 5501 PP1G; PPP1CC PP-1G; PPP1G; PP1C ; XM_011538505; XM_011538504; A0A024R NM_001244974; NM_002710 BP2 CRNL1_MOUSE 51340 CRNL1 CRNKL1 HCRN; CLF; CRN; MSTP021; NM_001278627; NM_001278626; Clf1; SYF3 NM_001278628; NM_001278625; NM_016652 IMB1_MOUSE 3837 IMB1 KPNB1 NTF97; IMB1; IPO1; IPOB; Impnb NM_002265; NM_001276453 PEBP1_MOUSE 5037 PEBP1 PEBP1 HCNP; HEL-S-34; HCNPpp; PBP; NM_002567 PEBP-1; HEL-210; PEBP; RKIP TP53B_MOUSE 7158 TP53B TP53BP1 p202; 53BP1 XM_011521986; XR_931898; XR_931899; NM_001141980; XM_011521985; NM_005657; XM_011521984; NM_001141979; XM_005254635 RL19_MOUSE 6143 RL19; RPL19 L19 NM_000981; XM_005257564 J3KTE4 CO1A2_MOUSE 1278 CO1A2 COL1A2 OI4 ; NM_000089 SSRP1_MOUSE 6749 SSRP1 SSRP1 FACT80; FACT; T160 NM_003146; XM_005274194; XM_011545218 SMCA4_MOUSE 6597 SMCA4 SMARCA4 BAF190; RTPS2; SNF2; hSNF2b; NM_001128844; ; XM_005260031; SW12; BAF190A; MRD16; XM_005260033; XM_005260034; SNF2LB; BRG1; SNF2L4 NM_001128846; XM_005260032; XM_005260035; XM_006722847; NM_001128845; NM_001128848; NM_003072; XM_006722845; XM_006722846; NM_001128849; XM_005260028; XM_005260030; XM_011528198; NM_001128847 CAPR1_MOUSE 4076 CAPR1 CAPRIN1 RNG105; GPIP137; GRIP137; XR_0930869; NM_005898; NM_203364 M11S1; GPIAP1; p137GPI SYHC_MOUSE 3035 SYHC HARS USH3B; HRS ; NM_001258042; NM_001289093; NM_001258040; NM_001289092; NM_001289094; NM_002109; NM_001258041 CTCF_MOUSE 10664 CTCF CTCF MRD21 NM_006565; XM_005255775; ; NM_001191022 HCFC1_MOUSE 3054 HCFC1 HCFC1 HCF1; HCF1; PPP1R89; VCAF; XM_006724816; XM_011531147; ; MRX3; CFF; HCF; HCF-1 XM_011531144; XM_011531146; XM_011531150; XM_011531148; NM_005334; XM_006724815; XM_011531149; XM_011531145 BAP31_MOUSE 10134 BAP31 BCAP31 CDM; DXS1357E; 6C6-AG; NM_001139441; NM_001256447; BAP31; DDCH NM_001129457; NM_005745 CBX5_MOUSE 23468 CBX5 CBX5 HEL25; HP1; HP1A NM_001127321; NM_001127322; NM_012117 CLH1_MOUSE 1213 CLH1; CLTC CLTCL2; CHC17; CLH-17; Hc; XM_011524279; XM_011524280; A0A087 CHC XM_01152481; XM_005257012; WVQ6 NM_001288653; NM_004859 PDS5A_MOUSE 23244 PDS5A PDS5A PIG54; SCC112; SCC-112 NM_001100400; XM_011513673; XM_011513674; NM_015200; NM_001100399; XM_011513672 TPM4_MOUSE 9169 SCAFB SCAF11 SRSF21P; SFRS21P; CASP11; SIP1; XM_011538985; NM_004719; XM_011538986; SRRP129 XM_006719692; XM_011538984; XM_005269230; XM_011538983; XM_011538987 REXO4_MOUSE 57109 REXO4 REXO4 XPMC2H; XPMC2; REX4q NM_001279350; NR_103996; NM_020385; NM_001279351; NR_103995; NM_001279349 CNFN_MOUSE 84518 CNFN CNFN PLAC8L2 XM_005259332; XM_011527396; NM_032488; XM_011527397 RS9_MOUSE 6203 RS9 RPS9 S9 XM_011547987; XM_011548358; XM_011548624; XR_431025; XR_431068; XR_953069; NM_001013; XM_005278288; XM_006726201; XM_006726202; XM_011547988; XM_011548623; XR_254260; XR_254311; XR_431090; XR_952765; XR_952994; XM_011547789; XM_011547790; XR_431067; XR_952920; XR_952995; XR_953155; XR_254518; XR_953156; XM_005277274; XM_006725965; XR_431057; XR_431069; XR_952922; XR_952996; XR_953068; XM_005278287; XM_011548167; XR_254517; XR_952766; XR_953070; XR_953157; XM_005277315; XM_011548359; XR_431058; XR_952764; XR_952919; XM_005277084; XM_005277085; XM_011548166; XR_430207; XR_431099 RPA34_MOUSE 1-849 RPA34 CD3EAP CAST; PAF49; ASE-1; ASE1 NM_001297590; NM_012099 LC7L2_MOUSE 51631 LC7L LUC7L CGI-74; LUC7B2; CGI-59 ; NM_001244585; NM_016019; NM_001270643 DHX33_MOUSE 56919 DHX33 DHX33 DDX33 XR_934069; NM_001199699; NM_020162 TNPO1_MOUSE 3842 TNPO1 TNPO1 MIP, IPO2; MIP1; TRN; KPNB2 XM_005248500; NM_153188; XR_948249; NM_002270; XM_005248501 MAK16_MOUSE 84549 MAK16 MAK16 MAK16L; RBM13 NM_032509 NU107_MOUSE 57122 NU107 NUP107 NUP84 XM_005269037; NM_020401; XM_011538576 WDR3_MOUSE 10885 WDR3 WDR3 UTP12; DIP2 NM_006784 BOREA_MOUSE 55143 BOREA CDCA8 DasraB; BOR; MESRGP; NM_018101; NM_001256875 BOREALIN MAL2_MOUSE 114569 MAL2 MAL2 NM_052886; XM_011516807 CARF_MOUSE 55602 CARF CDKN2AIP CARF XM_005263118; NM_017632 NUP93_MOUSE 9688 NUP93 NUP93 NIC96 NM_001242795; XM_005256263; NM_014669; NM_001242796 NKRF_MOUSE 55922 NKRF NKRF NRF; ITBA4 XM_011531365; NM_001173488; NM_001173487; NM_017544; RBM34_MOUSE 23029 RBM34 RBM34 XM_011544134; NM_015014; NM_001161533; XM_011544133; NR_027762 UTP15_MOUSE 84135 UTP15 UTP15 NET21 NM_001284431; XM_011543680; NM_001284430; NM_032175 EMC1_MOUSE 23065 EMC1 EMC1 KIAA0090 XM_005245788; ; XM_005245787; NM_001271429; NM_001271427; NM_001271428; NM_015047 ELOA1_MOUSE 6924 ELOA1 TCEB3 TCEB3A; SIII; EloA; SIII_p110 NM_003198 P66A_MOUSE 54815 P66A GATAD2A p66alpha XM_005259956; XM_011528104; XM_005259962; XM_006722780; XM_011528106; XM_011528107; NM_017660; XM_005259957; XM_005259961; NM_001300946; XM_005259959; XM_005259960; XM_011528105; XM_011528108 SPF45_MOUSE 84991 SPF45 RBM17 SPF45 NM_032905; NM_001145547 SF3A1_MOUSE 10291 SF3A1 SF3A1 PRPF21; PRP21; SF3A120; SAP114 ; NM_005877; NM_001005409 NU133_MOUSE 55746 NU133 NUP133 hNUP133 ; NM_018230 THOC1_MOUSE 9984 THOC1 THOC1 HPR1; P84N5; P84 XM_011525773; XM_011525774; NM_005131; XM_011525772 NOL6_MOUSE 65083 NOL6 NOL6 NRAP; bA311H10.1; UTP22 NM_022917; NM_139235; NM_130793 NDC1_MOUSE 55706 NDC1 NDC1 NET3, TMEM48 XM_011541766; NR_033142; XM_006710762; NM_018087; NM_001168551 CCAR2_MOUSE 57805 CCAR2 CCAR2 p30 DBC; DBC1; KIAA1967; XM_011544604; NM_199205; NR_033902; NET35; p30DBC; DBC-1 XM_011544603; NM_021174 LEGL_MOUSE 29094 LEGL LGALSL GRP; HSPC159 NM_014181 P66B_MOUSE 57459 P66B GATAD2B MRD18; P66beta; p68 XM_005245364; XM_011509808; NM_020699; XM_006711469 FLNC_MOUSE 2318 FLNC FLNC ABP-280; ABPA; MPD4; ABPL; ; NM_001127487; NM_001458 MFM5; ABP280A; FLN2 DDX1_MOUSE 1653 DDX1 DDX1 DBP-RB; UKVH5d NM_004939 DNJC9_MOUSE 23234 DNJC9 DNAJC9 JDD1; HDJC9; SB73 NM_015190 PTBP2_MOUSE 58155 PTBP2 PTBP2 nPTB; PTBLP; brPTB XR_946723; XT946722; NM001300987; NR_125357; XM_011541876; XM_011541875; XR_946720; NM_001300986; NM_001300988; NM_02190; NM_001300990; NR_125356; XM_011541874; XR_946721; NM_001300985; NM_001300989 SMC6_MOUSE 79677 SMC6 SMC6 hSMC6; SMC-6; SMC6L1 XR_939716; NM_001142286; XM_011533107; XM_011533108; NM_024624 SFXN1_MOUSE 94081 SFXN1 SFXN1 XM_005266102; NM_022754 RLP24_MOUSE 51187 RLP24 RSL24D1 HRP-L30-iso; TVAS3; RLP24; NM_016304 C15orf15; L30; RPL24; RPL24L RTCB_MOUSE 51493 RTCB RTCB HSPC117; C22orf28; DJ149A16.6; NM_014306 FAAP CPSF5_MOUSE 11051 CPSF5 NUDT21 CFIM25; CPSF5 NM_007006 LSM7_MOUSE 51690 LSM7 LSM7 YNL147W XM_011528061; NM_016199 RER1_MOUSE 11079 RER1 RER1 XM_005244713; XM_011540543; NM_007033; XM_011540542; XM_006710306; NSA2_MOUSE 10412 NSA2 NSA2 CDK105, TINP1; HUSSY-29; XM_011543098; NM_001271665; XR_948227; HUSSY29; HCLG1; HCL-G1 NM_014886; NR_073403 RRP15_MOUSE 51018 RRP15 RRP15 CGI-115; KIAA0507 XM_011509597; NM_016052 CISY_MOUSE 1431 A0A024R CS NM_004077; NM_198324 B75; CISY RFC5_MOUSE 5985 RFC5 RFC5 RFC36 XM_011538645; NM_001130112; NM_001130113; NM_007370; NM_001206801; XM_011538643; XM_011538644; NM_181578 SYRC_MOUSE 5917 SYRC PARS HLD9; DALRD1; ArgRS NM_002887; PHF6_MOUSE 84295 PHF6 PHF6 BFLS; BORJ; CENP-31 NM_001015877; NM_032335; ; NM_032458 SUN1_MOUSE 23353 SUN1 SUN1 UNC84A NM_001171945; NM_001130965; NM_001171944; NM_025154; NM_001171946 CALL3_MOUSE 810 CALL3 CLAML3 CLP NM_005185 TGM5_MOUSE 9333 TGM5 TGM5 TGASE5; TGM6; TGX; PSS2; XM_011522229l XR_931948; NM_201631; TGMX; TGASEX NM_004245; XM_011522230 CPNS2_MOUSE 84290 CPNS2 CAPNS2 NM_032330 FIP1_MOUSE 81608 FIP1 FIP1L1 FIP1; Rhc; hFip1 XM_005265770; NM_001134937; XM_005265768; XM_005265781; NM_030917; XM_005265769; XM_005265773; XM_005265774; XM_005265778; XM_005265779; ; XM_005265771; NM_001134938; XM_005265780; XM_005265782; XM_005265776; XM_005265777; XM_005265772; XM_005265775 EVPL_MOUSE 2125 EVPL EVPL EVPK XM_011524516; NM_001988 SNAA_MOUSE 8775 SNAA NAPA SNAPA XM_011537437; NR_038457; NM_003827; XM_011527436; NR_039456 RRP8_MOUSE 23378 RRP8 RRP8 NML; KIAA0409 XR_930858; XM_011519955; XR_930859; NM_015324; XR_930860 XRN2_MOUSE 22803 XRN2 XRN2 XM_011529184; NM_012255 NDUA9_MOUSE 4704 NDUA9 NDUFA9 CI-39k; CI39k; CC6; NDUFFS2L; ; NM_005002 SDR22E1 CPSF1_MOUSE 29894 CPSF1 CPSF1 CPFS160; P/c1.18; HSU37012 XM_006716548; XM_011516999; NM_013291; XM_006716550; XM_011516998; XM_011516997; XM_006716549 AR6P4_MOUSE 51329 AR6P4 ARL6IP4 SRrp37; SR-25; SFRS20; SRp25 NR_103512; NM_001002252; NM_001278380; NM_018694; NM_001278378; NM_001278379; NM_001002251; NM_016638 CAF1A_MOUSE 10036 CAF1A CHAF1A CAF-1; CAF1B; CAF1; CAF1P150; XR_936135; XM_011527607; XM_011527605; P150 XM_011527606; NM_005483 INCE_MOUSE 3619 INCE ICNENP XM_011544998; XM_011544995; XM_011544997; XM_006718533; XM_011544996; NM_001040694; NM_020238 RFC2_MOUSE 5982 RFC2 RFC2 RFC40 XR_927506; NM_001278792; NM_001278793; NM_002914; NM_181471; ; NM_001278791; XM_006716080 SNF5_MOUSE 6598 SNF5 SMARCB1 MRD15; Snr1; INI1; RDT; RTPS1; ; XM_011546908; XM_011546909; SWNTS1; PPP1R144; SNF5; Sth1p; NM_001007468; NM_003073; XM_011530346; SNF5L1; BAF47; hSNFS XM_011530345 HNRPC_MOUSE 3183 HNRPC HNRNPC HNRNP; SNRPC; C1; C2; HNRPC NM_031314; XM_011536708; XM_006720125; XM_011536710; NM_001077442; XM_011536709; ; NM_004500; NM_001077443; XM_011536711; XM_011536712 B0LM42_MOUSE 29028 ATAD2 ATAD2 PRO2000; CT137; ANCCA XM_011516995; XM_011516996; XR_928326; XM_011516994; NM_014109 D3YUU6_MOUSE 64794 DDX31 DDX31 PPP1R25 XM_011518923; XM_005272206; XM_011518921; XM_011518924; NM_138620; XR_246600; XR_929836; XM_006717236; NM_022779; XM_005272207; XM_011518922 E9PWW9_MOUSE 57466 SFR15 SCAF4 SRA4; SFRS15 NM_001145445; XM_006724036; NM_001145444; XM_005261017; XM_006724035; NM_020706 E9PZM8_MOUSE G3X963_MOUSE 5646 TYR3 PRSS3 PRSS4; TRY4; TRY3; MTG; T9 ; NM_001197098; NM_007343; NM_001197097; XM_011517965; NM_002771 Q3TWW8_MOUSE Q6NZQ2_MOUSE 10180 RBM6 RBM6 DEF-3; HLC-11; 3G2; g16; NY-LU- NM_005777; XM_005264787; XM_005264786; 12; DEF3 XM_005264785; XM_005264788; NM_001167582; XM_005264784; XM_006712916; XR_940359; XR_940360 Q6PFF0_MOUSE 4288 K167 MK167 KIA; MIB-1; MIB-; PPP1R105 NM_002417; NM_001145966; XM_006717864; XM_011539818 Q9ZIR9_MOUSE 56252 YLPM1 YLPM1 PPP1R169; ZQP3; C14orf170; XM_005267860; XM_011536966; ZAP113 XM_011536967; NM_019589; XR_943494 S4R1W5_MOUSE 142 PARP1 PARP1 PARP; PARP-1; ADPRT1; PPOL; NM_001618 pADPRT-1; ADPRT; ADPRT 1; ARTD1 E9PVX6_MOUSE 9790 BMS1 BMS1 ACC; BMS1L XR_428728; XM_005271846; XM_005271849; XM_006718081; XM_014753; XM_005271848; XR_246522; XM_005271847; XM_011540403; XM_011540402 D3YWX2_MOUSE 10940 PQP1 PQP1 NM_001145860; NM_01145861; NM_015029; XM_011516800; XM_011516801 Q921K2_MOUSE 9416 DDX23 DDX23 prp28; SNRNP100; PRPF28; U5- NM_004818 100K; U5-100KD SUN2_MOUSE 25777 SUN2 SUN2 UNC84B NM_015374; XM_011530105; XM_011530104; NM_001199580; NM_01199579 SAFB1_MOUSE 6294 SAFB1 SAFB HAP; HET; SAF-B1; SAFB1 XM_006722839; NR_037699; NM_001201340; NM_001201339; NM_001201338; NM_002967 HNRL2_MOUSE 221092 HNRL2 HNRNPUL2 HNRPUL2; SAF-A2 NM_001079559 CHD4_MOUSE 1108 CHD4 CHD4 Mi2-BETA; Mi-2b; CHD-4 XM_006718958; NM_001273; XM_006718962; XM_006718960; XM_006718959; XM_005253668; XM_006718961; NM_001297553 TCOF_MOUSE 6949 TCOF TCOF1 treacle; MFD1; TCS1; TCS NM_001008656; XM_005268504; XM_005268505; NM_001135243; XM_005268509; NM_000356; NM_001008657; NM_001135245; XM_011537678; XR_427780; XM_005268502; XM_005268507; XR_427778; XM_005268506; XM_005268508; ; NM_001135244; XM_005268503; XR_427779; NM_001195141 RRP1B_MOUSE 23076 RRP1B RRP1B PPP1R136; KIAA0179; NNP1L; NM_015056 Nnp1; RRP1 LA_MOUSE 6741 LA SSB La; La/SSB; LARP3 NM_003142; NM_001294145; Q6PGF5_MOUSE 3187 HNRH1 HNRNPH1 HNRPH1; hnRNPH; HNRPH XM_006714862; XM_005265895; XM_006714863; XM_011534541; XM_005265901; XM_005265896; XM_011534542; XM_011534543; XM_011534544; NM_001257293; NM_005520; XM_011534547; XM_005265902; XM_011534545; XM_011534546 Q8K205_MOUSE 9221 NOLC1 NOLC1 NOPP130; NOPP140; P130; XM_005270273; NM_004741; NM_001284389; NS5ATP13 NM_001284388 HMGB2_MOUSE 3148 HMGB2 HMGB2 HMG2 NM_002129; NM_001130688; NM_001130689 HNRH2_MOUSE 3188 HNRH2 HNRNPH2 FTP3; HNRPH; HNRPH2; ; NM_019597; NM_001032393 hnRNPH TR150_MOUSE 9967 TR150 THRAP3 TRAP150 XM_005271371; XR_246308; NM_005119 SNR40_MOUSE 9410 SNR40 SNRNP40 PRPF8BP; 40K; SPF38; WDR57; NM_004814 HPRP8BP; PRP8BP MTA2_MOUSE 9219 MTA2 MTA2 MTA1L1; PID NM_004739 RRP5_MOUSE 22984 RRP5 PDCD11 NFBP; RRP5; ALG-4; ALG4 NM_014976; XM_011539538; XM_011539540; XM_005269647; XM_011539539 CO1A1_MOUSE 1277 CO1A1 COL1A1 O14 NM_000088; ; XM_005257059; XM_005257058; XM_011524341 CATA_MOUSE 847 CATA CAT ; NM_001752 PSA2_MOUSE 5683 A0A024R PSMA2 OSMA2; HC3; MU; PSC2 NM_002787 A52; PSA2 PUF60_MOUSE 22827 PUF60 PUF60 SIAHBP1; RoBPI; FIR; VRJS NM_001271096; NM_001271097; NM_001136033; NM_014281; ; NM_001271100; NM_078480; XM_011516929; NM_001271098; XM_011516930; NM_001271099 SF01_MOUSE 7536 SF01 SF1 MBBP; D11S636; ZCCHC25; BBP; NM_001178031; NR_033649; NR_033650; ZFM1; ZNF162 NM_001178030; XM_011545247; NM_201995; NM_201998; XM_011545245; ; NM_004630; XM_011545244; XM_011545248; NM_201997; XM_011545246 IMMT_MOUSE DDX54_MOUSE 79039 DDX54 DDX54 DP97 NM_001111322; NM_024072 RBM19_MOUSE 9904 RBM19 RBM19 XM_011539038; XR_944848; NM_016196; NM_001146698; NM_001146699 SMCA5_MOUSE 8467 SMCA5 SMARCA5 ISWI; SNF2H; hISWI; WCRF135; NM_003601; XM_011532361 hSNF2H GLYR1_MOUSE 84656 GLYR1 GLRY1 BM045; N-PAC; NP60; HIBDL XM_005255638; XM_011522717; XR_932954; XM_005255640; NM_032569; XM_005255639; XM_011522716; XM_011522718; XM_005255637; XR_243321 PSIP1_MOUSE 11168 PSIP1 PSIP1 PSIP2; p52; DFS70; LEDGF; p75; XM_005251358; XM_011517698; PAIP NM_001128217; NM_033222; XM_011517697; XM_011517700; NM_021144; XM_011517699 NOG1_MOUSE 23560 NOG1; GTPBP4 CRFG; NGB; NOG1 NM_012341 D2CFK9 PSA6_MOUSE 5687 PSA6 PSMA6 IOTA; p27K; PROS27 ; NM_001282234; NM_002791; NM_001282232; NM_001292233; NR_104110 D3Z0M9_MOUSE 9295 SRS11 SRSF11 dJ677H15.2; p54; SFRS11; NET2 XM_005271339; XM_011542429; NM_004768; XM_011542430; NM_001190987; XM_005271338; XM_006711037; XM_011542432; XM_006711038; XM_011542433; XR_426640; XM_011542428; XM_006711039 DHX9_MOUSE 1660 DHX9 DHX9 DDX9; LKP; NHD2; NDHII; RHA ; NM_001357; NM_030588; NR_033302 DHX15_MOUSE 1665 DHX15 DHX15 PRPF43; HRH2; PRP43; DBP1; XR_925314; NM_001358 DDX15; PrPp43p ELAV1_MOUSE 1994 ELAV1 ELAVL1 ELAV1; Me1G; Hua; HUR XM_011527777; NM_001419 CDC5L_MOUSE 988 CDC5L CDC5L PCDC5RP; CDC50LIKE; XM_006715289; NM_001253; XR_926346 dJ319D22.1; CEF1; CDC5 NUP98_MOUSE 10236 HNPRP HNRNPR hnRNP-R; HNRPR XM_011540473; XM_005245711; XM_011540472; NM_001102399; NM_001102397; XM_011540474; XM_011540476; NM_001297621; NM_001297622; XM_011540471; XM_011540475; XM_011540477; NM_001102398; NM_001297620; NM_005826 RBM28_MOUSE 55131 RBM28 RBM28 ANES XM_011516370; XM_011516371; NM_018077; NM_001166135; XR_927487; Q8C2Q7_MOUSE 79026 AHNK AHNAK AHNAKRS XM_005274240; XM_005274242; XM_005274243; XM_011545250; XM_005274241; XM_005274244; NM_024060; XM_005274245; XM_011545249; NM_001620 PRP8_MOUSE 10594 PRP8 PRPF8 SNRNP220; HPRP8; PRPC8; PRP8; NM_006445; RP13 U520_MOUSE 23020 U520 SNRNP200 ASCC3L1; BRR2; RP33; U5- ; NM_014014 200KD; HELIC2 BAZIB_MOUSE 9031 BAZIB BAZIB WBSCR9; WBSR10; WSTF NM_032408; NM_023005; XM_005250683; UST48_MOUSE 1650 A0A024R DDOST OST; OST48; AGER1; OKSWc145; ; NM_005216 AD5; CDG1R; WBP1 OST48 P53_MOUSE 7157 H2EHT1; TP54 TRP53; BCC7; P53; LFS1 NM_001126112; NM_001276697; K7PPA8; NM_01126115; ; NM_01126114; P53; NM_001276698; NM_001276761; A0A087 NM_001126118; NM_001126113; WXZ1; NM_001126117; NM_001276695; A0A087X NM_001276699; NM_001276760; NM_000546; 1Q1; NM_001126116; NM_001276696 Q53GA5; A0A087 WT22 LYZ1_MOUSE 1E+08 XP32 C1orf68 XP32; LEP7 NM_001024679 H2A1_MOUSE 5725 PTBP1 PTBP1 pPTB; PTB3; HNRNP-1; PTB; XR_244034; NM_002819; XR_244035; HNRNPI; PTB-T; PTB2; HNRP1; XM_005259597; NM_031991; NM_175847; PTB-1; PTB4 XM_005259598; NM_031990 RL27_MOUSE 6155 A0A024R RPL27 L27 NM_000988 1V4; RL27 RS6_MOUSE RBBP6_MOUSE 5930 RBBP6 RBBP6 P2P-R; MY038; RBQ-1; SNAMA; XM_005255461; NM_018703; XM_005255462; PACT NM_006910; NM_032626 LYAR_MOUSE 55646 LYAR LYAR ZC2HC2; ZYLAR XM_011513505; NM_001145725; NM_017816; XM_011513506 PSA_MOUSE 9520 PSA NPEPPS PSA; AAP-S; MP100 XM_011525496; NM_006310 RRP12_MOUSE 23223 RRP12 RRP12 KIAA0690 NM_015179; XM_011539556; XM_011539557; XM_011539555; NM_001145114; NM_001284337 WDR43_MOUSE 23160 WDR43 WDR43 NET12; UTP5 NM_015131 RS27_MOUSE 6232 RS27 RPS27 MPS-1; S27; MPS1 NM_001030 RL24_MOUSE 6152 RL24 RPL24 HEL-S-310; L24 NM_000986 RFOX2_MOUSE 23543 RFOX2 RBFOX2 FOX2; Fox-2; HNRBP2; HRNBP2; XM_006724190; XM_006724193; RBM9; RTA; fxh; dJ106I20.3 XM_006724185; XM_006724187; XM_011530036; NM_001031695; NM_001082577; XM_005261428; XM_005261430; XM_005261431; XM_005261432; XM_005261433; XM_005261437; NM_001082579; XM_005261429; XM_006724186; XM_006724194; XM_006724192; NM_001082578; NM_014309; NM_001082576; XM_005261435; XM_006724188; XM_006724189; XM_006724191 MYEF2_MOUSE 50804 MYEF2 MYEF2 myEF-2; MSTP156; HsT18564; XM_005254424; NM_006720553; MEF-2; MST156 XM_005254422; XM_005254425; NM_001301210; NM_016132; XM_005254427; XM_011521657; NR_125408 MATR3_MOUSE 9782 MATR3 MATR3 MPD2; ALS21; VCPDM NM_001282278; NM_018834; NM_001194956; NM_199189; ; NM_01194954; NM_001194955 RBM39_MOUSE 9584 RBM39 RBM39 CAPERalpha; FSAP59; CAPER; XM_011529110; NM_184237; XM_006723891; HCC1; RNPC2 XM_006723893; NM_001242599; NM_184234; ; NM_001242600; NR_040722; XM_006723890; XM_01152911; NM_004902; NR_040723; NM_184241; NR_040724; NM_184244 PRP6_MOUSE 24148 PRP6 PRPF6 TOM; ANT-1; Prp6; hPrp6; XM_006723769; ; NM_012469 C20orf14; RP60; ANT1; SNRNP102; U5-102K SSF1_MOUSE 56342 SSF1 PPAN SSF-1; SSF1; BXDC3; SSF; SSF2 NM_020230 ILF2_MOUSE 3608 ILF2 ILF2 NF45; PRO3063 NM_001267809; NM_004515 TMM43_MOUSE 79188 TMM43 TMEM43 LUMA; ARVC5; ARVD5; ADMD7 XM_011534109; ; NM_024334 PK1IP_MOUSE 55003 PK1IP1 PAK1IP1 bA421M1.5; PIP1; hPIP1; MAK11; XM_005249204; XM_011514720; WDR84 XM_006715129; XM_011514721; NM_017906 GSDMA_MOUSE 284110 GSDMA GSDMA FKSG9; GSDM; GSDM1 XM_006721832; XM_011524651; NM_178171 SON_MOUSE 6651 SON SON NREBP; BASS1; DBP-5; C21orf50; NR_103797; NM_138927; NM_001291412; SON3 NM_003103; NR_103798; NM_001291411; NM_032195; NM_138925; NR_103796 E9Q5C9_MOUSE E9Q6E5_MOUSE Q8VHM5_MOUSE TOP2A_MOUSE 7153 TOP2A TOP2A TOP2; TP2A XM_005257632; XM_011525165; NM_001067; FINC_MOUSE 2335 FINC FN1 FNZ; GFND; C1G; ED-B; GFND2; XM_005246416; ; XM_005246413; MSF; FINC; FN; LETS NM_212476; XM_005246407; XM_005246410; XM_005246414; NM_212474; XM_005246402; XM_005246408; XM_005246409; XM_005246399; NM_054034; XM_005246400; XM_005246403; XM_005246405; XM_005246406; XM_005246415; NM_002026; XM_005246398; XM_005246401; XM_005246404; XM_005246412; XM_005246417; XM_005246397; XM_005246411; NM_212478; NM_212482; NM_212475 RASK_MOUSE 3845 RASK KRAS KI-RAS; NS; K-RAS4B; K-RAS4A; XM_011520653; NM_004985; ; RASK2; CFC2; K-RAS2B; KRAS2; XM_006719069; NM_033360 KRAS1; C-K-RAS; K-RAS2A; NS3 HNRPQ_MOUSE 10492 HNRPQ SYNCRIP GRY-RBP; HNRPQ1; PP68; XM_005248636; XM_005248637; hnRNP-Q; GRYRBP; NSAP1; NM_001159676; ; NM_001159673; HNRNPQ NM_001159674; NM_001159677; NM_001159675; NM_001253771; NM_006372; XM_005248635 MYH10_MOUSE 4628 MYH10 MYH10 NMMHC-IIB; NMMHCB NM_001256095; XM_011523875; XM_011523877; XM_011523879; XM_011523880; XM_011523876; XM_005256651; NM_005964; XM_011523878; NM_001256012 DDX51_MOUSE 317781 DDX51 DDX51 XM_011538256; NM_175066 DEK_MOUSE 7913 DEK DEK D6S231E XM_011514889; NM_001134709; XR_926307; NM_003472 NOP16_MOUSE 51491 NOP16 NOP16 HSPC185; HSPC111 NM_001291306; NM_016391; NM_001256539; NM_001256540; NM_001291305; XM_011534567; NM_001291308; XM_011534566; NM_001291307 RBM14_MOUSE 10432 RBM14 RBM14 COAA; TMEM137; SIP; SYTIP1; NM_001198837; ; NM_001198836; PSP2 NM_006328; NM_032886 RL4_MOUSE 6124 RL4 RPL4 L4 NM_000968 ADT1_MOUSE 291 SDT1 SLC25A4 AAC1; ANT; ANT1; PEO2; PEO3; NM_001151; 1; ANT 1; MTDPS12; T1 HNRPL_MOUSE 3191 HNRPL HNRNPL HNRPL; hnRNP-L; P/OKc1.14 XM_011526887; XR_243927; XM_011526886; XM_011526889; NM_001533; NM_001005335; XM_011526888; XM_011526890 NONO_MOUSE 4841 NONO NONO P54; PPP1R114; NMT55; NRB54; NM_001145410; NM_007363; NM_001145409; P54NRB NM_001145408 DNMT1_MOUSE 1786 I6L9H2; DNMT1 AIM; CXXC9; DNMT; MCMT; XM_011527773; ; NM_001130823; DNMT1 ADCADN; HSN1I NM_001379; XM_011527772; XM_011527774 E9Q616_MOUSE HNRPM_MOUSE 4670 HNRPM HNRNPM HTGR1; NAGR1; hnRNP M; NM_005968; XM_005272478; XM_005272480; HNRPM; CEAR; HNRNPM4; XM_005272483; XM_005272479; HNRPM4 XM_005272481; NM_001297418; NM_031203; FBX50_MOUSE 342897 FBX50 NCCRP1 NCCRP-1; FBXO50 NM_001001414; XM_011526906 PSB1_MOUSE 5689 PSB1 PSMB1 PSC5; PMSB1; HC5 NM_002793 SRSF5_MOUSE 6430 SRSF5 SRSF5 HRS; SRP40; SFRS5 XM_005267999; XR_943505; NM_006925; XM_005267998; XR_943506; NM_001039465; XM_005268000; XM_011537077 CAN1_MOUSE 823 CAN1 CAPN1 muCL; CANPL1; muCANP; CANP; NM_001198868; NR_040008; XM_006718698; CANP1 XM_011545292; NM_005186; NM_001198869 ZN326_MOUSE 284695 ZN326 ZNF36 Zfp326; ZAN75; dJ871E2.1; ZIRD NM_181781; XM_005270780; XM_005270779; XM_011541288; XM_011541289; XM_011541290; NM_182975; NM_182976 CASPE_MOUSE 23581 CASPE CAP14 NM012114; XM011527861 COX2_MOUSE 4513 COX2; COX2 COII; MTCO2 U5Z487 MAOX_MOUSE 4199 MAOX MEI HUMNDME; MES XM_011535836; NM_002395 RL7_MOUSE 6129 RL7 RPL7 L7; humL7-1 XM_006716463; NM_000971 NDKA_MOUSE 4830 NDKA NME1 GAAD; NB; AWD; NBS; NDPK-A; ; NM_198175; NM_000269 NDPKA; NDKA; NM23; NM23-H1 TPM3_MOUSE 7170 TPM3 TPM3 NEM1; HEL-189; OK/SW-c1.5; XM_006711520; XM_006711521; TM30nm; TM-5; TH5; CAPM1; XM006711523; NR_103461; XM_006711517; TM3; TM30; CFTD; hscp30; NM_001043353; XM_006711522; TPMsk3; HEL-S-82p; TRK XM_006711519; XM_011509950; XM_011509953; NM_001278190; NM_152263; XM_011509952; NM_153649; XM_006711515; XM_011509954; NM_001278189; XM_011509951; NM_001278188; NM_001278191; XM_006711518; NM_001043351; NM_001043352; NR_103460 RS2_MOUSE 6187 RS2 RPS2 LLREP3; S2 NM_002952 RL12_MOUSE 6136 RL12 RPL12 L12 NM_000976 H11_MOUSE 3024 H11 HISTH1A H1.1; HIST1; H1A; H1F12 NM_005325 CAPZB_MOUSE 832 CAPBZ CAPBZ CAPB; CAPZ; CAPPB XM_011542229; NM_001206541; NM_004930; XM_006710938; XM_011542230; NM_001206540; XM_011542228; NM_001282162 LIS1_MOUSE 5048 LIS1 PAFAH1B1 LIS1; LIS2; MDCR; PAFAH; MDS XM_011523902; XM_011523903; XM_011523904; NM_000430; XM_011523901; HMGB1_MOUSE 3146 HNGB1 HNGB1 HNG3; SBP-1; HNG1 XM_005266368; XM_011535056; XM_011535055; XR_941568; NM_002128; XM_005266363; XM_005266365 RS10_MOUSE 1.01E+08 S4R435 RPS10- NM_001202470 NUDT3 PHB_MOUSE 5245 PHB PHB HEL-S-54e; PHB1; HEL-215 ; NM_002634; NM_001281715; NM_001281496; NM_001281497 NACAM_MOUSE PHF5A_MOUSE 84844 PHF5A PHF5A DAP14b; INI; Rds3; bK223H9.2; NM_032758 SF3B7; SF3b14b RS3A_MOUSE 6189 RS3A; RPS3A S3A; MFTL; FTE1 NM_001267699; NM_001006 B7Z3M5 ZCH18_MOUSE 124245 ZCH18 ZC3H18 NHN1 XM_011522864; XM_011522863; XM_011522865; XM_011522862; NM_001294340; NM_144604 FUBP2_MOUSE 8570 FUBP2 KHSRP FUBP2; FBP2; KSRP XM_005259668; NM_003685; XM_011528395 DDX17_MOUSE 10521 DDX17 DDX17 RH70; P72 NM_001098505; NM_030881; NM_001098504; ; NM_006386 LC7L3_MOUSE 51747 LC7L3 LUC7L3 hLuc7A; CRA; CREAP-1; CROP; XM_005257448; NM_006107; XM_005257449; LUC7A; OA48018 XM_006721943; XM_005257455; NM_016424; XM_005257454; XM_005257452; XM_005257450 EWS_MOUSE 2130 EWS EWSR1 EWS; bK984G1.4 XM_005261389; XM_011529999; XM_011530001; NM_013986; XM_011529995; XM_011529997; XM_011529996; ; NM_001163285; NM_001163286; XM_005261390; XM_011529998; NM_001163287; XM_011530000; XM_011530002; NM_005243 UT14A_MOUSE 10813 UT14A UTP14A NYCO16; dJ537K23.3; SDCCAG16 XM_011531264; NM_001166221; NM_006649; XM_005262363 PWP2_MOUSE 5822 PWP2 PWP2 EHOC-17; UTP1; PWP2H XM_011529667; NM_005049 CPNE1_MOUSE 8904 CPNE1 CPNE1 COPN1; CPN1 NM_152931; NM_152927; NM_152930; NM_152925; NR_037188; NM_003915; NM_152926; NM_001198863; NM_152928 H2AW_MOUSE 55506 A0A024Q H2AFY2 macroH2A2 NM_018649 ZP6; H2AW SLTM_MOUSE 79811 SLTM SLTM Met XM_011522027; XM_011522030; XM_011522023; XM_011522032; XR_931906; NM_017968; XM_011522024; XM_011522026; NM_001013843; XM_011522022; XM_011522028; XM_006720690; XM_011522029; NM_024755; XM_006720686; XM_011522025; XM_011522031 GNL3_MOUSE 27354 GNL3 GNL3 C77032; E21G3; NNP47; NS NM_206826; NM_014366; NM_206825 PYGB_MOUSE 5834 PYGB PYGB GPBB NM_002862 NAT10_MOUSE 55226 NAT10 NAT10 NET43; ALP XM_011520197; NM_001144030; NM_024662 DDX52_MOUSE 11056 DDX52 DDX52 HUSSY19; ROK1 XM_011546776; NM_007010; XR_951954; NM_001291476; XM_011524232; XM_011546775; XM_011524233; NM_152300 PRAF3_MOUSE 10550 PRAF3 ARL61P5 jmw; HSPC127; DERP11; JWA; NM_006407 PRAF3; addicsin; GTRAP3-18; hp22 SRSF4_MOUSE 6429 SRSF4 SRSF4 SFRS4; SRP75 XM_011541951; NM_005626 SP16H_MOUSE 11198 SP16H SUPT16H FACTP140; SPT16; CDC68; NM_007192; ; XM_011536381 SPT16/CDC68 TADBP_MOUSE 23435 TADBP TARDBP ALS10; TDP-43 NM_007375; XR_946596; ; XR_946597 SF3B1_MOUSE 34251 SF3B1 SF3B1 PRPF10; SAP155; MDS; SF3b155; XR_241302; NM_001005526; XR_241300; Hsh155; PRP10 NM_012433; XM_011510867; ; XM_011510868 NU155_MOUSE 9631 NU155 NUP155 ATFB15; N155 XM_011514166; XM_011514164; NM_00178312; XM_011514165; NM_004298; NM_153485 SMC3_MOUSE 9126 SMC3 SMC3 BAM; HCAP; SMC3L1; CSPG6; ; NM_005445 CDLS3; BMH ROA0_MOUSE 10949 ROA0 HNRNPA0 HNRPA0 NM_006805 SSRA_MOUSE 6745 SSRA SSR1 TRAPA NM_003144; NM_001292008; NR_120448 NH2L1_MOUSE 4809 NH2L1 NHP2L1 NHPX; SSFA1; FA-1; FA1; XM_011530201; NM_005008; NM_001003796 SNU13; SNRNP15-5; 15.5K; SPAG12; OTK27 S10AE_MOUSE 57402 S10AE S100A14 BCMP84; S100A15 XM_005245362; NM_020672 NOP56_MOUSE 10528 NOP56 NOP56 SCA36; NOL5A NR_027700; ; NM_006392 RPN2_MOUSE 6185 RPN2 RPN2 SWP1; RPNII; RPN-II; RIBIIR XM_006723850; NM_002951; XM_006723851; XM_005260491; XM_006723849; NM_001135771; XM_00672852 RBP2_MOUSE 5903 RBP2 RANBP2 ANE1; TRP1; TRP2; ADANE; XM_011511576; NM_006267; XM_005264002; NUP358; HAE3 XM_005264004; XM_011511575; XM_005264003; XM_005264007; XM_011511577; XM_005264005; XM_011511578; DKC1_MOUSE 1736 DKC1 DKC1 DKC; XAP10; NAP57; NOLA4; ; NR_110021; NM_001288747; NR_110023; CBF5; DKCX NM_001363; NR_110022; NM_001142463 IDE_MOUSE 3416 IDE IDE INSULYSIN XM_005269769; ; XM_005269766; XR_945727; NM_004969; NM_001165946 SAS10_MOUSE 57050 SAS10 UTP3 SAS10; CRL1; CRLZ1 NM_020368 AL9A1_MOUSE 223 AL9A1 ALDH9A1 E3; ALDH7; ALDH9; TMABADH; NM_000696; ; XM_011509294 ALDH4 PSA7_MOUSE 5688 PSA7 PSMA7 RC6-1; HSPC; XAPC7; C6 NM_002792; NM_152255 G5E8Z3_MOUSE Q8BGJ5_MOUSE Q9QUK9_MOUSE FBRL_MOUSE 2091 FBRL FBL FIB; FLRN; RNU31P1 XM_011548799; XM_011526623; XM_011548798; XM_005258651; NM_001436 CEBPZ_MOUSE 10153 CEBPZ CEBPZ HSP-CBF; CBF2; BOC1; CBF NM_005760 ACTN4_MOUSE 81 ACTN4 ACTN4 FSGS; FSGS1; ACTININ-4 XM_006723406; NM_004924; XM_005259282; ; XM_005259281 DDX21_MOUSE 9188 DDX21 DDX21 GURDB; GUA; RH-II/GuAl RH- NM_004728; NM_001256910; XM_011540336 II/GU Q8BVY0_MOUSE 26156 RL1D1 RSL1D1 PBK1; L12; UTP30; CS1G NM_015659 PLEC_MOUSE E9Q7G0_MOUSE 4926 NUMA1 NUMA1 NMP-22; NUMA XM_011545059; XM_011545066; NM_001286561; XM_011545054; XM_011545060; XM_011545064; XM_011545062; XM_011545065; NR_104476; XM_011545063; XM_011545055; XM_011545061; NM_006185; XM_011545057; XM_011545058; XM_006718564; XM_011545056 ADT2_MOUSE 292 ADT2 SLC25A5 ANT2; T2; AAC2; T3; 2F1 ; NM_001152 LAP2B_MOUSE 7112 LAP2B; TMPO LAP2; CMD1T; LEMD4; TP; ; NM_001032284; XM_005269132; LAP2A PRO0868 XM_005269130; NM_001032283; NM_003276 NOP58_MOUSE 51602 NOP58 NOP58 NOP5/NOP58; NOP5; HSPC120 NM_015934 SRSF1_MOUSE TGM1_MOUSE ILF3_MOUSE H2B1F_MOUSE 8340; 8341 E1QN31_MOUSE 4839 NOP2 NOP2 NSUN1; p120; NOP120; NOL1 XM_005253691; NM_006170; NM_001033714; NM_001258310; NM_001258308; NM_001258309; XM_011520962 PRDX4_MOUSE 10549 PRDX4 PRDX4 AOE37-2; PRX-4; HEL-S-97n; NM_006406; XM_005274438; AOE372 PSB5_MOUSE 5693 PSB5 PSMB5 MB1; X; LMPX XM_005267871; NM_002797; NM_001144932; NM_001130725 PDIA1_MOUSE 5034 A0A024R P4HB PHDB; P4Hbeta; PO4DB; PROHB; ; NM_000918 8S5; ERBA2L; GIT; DSI; PDI; PDIA1; PDIA1 PO4HB NUCL_MOUSE 4691 NUCL NCL C23 NM_005381 THIO_MOUSE 7295 H9ZYJ2; TXN TRDX; TRX1; TRX NM_003329; NM_001244938 THIO DDX3L_MOUSE 8653 DDX3Y DDX3Y DBY ; XM_006724878; NM_001122665; NM_001302552; NM_004600; XM_011531471 TPIS_MOUSE 7167 V9HWK1; TP11 TPID; HEL-D-49; TPI; TIM NM_001159287; NM_000365; NM_001258026; Q53HE2; TPIS RL18_MOUSE RL6_MOUSE 6128 A0A024R RPL6 TXREB1l TAXREB107; SHUJUN- XM_006719548; XM_006719546; NM_000970; BK3; 2; L6 NM_001024662; XM_006719547; Q8TBK5; XM_006719549; XM_011538647; RL6 XM_011538646 SAHH_MOUSE 191 SAHH AHCY SAHH; adoHcyase XM_005260317; ; XM_005260316; XM_011528660; XM_011528657; XM_011528658; XM_011528659; NM_000687; NM_001161766; XM_011528656 KPYM_MOUSE 5315 A0A024R PKM CTHBP; HEL-S-30; PK3; OIP3; NM_001206796; NM_001206797; 5Z9; TCB; THBP1; PKM2 XM_011521673; XM_005254445; V9HWB8; XM_011521670; XM_011521672; NM_002654; B4DNK4; NM_001206798; XM_005254443; KPYM XM_006720570; XM_011521671; NM_001206799; NM_182470; NM_182471 CALM_MOUSE RUXF_MOUSE 6636 RUXF SNRPF Sm-F; snRNP-F; SMF NM_003095 SMD2_MOUSE 6633 SMD2 SNRPD2 SMD2; SNRPD1; Sm-D2 NM_004597; NM_177542; XM_005259180 TOP1_MOUSE 7150 TOP1 TOP1 TOP1 XM_011529033; ; XM_011529032; NM_003286 HNRPD_MOUSE VDAC1_MOUSE ARGI1_MOUSE 383 ARGI1 ARG1 NM_000045; NM_001244438; ; XM_011535801 RALY_MOUSE CPNE_MOUSE 8895 CPNE3 CPNE3 CPN3; PRO1071 XM_005251093; NM_003909 DDX18_MOUSE 8886 DDX18 DDX18 MrDb NM_006773 DDX27_MOUSE 55661 DDX27 DDX27 HSPC259; Drs1p; dJ686N3.1; NM_017895; XM_011528888 PP3241; DRS1; RHLP ROAA_MOUSE 3182 ROAA HNRNPAB HNRPAB; ABBP1 NM_004499; NM_031266 NOG2_MOUSE 29889 NOG2 GNL2 Hug2; Ngp-1; Nog2; NGP1; XM_011541300; NM_013285 HUMAUANT1G RL17_MOUSE GGCT_MOUSE 79017 GGCT GGCT C7orf24; GGC; CRF21; GCTG NM_001199817; NM_024051; NM_001199815; NM_001199816; NR_037669 NVL_MOUSE 4931 NVL NVL XM_011544199; NM_001243146; XM_011544202; XM_011544198; XM_011544201; NM_206840; XM_011544196; XM_011544197; XM_011544200; ; NM_001243147; NM_002533 PSB3_MOUSE 5691 PSB3 PSMB3 HC10-II NR_104195; NM_002795; NR_104194 LOXE3_MOUSE 59344 LOXE3 ALOXE3 ARCI3; eLOX3; E-LOX3; eLOX-3 NM_001165960; ; NM_021628 D3YWT1_MOUSE 3189 HNRH3 HNRNPH3 HNRPH3; 2H9 XM_005269753; XM_005269748; XM_005269752; XM_006717816; XM_005269751; XM_011539743; XM_006717817; XM_005269749; XM_005269754; NM_012207; NM_021644; XM_011539742 HNRPF_MOUSE FILA2_MOUSE DSG1A_MOUSE 1828 DSG1 DSG1 CDHF4; DSG; PPKS1; EPKHIA; ; NM_001942 SPPK1; DG1; EPKHE SRSF7_MOUSE MYH9_MOUSE 4627 MYH9 MYH9 BDPLT6; DFNA17; FTNS; XM_011530197; ; NM_002473 NMMHCA; EPSTS; NMHC-II-A; MHA; NMMHC-11A SON_MOUSE RBM25_MOUSE 58517 RBM25 RBM25 Snu71; NET52; RED120; RNPC7; XR_943501; NM_021239; XM_011537044; S164; fSAP94 XM_011537045 PCNA_MOUSE 5111 PCNA PCNA ATDL2 NM_002592; NM_182649 TRA2B_MOUSE 6434 TRA2B TRA2B PPP1R156; SFRS10; TRAN2B; XM_011513072; XM_006713724; NM_004593; SRFS10; TRA2-BETA; Htra2-beta ; NM_001243879; XM_005247703 DDX5_MOUSE EFTU_MOUSE 7284 EFTU TUFM COXPD4; EFTU; P43; EF-TuMT ; NM_003321; XM_011545928 UHRF1_MOUSE SFPQ_MOUSE 6421 SFPQ SFPQ PPP1R140; PSF; POMP100 XM_005271113; XM_005271115; XM_011541950; XM_005271112; NM_005066 DDX24_MOUSE 57062 DDX24 DDX24 NM_020414 HNRDL_MOUSE 9987 HNRDL HNRNPDL LGMD1G; HNRNP; HNRPDL; NM_031372; ; NM_005463; NM_001207000; JKTBP2; JKTBP; 1aAUF1 NR_003249 HNRPC_MOUSE U2AF2_MOUSE 11338 U2AF2 U2AF2 U2AF65 XM_006722994; NM_001012478; ; NM_007279; XM_011526410 H13_MOUSE 3007 H13 HISTIH1D H1.3; H1s-2; H1F3; H1D NM_005320 HNRPK_MOUSE RS27A_MOUSE 6233 RS27A RPS27A UBC; UBCEP80; S27A; UBCEP1; NM_002954; NM_001177413; ; NM_001135592 CEP80; CEL112; UBA80 TBB5_MOUSE 203068 TBB5 TUBB M40; TUBB1; CDCBM6; OK/SW- ; NM_001293213; NM_001293214; c1.56; TUBB5 NM_001293212; NR_120608; NM_001293215; NM_001293216; NM_178014 FUBP1_MOUSE G3X9B1_MOUSE 55127 HETA1 HEATR1 UTP10; BAP28 NM_018072; NM_011544219 HNRPU_MOUSE 3192 HNRPU HNRNPU HNRPU; SAF-A; U21.1; hmRNP U NM_004501; NM_031844 HSP7C_MOUSE 3312 HSP7C HSPA8 LAP1; LAP-1; HSC70; HSPA10; ; XM_011542798; NM_153201; NM_006597 HEL-33; HDC54; HSC71; HSP71; HSP73; HEL-S-72p; NIP71 SRRM2_MOUSE HS71B_MOUSE 3304; 3303 ROA1_MOUSE 3178; 144983 MBB1A_MOUSE 10514 MBB1A MYBBP1A PAP2; P160 NM_001105538; NM_014520; XM_011523616 NPM3_MOUSE 10360 NPM3 NPM3 TMEM123; PORMIN NM_006993 MDHM_MOUSE 4191 A0A024R MDH2 MGC:3559; M-MDH; MOR1; MDH NR_104165; NM_001282403; NM_001282404; 4K3; NM_005918 MDHM; B3KTM1; G3XAL0 H14_MOUSE 3008 H14 HIST1H1E H1F4; dJ221C16.5; H1.4; H1E; NM_005321 H1s04 ATPB_MOUSE 506 V9HW31; ATP5B ATPMB; HEL-S-271; ATPSB NM_001686 ATPB H2AY_MOUSE 9555 H2AY H2AFY H2AFJ; H2A.y; H2AF12M; H2A/y; NM_138609; XM_011543731; XR_948308; mH2A1; macroH2A1.2; NM_004893; XM_005272132; XM_005272134; MACROH2A1.1 XM_011543735; XR_948310; XM_011543728; XR_948306; XR_948307; XM_005272135; XM_011543730; XM_011543733; XR_948309; NM_138610; XM_011543729; XM_011543732; NM_001040158; XM_011543734; XR_948311 DESP_MOUSE 1832 DESP DSP DCWHKTA; DP; DP1; DPI1 ; XM_011514323; NM_001008844; NM_004415 ANXA2_MOUSE 302 A0A024R ANXA2 LPC2; ANX2L4; LIP2; LPC2D; NM_004039; XM_011521475; XM_011521476; 5Z7; PAP-IV; ANX2; P36; HEL-S-270; NM_001002858; NM_001002857; ANXA2 CAL1H NM_001136015; XM_011521477 VIME_MOUSE 7431 VIME VIM CTRCT30; HEL113 XM_011519649; XM_006717500; NM_003380 ROA2_MOUSE 3181 ROA2 HNRNPA2B1 HNRPA2; RNPA2; SNRPB1; XR_242076; XR_242077; NM_002137; HNRNPA2; HNRNPB1; IBMPFD2; XR_428077; XR_428078; XM_006715714; HNRPA2B1; HNRPB1 NM_031243; XM_005249729 ATPA_MOUSE 498 ATPA; ATP5A1 hATP1; ATP5A; HEL-S-123m; NM_001257334; ; NM_001001937; V9HW26 MOM2; COXPD22; OMR; ATPM; XM_011526018; NM_001001935; MC5DN4; ORM; ATP5AL2 XM_001257335; NM_004046 NPM_MOUSE 4869 NPM NPM1 B23; NPM XM_005265920; ; NM_001037738; NM_002520; NM_199185; XM_011534564 LMNA_MOUSE 4000 LMNA LMNA LMN1; LMNL1; EMD2; FPL; IDC; XR_921781; NM_005572; NM_170707; CDCD1; LMNC; CDDC; CMD1A; NM_170708; ; NM_001282624; FPLD; PRO1; LFP; LGMD1B; NM_001282626; NM_001282625; CMT2B1; FPLD2; HGPS; LDP1 XM_011509534; NM_001257374; XM_0115909533 MUP17_MOUSE THOC4_MOUSE 10189 THOC4 ALYREF ALY/REF; THOC4; BEF; ALY; NM_005782; XR_933919 REF U5S1_MOUSE 9343 U5S1 EFTUD2 MFDGA; Snrp116; Snu114; NM_001258353; NM_001142605; XR_934602; SNRNP116; U5-116KD; MFDM NM_001258354; NM_004247; HDAC1_MOUSE 3065 Q6IT96; HDAC1 RPD3; GON-10; HD1; RPD3L1 XM_011541309; NM_004964 HDAC1 NEP1_MOUSE 10436 NEP1 EMG1 C2F; Grcc2f; NEP1 ; XM_011520907; NM_006331 7528 YY1 YY1 NF-EI; INO80S; UCRBP; DELTA; NM_003403 YIN-YANG-1 23429 RYBP RYBP AAP1; DEDAF; YEAF1 XM_011548867; XM_011548866; NM_012234 2146 EZH2 EZH2 KMT6; KMT6A; WVS; EZH2b; XM_011515896; XM_011515897; ENX-1; EZHI; ENX1; WVS2 XM_011515901; NM_001203249; XM_005249964; XM_011515884; XM_011515890; XM_011515894; XM_011515899; NM_004456; XM_011515886; XM_011515892; XM_011515900; NM_152998; XM_011515888; XM_011515889; XM_011515902; ; NM_001203247; NM_001203248; XM_005249962; XM_011515895; XM_011515883; XM_005249963; XM_011515885; XM_011515887; XM_011515898; XM_011515891; XM_011515893 8726 EED EED HEED; WAIT1 XM_011545330; XM_005274373; XM_011545331; XM_011535329; XR_247215; ; NM_003797l NM_152991 3720 JARID2 JARID2 JMJ XM_011514578; NM_004973; XM_011514580; NM_001267040; NM_011514581; XM_011514579; XM_011514584; XM_011514583; XM_005249089; XM_011514582 23512 SUZ12 SUZ12 CHET9; JJAZ1 XM_005257954; XM_011524578; NM_015355; XM_006721794; XM_011524576; XM_011524577; 84733 CBX2 CBX2 CDCA6; SRXY5; M33 XM_011525382; XM_011525383; NM_032647; NM_005189; 8535 CBX4 CBX4 NBP16; PC2 XM_011525399; NM_003655 23468 CBX5 CBX5 HEL25; HP1; HP1A NM_001127321; NM_001127322; NM_012117 23466 CBX6 CBX6 NM_001127321; NM_001127322; NM_012117 23492 CBX7 CBX7 XM_006724178; XM_006724174; XM_006724176; NM_175709; XM_006724175; XM_011530025; XM_005261413; XM_006724177 57332 CBX8 CBX8 RC1; PC3 NM_020649 6015 RING1 RING1 RING1A; RNF1; XM_008581826; XM_002914334; MDA_GLEAN10006855; XM_011282270; XM_004711741; AT5G10380; ATRING1; XM_010994566; NM_001114959; F12B17.270; F12B17_270; XM_008263251; XM_008160095; PAL_GLEAN10007107 XM_006144236; XM_003789083; XM_003768961; XM_003421045; XM_003340366; XM_006882095; XM_004673367; XM_004043802; NM_001081482; XM_009450849; XM_007939317; XM_004817207; XM_004817208; XM_004770597; XM_004770598; XM_006105473; XM_007972961; XM_010848711; XM_005891414; XM_007460823; XM_003808593; NM_001048128; XM_006738062; XM_004479796; XM_001493382; XM_005603802; NM_001190235; XM_002746424; XM_007093228; XM_003897435; XM_008693443; XM_002809147; NM_002931; XM_010357860; XM_004617672; XM_005867940; XM_005867939; XM_005867938; XM_008060264; XM_010949097; XM_006769154; XM_006769153; XM_006769152; XM_004389800; XM_004389799; XM_006202134; XM_006860350; NM_121076; XM_009398851; XM_008501211; XM_008507909; XM_008507908; XM_007186905; XM_006180513; XM_005553330; XM_003923131; XM_011373441; XM_006050304; XM_004267748; XM_003271891; XM_007527425; XM_006907387; NM_001105051; XM_004018744; XM_005979771; XM_004407693; XM_004326287; XM_004424282; XM_005696449; XM_004590264 6045 RNF2 RNF2 UY3_04118; RING1B; XM_007056701; NM_001133961; Anapl_15990; XM_009240017; XM_010010379; PAL_GLEAN10017658; RING2; XM_005030750; XM_005030748; BAP-1; DING; HIPI3; BAP1; XM_005030749; XM_005622432; XM_537164; TREES_T100002675; AS27_08110 XM_003785791; XM_005232734; XM_004313674; XM_011588767; XM_011588768; XM_011588769; XM_008066104; XM_007166956; XM_007166955; XM_008249917; XM_002722443; XM_010184804; XM_010131884; XM_009940829; XM_009582679; XM_009967773; XM_008588367; XM_006872706; XM_004808116; XM_004808117; XM_004767958; XM_004767956; XM_004767957; XM_009636901; XM_003264459; XM_004088945; XM_004613710; XM_005856664; XM_009902653; XM_006907738; XM_005667822; XM_005667824; XM_005667826; XM_005667821; XM_003130379; XM_005667823; XM_005667825; XM_006135799; XM_010853086; XM_009979151; XM_009191712; XM_002893395; XM_514507; XM_003308638; XM_009439610; XM_009439605; XM_007937694; XM_005531309; XM_006267565; XM_008945965; XM_009919202; XM_011227014; XM_002920849; XM_006089858; XM_005049912; XM_005049913; XM_001516642; XM_007668980; XM_006037004; XM_005146513; XM_005893101; XM_005893100; XM_004372913; XM_010406351; XM_010580692; XM_011509852; NM_007212; XM_005245413; XM_011509851; XM_010155175; XM_009074584; XM_007434510; XM_005963396; XM_005963397; XM_010213372; XM_004468429; XM_004468430; XM_004468431; XM_005487039; XM_009463539; XM_011364545; XM_004688568; XM_004688569; XM_009997849; XM_005506534; XM_004943287; XM_422295; XM_004943285; XM_004943286; XM_003208502; XM_010715546; XM_010715547; XM_009088429; XM_009481357; XM_001490007; XM_008534655; XM_006772947; XM_006772948; XM_006185546; XM_003925286; XM_004424928; XM_005690974; XM_008968563; XM_003815602; XM_008145953; XM_006143866; XM_005443319; XM_009865895; XM_010204370; XM_006060513; XM_006060510; XM_006060512; XM_006060511; XM_002190830; XM_009275831; XM_011291005; XM_004001340; XM_007989177; XM_007989176; XM_007989179; XM_010368958; XM_010368957; XM_004275227; XM_007523806; XM_005540227; XM_005540230; XM_005540228; XM_005540229; XM_005540231; NM_001101203; XM_004028047; XM_004028046; XM_004578826; XM_010084954; XM_009556366; XM_006198790; XM_009506697; XM_010313112; XM_009324640; XM_003767510; XM_010591103; XM_002760258; XM_008984832; XM_008984833; XM_007451138; XM_007451139; XM_010992086; XM_010992085; XM_007096230; XM_004013869; XM_009884364; XM_009672662; XM_008635395; XM_008635394; XM_005290711; XM_010116863; XM_009947654; XM_010165133; XM_004405742; XM_006732908; XM_006732907; XM_009808327; XM_010296946; XM_008494822; XM_005997271; XM_001366864; XM_004706673; XM_004706674; XM_010973308; XM_010973311; XM_008930821; XM_005423737; XM_008697076; XM_008697084; XM_008697091; XM_009695548
TABLE-US-00011 TABLE 6 iDRiP proteomics resultsMultiplexed quantitation of proteins pulled down by iDRiP and identified by mass spectrometry. UniProt Entry Human Human Human Gene Name Gene ID Protein Symbol Gene Synonyms Accession numbers MINT_MOUSE 23013 MINT SPEN HIAA0929; NM_015001 MINT; SHARP; RBM15C FIBB_MOUSE 2244 FIBB FGB HEL-S-78p NM_005141; ; NM_001184741 CO1A2_MOUSE 1278 CO1A2 COL1A2 OI4 NM_000089 IKIP_MOUSE 121457 IKIP IKBIP IKIP NM_153687; NM_201613; NM_201612 RGAP1_MOUSE 29127 RGAP1 RACGAP1 CYK4; NM_001126104; XM_005268814; XM_011538235; MgcRacGAP; XM_011538242; XM_005268813; XM_011538240; ID-GAP; XM_006719359; XM_011538241; XM_011538243; HsCYK-4 NM_001126103; XM_005268815; XM_011538236; XM_005268812; XM_011538237; XM_011538238;
RFC1_MOUSE 5981 RFC1 RFC1 RFC140; PO-GA; NM_001204747; XM_011513730; NM_002913; XM
RECC1; A1; MHCBFB; RFC COCA1_MOUSE 1303 COCA1 COL12A1 BA209D8.1; XM_011535436; NM_004370; XM_011535435; NM
COL12A1L; XM_011535434 DJ234P15.1 NEP_MOUSE 4311 NEP MME CALLA; NEP; XM_006713647; NM_007289; XM_011512856; NM
CD10; SFE XM_006713646; NM_007288; XM_011512855; XM
XM_011512857; NM_000902 NUP88_MOUSE 4927 NUP88 NUP88 XM_011523893; XM_005256659; NM_002532 UHRF1_MOUSE 29128 UHRF 1 UHRF 1 RNF106; NM_001290052; XM_011527942; ; NM_001290051; ICBP90; Np95; NM_001048201; NM_001290050; NM_013282 hNP95; hUHRF1; huNp95 WAPL_MOUSE 23063 WAPL WAPAL KIAA0261; XM_011539547; XM_011539548; XM_006717729;
WAPL; FOE ZFR_MOUSE 51663 ZFR ZFR SPG71; ZI;R1 XR_427659; NM_016107 BAK_MOUSE 578 BAK BAK1 BAK; BAK- XM_011514779; XM_011514780; NM_001188 LIKE; CDN1; BCL2L7 NU133_MOUSE 55746 NU133 NUP133 hNUP 133 NM_018230 Q8BVY0_MOUSE CO1A1_MOUSE 1277 CO1A1 COL1A1 OI4 NM_000088; ; XM_005257059; XM_005257058; X
NHP2_MOUSE 55651 NHP2 NHP2 DKCB2; NM_001034833; NM_017838 NHP2P; NOLA2 HELLS_MOUSE 3070 HELLS HELLS PASG; LSH; NM_001289067; NM_001289071; NM_001289073; Nbla10143; NM_001289074; NM_001289075; NM_001289068; SMARCA6 NM_001289070; NM_001289069; NM_001289072;
HNRPU_MOUSE 3192 HNRPU HNRNPU HNRPU; SAF-A; NM_004501; NM_031844 U21.1; hnRNP U LRWD1_MOUSE 222229 LRWD1 LRWD1 CENP-33; XM_005250204; NM_152892 ORCA RCC1_MOUSE 1104 RCC1 RCC1 CHC1; SNHG3- NM_001048199; NM_001269; NM_001048195; NR_
RCC1; RCC1-I NR_030726; NM_001048194 MBB1A_MOUSE 10514 MBB1A MYBBP1A PAP2; P160 NM_001105538; NM_014520; XM_011523616 MYEF2_MOUSE 50804 MYEF2 MYEF2 myEF-2; XM_005254424; XM_006720553; XM_005254422; MSTP156; XM_005254425; NM_001301210; NM_016132; XM
HsT18564; XM_011521657; NR 125408 MEF-2; MST156 LRP1_MOUSE 4035 LRP1 LRP1 CD91; NM_002332; IGFBP3R; A2MR; LRP1A; APOER; APR; LRP; TGFBR5 NXF1_MOUSE 10482 NXF1 NXF1 MEX67; TAP NM_001081491; NM_006362 RL7L_MOUSE 285855 RL7L RPL7L1 dJ475N16.4 XM_005249026; NM_198486 HXA5_MOUSE 3202 HXA5 HOXA5 HOX1.3; HOX1; NM_019102 HOX1C SMHD1_MOUSE 23347 SMHD1 SMCHD1 XM_011525645; NM_015295; XM_011525646; ; X
XM_011525644; XR_935054; XM_011525642; XM_
XR_935055; XR_430039 NFIC_MOUSE 4782 NFIC NFIC NFI; NF-I; CTF; NM_001245005; NM_005597; XM_005259563; XM
CTF5 NM_205843; NM_001245002; NM_001245004; XM
P53_MOUSE 7157 H2EHT1 TP53 TRP53; BCC7; NM_001126112; NM_001276697; NM_001126115; ; P53; LFS1 NM_001126114; NM_001276698; NM_001276761; NM_001126118; NM_001126113; NM_001126117; NM_001276695; NM_001276699; NM_001276760;
NM_001126116; NM_001276696 CELF2_MOUSE 10659 CELF2 CELF2 CUGBP2; NM_001083591; NM_006561; XM_006717373; XM
NAPOR; XM_011519295; XM_011519297; XM_011519298; BRUNOL3; XM_005252354; XM_006717371; NM_001025076; ETR-3; ETR3 XM_006717374; XM_006717375; XM_011519299; NM_001025077; XM_005252357; XM_005252358; XM_006717369; XM_011519296; XM_006717370 XPO5_MOUSE 57510 XPO5 XPO5 exp5 NM_020750 GAPR1_MOUSE 152007 GAPR1 GL1PR2 C9orf19; GAPR- NM_001287012; NM_001287014; NR_104638; NM_
1; GAPR1 NR_104640; NR_104641; NR_104637; NR_104639; XM_011517714; NM_001287013; NM_022343; NM
MSH2_MOUSE 4436 MSH2 MSH2 HNPCC; NM_000251; XM_005264332; NM_001258281; XR_
HNPCC1; FCC1; XM_011532867 COCA1; LCFS2 PNO1_MOUSE 56902 PNO1 PNO1 KHRBP1; NM_020143 RRP20 TSP1_MOUSE 7057 TSP1 THBS1 TSP; TSP1; XM_011521970; XR_931897; XM_011521971; NM_
THBS; THBS-1; TSP-1 LBR_MOUSE 3930 LBR LBR PHA; XM_011544187; NM_002296; XM_011544185; XM
DHCR14B; NM_194442; XM_005273125 TDRD18; _ LMN2R PGS1_MOUSE 633 PGS1 BGN PG-S1; DSPG1; NM_001711 SLRR1A; PGI PCOC1_MOUSE 5118 PCOC1 PCOLCE PCPE-1; PCPE1; NM_002593 PCPE RING1_MOUSE 6015 RING1 RING1 RING1A; RNF1 NM_002931 ROA0_MOUSE 10949 ROA0 HNRNPA0 HNRPA0 NM_006805 RB15B_MOUSE 29890 RB15B RBM15B HUMAGCGB; NM_013286 OTT3 FBLN4_MOUSE 30008 FBLN4 EFEMP2 UPH1; FBLN4; NM_016938; ; NR_037718 ARCL1B; MBP1 HNRL2_MOUSE 221092 HNRL2 HNRNPUL2 HNRPUL2; NM_001079559 SAF-A2 NIP7_MOUSE 51388 N1P7 N1P7 HSPC031; CGI- NM_001199434; NM_016101 37; KD93 J3QQ16_MOUSE RRP1B_MOUSE 23076 RRP1B RRP1B PPP1R136; NM_015056 KIAA0179; NNP1L; Nnp1; RRP1 DCLK1_MOUSE 9201 DCLK1 DCLK1 CL1; CLICK1; XM_006719893; XM_005266592; NM_001195430; DCDC3A; NM_001195416; NM_001195415; NM_004734 DCAMKL1; DCLK ACADS_MOUSE 35 ACADS ACADS ACAD3; SCAD NM_000017; NM_001302554 MD1L1_MOUSE 8379 MD1L1 MAD1L1 TXBP181; XM_011515570; XM_005249877; XM_011515567; TP5319; MAD1; XM_011515571; NM_001013837; NM_001304525; PIG9 XM_011515568; ; NM_001013836; NM_001304523; XM_011515569; NM_001304524 XRN2_MOUSE 22803 XRN2 XRN2 XM_011529184; NM_012255 CO6A2_MOUSE 1292 CO6A2 COL6A2 PP3610 XR_937439; NM_058175; NM_058174; XR_937438 XM_011529452; XM_011529451 TADBP_MOUSE 23435 TADBP TARDBP ALS10; TDP-43 NM_007375; XR_946596; ; XR_946597 MYOF_MOUSE 26509 MYOF MYOF FER1L3 XM_006717760; NM_133337; XM_005269693; XM
XM_011539633; NM_013451; XM_005269694 NID2_MOUSE 22795 NID2 NID2 NID-2 XM_005267405; XM_005267406; XM_005267407;
MGN2_MOUSE 55110 MGN2 MAGOHB mago; MGN2; NM_018048; XM_005253402; NM_001300739; XM
magoh SNTB2_MOUSE 6645 SNTB2 SNTB2 SNT2B2; SNT3; NM_006750; NM_130845 SNTL; D1652531E; EST25263 H3BJG4_MOUSE KDM2A_MOUSE 22992 KDM2A KDM2A CXXC8; FBL11; NR_027473; NM_012308; XM_011544860; XM_006
FBL7; JHDM1A; XM_006718480; XM_011544861; XM_011544862;
FBXL11; LILINA DJC10_MOUSE 54431 DJC10 DNAJC10 ERdj5; MTHr; NM_001271581; NM_018981; NR_073367; NR_073
JPDI; PDIA19 NR_073365 MAOM_MOUSE 4200 MAOM ME2 ODS1 NM_002396; XR_935223; ; NM_001168335 SUN2_MOUSE 25777 SUN2 SUN2 UNC84B NM_015374; XM_011530105; XM_011530104; NM
NM_001199579 Q921K2_MOUSE GPX1_MOUSE 2876 GPX1 GPX1 GSHPX1; GPXD NM_000581; NM_201397; DYR_MOUSE 1719 DYR DHFR DHFRP1; DYR NM_000791; NM_001290357; ; NM_001290354; NR
G5E924_MOUSE LEG8_MOUSE 3964 LEG8 LGALS8 Po66-CBP; NM_201544; XM_011544188; NM_201543; NM_00
PCTA-1; Gal-8; NM_201545 PCTA1 LYOX_MOUSE 4015 LYOX LOX NM_001178102; ; NM_002317 EIF2A_MOUSE 83939 EIF2A EIF2A EIF-2A; XM_011513224; XM_011513223; NM_032025 MST089; CDA02; MSTP004; MSTP089 PTBP2_MOUSE 58155 PTBP2 PTBP2 nPTB; PTBLP; XR_946723; XR_946722; NM_001300987; NR_1253
brPTB XM_011541876; XM_011541875; XR_946720; NM_
NM_001300988; NM_021190; NM_001300990; NR_
XM_011541874; XR 946721; NM_001300985; NM_
STT3B_MOUSE 201595 STT3B STT3B SIMP; CDG1X; XM_011533465; NM_178862 STT3-B HNRPM_MOUSE 4670 HNRPM HNRNPM HTGR1; NM_005968; XM_005272478; XM_005272480; XM
NAGR1; hnRNPM; XM_005272479; XM_005272481; NM_001297418;
HNRPM; CEAR; HNRNPM4; HNRPM4 FARP1_MOUSE 10160 FARP1 FARP1 CDEP; FARP1- NM_001001715; NM_001286839; XM_011521046;
IT1; PPP1R75; PLEKHC2 ERH_MOUSE 2079 A0A024R6D4 ERH DROER NM_004450 SMD2_MOUSE 6633 SMD2 SNRPD2 SMD2; NM_004597; NM_177542; XM_005259180 SNRPD1 ; Sm-D2 PTPRS_MOUSE 5802 PTPRS PTPRS PTPSIGMA XM_006722809; XM_006722810; XM_006722820;
XM_005259606; XM_005259607; XM_006722808; XM_006722815; NM_130854; XM_011528157; NM
XM_005259610; XM_006722812; XM_006722819;
XM_005259600; XM_006722817; XM_006722818; XM_011528158; ; XM_006722814; XM_005259601; XM_005259609; XM_006722811 MY01D_MOUSE 4642 MYO1D MYO1D myr4; PPP1R108 XR_934470; NM_001303280; NM_001303279; NM_
NB5R3_MOUSE 1727 NB5R3 CYB5R3 B5R; DIA1 NM_007326; NM_000398; NM_001129819; NM_00
NM_001171661; RM46_MOUSE 26589 RM46 MRPL46 P2ECSL; NM_022163 LIECG2; C15orf4 NEDD4_MOUSE 4734 NEDD4 NEDD4 RPF1; NEDD4-1 NM_001284339; XM_011521626; XM_011521624;
NR_104302; XM_011521627; NM_001284338; NM_
XM_011521625; NM_001284340 FBRL_MOUSE 2091 FBRL FBL FIB; FLRN; XM_011548799; XM_011526623; XM_011548798; RNU3IP1 XM_005258651; NM_001436 LXN_MOUSE 56925 LXN LXN TCI; ECI NM_020169 RAB9A_MOUSE 9367 RAB9A RAB9A RAB9 NM_004251; NM_001195328 HMGCL_MOUSE 3155 HMGCL HMGCL HL NM_000191; NM_001166059 Q8VHM5_MOUSE ITPR3_MOUSE 3710 ITPR3 ITPR3 IP3R; IP3R3 XM_011514577; ;NM_002224; XM_011514576 DHB12_MOUSE 51144 DHB12 HSD17B12 SDR12C1; KAR XM_011520156; NM_016142 PHIP_MOUSE 55023 PHIP PHIP DCAF14; XM_011535919; NM_017934; XM_005248729; XM
WDR11; XM_011535918; XR_942499 BRWD2; ndrp PTBP3_MOUSE 9991 PTBP3 PTBP3 ROD1 XM_006717346; XM_005252324; XM_011519267; NM_001244897; NM_005156; XM_006717343; XM
NM_001163788; NM_001244898; NM_001163790; XM_011519265; NM_001244896 NUP43_MOUSE 348995 NUP43 NUP43 p42; bA350J20.1 XM_011535799; XM_005266961; XM_011535798;
XM_005266960; XM_005266962; XR 942420; NM_
NR_104456 ROAA_MOUSE 3182 ROAA HNRNPAB HNRPAB; NM_004499; NM_031266 ABBP1 KAD3_MOUSE 50808 Q7Z4Y4; AK3 AK3L1; NM_001199855; NM_001199853; NM_016282; NM
KAD3 AKL3L1; AK6; NM_001199852; NM_001199856 AKL3L; FIX RBM14_MOUSE 10432 RBM14 RBM14 COAA; NM_001198837; ;NM_001198836; NM_006328; N
TMEM137; SIP; SYTIP1; PSP2 MYH1_MOUSE 4619 MYH1 MYH1 HEL71; MyHC- NM_005963 2x; MYHSA1; MYHa; MyHC- 2X/D RBBP6_MOUSE 5930 RBBP6 RBBP6 P2P-R; MY038; XM_005255461; NM_018703; XM_005255462; NM
RBQ-1; NM_032626 SNAMA; PACT RFC2_MOUSE 5982 RFC2 RFC2 RFC40 XR_927506; NM_001278792; NM_001278793; NM_
NM_181471; ;NM_001278791; XM_006716080 Q0VBL3_MOUSE E9Q5G3_MOUSE RALY_MOUSE 22913 RALY RALY P542; HNRPCL2 XM_005260336; XM_011528694; NM_007367; NM
XM_011528695; XM_005260334 STA5A_MOUSE 6776 STA5A; STAT5A MGF; STAT5 NM_001288720; NM_001288719; XM_005257624; Q59GY7; NM_001288718; NM_003152 A8K615; K7EK35 PHF5A_MOUSE 84844 PHF5A PHF5A SAP14b; INI; NM_032758 Rds3; bK223H9.2; SF3B7; SF3b14b ADRO_MOUSE 2232 ADRO FDXR ADXR XM_006721772; XM_011524532; NM_001258015; XM_011524528; XM_011524531;NM_001258016; XM_011524527; XM_011524530; XM_011524533;
NR_ 047576; NM_001258013; NM_001258014; XM_
NM_001258012; NM_024417 RT11_MOUSE 64963 RT11 MRPS11 HCC-2 NM_176805; XM_011521946; XM_005254978; XM
NM_022839; XM_005254977 BAZ1B_MOUSE 9031 BAZ1B BAZ1B WBSCR9; NM_032408; NM_023005; XM_005250683; WBSCR10; WSTF RAVR1_MOUSE 125950 RAVR1 RAVER1 NM_133452; XM_011527671; XM_011527672 E41L2_MOUSE 2037 E41L2 EPB41L2 4.1G; 4.1-G XM_006715362; XM_011535523; NM_001431; XM
XR_942326; XR_942328; NM_001135554; XM_006
XM_011535531; XM_011535535;NM_001252660; XM_005266840; XM_011535522; XM_011535526; XM_011535530; XM_011535534; XM_011535521; XM_011535525; XM_011535528; XM_011535529; XM_011535532; NM_001199389; NM_001135555; NM_001199388; XM_005266841; XM_011535524; XM_011535533; XM_011535536 DCA13_MOUSE 25879 DCA13 DCAF13 HSPC064; NM_015420 WDSOF1; GM83 Q3TIX6_MOUSE CLK3_MOUSE 1198 CLK3 CLK3 PHCLK3/152; XM_005254153; XM_011521210; XM_011521206; PHCLK3 XM_011521209; XM_011521208; NM_003992; XM
XM_006720384; XM_011521205; XR_931746; NM_
XM_011521207; NM_001130028 LAP2_MOUSE 55914 LAP2 ERBB2IP HEL-S-78; XM_011543514; NM_001253698; NM_018695; ; X
LAP2; ERBIN XM_005248555; NM_001006600; NM_001253699; XM_006714660; NM_001253697; NM_001253701 WDR33_MOUSE 55339 WDR33 WDR33 WDC146; XM_005263697; NM_001006623; NM_018383; XM
NET14 NM_001006622 SMC3_MOUSE 9126 SMC3 SMC3 BAM; HCAP; NM_005445 SMC3L1; CSPG6; CDLS3; BMH GULP1_MOUSE 51454 GULP1 GULP1 CED6; CED-6; XM_006712583; XM_006712585; XM_006712589; GULP XM_011511327; XM_011511332; NM_001252668; NM_001252669; XM_011511328; XM_011511329; XM_006712590; XM_011511331; XM_011511334;
NR_045563; XM_006712581; XM_011511333; XM_
XM_006712580; XM_006712582; XM_006712584;
XM_011511330 LS14A_MOUSE 26065 LS14A LSM14A C19orf13; XM_011547018; NM_015578; XM_011526708; XM
RAP55A; XM_005258719; XM_005258720; XM_005258721; RAP55; XM_005276948; NM_001114093; XM_005276950 FAM61A MCU_MOUSE 90550 MCU MCU C10orf42; NR_073062; NM_138357; NM_001270679; NM_001
CCDC109A KANK2_MOUSE 25959 KANK2 KANK2 PPKWH; SIP; NM_001136191; NM_015493 ANKRD25; MXRA3 ALDH2_MOUSE 217 ALDH2 ALDH2 ALDHI; ALDH- NM_001204889; NM_000690; E2; ALDM CBR2_MOUSE MAAI_MOUSE 2954 MAAI GSTZ1 GSTZ1-1; XM_011536671; NM_001513; XM_005267559; NM
MAAI; MAI NM_145870; XM_011536670 TRA2A_MOUSE 29896 TRA2A TRA2A AWMS1; NM_013293; NM_001282757; NM_001282759; XM
HSU53209 XM_011515331; XM_006715713; NM_001282758 TENC1_MOUSE 23371 TENC1 TNS2 C1TEN; TENC1; XM_006719303; NM_015319; XM_006719304; XM
C1-TEN NM_170754; XM_006719302; NM_198316 ACSF2_MOUSE 80221 ACSF2 ACSF2 AVYV493; XR_934566; XR_934563; XR_934564; NM_025149; ACSMW NM_001288970; XM_006722110; XM_011525294;
NM_001288968; NM_001288969; NM_001288971; NM_001288972; XR_934565; NR_110232 PRP19_MOUSE 27339 PRP19 PRPF 19 hPSO4; PSO4; NM_014502 UBOX4; PRP19; SNEV; NMP200 ENV1_MOUSE PR38A_MOUSE 84950 PR38A PRPF38A Prp38 NM_032864; XM_011542315; NM_032284 RRP5_MOUSE 22984 RRP5 PDCD11 NFBP; RRP5; NM_014976; XM_011539538; XM_011539540; XM
ALG-4; ALG4 XM_011539539 SQRD_MOUSE 58472 SQRD SQRDL CGI-44; NM_001271213; NM_021199 PRO1975; SQOR THOC3_MOUSE 84321 THOC3 THOC3 hTREX45; XM_011534668; XM_011534666; NM_032361; XM
THO3 THIKA_MOUSE 30 THIK ACAA1 ACAA; THIO; NM_001130410; XM_006713122; NR_024024; NM_
PTHIO XM_011533650; ; XM_006713123 P5CR2_MOUSE 29920 P5CR2 PYCR2 P5CR2 NM_001271681; NM_013328 PDK3_MOUSE 5165 PDK3 PDK3 CMTX6; GS1- ;NM_001142386; NM_005391 358P8.4 Q8BGJ5_MOUSE S12A2_MOUSE 6558 S12A2 SLC12A2 BSC2; NKCC1; NM_001256461; NM_001046; XM_011543588; NR_
BSC; PPP1R141 RBMS2_MOUSE 5939 RBMS2 RBMS2 SCR3 XM_005269059; NM_002898; XM_006719543; XM
XM_005269060; XM_011538640; XM_006719541; XM_006719542; XM_006719544; XM_011538637; XM_005269061; XM_011538642; XM_005269066; XM_011538638; XM_011538641 PLRG1_MOUSE 5356 PLRG1 PLRG1 PRPF46; PRL1; NM_002669; NM_001201564 PRP46; Cwe1; TANG04 RINI_MOUSE 6050 RINI RNH1 RAI; RNH XM_011520263; XM_011546605; XM_011520257; XM_011546603; XM_011546606; NM_203383; NM
XM_011520261; XM_011546604; XM_011546609; XM_011546607; XM_011546608; NM_203386; NM
XM_011520259; XM_011520262; XM_011546602; XM_011520260; XM_011546610; XM_011520256;
NM_203385; NM_203387; XM_011520255; XM_01
NM_203384 CDK4_MOUSE 1019 CDK4 CDK4 PSK-J3; CMM3 NM_052984; NM_000075 ACADM_MOUSE 34 ACADM ACADM ACAD1; NM_001127328; NM_001286042; NM_001286043; ; MCAD; NM_001286044; NR 022013 MCADH HNRPK_MOUSE 3190 HNRPK HNRNPK TUNP; CSBP; XM_011518616; NM_002140; NM_031262; XM_00
HNRPK XM_005251960; XM_005251961; NM_031263; XM
XM_005251966; XM_005251963 GPX41_MOUSE 2879 Q6PI42 GPX4 GPx-4; MCSP; NM_002085; NM_001039847; NM_001039848 snPHGPx; PHGPx; GSHPx- 4; snGPx RBM3_MOUSE 5935 RBM3 RBM3 IS 1-RNPL; NM_001017430; XM_011543939; NM_001017431;
RNPL XM_011543938 SNR40_MOUSE 9410 SNR40 SNRNP40 PRPF8BP; 40K; NM_004814 SPF38; WDR57; HPRP8BP; PRP8BP KHDR1_MOUSE 10657 KHDR1 KHDRBS1 Sam68; p62; p68 NR_073498; NR_073499; NM_001271878; NM_006
ILK_MOUSE 3611 ILK ILK HEL-S-28; XM_005252904; NM_001278441; XM_011520065; p591LK; ILK-1; XM_005252905; NM_001014795; NM_001278442; ILK-2; P59 NM_001014794; NM_004517 GAR1_MOUSE 54433 GAR1 GAR1 NOLA1 NM_032993; NM_018983 CSTF1_MOUSE 1477 CSTF1 CSTF1 CstFp50; CstF-50 NM_001033522; NM_001033521; NM_001324; XM
UGGG1_MOUSE 56886 UGGG1 UGGT1 UGCGL1; XM_006712635; XR_922969; NM_020120; NM_001
HUGT1; UGT1 NR_027671; XM_006712634; XM_006712636 CPSF4_MOUSE 10898 CPSF4 CPSF4 CPSF30; NAR; XM_011515755; XM_011515756; NM_006693; XM
NEB1 NM_001081559; XM_011515758; XM_011515759 IF4A3_MOUSE 9775 IF4A3 EIF4A3 MUK34; XM_011525522; NM_014740 NMP265; NUK34; eIF4AIII; RCPS; DDX48 PCBP2_MOUSE 5094 PCBP2 PCBP2 HNRNPE2; NM_001128912; NM_001128911; NM_001128914; HNRPE2; NM_001098620; NM_031989; NM_001128913; NM
hnRNP-E2 QKI_MOUSE 9444 QKI QKI Hqk; QK; QK3; XM_011536259; XM_011536260; XR 942633; ; XM
hqkI; QK1 NM_206853; NM_001301085; NM_006775; XM_01
NM_206854; XR 245557; NM_206855 ACADV_MOUSE 37 ACADV ACADVL ACAD6; XM_011523829; XR_934023; NM_001270447; XR_
LCACD; NM_001270448; NM_000018; XM_006721516; ; X
VLCAD XR_934022; NM_001033859 ELAV1_MOUSE 1994 ELAV1 ELAVL1 ELAV1; MelG; XM_011527777; NM_001419 Hua; HUR FINC_MOUSE 2335 FINC FN1 FNZ; GFND; XM_005246416; ; XM_005246413; NM_212476; X
CIG; ED-B; XM_005246410; XM_005246414; NM_212474; XM
GFND2; MSF; XM_005246408; XM_005246409; XM_005246399;
HNC; FN; LETS XM_005246400; XM_005246403; XM_005246405; XM_005246406; XM_005246415; NM_002026; XM
XM_005246401; XM_005246404; XM_005246412; XM_005246417; XM_005246397; XM_005246411;
NM_212482; NM_212475 WDR3_MOUSE 10885 WDR3 WDR3 UTP12; DIP2 NM_006784 SRSF9_MOUSE 8683 SRSF9 SRSF9 SFRS9; SRp30c NM_003769 NPM_MOUSE 4869 NPM NPM1 B23; NPM XM_005265920; ; NM_001037738; NM_002520; N
XM_011534564 FUBP2_MOUSE 8570 FUBP2 KHSRP FUBP2; FBP2; XM_005259668; NM_003685; XM_011528395 KSRP HNRPD_MOUSE 3184 HNRPD HNRNPD P37; AUF1; ; NM_002138; NM_001003810; NM_031370; NM_0
AUF1A; HNRPD; hnRNPD0 UTP15_MOUSE 84135 UTP15 UTP15 NET21 NM_001284431; XM_011543680; NM_001284430;
IMMT_MOUSE CD2A1_MOUSE 1029 CD2A2 CDKN2A P16INK4A; XM_011517676; XR 929166; ; NM_058197; NM_05
CMM2; P14; XR_929165; NM_001195132; XR_929162; NM_058
P16INK4; P19; XM_011517675; XM_011517678; XM_011517679;
P19ARF; NM_000077; XM_011517677; XR_929161; XR_929
CDKN2; INK4; XM_005251343; XR_929164 TP16; MTS1; INK4A; P14ARF; ARF; MTS-1; P16- INK4A; CDK4I; MLM; P16 RSMB_MOUSE 6628 Q66K91 SNRPB CCMS; COD; NM_198216; NM_003091; Sm-B/B; SmB/SmB; snRNP-B; SNRPB1; SmB/B IMA1_MOUSE 3838 IMA1 KPNA2 IPOA1; QIP2; XM_011524783; NM_002266 SRP1alpha; RCH1 THIL_MOUSE 38 THIL ACAT1 ACAT; MAT; XM_006718834; XM_006718835; NM_000019; T2; THIEL RT07_MOUSE 51081 RT07 MRPS7 S7mt; bMRP27a; NM_015971 MRP-S7; RPMS7; RP-S7; MRP-S MEN1_MOUSE 4221 MEN1 MEN1 MEAL; SCG2 NM_130800; NM_130802; NM_130799; XM_01154
NM_130804; NM_000244; XM_005274001; NM_13
NM_130803; XM_011545040; ; XM_011545042 HNRPF_MOUSE 3185 HNRPF HNRNPF HNRPF; NM_001098207; NM_001098208; NM_001098204; OK/SW-cl 23; NM_001098205; NM_001098206; NM_004966 mcs94-1 ROA3_MOUSE 220988 ROA3 HNRNPA3 2610510D13Rik; NM_194247; XM_005246380; XM_006712365; XM
D10S102; HNRPA3; FBRNP NCOA5_MOUSE 57727 NCOA5 NCOA5 bA465L10.6; NM_020967; XM_011528951; XM_005260474 CIA KIF4_MOUSE 24137 KIF4A KIF4A KIF4; KIF4G1; XM_011530893; ;NM_012310 MRX100 FBLN1_MOUSE 2192 Q8NBH6 FBLN1 FBLN; FIBL1 NM_006486; NM_001996; ;NM_006485; NM_0064
SYWM_MOUSE 10352 SYWM WARS2 TrpRS XM_006710283; NM_015836; NM_201263; XM_01
XM_005270350; XM_011540495; XM_011540494 GELS_MOUSE 2934 GELS GSN AGEL; ADF XM_006717075; XM_011518587; NM_198252; XM
XM_005251945; XM_011518584; XM_011518594; XM_005251943; XM_005251944; XM_011518586; XM_011518592; NM_001127666; XM_006717079; XM_011518589; NM_001127664; XM_011518585; XM_011518588; XM_011518590; XM_011518593; ; NM_001127662; NM_001127663; NM_001127667; XM_011518591; NM_001258029; NM_001127665;
UTP20_MOUSE 27340 UTP20 UTP20 DRIM NM_014503; XM_006719343 TENA_MOUSE 3371 TENA TNC 150-225; XM_011518624; XM_011518627; ; XM_005251974; GMEM; JI; GP; XM_011518629; XM_006717100; XM_011518622; TN; TN-C; XM_011518623; XM_011518626; XM_005251972; DFNA56; HXB XM_006717097; XM_005251975; XM_011518625; XM_006717096; XM_011518628; XM_011518630;
XM_005251973; XM_006717098; XM_006717101 SENP3_MOUSE 26168 SENP3 SENP3 Ulp1; SMT3IP1; NM_015670 SSP3 CPT2_MOUSE 1376 CPT2 CPT2 CPTASE; CPT1; ; XM_005270484; NM_000098 IIAE4 RBBP7_MOUSE 5931 RBBP7 RBBP7 RbAp46 XM_011545553; NM_001198719; XM_011545554;
AOFA_MOUSE 4128 AOFA MAOA MAO-A NM_000240; NM_001270458; ECHB_MOUSE 3032 ECHB HADHB ECHB; NM_001281513; NM_000183; XM_011532803; ; N
MSTP029; XM_011532804 MTPB; TP- BETA E9QNN1_MOUSE Q91VA7_MOUSE 3420 A0A087WZN1 IDH3B RP46; H-IDHB XM_005260716; XR_937066; ; NM_174856; NM_17
NM_001258384; NM_006899 PYC_MOUSE 5091 A0A024R5C5 PC PCB XM_006718577; ; NM_001040716; XM_011545086; XM_005274031; XM_005274032; XM_006718578; XM_006718579; NM_000920; XM_011545087; NM
XM_011545085; XM_011545088 DNMT1_MOUSE 1786 I6L9H2 DNMT1 AIM; CXXC9; XM_011527773; ;NM_001130823; NM_001379; X
DNMT; MCMI; XM_011527774 ADCADN; HSN1E ROA2_MOUSE 3181 ROA2 HNRNPA2B1 HNRPA2; XR_242076; XR_242077; NM_002137; ; XR_42807
RNPA2; XM_006715714; NM_031243; XM_005249729 SNRPB1 ; HNRNPA2; HNRNPB1; IBMPFD2; HNRPA2B1; HNRPB1 LARP7_MOUSE 51574 LARP7 LARP7 ALAZS; PIP7S; NM_015454; NM_016648; NR_049768; NM_001267 HDCMA18P PREP_MOUSE 10531 PREP PITRM1 PreP; MP1 XM_005252345; XM_011519292; NM_014968; NM
NM_001242309; XM_006717362; NM_014889 EDC4_MOUSE 23644 EDC4 EDC4 RCD-8; HEDLS; NM_014329 Ge-1; RCD8; GE1; HEDL5 RFOX2_MOUSE 23543 RFOX2 RBFOX2 FOX2; Fox-2; XM_006724190; XM_006724193; ; XM_006724185; HNRBP2; XM_006724187; XM_011530036; NM_001031695; HRNBP2; NM_001082577; XM_005261428; XM_005261430; RBM9; RTA; XM_005261431; XM_005261432; XM_005261433; fxh; dJ106I20.3 XM_005261437; NM_001082579; XM_005261429; XM_006724186; XM_006724194; XM_006724192; NM_001082578; NM_014309; NM_001082576; XM
XM_006724188; XM_006724189; XM_006724191 SMD3_MOUSE 6634 SMD3 SNRPD3 SMD3; Sm-D3 NM_001278656; NR_103819; NM_004175 ODBA_MOUSE 593 ODBA BCKDHA MSU; MSUD1; ; NM_000709; NM_001164783 BCKDE1A; OVD1A RT23_MOUSE 51649 RT23 MRPS23 CGI-138; NM_016070 HSPC329; MRP- S23 RBP2_MOUSE 5903 RBP2 RANBP2 ANE1; TRP1; XM_011511576; NM_006267; XM_005264002; XM
TRP2; ADANE; XM_011511575; XM_005264003; XM_005264007; NUP358; IIAE3 XM_011511577; XM_005264005; XM_011511578; NIPA_MOUSE 51530 NIPA ZC3HC1 HSPC216; NIPA NM_001282190; XM_005250403; NM_001282191; XM_011516288; XM_011516289; XM_011516290;
KAD1_MOUSE 203 Q6FGX9 AK1 HTL-S-58j XM_005251786; ;XM_011518348; XM_011518349; SUCB2_MOUSE 8801 SUCB2 SUCLG2 GBETA XR_940506; XR_245062; NM_001177599; NM_003
PRP8_MOUSE 10594 PRP8 PRPF8 SNRNP220; NM_006445; HPRP8; PRPC8; PRP8; RP13 NCPR_MOUSE 5447 NCPR POR P450R; CPR; ; NM_000941 CYPOR LMNB1_MOUSE 4001 LMNB1 LMNB1 LMN2; LMNB; NM_001198557; XR 948250; ; NM_005573 LMN; ADLD SF3B4_MOUSE 10262 SF3B4 SF3B4 SF3b49; Hsh49; ; NM_005850 AFD1; SAP49 A2ANY6_MOUSE 23195 MDN1 MDN1 XM_011535635; XR_942362; XM_005248700; XM_
XM_011535636; ;NM_014611 LAP2B_MOUSE 7112 LAP2B; TMPO LAP2; CMD1T; ; NM_001032284; XM_005269132; XM_005269130; LAP2A LEMD4; TP; NM_001032283; NM_003276 PR00868 GNL3_MOUSE 26354 GNL3 GNL3 C77032; E2IG3; NM_206826; ; NM_014366; NM_206825 NNP47; NS RL6_MOUSE 6128 A0A024RBK3; RPL6 TXREB1; XM_006719548; XM_006719546; NM_000970; NM
Q8TBK5; RL6 TAXREB107; XM_006719547; XM_006719549; XM_011538647;
SHUJUN-2; L6 RBM22_MOUSE 55696 RBM22 RBM22 Cwc2; ZC3H16; NM_018047 fSAP47 MYO5A_MOUSE 4644 MYO5A MYO5A GS1; MYO5; XM_011521610; XM_011521611;NM_001142495; MYH12; XM_011521607; ;NM_000259; XM_005254398; X
MYR12 XM_005254397; XM_011521609; XM_011521612;
HYOU1_MOUSE 10525 HYOU1 HYOU1 HSP12A; ORP- XM_005271392; XM_011548779; NM_001130991; 150; Grp170; XM_011548780; XM_011548781; XM_011548782;
ORP150; GRP- XM_011542557; XM_005271394; XR_947790; XR_
170 XM_005271393; XM_011542558; XM_011548778 ACDSB_MOUSE 36 ACDSB ACADSB 2-MEBCAD; ; NM_001609 ACAD7; SBCAD NOL11_MOUSE 25926 NOL11 NOL11 NM_015462; NM_001303272 HEMH_MOUSE 2235 HEMH; FECH FCE; EPP NM_000140; XM_011525882; NM_001012515; ; X
Q7KZA3 SNUT2_MOUSE 10713 SNUT2 USP39 SNRNP65; NM_006590; NM_001256726; NM_001256728; NR_
HSPC332; 65K; XM_011532488; XR_939653; NM_001256725; NM_
SAD1; CGI-21 XM_006711922; XR_939652; XM_006711923; XM_
NOG1_MOUSE 23560 NOG1; GTPBP4 CRFG; NGB; NM_012341 D2CFK9 NOG1 NEP1_MOUSE 10436 NEP1 EMG1 C2F; Grcc2f; ; XM_011520907; NM_006331 NEP1 WDR61_MOUSE 80349 WDR61 WDR61 REC14; SKI8 NM_001303248; NM_001303247; XM_011522094;
NM_025234 RFC3_MOUSE 5983 RFC3 RFC3 RFC38 XM_011535174; NM_002915; NM_181558; XM_01
XM_011535175; XM_011535172; XM_011535176 Q3TWW8_MOUSE 6431 SRSF6 SRSF6 SRP55; B52; ; NR_034009; XR_936608; NM_006275 HEL-S-91; SFRS6 PPIL2_MOUSE 23759 PPIL2 PPIL2 CYP60; Cyp-60; XM_011530047; XM_011530051; XM_011530041; CYC4; UBOX7; XM_011530045; NM_148175; XM_011530046; XM
hCyP-60 XM_011530050; XM_005261447; XM_011530043;
XM_005261448; XM_011530042; XM_011530044; XM_011530049; NM_148176 HDAC1_MOUSE 3065 Q6IT96; HDAC1 RPD3; GON-10; XM_011541309; NM_004964 HDAC1 HD1; RPD3L1 PAPD1_MOUSE 55149 PAPD1 MTPAP PAPD1; SPAX4 ; NM_018109 MCM3_MOUSE 4172 MCM3 MCM3 P1-MCM3; P1.h; NM_002388; NM_001270472 HCC5; RLFB SRSF7_MOUSE 6432 SRSF7 SRSF7 SFRS7; 9G8; XM_011533032; XR_939708; XR_426994; NM_001
AAG3 XR_939711; NM_001031684; XM_005264484; XM_
XR_939709; XR_939710; NM_006276 THIM_MOUSE 10449 THIM ACAA2 DSAEC NM_006111 PK1IP_MOUSE 55003 PK1IP PAK1IP1 bA421M1.5; XM_005249204; XM_011514720; XM_006715129; PIP1; hPIP1; XM_011514721; NM_017906 MAK11; WDR84 ATAD1_MOUSE 84896 ATAD1 ATAD1 THORASE; XM_005270251; XM_011540302; XM_005270253;
FNP001; AFDC1 NM_032810; XM_005270252; XM_011540303; XM
Q3U821_MOUSE SYYM_MOUSE 51067 SYYM YARS2 MT-TYRRS; XR_931297; XR_931299; ; XR_242892; XR_429036 TYRRS; XR_242891; NM_001040436; XR_931296; NM_015
MLASA2; CGI-04 RU17_MOUSE 6625 RU17 SNRNP70 U1-70K; Snp1; XM_011527241; NM_001009820; NM_001301069;
U170K; XM_005259178; XM_011527240 SNRP70; U1AP; U1RNP; RPU1; RNPU1Z NUP85_MOUSE 79902 NUP85 NUP85 FROUNT; XR_429921; NM_024844; XR_243683; XM_005257
Nup75 XM_011525267; NM_001303276; XM_005257693; XM_005257692; XM_006722094; XM_011525268;
E9Q5F4_MOUSE POGZ_MOUSE 23126 POGZ POGZ ZNF635; XM_011509331; NM_015100; XM_005244999; XR_
ZNF635m; NM_001194938; XM_005245006; XM_011509330;
ZNF280E NM_207171; XM_005245000; XM_005245001; XM
NM_001194937 WDR12_MOUSE 55759 Q53T99; WDR12 YTM1 XM_011511469; NM_018256 WDR12 RL12_MOUSE 6136 RL12 RPL12 L12 NM_000976 ARL2_MOUSE 402 ARL2 ARL2 ARFL2 NM_001667; NM_001199745 RPAB3_MOUSE 5437 RPAB3 POLR2H RPABC3; RPB8; XM_006713667; XM_006713666; XM_006713670; RPB17 NM_001278700; NM_001278714; XM_005247541; NM_001278698; XM_006713668; NM_001278699; NM_001278715; NM_006232 CALX_MOUSE 821 CALX CANX P90; IP90; CNX XM_011534664; XM_011534665; NM_001024649;
AP2A2_MOUSE 161 AP2A2 AP2A2 HIP9; HYPJ; XM_011519928; NM_012305; NM_001242837; XM
ADTAB; XR_930847; XM_011519929 CLAPA2; HIP-9 EFGM_MOUSE 85476 E5KND5; GFM1 EGF1; COXPD1; ; NM_024996; XM_006713795; XM_011513247 EFGM GFM; EFG; hEFG1; EFG1; EFGM CELF1_MOUSE 10658 CELF1 CELF1 CUGBP1; XM_011519847; XM_011519853; XM_011519856; NAB50; hNab50; XM_011519855; XM_011519859;NM_001172640;
CUG-BP; XM_011519849; XM_011519854; XM_011519851; CUGBP; XM_011519852; NM_001172639; XM_011519850; BRUNOL2; XM_011519857; NM_198700; XM_011519848; XM
NAPOR; EDEN- NM_001025596 BP ARAF_MOUSE 369 ARAF ARAF A-RAF; ARAF1; XM_011543909; XM_011543907; XM_011543906; ; PKS2; RAFA1 XM_006724529; NM_001256196; XM_011543908; NM_001256197; NM_001654 HNRPC_MOUSE SMCA5_MOUSE 8467 SMCA5 SMARCA5 ISWI; SNF2H; NM_003601; XM_011532361 hISWI; WCRF135; hSNF2H HNRH1_MOUSE 3187 HNRH1 HNRNPH1 HNRPH1; XM_006714862; XM_005265895; XM_006714863; hnRNPH; XM_011534541; XM_005265901; XM_005265896; HNRPH XM_011534542; XM_011534543; XM_011534544; NM_001257293; NM_005520; XM_011534547; XM
XM_011534545; XM_011534546 RBM4B_MOUSE 83759 RBM4B RBM4B ZCCHC21B; XR_247214; NM_001286135; XR_247213; XM_011
ZCRB3B; NM_031492 RBM4L; ZCCHC15; RBM30 MTMR5_MOUSE 6305 MTMR5 SBF1 CMT4B3; XM_005261931; XM_005261935; XM_011530709; MTMR5; XM_011530710; XM_011530707; NM_002972; XR_
DENND7A XM_011530708; XM_011530711 RL23_MOUSE 9349 RL23 RPL23 rpL17; L23 NM_000978 DDX3X_MOUSE 1654 DDX3X DDX3X DBX; DDX14; ; NM_024005; NM_001356; NR 126093; XM_01154
DDX3; CAP-Rf; NM_001193417; NM_001193416; NR 126094 HLP2 NMRL1_MOUSE 57407 NMRL1 NMRAL1 HSCARG; XM_006720905; NM_020677; XM_006720906; XM
SDR48A1 XM_011522566; XM_005255447; XM_006725238; NM_001305141; XM_005255446; XM_006725236; XM_011546747; XM_006725237; XM_011522567; XM_011546748; NM_001305142 TR150_MOUSE 9967 TR150 THRAP3 TRAP150 XM_005271371; XR_246308; NM_005119 NAT10_MOUSE 55226 NAT10 NAT10 NET43; ALP XM_011520197; NM_001144030; NM_024662 ODPB_MOUSE 5162 ODPB PDHB PHE1B; PDHE1-B; XM_011533828; NM_000925; NR_033384; NM_001
PDHBD DDX1_MOUSE 1653 DDX1 DDX1 DBP-RB; NM_004939 UKVH5d ECHA_MOUSE 3030 ECHA HADHA MTPA; LCHAD; NM_000182; ECHA; GBP; TP-ALPHA; HADH; LCEH PREB_MOUSE 10113 PREB PREB SEC12 XM_011532471; XM_011532472; XR_939649; XM_
XR_939648; NM_013388 LA_MOUSE 6741 LA SSB La; La/SSB; NM_003142; NM_001294145; LARP3 PD1P2_MOUSE 26073 PDIP2 POLDIP2 POLD4; p38; NM_001290145; NM_015584 PDIP38 AGAP3_MOUSE 116988 AGAP3 AGAP3 CRAG; cnt-g3; NM_001281300; XM_005249942; XM_005249943; AGAP-3; XM_011515780; NM_001042535; NM_031946 CENTG3; MRIP - 1 CO6A1_MOUSE 1291 CO6A1 COL6A1 OPLL NM_001848; CRNL1_MOUSE 51340 CRNL1 CRNKL1 HCRN; CLF; NM_001278627; NM_001278626; NM_001278628; CRN; MSTP021; NM_001278625; NM_016652 Clfl; SYF3 MATR3_MOUSE 9782 MATR3 MATR3 MPD2; ALS21; NM_001282278; NM_018834; NM_001194956; NM
VCPDM NM_001194954; NM_001194955 PRP17_MOUSE 51362 PRP17 CDC40 PRP17; PRPF17; NM_015891; XM_011535880 EHB3 RL7_MOUSE 6129 RL7 RPL7 L7; humL7-1 XM_006716463; NM_000971 NUCL_MOUSE 4691 NUCL NCL C23 NM_005381 RS9_MOUSE 6203 RS9 RPS9 S9 XM_011547987; XM_011548358; XM_011548624;
XR_431068; XR_953069; NM_001013; XM_005278
XM_006726201; XM_006726202; XM_011547988; XM_011548623; XR_254260; XR_254311; XR_431
XR_952765; XR_952994; XM_011547789; XM_011
XR_431067; XR_952920; XR_952995; XR_953155; XR_953156; XM_005277274; XM_006725965; XR_
XR_431069; XR_952922; XR_952996; XR_953068; XM_005278287; XM_011548167; XR_254517; XR_
XR_953070; XR_953157; XM_005277315; XM_011
XR_431058; XR_952764; XR_952919; XM_005277
XM_005277085; XM_011548166; XR_430207; XR_
HTRA2_MOUSE 27429 HTRA2 HTRA2 PARK13; OMI; ; NM_145074; XM_005264266; NM_013247 PRSS25 E9Q7G0_MOUSE LRC59_MOUSE 55379 LRC59 LRRC59 p34; PRO1855 NM_018509 THOC2_MOUSE 57187 THOC2 THOC2 THO2; CXorf3; XM_005262447; XM_011531369; XM_011531372; ; hTREX120; XM_011531368; XM_011531374; XR_938550; XR_
dJ506G2.1 NM_001081550; XM_011531373; XR_938551; XM_
XR_938553; NM_020449; XM_011531367; XM_011
XM_011531371 ERLN2_MOUSE 11160 ERLN2 ERLIN2 NET32; SPFH2; XM_005273392; XM_006716280; NM_001003790;
Erlin-2; SPG18; NM_001003791 C8orf2 GALK1_MOUSE 2584 GALK1 GALK1 GALK; HEL-S- ; NM_000154 19; GK1 SAFB1_MOUSE 6294 SAFB1 SAFB HAP; HET; XM_006722839; NR_037699; NM_001201340; NM_
SAF-B1; SAFB1 NM_001201338; NM_002967 RL28_MOUSE 6158 RL28 RPL28 L28 NM_001136135; NM_001136137; NM_001136136; NM_001136134; XM_005259132; NM_000991 MYO1C_MOUSE 4641 MYO1C MYO1C myr2; MMI-beta; NM_033375; NM_001080950; NM_001080779 MMIb; NMI SRS10_MOUSE 10772 SRS10 SRSF10 PPP1R149; NM_001191009; NM_001191006; NM_001191007; SFRS13A; NM_001300937; NM_054016; NR_034035; NM_001
TASR2; NM_006625; NM_001300936 SFRS13; TASR; TASR1; FUSIP1; FUSIP2; NSSR; SRp38; SRrp40 E9PYF4_MOUSE ACAD9_MOUSE 28976 ACAD9 ACAD9 NPD002 NR_033426; XR_427367; XM_011512742; ; NM_01
KIF2A_MOUSE 3796 B0AZS5; KIF2A KIF2; CDCBM3; NM_004520; NM_001243952; NM_001098511; NM
KIF2A HK2 IDH3A_MOUSE 3419 B4DJB4; IDH3A XM_005254334; NM_005530; XM_005254337; XM
IDH3A PWP2_MOUSE 5822 PWP2 PWP2 EHOC-17; XM_011529667; NM_005049 UTP1; PWP2H CPSF7_MOUSE 79869 CPSF7 CPSF7 CFIm59 XM_011545257; XM_011545263; XM_005274303; NM_001142565; XM_011545258; XM_011545262; XM_005274299; XM_011545260; NM_024811; XM
NM_001136040; XM_005274298; XM_011545259 Q6PGF5_MOUSE NUP93_MOUSE 9688 NUP93 NUP93 NIC96 NM_001242795; XM_005256263; NM_014669; NM
H14_MOUSE 3008 H14 HIST1H1E H1F4; NM_005321 dJ221C16.5; H1.4; H1E; H1s-4 FUND2_MOUSE 65991 FUND2 FUNDC2 HCBP6; DC44; NM_023934 PD03104; HCC3 APT_MOUSE 353 APT APRT APRTD; AMP NM_000485; ; NM_001030018 MCM5_MOUSE 4174 B1AHBO; MCM5 CDC46; P1- XM_006724242; NM_006739 MCM5 CDC46 CLPX_MOUSE 10845 CLPX CLPX XR_931743; XM_011521164; NM_006660 RBM8A_MOUSE 9939 RBM8A; RBM8A BOV-1C; BOV- ; NM_005105 A0A023T787 1B; DEL1q21.1; ZRNP1; TAR; BOV-1A; C1DELq21.1; RBM8B; MDS014; RBM8; Y14; ZNRP L2GL1_MOUSE 3996 L2GL1 LLGL1 HUGL-1; XM_011523851; XM_011523853; XM_011523854; HUGL1; HUGL; XM_011523856; XM_011523850; XM_011523855;
DLG4; LLGL XM_011523852; XM_011523849 SMC5_MOUSE 23137 SMC5 SMC5 SMC5L1 NM_015110; XM_005251837; XM_005251839; XM
NAA15_MOUSE 80155 NAA15 NAA15 TBDN100; XM_005263236; NM_057175 NATH; NAT1P; Ga19; NARG1; TBDN RS11_MOUSE 6205 RS11 RPS11 S11 NM_001015 ATAD3_MOUSE 83858; 55210 TIAR_MOUSE 7073 TIAR TIAL1 TIAR; TCBP XM_005270108; XR_428715; XM_005270109; ; XM
XR_945808; NM_003252; NM_001033925 RL9_MOUSE 6133 RL9 RPL9 L9; NPC-A-16 NM_000661; NM_001024921; XM_005262661 ACO13_MOUSE 55856 ACO13 ACOT13 HT012; PNAS- NM_001160094; NM_018473 27; THEM2 WDR82_MOUSE 80335 WDR82 WDR82 PRO2730; XM_011534136; XM_011534137; NM_025222 WDR82A; MSTP107; SWD2; MST107; PRO34047; TMEM113 PTRF_MOUSE 284119 PTRF PTRF cavin-1; CAVIN; ; NM_ 012232; XM_005257242 CAVIN1; CGL4; FKSG13 DDX5_MOUSE 1655 DDX5 DDX5 p68; HUMP68; XM_006721738; XM_011524456; XM_011524457;
HLR1; G17P1 XM_005257111 WDR5_MOUSE 11091 WDR5 WDR5 CFAP89; SWD3; NM_017588; NM_052821; XM_005272163 BIG-3 CDC73_MOUSE 79577 CDC73 CDC73 HRPT2; HYX; XM_006711537; ; NM_024529 C1orf28; FIHP; HRPT1; HPTJT RM03_MOUSE 11222 RM03 MRPL3 RPML3; MRL3; ; NM_007208 COXPD9 THOC6_MOUSE 79228 THOC6 THOC6 BBIS; fSAP35; NM_024339; NM_001142350 WDR58 RL13A_MOUSE 23521 RL13A RPL13A TSTAl; L13A NR_073024; NM_001270491; NM_012423 RL22_MOUSE 6146 RL22 RPL22 EAP; HBP15; NM_000983 L22; HBP15/L22 DAZP1_MOUSE 26528 DAZP1 DAZAP1 XM_005259535; XM_005259536; NM_170711; XM
XM_011527904; XM_011527908; XM_005259534; XM_011527909; NM_018959; XM_005259531; ; X
XM_011527910; XM_011527905 E41L3_MOUSE 23136 E41L3 EPB41L3 4.1B; DAL-1; XM_011525619; XM_011525620; XM_011525611; DAL1 XM_011525625; XM_011525626; XM_011525635; XM_011525609; XM_011525612; XM_011525613; XM_011525614; XM_011525615; XM_011525628; XM_011525631; NM_001281535; XM_011525607; XM_011525616; XM_011525621; XM_011525624; XM_011525630; NM_001281533; XM_011525610; XM_011525623; XM_011525627; NM_001281534; XM_011525606; XM_011525617; XM_011525618; XM_011525622; XM_011525629; XM_011525632; XM_011525637; XM_011525633; XM_011525636;
XM_011525608; XM_011525634 RBMX_MOUSE 27316 RBMX RBMX RBMXP1; NR_028477; NR_028476; NM_001164803; ; NM_00
HNRNPG; hnRNP-G; RBMXRT; HNRPG; RNMX IDHP_MOUSE 3418 IDHP IDH2 IDP; IDPM; ; NM_001289910; NM_002168; NM_001290114 mNADP-IDH; IDH; IDHM; D2HGA2; ICD-M DDX27_MOUSE 55661 DDX27 DDX27 HSPC259; NM_017895; XM_011528888 Drs1p; dJ686N3.1; PP3241; DRS1; RHLP NTKL_MOUSE 57410 NTKL SCYL1 GKLP; TAPK; NM_020680; XM_005274120; XM_005274118; NM
TRAP; HT019; XM_005274121 NKTL; NTKL; P105; TEIF RL22L_MOUSE 200916 RL22L RPL22L1 NM_001099645; XM_005247205 RBM10_MOUSE 8241 RBM10 RBM10 GPATC9; ; NM_152856; XM_005272678; XM_005272679; N
GPATCH9; NM_005676; NM_001204466; XM_011543989; NM
DX58237E; XM_006724563; XM_005272677 TARPS; ZRANB5; S1-1 TBL3_MOUSE 10607 TBL3 TBL3 UTP13; SAZD NM_006453 Q99N15_MOUSE RL3_MOUSE 6122 RL3 RPL3 ASC-1; TARBP- NM_000967; NM_001033853 B; L3 HNRDL_MOUSE 9987 HNRDL HNRNPDL LGMD1G; NM_031372; ; NM_005463; NM_001207000; NR_0
HNRNP; HNRPDL; JKTBP2; JKTBP; 1aAUF1 B1B0C7_MOUSE TIM44_MOUSE 10469 TIM44 TIMM44 TIM44 NM_006351 TOP2A_MOUSE 7153 TOP2A TOP2A TOP2; TP2A XM_005257632; XM_011525165; NM_001067; FBLN2_MOUSE 2199 FBLN2 FBLN2 XM_006713026; NM_001004019; NM_001165035;
ILF2_MOUSE 3608 ILF2 ILF2 NF45; PRO3063 NM_001267809; NM_004515 U2AF2_MOUSE 11338 U2AF2 U2AF2 U2AF65 XM_006722994; NM_001012478; ;NM_007279; X
CDC5L_MOUSE 988 CDC5L CDC5L PCDC5RP; XM_006715289; NM_001253; XR_926346 CDC5-LIKE; dJ319D22.1; CEF1; CDC5 SND1_MOUSE 27044 SND1 SND1 TDRD11; p100 NM_014390; XM_011516051 ETFB_MOUSE 2109 ETFB ETFB FP585; MADD NM_001014763; ;NM_001985 SMC2_MOUSE 10592 B7Z117; SMC2 SMC-2; CAP-E; XM_011518150; XM_011518149; XM_011518151; A8K984; SMC2L1; CAPE XM_011518153; NM_006444; XM_011518148; NM
B3KM1B1; XM_006716933; XM_011518152; NM_001265602; SMC2; XM_011518154; NM_001042551 A0A024R158 DDX54_MOUSE 79039 DDX54 DDX54 DP97 NM_001111322; NM_024072 RAI14_MOUSE 26064 RAI14 RAI14 NORPEG; XM_011514022; XM_011514024; XM_011514016; RAI13 XM_011514019; NM_001145520; XM_011514025; NM_001145521; NM_001145525; NM_001145522; XM_006714469; XM_011514018; XM_011514021; XM_011514017; NM_001145523; NM_015577; XM
XM_011514023 PCNA_MOUSE 5111 PCNA PCNA ATLD2 NM_002592; NM_182649 CNOT1_MOUSE 23019 CNOT1 CNOT1 NOT1; AD-005; NM_206999; NM_001265612; NR 049763; NM_01
CDC39; NOT1H CPSF3_MOUSE 51692 CPSF3 CPSF3 CPSF-73; XM_005246167; XM_011510362; NM_016207; XM
CPSF73 RS2_MOUSE 6187 RS2 RPS2 LLREP3; S2 NM_002952 PPIL4_MOUSE 85313 PP1L4 PP1L4 HDCME13P NM_139126 FXR1_MOUSE 8087 FXR1 FXR1 FXR1P XM_005247816; NM_001013438; XM_005247814; XM_011513216; XM_005247815; XM_006713775; XM_011513215; XM_011513217; NM_005087; NM
XM_005247813 COR1C_MOUSE 23603 A0A024RBI5; CORO1C HCRNN4 XM_011538124; NM_014325; XM_011538125; NM
COR1C XR_944514; NM_001276471 DNLI1_MOUSE 3978 DNLI1; LIG1 NR_110296; NM_001289064; XM_006723215; XR_
B4DM52; NM_000234; NM_001289063; XR 243932; ; XM_0
F5GZ28 XM_006723216 RM22_MOUSE 29093 RM22 MRPL22 MRP-L25; NM_014180; NM_001014990 RPML25; HSPC158; L22mt; MRP- L22 RBM5_MOUSE 10181 RBM5 RBM5 RMB5; G15; XM_006712917; ;XM_011533261; XM_011533262; H37; LUCA15 NR_036627; XM_006712919; XR_427245 U520_MOUSE 23020 U520 SNRNP200 ASCC3L1; ; NM_014014 BRR2; RP33; U5-200KD; HELIC2 MCM6_MOUSE 4175 MCM6 MCM6 MCG40308; ; NM_005915 Mis5; P105MCM CPSF2_MOUSE 53981 CPSF2 CPSF2 CPSF100 XM_005267767; NM_017437 FXR2_MOUSE 9513 FXR2 FXR2 FMR1L2; XR_243572; ; NM_004860 FXR2P CPSF5_MOUSE 11051 CPSF5 NUDT21 CFIM25; CPSF5 NM_007006 RL14_MOUSE 9045 RL14 RPL14 CAG-ISL-7; NM_001034996; NM_003973 L14; CTG-B33; RL14; hRL14 TRA2B_MOUSE 6434 TRA2B TRA2B PPP1R156; XM_011513072; XM_006713724; NM_004593; ; N
SFRS10; XM_005247703 TRAN2B; SRFS10; TRA2- BETA; Htra2- beta VWA8_MOUSE 23078 VWA8 VWA8 KIAA0564 NM_001009814; XM_011535006; NM_015058; XM
XM_011535007 NAA38_MOUSE 51691 LSM8 LSM8 NAA38 NM_016200 HNRPQ_MOUSE TRAP1_MOUSE 10131 TRAP1 TRAP1 TRAP-1; NM_001272049; ; XM_011522345; NM_016292 HSP90L; HSP 75; HSP75 STAG1_MOUSE 10274 STAG1 STAG1 SCC3A; SA1 XM_011512332; XM_011512331; NM_005862; XM
XM_011512329; XM_011512330 DDX17_MOUSE 10521 DDX17 DDX17 RH70; P72 NM_001098505; NM_030881; NM_001098504; ; N
ERD21_MOUSE 10945 ERD21 KDELR1 HDEL; PM23; XM_011526358; NM_006801 ERD2; ERD2.1 RL18A_MOUSE 6142 RL18A RPL18A L18A NM_000980 UBXN1_MOUSE 51035 UBXN1 UBXN1 SAKS1; XM_011545090; NM_001286077; XM_005274033;
UBXD10; 2B28 NM_001286078 EPDR1_MOUSE 54749 EPDR1 EPDR1 MERP-1; NM_001242946; NM_001242948; NM_017549 MERP1; EPDR; UCC1 KAP0_MOUSE 5573 KAP0 PRKAR1A ACRDYS1; XM_011524985; ;NM_212471; NM_001278433; N
CAR; CNC; XM_011524984; NM_001276289; NM_212472; XM
PPNAD1; NM_002734 ADOHR; CNC1; PRKAR1; TSE1; PKR1 CBR4_MOUSE 84869 CBR4 CBR4 SDR45C1 XR_938789; XM_005263315; XM_006714392; XM_
XM_006714391; NM_032783; XM_011532385; XM
RL13_MOUSE 6137 RL13; RPL13 D16S444E; L13; NM_001243130; NM_033251; NM_000977; NM_00
A8K4C8 D16S44E; BBC1 SFPQ_MOUSE 6421 SFPQ SFPQ PPP1R140; PSF; XM_005271113; XM_005271115; XM_011541950; POMP100 XM_005271112; NM_005066 PDS5B_MOUSE 23047 PDS5B PDS5B AS3; CG008; XM_011535002; XM_005266298; XM_011535001;
APRIN NM_015928; XM_011534999; XM_011535000; KPCI_MOUSE 5584 KPCI PRKCI PKCI; NM_002740 DXS1179E; nPKC-iota THOC4_MOUSE 10189 THOC4 ALYREF ALY/REF; NM_005782; XR_933919 THOC4; BEF; ALY; REF SF3B3_MOUSE 23450 SF3B3 SF3B3 SAP130; RSE1; NM_012426 STAF130; SF3b130 E9QN31_MOUSE AKT1_MOUSE 207 AKT1 AKT1 AKT; PKB- NM_005163; XM_011536544; NM_001014431; XM
ALPHA; RAC; XM_011536543; NM_001014432; PRKBA; RAC- ALPHA; CWS6; PKB NOP56_MOUSE 10528 NOP56 NOP56 SCA36; NOL5A NR_027700; ; NM_006392 SMU1_MOUSE 55234 SMU1 SMU1 SMU-1; BWD; XM_005251503; NM_018225 fSAP57 MTA1_MOUSE 9112 MTA1 MTA1 XM_011537305; XM_011537309; XM_011537301; XM_011537304; XM_011537311; XM_011537315; ; XM_011537306; XM_011537308; XM_011537314; XM_011537310; XM_011537302; XM_011537303; XM_011537307; NM_004689; NM_001203258; XM
XM_011537313 BUB3_MOUSE 9184 BUB3 BUB3 BUB3L; hBUB3 NM_004725; ; NM_001007793 RPF2_MOUSE 84154 RPF2 RPF2 bA397G5.4; NM_001289111; NM_032194 BXDC1 ATLA3_MOUSE 25923 ATLA3 ATL3 HSN1F ; NM_015459; XM_006718493; XM_006718494; X
NM_001290048 NSA2_MOUSE 10412 NSA2 NSA2 CDK105; XM_011543098; NM_001271665; XR_948227; NM_
TINP1; HUSSY- NR_073403 29; HUSSY29; HCLG1; HCL-G1 ACON_MOUSE 50 ACON ACO2 ACONM; ICRD ; NM_001098 DNJC3_MOUSE 5611 DNJC3 DNAJC3 PRKRI; HP58; XM_011521105; NM_006260; XM_011521104; P58; ERdj6; P58IPK; ACPHD RPB2_MOUSE 5431 RPB2; POLR2B POL2RB; NM_001303269; NM_000938; NM_001303268 B4DH29; hRPB140; RPB2 C9J4M6; B4DHJ3; C9J2Y9 RL11_MOUSE 6135 RL11 RPL11 L11; DBA7; NM_000975; NM_001199802; GIG34 PRP6_MOUSE 24148 PRP6 PRPF6 TOM; ANT-1; XM_006723769; ; NM_012469 Prp6; hPrp6; C20orf14; RP60; ANT1; SNRNP102; U5- 102K LSM2_MOUSE 57819 LSM2 LSM2 YBL026W; NM_021177 C6orf28; G7B; snRNP RS28_MOUSE K6PF_MOUSE 5213 A0A024ROY5; PFKM PFKA; PFK1; NM_001166688; NM_001166687; NM_001166686; PFKAM PFK-1; PFKX; XM_005268976; XM_005268978; ; XM_005268977; PPP1R122; ATP- XM_011538487; XM_005268974; XM_005268975; PFK; GSD7 XM_005268979; XM_011538488; NM_000289 NU155_MOUSE 9631 NU155 NUP155 ATFB15; N155 XM_011514166; ; XM_011514164; NM_001278312; XM_011514165; NM_004298; NM_153485 PTH2_MOUSE 51651 PTH2 PTRH2 2; CFAP37; XM_011524886; NM_001015509; XM_005257447; PTH2; CGI-147; XM_011524887; NM_016077 IMNEPD; PTH; BIT1; PTH 2 FLOT1_MOUSE 10211 FLOT1 FLOT1 XM_005275502; XM_005275503; XM_005272759; XM_005272760; XM_006725672; XM_006726072; XM_005248780; XM_005274909; XM_005275335; XM_005248781; XM_005274910; XM_006714947; XM_006725971; XM_005275336; XM_006725465;
NIPS2_MOUSE 2631 NIPS2 GBAS NIPSNAP2 NM_001483; NM_001202469 PUF60_MOUSE 22827 PUF60 PUF60 SIAHBP1 ; NM_001271096; NM_001271097; NM_001136033;
RoBPI; FIR; NM_001271100; NM_078480; XM_011516929; NM
VRJS XM_011516930; NM_001271099 SMAL1_MOUSE 50485 SMAL1 SMARCAL1 HHARP; HARP ; XM_006712557; NM_014140; NM_001127207; X
XM_005246631 MPPB_MOUSE 9512 MPPB PMPCB P-52; MPPB; XM_005250717; XM_006716181; XR 242267; NM_
Beta-MPP; MPP11; MPPP52 RBM39_MOUSE 9584 RBM39 RBM39 CAPERalpha; XM_011529110; NM_184237; XM_006723891; XM
FSAP59; NM_001242599; NM_184234; ; NM_001242600; NR
CAPER; HCC1; XM_006723890; XM_011529111; NM_004902; NR_
RNPC2 NM_184241; NR_040724; NM_184244 SNX3_MOUSE 8724 SNX3 SNX3 Grd19; NM_001300929; NM_001300928; ; NM_003795; N
MCOPS8; SDP3 NM_152827 RBBP4_MOUSE 5928 RBBP4 RBBP4 lin-53; RBAP48; NM_005610; NM_001135255; NM_001135256 NURF55 AL4A1_MOUSE 8659 AL4A1 ALDH4A1 P5CD; P5CDh; XR_946786; XM_011542353; NM_003748; NM_17
ALDH4 XM_011542352; NM_001161504; SMC1A_MOUSE 8243 G8JLG1; SMC1A SMCB; SB1.8; ; NM_006306; NM_001281463 SMC1A SMC1alpha; DXS423E; CDLS2; SMC1; SMC1L1 ILF3_MOUSE 3609 ILF3 ILF3 MMP4; ; XM_005259895; XM_011527984; XM_006722742; DRBP76; MPP4; XM_011527987; XM_011527986; NM_004516; NM
NFAR2; NF-AT- NM_017620; XM_011527985; NM_001137673; NM
90; NF110b; MPHOSPH4; DRBF; NF90a; NF90b; NFAR; NFAR-1; TCP110; NF90; CBTF; NF110; TCP80 SERPH_MOUSE 871 SERPH SERPINH1 PPROM; RA- ; NM_001235; XM_006718729; XM_011545327; N
A47; CBP2; XM_011545326 PIG14; CBP1; gp46; AsTP3; HSP47; OI10; SERPINH2 AP2A1_MOUSE 160 AP2A1 AP2A1 ADTAA; AP2- NM_014203; XM_011526556; XM_011526557; NM
ALPHA; CLAPA1 CCAR2_MOUSE 57805 CCAR2 CCAR2 p30 DBC; XM_011544604; NM_199205; NR 033902; XM_011
DBC1; NM_021174 KIAA1967; NET35; p30DBC; DBC-1 SUCB1_MOUSE 8803 SUCB1; SUCLA2 SCS-betaA; XM_011535293; NM_003850; ; XM_011535292; X
E5KS60 MTDPS5; A- BETA RM14_MOUSE 64928 RM14 MRPL14 L32mt; XM_005249301; NM_032111; XM_011514814; XM
MRPL32; MRP- XM_005249299 L32; L14mt; MRP-L14; RMPL32; RPML32 RPB1_MOUSE 5430 RPB1 POLR2A RPB1; RPO2; ; NM_000937 RpIILS; POLR2; RPBhl; POLRA; hRPB220; hsRPB1; RPOL2 AGK_MOUSE 55750 AGK AGK MULK; XM_011516397; XM_005250023; NM_018238; MTDPS10; CATC5; CTRCT38 CSDE1_MOUSE 7812 CSDE1 CSDE1 UNR; D1S155E NM_001007553; NM_001242892; NM_007158; NM
NM_001130523; NM_001242891 PDLI7_MOUSE 9260 PDLI7 PDLIM7 LMP3; LMP1 XM_011534699; NR_103804; XM_011534697; XM_
XM_011534698; XM_011534696; NM_213636; NM
_ NM_203352; NM_203353 RB6I2_MOUSE 23085 RB6I2 ERC1 ELKS; ERC-1; XM_011520940; NM_178039; NR_027948; NM_001
RAB6IP2; Cast2 XM_011520938; XM_011520942; XR_931510; XM_
XR_931509; XM_011520936; NR_027949; XM_011
NM_178040; XM_011520939; XM_011520941; XM
XR_931508; NR_027946 CHD4_MOUSE 1108 CHD4 CHD4 Mi2-BETA; Mi- XM_006718958; NM_001273; XM_006718962; XM
2b; CHD-4 XM_006718959; XM_005253668; XM_006718961;
PRDX3_MOUSE 10935 PRDX3 PRDX3 AOP-1; SP-22; NR_126105; NM_014098; NM_006793; NR_126103 AOP1; MER5; NM_001302272; NR_126102; NR_126106 prx-III; HBC189; PRO1748 AP2M1_MOUSE 1173 AP2M1 AP2M1 AP50; mu2; NM_004068; NM_001025205 CLAPM1 LIMA1_MOUSE 51474 LIMA1 LIMA1 SREBP3; EPLIN NM_001243775; XM_011538455; NM_001113547; ; NM_001113546; NM_016357 GOLI4_MOUSE 27333 GOLI4 GOLIM4 GPP130; XM_005247365; XM_005247364; NM_014498; XM
GIMPC; P138; GOLPH4 HCFC1_MOUSE 3054 HCFC1 HCFC1 HCF1;HFC1; XM_006724816; XM_011531147; ; XM_011531144; PPP1R89; XM_011531146; XM_011531150; XM_011531148;
VCAF; MRX3; XM_006724815; XM_011531149; XM_011531145 CFF;HCF; HCF-1 E41L1_MOUSE 2036 E41L1 EPB41L1 MRD11; 4.1N XM_011528669; XM_011528677; XM_011528681; XM_011528684; XM_011528670; XM_011528674; XM_011528686; XM_011528666; ; NM_001258331; XM_011528675; XM_011528676; XM_011528679; XM_011528680; NM_001258329; NM_012156; XM
XM_011528668; XM_011528671; XM_011528672; XM_011528685; NM_001258330; XM_011528664; XM_011528665; XM_011528682; XM_011528683;
XM_011528673; XM_011528678 TMM65_MOUSE 157378 TMM65 TMEM65 XM_011516847; NM_194291 SMD1_MOUSE 6632 SMD1 SNRPD1 HsT2456; NM_006938; NM_001291916 SMD1; SNRPD; Sm-D1 RT05_MOUSE 64969 RT05 MRPS5 MRP-S5; S5mt XM_006712694; XR_922989; NM_031902 DHX15_MOUSE 1665 DHX15 DHX15 PRPF43; HRH2; XR_925314; NM_001358 PRP43; DBP1; DDX15; PrPp43p MK03_MOUSE 5595 MK03; MAPK3 P44ERK1; NM_001040056; XR 243293; NM_001109891; NM_
L7RXH5 P44MAPK; ERK-1; PRKM3; ERT2; HUMKER1A; p44-ERK1; p44- MAPK; ERK1; HS44KDAP CPSF1_MOUSE 29894 CPSF1 CPSF1 CPSF160; XM_006716548; XM_011516999; NM_013291; XM
P/cl.18; XM_011516998.; XM_011516997; . XM_006716549 HSU37012 SYMC_MOUSE 4141 SYMC MARS MRS; SPG70; XM_006719398; NM_004990; XM_011538353; MTRNS; METRS LPPRC_MOUSE 10128 LPPRC LRPPRC CLONE-23970; XM_011532474; ; XM_006711915; XM_006711916; LRP130; LSFC; XM_011532473; NM_133259 GP130 RL27A_MOUSE 6157 RL27A RPL27A L27A NM_032650; NM_000990 SRSF1_MOUSE 6426 SRSF1 SRSF1 SFRS1; SRp30a; NR_034041; XM_006722012; XR_429911; XR_429
ASF; SF2; NM_001078166; NM_006924 SF2p33 BOP1_MOUSE 23246 BOP1 BOP1 ; NM_015201 IMDH2_MOUSE 3615 IMDH2 IMPDH2 IMPD2; IMPDH-II XM_006713128; ; NM_000884 H31_MOUSE 8353; 8358; 8357; 8968; 8350; 8351; 8355; 8354; 8356; 8352 AACS_MOUSE 65985 AACS AACS ACSF1; SUR-5 XM_005253611; XR_242960; NM_023928; XM_005
XM_005253610; XM_011538692 PDS5A_MOUSE 23244 PDS5A PDS5A PIG54; SCC112; NM_001100400; XM_011513673; XM_011513674;
SCC-112 NM_001100399; XM_011513672 PP1G_MOUSE 5501 PP1G; PPP1CC PP-1G; PPP1G; ; XM_011538505; XM_011538504; NM_001244974; A0A024RBP2 PP1C PCH2_MOUSE 9319 PCH2 TRIP13 16E1BP NM_001166260; NM_004237; XM_011514163 DX39A_MOUSE 10212 DX39A DDX39A URH49; BAT1; NM_001204057; NR 038336; NM_005804; NM_138
DDXL; BAT1L; NR_046366; XM_006722606; XM_011527620; XM_
DDX39 AKAP8_MOUSE 10270 AKAP8 AKAP8 AKAP 95; XM_011527624; XM_011527625; XR 244062; NM_
AKAP-8; AKAP-95; AKAP95 LAR4B_MOUSE 23185 LAR4B LARP4B LARP5; XM_005252431; XM_011519434; NM_015155; XM
KIAA0217 XM_011519436; XM_005252432; XM_005252435 ARI1A_MOUSE 8289 ARI1A ARID1A B120; BAF250a; NM_018450; ;NM_139135; NM_006015 C1orf4; ELD; OSA1; P270; SMARCF1; hELD; hOSA1; BAF250; BM029; 1VIRD14 RUXE_MOUSE 6635 RUXE SNRPE SME; Sm-E; B- NM_001304464; NR_130746; NM_003094 raf; HYPT11 PNPT1_MOUSE 87178 PNPT1 PNPT1 OLD35; old-35; XM_005264629; NM_033109; XM_011533142; DFNB70; PNPASE; COXPD13 BAZ1A_MOUSE 11177 BAZ1A BAZ1A WALp1; XM_011536376; XR_943381; NM_013448; XM_011
WCRF180; XM_011536375; NM_182648 hACF1; ACF1 ACSF3_MOUSE 197322 ACSF3 ACSF3 XM_011522943; XR_933238; XR_933240; NM_001
XR_933239; XM_011522944; NR_104293; NM_001
XM_011522942; XR_933241; ; NM_174917; XM_0
NM_001243279; NR_045667; NR_045666 RS23_MOUSE 6228 RS23 RPS23 S23 NM_001025 CHERP_MOUSE 10523 CHERP CHERP SCAF6; SRA1; NM_006387 DAN16 RL38_MOUSE 6169 RL38 RPL38 L38 NM_000999; NM_001035258 NOC3L_MOUSE 64318 NOC3L NOC3L C10orf117; XM_005270048; NM_022451; XM_011540067; XR_
FAD24; AD24 TBB6_MOUSE 84617 TBB6 TUBB6 HsT1601; NM_ 001303530; NM_001303524; NM_ 001303528; TUBB-5 NM_ 001303525; NM_001303526; NM_ 001303529; NM_ 001303527; NM_032525 PDIP3_MOUSE 84271 PDIP3 POLDIP3 SKAR; PDIP46 XM_ 011530457; NM_032311; NM_178136; NM_00
XR_937942; NR 103820
indicates data missing or illegible when filed
Other Embodiments
[0345] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.