TARGETED MRNA FOR IN VIVO APPLICATION

Abstract

A medicament can include a product for in vivo expression of a protein in a living being. The product can include a first entity, which includes a nucleic acid encoding an intracellularly expressible protein, and an associated second entity configured for specific binding to a cellular structure of the living being. One example of the product is a nucleotide-modified mRNA, in which includes a first ribonucleotide sequence encoding the intracellularly expressible protein, and a second ribonucleotide sequence encoding an aptamer configured for specific binding to the cellular structure of the living being.

Claims

1. A product for an in vivo expression of a protein in a living being, comprising a first entity comprising a first nucleic acid encoding an intracellularly expressible protein, and, associated therewith, a second entity configured for a specific binding to a cellular structure of said living being.

2. The product of claim 1, wherein said first nucleic acid is an mRNA.

3. The product of claim 2, wherein said mRNA is a nucleotide-modified mRNA.

4. The product of claim 1, wherein said intracellularly expressible protein is a protein capable of effecting at least one phenomenon in said living being in a targeted manner, said phenomenon is selected from the group consisting of: immune response, cytokine expression, cell death induction, cell death inhibition, transcription factor expression, genetic modification, epigenetic modification.

5. The product of claim 4, wherein said intracellularly expressible protein is an antigen-specific receptor.

6. The product of claim 5, wherein said antigen-specific receptor is selected from the group consisting of: T-cell receptor, tumor antigen-specific T-cell receptor, virus antigen specific T-cell receptor, bacterium antigen-specific T-cell receptor, fungus antigen-specific T-cell receptor, protozoan antigen-specific T-cell receptor; chimeric antigen receptor (CAR), CAR targeting a tumor-associated antigen selected from the group consisting of: HER2/neu, ErbB, EGFR, EGFRvIII, FGFR3, FGFR4, LI-13R, II-13R?2, II-11R?, VEGFR2, ALK, GD2, GD3, mesothelin, Survivin, PMSA, PSCA, CEA, MUC1, GPC3, GPCS, CSPG4, ROR1, FR-?, FR-?, Igk, Lewis.sup.Y, Glypican3, EphA2, CAIX, AFP, FAP, c-MET, HLA-DR, CA-125, CS1, BCMA, NKG2D ligands (MICA/MICB), CLL1, TALLA, LGR5, PD-L1, PD-L2, CD10, CD11b, CD14, CD15, CD19, CD20, CD22, CD29, CD30, CD32, CD33, CD34, CD38, CD44, CD44v6, CD44v7/8, CD45, CD47, CD56, CD64, CD66, CD79a, CD79b, CD95, CD99, CD112, CD117, CD123, CD133, CD135, CD138, CD146, CD152, CD157, CD171CD184, CD200, CD221, CD243, CD262, CD276, CD300f, CD305, CD326, CD338, CD366; CAR targeting a bacterium specific antigen, CAR targeting a fungus specific antigen, CAR targeting a virus specific antigen, CAR targeting a protozoan specific antigen.

7. The product of claim 4, wherein said intracellularly expressible protein is a cell death inducing or inhibiting protein selected from the group consisting of: caspase, second mitochondria-derived activator of caspases (SMAC), BCL-2 family protein, inhibitor of apoptosis protein (IAP), tumor necrosis factor receptor superfamily (TNFRSF) protein, death-inducing signaling complex, p53, interferons, or an immune modulatory protein selected from the group consisting of: cytokines, chemokines, tumor necrosis factor (TNF) family proteins and colony stimulating factors, or a gene expression or protein modulating cellular signaling molecule selected from a group consisting of: kinases, phosphatases, acetyltransferases, deacetylases, methyltransferases, SUMOylating enzymes, and deSUMOylating enzymes, or a gene sequence modulating molecule selected from the group consisting of: zinc-finger nucleases, meganucleases, TAL effector nucleases, CRISPR/Cas9 related nucleases, nickases, and FokI based dCas9 nucleases.

8. The product of claim 1, wherein said second entity is configured for a specific binding to a cell surface expressed protein characterizing a cell of the human hematopoiesis or a cell of the human immune system or both.

9. The product of claim 8, wherein said cell surface expressed protein is a cluster of differentiation (CD) protein or equivalent.

10. The product of claim 9, wherein said CD protein is selected from the group consisting of: CD4, CD8, CD3, CD10, CD16, CD19, CD20, CD22, CD25, CD28, CD30, CD33, CD34, CD38, CD44, CD44v6, CD44v7/8, CD45, CD45RA, CD45RO, CD56, CD62L, CD95, CD123, CD127, CD133, CD135, CD137, CD138, CD152, CD171, and wherein said equivalent is selected from the group consisting of: CCR4, CCR5, CCR6, CCR7, CXCR3, CXCR4, CXCR5, TCR??, TCR??, CTLA-4, PD1, TIM3, NKG2D, HER2/neu, ErbB, EGFR, EGFRvIII, FGFR3, FGFR4, LI-13R, II-13R?2, II-11R?, VEGFR2, ALK, GD2, GD3, mesothelin, survivin, PMSA, PSCA, CEA, MUC1, GPC3, GPC5, CSPG4, ROR1, FR-?, FR-?, Igk, Lewis.sup.Y, glypican3, EphA2, CAIX, CSPG4, AFP, FAP, c-MET, HLA-DR, CA-125, CS1, BCMA, NKG2D ligands (MICA/MICB), PD1, PD-L1, PD-L2, CLL1, TALLA, LGR5.

11. The product of claim 1, wherein said second entity is an aptamer.

12. The product of claim 11, wherein said aptamer is an RNA aptamer.

13. The product of claim 11, wherein said aptamer is connected to said first nucleic acid by the concatenation of nucleotides resulting in a single-stranded nucleic acid molecule.

14. The product of claim 13, wherein the single stranded nucleic acid molecule is a single-stranded mRNA molecule.

15. The product of claim 11, wherein said aptamer is connected to said nucleic acid by the hybridization of complementary bases resulting in a double-stranded nucleic acid molecule.

16. The product of claim 15, wherein said double stranded nucleic acid molecule is a double-stranded mRNA molecule.

17. The product of claim 1, further comprising nanoparticles complexed with said first or said second entity or both.

18. The product of claim 1, further comprising liposomes packaging said first or said second entity or both.

19. A medicament comprising the product of claim 1 and a pharmaceutically acceptable carrier.

20. The method for the treatment a disease comprising the administration of the product of claim 1 or the medicament of claim 19 to a patient in need.

21. The method of claim 20, wherein said disease is selected from the group consisting of: a tumor and/or oncologic disease, a hematologic disease, an infectious disease, a rheumatologic disease, a genetic/hereditary disease, an autoimmune disease, an allergic disease.

22. A nucleotide-modified mRNA for an in vivo expression of a protein in a living being comprising a first ribonucleotide sequence encoding an intracellularly expressible protein, and a second ribonucleotide sequence encoding an aptamer configured for a specific binding to a cellular structure of said living being.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0087] FIG. 1 illustrates therapeutic approaches of the state of the art aimed at delivering functionally active protein or its precursors, exemplified by cystic fibrosis transmembrane conductance regulator (CFTR), into patient's cells; Supplementation of a cell with (A) functional CFTR protein, (B) CFTR cDNA, or (C) mRNA transcripts;

[0088] FIG. 2 shows the result of an analysis by means of cytometry of blood cells withdrawn from mice after the administration in vivo of nucleotide-modified mRNA encoding red fluorescent reporter protein (RFP) assembled to nanoparticles into mice for the expression of RFP;

[0089] FIG. 3 illustrates the in vivo immune reaction represented by IFN-alpha as measured by ELISA, initiated in mice after the administration in vivo of nucleotide-modified mRNA encoding RFP assembled to nanoparticles;

[0090] FIG. 4 shows the result of an analysis by means of cytometry of immune (CD4+) cells withdrawn from NOD.Cg-Prkdc.sup.scidII2rg.sup.tm1Wjl/SzJ (NSG) mice previously transplanted with human peripheral blood mononuclear cells (PBMCs), after the i.v. administration into mice of aptamer-targeted nucleotide-modified mRNA (atmRNA) encoding RFP and an anti-CD4 aptamer assembled to nanoparticles into mice for the expression of RFP;

[0091] FIG. 5 illustrates the structure of the an atmRNA consiting of an aptamer (ar) targeting an effector antigen (ea) and a transgen (tg) (e.g. a chimeric antigen receptor) that is encoded by modified mRNA (mr).

[0092] FIG. 6 demonstrates in vitro anti-CD19-CAR expression by flow cytometry on human CD4 and CD8 positive T cells as well as CD14 positive monocytes after electroporation peripheral blood mononuclear cells (PBMCs) with anti-CD19-CAR encoding mRNA or incubation of PBMCs with CD4-targeted anti-CD19-CAR encoding atmRNA alone or assembled to nanoparticles.

[0093] FIG. 7 shows in vitro lysis of CD19 positive leukemic blasts (cell line Nalm6) by anti-CD19-CAR expressing T cells at different effector to target ratios. Expression was achieved by either electroporation or pre-incubation with CD4-targeted anti-CD19 CAR encoding atmRNA alone or assembled to nanoparticles as demonstrated in FIG. 6.

[0094] FIG. 8 shows the result on an analysis by means of cytometry of immune (CD4+) cells withdrawn from mice after the administration in vivo of atmRNA encoding anti-CD19 CAR and an anti-CD4 aptamer assembled to nanoparticles into mice for the expression of anti-CD19 CAR.

[0095] FIG. 9 demonstrates the result of an analysis by flow cytometry of human CD4 and CD8 positive T cells withdrawn from mice after transplantation of pre-activated human T cells and administration in vivo of CD4-targeted atmRNA encoding anti-CD19-CAR assembled to nanoparticles into NSG mice for the expression of anti-CD19-CAR.

[0096] FIG. 10 shows the result of an analysis of leukemia (cell line Nalm6) infiltration of bone marrow, analyzed by flow cytometry, in NSG mice after treatment with pre-activated human T cells with or without in vivo application of CD4-targeted atmRNA encoding anti-CD19-CAR assembled to nanoparticles.

[0097] FIG. 11 illustrates the modular design of the product according to the invention.

[0098] FIG. 12 illustrates different strategy how immune receptors, expressed by atmRNA, can modulate effector as well as target cell function.

EXAMPLES

1. Methods of the Prior Art

[0099] FIG. 1 illustrates methods of the art for restoring functional protein expression in the setting of genetic disease. In this example, a genetic mutation in the cystic fibrosis transmembrane conductance regulator gene, CFTR, leads to faulty expression of the CFTR protein, a chloride ion channel anchored in the plasma membrane. By supplementing the cell with functional CFTR protein (A), CFTR cDNA (B), or mRNA transcripts (C), there is potential to overcome the genetic defects underlying this disease.

[0100] In the protein supplementation therapy shown in (A) a correct version of CFTR is transfected or transduced into the respective target cells. The protein delivery is often ineffective and it is difficult to include all natural post-protein modifications. In the transcript supplementation therapy shown in (B) a correct version of CFTR-mRNA is transfected into the respective target cells. Note the mRNA is actively producing CFTR already in the cytoplasm, thereby circumventing the nuclear membrane. In the gene supplementation therapy shown in (C) a correct version of the CFTR gene is transfected or transduced into the respective target cells. Note that the DNA has to enter the nucleus to be transcribed, which is a major barrier in gene therapy. Furthermore, gene delivery using plasmid DNA is commonly limited by CpG motifs that induce strong immune responses through innate immune receptors such as Toll-like receptor 9 (TLR9) and poor transfection efficiency in non- or slowly-dividing mammalian cells. Additionally, the use of viral vectors for gene therapy approaches has been threatened by the risk of insertional mutagenesis following random integration events that may occur within an oncogene or tumor suppressor. The development of immune responses against the viral capsid may also occur, which can prevent the possibility of vector re-administration.

2. Design of an Aptamer Targeted mRNA (atmRNA)

[0101] The inventors have developed a nucleotide-modified mRNA that can be delivered intravenously (i.v.) in mice to reprogram T cells, thus targeting a specific antigen. The antigen may be located on any cell of the human body such as tumor cells, on viruses, bacteria or funghi.

[0102] The disclosed mRNA consists of a part that encodes for a chimeric antigen receptor (CAR) and it consistsdownstream of the CAR encoding partof a non-protein coding aptamer sequence. The aptamer sequence is able to target e.g. CD4+ T cells.

[0103] The DNA sequence encoding the anti-CD4 aptamer is as follows:

TABLE-US-00001 (SEQIDNo.1) 5-GGGAGACAAGAATAAACGCTCAATGACGTCCTTAGAATTGCGCA TTCCTCACACAGGATCTTTTCGACAGGAGGCTCACAACAGGC-3.

[0104] In the corresponding mRNA sequence of the anti-CD4 aptamer each T (thymine) is replaced by an U (uracil).

[0105] As the aptamer is critical for the specificity of the mRNA, the inventors call this mRNA atmRNA (aptamer targeted mRNA).

3. Functional Tests Demonstrating the Activity of the atmRNA

[0106] First, the inventors tested such an mRNA using a red fluorescent reporter protein (RFP) as the encoding part without aptamer sequence. For this experiment RFP DNA was subcloned into the pVAX-A120 vector; see Kormann et al (I.c.). For in vitro transcription (IVT) of chemically modified mRNA the plasmid was linearized with XhoI and transcribed in vitro using the MEGAscript T7 Transcription kit (www.lifetechnologies.com), incorporating 25% 2-thio-UTP and 25% 5-methyl-CTP or 100% PseudoUTP and 100% 5-methyl-CTP (all from www.trilinkbiotech.com). The anti reverse CAP analog (ARCA)-capped synthesized nec-mRNAs were purified using the MEGAclear kit (www.lifetechnologies.com) and analyzed for size on agarose gels and for purity and concentration on a NanoPhotometer (http://www.implen.com),

[0107] In the first experiment (modified RFP-mRNA) the inventors assembled the mRNA to nanoparticles (NPs) with Chitosan-coated PLGA using the following protocol: Chitosan (83% deacetylated (Protasan UP CL 113, www.novamatrix.biz)) coated PLGA (poly-d,l-lactide-co-glycolide 75:25 (Resomer RG 752H, www.evonik.de) nanoparticles (short: NPs) were prepared by using emulsion-diffusion-evaporation15 with minor changes. In brief, 100 mg PLGA was dissolved in ethyl acetate and added dropwise to an aqueous 2.5% PVA solution (polyvinyl alcohol, Mowiol 4-88, www.kuraray.eu) containing 15 mg Chitosan. This emulsion was stirred (1.5 h at room temperature) and followed by homogenization at 17,000 r.p.m. for 10 min using a Polytron PT 2500E (www.kinematica.ch). These positively charged NPs were sterile filtered and characterized by Malvern ZetasizerNano ZSP (hydrodynamic diameter: 157.3 ?} 0.87 nm, PDI 0.11, zeta potential +30.8 ?} 0.115 mV). After particle formation they were loaded with mRNA by mixing (weight ratio, 25:1).

[0108] 20 ?g modified RFP-mRNA-NPs in a total volume of 100 ?l were administered i.v. into the tail vein of BALB/c mice. After 24 h blood was withdrawn via retro-orbital bleeding, mice were sacrificed and spleenocytes were isolated. Immune cells were analyzed for RFP expression by flow cytometry. The data is shown in FIG. 2: RFP+ cells were determined and quantified via flow cytometry. In some cell contexts RFP mRNA+NP was significantly higher expressed compared to RFP mRNA alone (n=3 mice per group). *P<0.05, ***P<0.001 (Mann-Whitney-U tests).

[0109] The immune reaction developed upon i.v. administration of RFP-mRNA-NPs was measured via quantification of IFN-alpha release after 6 h and 24 h using ELISA, as shown in FIG. 3: In vivo immune reaction to chemically modified RFP mRNA complex to NPs. 20 pg of RFP mRNA with or without NPs was i.v. injected into mice (n=3 mice per group). 6 h and 24 h post-injection, IFN-alpha was measured by ELISA in duplicates.

[0110] In a next experiment anti-CD4 aptamer sequence was added downstream of the polyA sequence. IVT was performed as described above to obtain atmRNA. i.v. application of the atmRNA to NSG mice, partially-humanized by i.v. injection of 25?10e6 human PBMCs two weeks prior to the start of the experiment, was performed as described above. After 24 h blood was withdrawn retroorbitally and immune cells were analyzed for RFP expression bei flow cytometry. The data is shown in FIG. 4: RFP+cells were determined and quantified via flow cytometry. In some cell contexts RFP atmRNA+NP was significantly higher expressed compared to regular RFP mRNA+NP (n=3 mice per group). **P<0.01 (Mann-Whitney-U tests).

[0111] Clearly, CD4+ T cells showed a significantly higher expression of RFP compared to the expression found when using chemically modified RFP mRNA without attached aptamer sequence.

[0112] In a further experiment, RFP was substituted with a CD19-CD28-CD3-zeta construct, whichupon translationassembles to an anti-CD19 CAR. The rationale behind that approach is depicted in FIG. 5: The aptamer-targeted modified messenger-RNA (atmRNA) consists of an aptamer (ar) targeting an effector antigen (ea) and a transgen (tg) (e.g. a chimeric antigen receptor, transgenic T cell receptor, transgenic T cell receptor with artificial costimulatory domain or any immunomodulatory receptor including reverse signaling and others) that is encoded by modified mRNA (mr). 1) atmRNA complexed with a nanoparticle (np) is injected intravenously. 2) atmRNA binds to the effector antigen (ea) and to an effector cell (ec) (e.g. CD4 on a T cell). 3) atmRNA bound on an effector antigen (ea) is internalized due to antigen flux. 4) transgen (tg) encoding modified messenger RNA gets translated in the cytosol of the target cell (tc) and the transgen (tg) gets expressed on the target cell (tg). 5) The transgen (e.g. a chimeric antigen receptor) binds to the target antigen (e.g. tumor associated antigen) on a target cell (tc) (e.g. tumor cell). 6) The effector cell (e.g. chimeric antigen expressing T cell) gets activated and mediates functions to the target cell (tc) (e.g. induces cell death in a tumor cell).

[0113] The DNA sequence encoding the CD19-CD28-CD3-zeta construct is as follows:

TABLE-US-00002 (SEQIDNo.2) 5-ATGCTTCTCCTGGTGACAAGCCTTCTGCTCTGTGAGTTACCACAC CCAGCATTCCTCCTGATCCCAGACATCCAGATGACACAGACTACATCCTC CCTGTCTGCCTCTCTGGGAGACAGAGTCACCATCAGTTGCAGGGCAAGTC AGGACATTAGTAAATATTTAAATTGGTATCAGCAGAAACCAGATGGAACT GTTAAACTCCTGATCTACCATACATCAAGATTACACTCAGGAGTCCCATC AAGGTTCAGTGGCAGTGGGTCTGGAACAGATTATTCTCTCACCATTAGCA ACCTGGAGCAAGAAGATATTGCCACTTACTTTTGCCAACAGGGTAATACG CTTCCGTACACGTTCGGAGGGGGGACTAAGTTGGAAATAACAGGCTCCAC CTCTGGATCCGGCAAGCCCGGATCTGGCGAGGGATCCACCAAGGGCGAGG TGAAACTGCAGGAGTCAGGACCTGGCCTGGTGGCGCCCTCACAGAGCCTG TCCGTCACATGCACTGTCTCAGGGGTCTCATTACCCGACTATGGTGTAAG CTGGATTCGCCAGCCTCCACGAAAGGGTCTGGAGTGGCTGGGAGTAATAT GGGGTAGTGAAACCACATACTATAATTCAGCTCTCAAATCCAGACTGACC ATCATCAAGGACAACTCCAAGAGCCAAGTTTTCTTAAAAATGAACAGTCT GCAAACTGATGACACAGCCATTTACTACTGTGCCAAACATTATTACTACG GTGGTAGCTATGCTATGGACTACTGGGGTCAAGGAACCTCAGTCACCGTC TCCTCAGTAGCAGATCCCGCCGAGCCCAAATCTCCTGACAAAACTCACAC ATGCCCACCGTGCCCAGCACCTGAACTCCTGGGGGGACCGTCAGTCTTCC TCTTCCCCCCAAAACCCAAGGACACCCTCATGATCTCCCGGACCCCTGAG GTCACATGCGTGGTGGTGGACGTGAGCCACGAAGACCCTGAGGTCAAGTT CAACTGGTACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGC GGGAGGAGCAGTACAACAGCACGTACCGGGTGGTCAGCGTCCTCACCGTC CTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAA CAAAGCCCTCCCAGCCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGC AGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTG ACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCCAG CGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACA AGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGC AAGCTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATG CTCCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCT CCCTGTCTCCGGGTAAAAAAGATCCCAAATTTTGGGTGCTGGTGGTGGTT GGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAACAGTGGCCTTTATTAT TTTCTGGGTGAGGAGTAAGAGGAGCAGGCTCCTGCACAGTGACTACATGA ACATGACTCCCCGCCGCCCCGGGCCCACCCGCAAGCATTACCAGCCCTAT GCCCCCCCACGCGACTTCGCAGCCTATCGCTCCCTGAGAGTGAAGTTCAG CAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGCTCTATA ACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGA CGTGGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCA GGAAGGCCTGTACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACA GTGAGATTGGGATGAAAGGCGAGCGCCGGAGGGGCAAGGGGCACGATGGC CTTTACCAGGGTCTCAGTACAGCCACCAAGGACACCTACGACGCCCTTCA CATGCAGGCCCTGCCCCCTCGCTAATCCTCGAGGGGAGACAAGAATAAAC GCTCAATGACGTCCTTAGAATTGCGCATTCCTCACACAGGATCTTTTCGA CAGGAGGCTCACAACAGGCTCCGGA-3.

[0114] In the corresponding mRNA sequence of the anti-CD4 aptamer each T (thymine) is replaced by an U (uracil).

[0115] IVT of atmRNA encoding the anti-CD19 CAR was performed as described above. Freshly isolated human PBMCs were incubated for 24 h with 10 ?g atmRNA targeted against CD4 with or without assembling to NP. mRNA encoding the anti-CD19 CAR with or without assembling to NP was used to demonstrate aptamer-specific expression. Electroporation of the same mRNA served as positive control. (n=4, technical replicates). The data is shown in FIG. 6: The experiment demonstrates a selective expression of the anti-CD19-CAR facilitated by atmRNA.

[0116] In the next experiment, activated T cells were pre-incubated for 24 h with 10 ?g anti-CD19-CAR encoding atmRNA targeted against CD4 with or without assembling to NP. Pre-activation of CD4 and CD8-positive human T cells was performed by stimulation with anti-CD3/anti-CD28 activation beads and cultivation in IL-7 and IL-15 containing medium for 10 days. Electroporation of anti-CD19-CAR encoding mRNA served as positive control. After pre-incubation/electroporation, T cells were incubated with CD19 positive leukemic blasts (Nalm-6) at the effector to target ratios 5:1 and 1:1. Specific lysis was determined via bioluminescence (D-luciferin, Sigma Aldrich, www.sigmaaldrich.com) in a luciferase-based cytotoxicity assay using firefly luciferase constitutively expressing tumor cells. The data is shown in FIG. 7: atmRNA conditions showed an increased specific lysis of Nalm-6 CD19+ tumor cells after 24 and 48 h (n=6, technical replicates). ***P<0.001, activated T cells incubated with atmRNA assembled to NP (CAR19) vs. activated T cells (one-way ANOVA).

[0117] After in vitro evaluation, atmRNA was injected into the tail vein of NSG mice, partially humanized by previous i.v. injection of 25?10e6 human PBMCs two weeks prior to the start of the experiment. After 24 h, blood was withdrawn retroorbitally and immune cells were analyzed for CAR expression by flow cytometry. The data is shown in FIG. 8: CAR+ cells were determined and quantified via flow cytometry. In CD4+ cells, the CAR-construct using CAR atmRNA assembled to NP was significantly higher expressed compared to CAR atmRNA alone (n=4 mice per group). ***P<0.001, CAR mRNA+NP vs. CAR mRNA naked in CD4+ cells (Mann-Whitney-U tests).

[0118] In the next experiment atmRNA was i.v. injected into leukemia baring NSG mice. NSG mice were injected i.v. with 1?10e6 CD19-positive Nalm-6 leukemic blasts. After 6 days, mice were transplanted with 2?10e7 pre-activated human T cells. One day after T cell application, atmRNA encoding anti-CD19-CAR assembled to nanoparticles was administered to the treatment group. After 48 h, blood was withdrawn retroorbitally and immune cells were analyzed for CAR expression by flow cytometry. The data is shown in FIG. 9. CAR+ cells were determined and quantified via flow cytometry. In CD4+ cells, injected with CAR atmRNA assembled to NP, CAR expression was significantly higher compared to CD8+ cells (n=4 mice per group). *P<0.05 (One-way ANOVA).

[0119] Functionality of expressed anti-CD19-CAR was further analyzed. In the above outlined experiment, mice were sacrificed 72 h after i.v. injection of CAR atmRNA assembled to NP. Bone marrow was analyzed for infiltration of leukemic blasts by flow cytometry using constitutive expression of mCherry on the Nalm-6 cell line for detection of blasts. Results demonstrate a significant reduction of blast infiltration in the bone marrow in the group activated T cells (aT cells)+atmRNA+NP compared to aT cells only (n=4 mice per group). *P<0.05 (One-way ANOVA). This effect has to be attributed to functional anti-CD19-CAR expression and specific T cell activation.

[0120] The data conclusively demonstrates that highly functional immunoreceptors, such as used in the above mentioned experiment, e.g. CARs, can be selectively expressed on specific immune cells such as CD4+ T cells. Using atmRNA naked or assembled to nanoparticles or liposomes, i.v. application is made possible, which overcomes all complicated and time-consuming ex vivo steps currently state-of-the-art to reprogram T cells. Thus, with the presented invention the genetic engineering of designer T cells can be done ultra-quick and off-the-shelf and opens up a vast range of possibilities to initiate/elicit antigen specific immune responses against cancer, infectious and immunologically triggered diseases.

4. Illustration of the Modular Design of the Product According to the Invention Exemplified by an Immune Receptor Expressing atmRNA

[0121] Reference is made to FIG. 11. The atmRNA-based immunoreceptor qualifies for targeting any cellular molecule expressed on the cell surface and internalized by any cell of interest via modular exchange of the aptamer specificity of interest (e.g. CD4, CD8, CD28, CD137 just to name a few, not excluding any others). Moreover the signaling and thereby the defined function is also based on a modular synthesis of predefined features and allows any available combinatory artificial signaling (e.g. activatory signaling [CD3? chain, CD28, CD137, OX40 just to name a few, not excluding any others], inhibitory signaling [PD-receptor, FAS-receptor just to name a few, not excluding any others], modulatory signaling [insulin and NF?B signaling just to name a few, not excluding any others]. The modular exchange of the binding domain (e.g. an scFv) by the target of interest facilitates the primary targeting and thus the fundamental on and off modulation of the downstream signaling by any predefined epitope structures, that are possibly targetable by a specific binding domain.

5. Illustration of Different Strategy how Immune Receptors, Expressed by atmRNA, can Modulate Effector as well as Target Cell Function

[0122] Reference is now made to FIG. 12. Immune receptors (IR) are composed of 1) an extracellular binding domain (bd) recognizing a specific antigen, 2) a transmembrane domain (td), 3) one or several signaling domains (sd). IR can mediate different functions upon specific ag recognition: a) activation of effector cell (EC) via an activating sd mediating effector function (.fwdarw.), e.g. induction of cell death, to a target cell (TC); b) enhanced activation of EC and enhanced effector function on TC by multiple sd; c) inhibition of EC via inhibitory sd; d) induction of specific gene expression in EC, mediating effect on EC and/or TC; e) activation of EC mediating effector function on TC and specific gene expression in EC mediating effect on EC and/or TC; f) simultaneous recognition of several ag using multiple bd; g) expression of IR on TC mediating e.g. specific gene expression in TC effecting TC and/or EC.

6. Example Sequence of Novel Modular Design Immune Receptor atmRNA

[0123] An example DNA sequence of a novel modular design immune receptor atmRNA is illustrated in the following.

[0124] Anti-CD19-41-BB-CD3? construct plus poly-a tail and sticky bridge:

TABLE-US-00003 (SEQIDNo.3) 5- GCTAGCGCCGCCACC GAATTCgagcagaagctgatctccgaagaggacctgACCACAACACC CGCTCCTAGAC-CTCCAACACCAGCTCCAACAATCGCCAGCCAGCCTCTG TCTCTCAGACCTGAGGCTTGTAGACCTGCTGCTGGCGGAGCCGTGCATAC AAGAGGACTGGATTTCGCCTGCGACATCTACATCTGGGCTCCTCTGGCTG GCACATGTGGCGTGCTGCTGCTGAGCCTGGTCATCACCCTGTATTGCAAG CGGGGCAGAAAGAAACTGCTCTACATCTTCAAGCAGCCCTTCATGCGGCC CGTGCAGACCACACAAGAGGAAGATGGCTGCTCCTGCAGATTCCCCGAGG AAGAAGAAGGCGGCTGCGAGCTGAGAGTGAAGTTCAGCAGATCCGCCGAC GCTCCTGCCTATCAGCAGGGCCAAAACCAGCTGTACAACGAGCTGAACCT GGGGAGAAGAGAAGAGTACGACGTGCTGGACAAGCGGAGAGGCAGAGATC CTGAAATGGGCGGCAAGCCCAGACGGAAGAATCCTCAAGAGGGCCTGTAT AATGAGCTGCAGAAAGACAAGATGGCCGAGGCCTACAGCGAGATCGGAAT GAAGGGCGAGCGCAGAAGAGGCAAGGGACACGATGGACTGTACCAGGGCC TGAGCACCGCCACCAAGGATACCTATGATGCCCTGCACATGCAGGCCCTG CCTCCAAGATAGAAGCTTCTCGA-Gaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGTCGA CCTCCTAG-GAGCTCGGGCCC-3 .

[0125] CD4 aptamer short stick:

TABLE-US-00004 (SEQIDNo.4) 5- GAGGATCCTCGAGCCCGGTTTTTTTT -3

[0126] CD4 aptamer long stick:

TABLE-US-00005 (SEQIDNo.5) 5- TTTTTTTTCAGCTGGAGGATCCTCGAGCCCGGTTTTTTTTGTGACGTCCT GATCGATTGTGCATTCGGTGTGACGATCT-3

[0127] CD8 aptamer short stick:

TABLE-US-00006 (SEQIDNo.6) 5- GAGGATCCTCGAGCCCGGTTTTTTTT -3

[0128] CD8 aptamer long stick:

TABLE-US-00007 (SEQIDNo.7) 5 TTTTTTTTCAGCTGGAGGATCCTCGAGCCCGGTTTTTTTT -3

[0129] The bold italic capital letters illustrate the BINDING DOMAIN (anti CD19 scFv). The restriction side is shown in underlined normal small letters. The myc-tag is shown in normal small letters. The (CO)SIGNALING DOMAIN (41-BB-CD3?) is shown in normal italic capital letters. The bold small letters show the poly-a-tail. The bold capital letters show the STICKY BRIDGE. The SPACER is shown in normal capital letters. The APTAMER is shown in bold italic large underlined letters.

[0130] In the corresponding mRNA sequences each T (thymine) is replaced by an U (uracil).

Sequences

[0131] SEQ ID no. 1: DNA sequence encoding the anti-CD4 aptamer; [0132] SEQ ID no. 2: DNA sequence encoding the CD19-CD28-CD3-zeta construct [0133] SEQ ID no. 3: DNA sequence encoding anti-CD19-41-BB-CD3? construct plus poly-a tail and sticky bridge [0134] SEQ ID no. 4: DNA sequence encoding CD4 aptamer short stick [0135] SEQ ID no. 5: DNA sequence encoding CD4 aptamer long stick [0136] SEQ ID no. 6: DNA sequence encoding CD8 aptamer short stick [0137] SEQ ID no. 7: DNA sequence encoding CD8 aptamer long stick