MUTATED HYDROXYPHENYLPYRUVATE DIOXYGENASE, DNA SEQUENCE AND ISOLATION OF PLANTS WHICH ARE TOLERANT TO HPPD INHIBITOR HERBICIDES
20190040408 ยท 2019-02-07
Inventors
- Marco BUSCH (Schwalbach Am Taunus, DE)
- Kerstin SELAK (Alzey-Weinheim, DE)
- Bernd Laber (Idstein, DE)
- Alain SAILLAND (Saint Didier Au Mont D'or, FR)
Cpc classification
C12Y113/11027
CHEMISTRY; METALLURGY
C12N9/0069
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a nucleic acid sequence encoding a mutated hydroxyphenylpyruvate dioxygenase (HPPD), to a chimeric gene which comprises this sequence as the coding sequence, and to its use for obtaining plants which are resistant to HPPD inhibitor herbicides.
Claims
1. A mutated hydroxyphenylpyruvate dioxygenase (HPPD) which retains its properties of catalysing the conversion of para-hydroxyphenylpyruvate (HPP) to homogentisate and which is less sensitive to a HPPD inhibitor than the original unmutated HPPD, characterized in that it contains a mutation on the amino acid glycine in position 336 with reference to the amino acid sequence of the Pseudomonas HPPD of SEQ ID NO:2 which is selected from the following group: Gly336His, Gly336Met, Gly336Phe, and Gly336Cys, provided that when the mutation is Gly336His, the amino acid at position 334 with reference to the amino acid sequence of the Pseudomonas HPPD of SEQ ID NO:2 is Gly.
2. The mutated HPPD according to claim 1, characterized in that the mutated HPPD contains a second mutation.
3. The mutated HPPD according to claim 2, characterized in that the second mutated amino acid is selected from the selected amino acids: Pro215, Gly298, Gly332, Phe333, Gly334 and Asn337, with reference to the Pseudomonas HPPD sequence of SEQ ID NO:2.
4. A nucleic acid sequence which encodes a mutated HPPD according to claim 1.
5. A chimeric gene which comprises a coding sequence as well as heterologous regulatory element in the 5 and optionally in the 3 positions, which are able to function in a host organism, characterized in that the coding sequence contains at least a nucleic acid sequence according to claim 4.
6. The chimeric gene according to claim 5 characterized in that it contains in the 5 position of the nucleic acid sequence which encodes a mutated HPPD, a nucleic acid sequence which encodes a plant transit peptide, with this sequence being arranged between the promoter region and the sequence encoding the mutated HPPD so as to permit expression of a transit peptide/mutated HPPD fusion protein.
7. A transit peptide/mutated HPPD fusion protein, with the mutated HPPD being defined according to claim 1.
8. A cloning and/or expression vector for transforming a host organism, characterized in that it contains at least one chimeric gene according to claim 5.
9. A plant cell, characterized in that it contains at least a nucleic acid sequence according to claim 4.
10. The plant cell according to claim 9 characterized in that it contains, in addition, a gene that is functional in plants allowing overexpression of a PDH (prephenate dehydrogenase) enzyme.
11. A transformed plant, characterized in that it contains a transformed plant cell according to claim 9.
12. A transformed seed, characterized in that it contains a transformed plant cell according to claim 9.
13. A method for obtaining a plant resistant to a HPDD inhibitor, characterized in that the plant is transformed with a chimeric gene according to claim 5.
14. A method for obtaining a plant resistant to a HPDD inhibitor according to claim 13, characterized in that the plant is further transformed, simultaneously or successively, with a second gene functional in this plant allowing overexpression of a PDH (prephenate dehydrogenase) enzyme.
15. A method for controlling weeds in an area or a field which contains transformed seeds according to claim 12, which method comprises applying, to the said area of the field, a dose of a HPPD inhibitor herbicide which is toxic for the said weeds, without significantly affecting said seeds.
16. A method for obtaining oil or meal comprising growing a transformed plant according to claim 11, optionally treating such plant with an HPPD inhibitor herbicide, harvesting the grains and milling the grains to make meal and optionally extract the oil.
17. The method according to claim 13, in which the HPPD inhibitor is a triketone HPPD inhibitor.
18. The method according to claim 17, in which the HPPD inhibitor is selected from tembotrione, mesotrione, and sulcotrione.
19. The mutated HPPD according to claim 1, characterized in that the mutation on the amino acid glycine in position 336 is Gly336His.
20. The mutated HPPD according to claim 1, characterized in that the mutation on the amino acid glycine in position 336 is Gly336Met.
21. The mutated HPPD according to claim 1, characterized in that the mutation on the amino acid glycine in position 336 is Gly336Phe.
22. The mutated HPPD according to claim 1, characterized in that the mutation on the amino acid glycine in position 336 is Gly336Cys.
Description
FIGURES
[0139]
SEQUENCES LISTING
[0140] SEQ ID NO 1: Nucleic acid sequence encoding Pseudomonas fluorescens HPPD
[0141] SEQ ID NO 2: Pseudomonas fluorescens HPPD amino acid sequence
[0142] SEQ ID NO 3: Nucleic acid sequence encoding Arabidopsis thaliana HPPD
[0143] SEQ ID NO 4: Arabidopsis thaliana HPPD amino acid sequence
[0144] SEQ ID NO 5: Nucleic acid sequence encoding Mus musculus HPPD
[0145] SEQ ID NO 6: Mus musculus HPPD amino acid sequence
[0146] SEQ ID NO 7: Nucleic acid sequence encoding Coccidioides immitis HPPD
[0147] SEQ ID NO 8: Coccidioides immitis HPPD amino acid sequence
[0148] SEQ ID NO 9: Nucleic acid sequence encoding Mycosphaerella graminicola HPPD
[0149] SEQ ID NO 10: Mycosphaerella graminicola HPPD amino acid sequence
[0150] SEQ ID NO 11: Nucleic acid sequence encoding Hordeum vulgare HPPD
[0151] SEQ ID NO 12: Hordeum vulgare HPPD amino acid sequence
[0152] SEQ ID NO 13: Nucleic acid sequence encoding Zea mais HPPD
[0153] SEQ ID NO 14: Zea mais HPPD amino acid sequence
[0154] SEQ ID NO 15: Nucleic acid sequence encoding Daucus carota HPPD
[0155] SEQ ID NO 16: Daucus carota HPPD amino acid sequence
[0156] SEQ ID NO 17: Nucleic acid sequence encoding Streptomyces avermitilis HPPD
[0157] SEQ ID NO 18: Streptomyces avermitilis HPPD amino acid sequence
[0158] SEQ ID NO 19: primer sequence kerfi001
[0159] SEQ ID NO 20: primer sequence kerfi002
[0160] SEQ ID NO 21: primer sequence kerfi003
[0161] SEQ ID NO 22: primer sequence kerfi004
[0162] SEQ ID NO 23: primer sequence kerfi007
[0163] SEQ ID NO 24: primer sequence kerfi008
[0164] SEQ ID NO 25: primer sequence kerfi011
[0165] SEQ ID NO 26: primer sequence kerfi012
[0166] SEQ ID NO 27: primer sequence kerfi014
[0167] SEQ ID NO 28: primer sequence kerfi016
[0168] SEQ ID NO 29: primer sequence kerfi019
[0169] SEQ ID NO 30: primer sequence kerfi020
[0170] SEQ ID NO 31: primer sequence kerfi015
[0171] SEQ ID NO 32: primer sequence kerfi018
EXAMPLES
[0172] The various aspects of the invention will be better understood with the aid of the experimental examples which follow. All the methods or operations which are described below in these examples are given by way of example and correspond to a choice which is made from among the different methods which are available for arriving at the same or similar result. This choice has no effect on the quality of the result and, as a consequence, any suitable method can be used by the skilled person to arrive at the same or similar result. The majority of the methods for manipulating DNA fragments are described in Current Protocols in Molecular Biology Volumes 1 and 2, Ausubel F. M. et al., published by Greene Publishing Associates and Wiley Interscience (1989) or in Molecular cloning, T. Maniatis, E. F. Fritsch, J. Sambrook, 1982, or in Sambrook J. and Russell D., 2001, Molecular Cloning: a laboratory manual (Third edition)
Example 1: Preparation of Mutated HPPD
General Outline
[0173] The Arabidopsis thaliana AtHPPD coding sequence (1335 bp)(Genebank AF047834; WO 96/38567) was initially cloned into the expression vector pQE-30 (QIAGEN) in between the restriction sites of BamHI and HindIII.
[0174] The Pseudomonas fluorescens PfHPPD coding sequence (1174 bp) (Retschi et al., Eur. J. Biochem., 205, 459-466, 1992, WO 96/38567) was initially cloned into the unique NcoI site of the expression vector pKK233-2 (Pharmacia) that provides a start codon.
[0175] The vectors pQE-30-AtHPPD and pKK233-2-PfHPPD were used for PCR-mediated attachment of an NcoI restriction site and of a sequence encoding an N-terminal His.sub.6-Tag to the 5 ends and an XbaI restriction site to the 3 ends of AtHPPD and PfHPPD.
[0176] The PCR product of the AtHPPD gene was isolated from an agarose gel, cut with the restriction enzymes NcoI and XbaI, purified with the MinElute PCR Purification Kit (Qiagen) and cloned into the pSE420(RI)NX vector cut with the same restriction enzymes.
[0177] Concerning the PfHPPD gene, the PCR product was isolated from an agarose gel and cloned into the pCR 2.1-TOPO vector. It was excised from this vector with the restriction enzymes NcoI and XbaI, isolated from an agarose gel and cloned into the pSE420(RI)NX vector cut with the same restriction enzymes.
[0178] Both pSE420(RI)NX-AtHPPD and -PfHPPD were then subjected to PCR-mediated site-directed mutagenesis to alter a defined codon at corresponding sites of both genes. The respective codon encodes Gly336 in WT PfHPPD and Gly422 in WT AtHPPD.
[0179] The mutated codons in the coding sequences are analyzed using the Pyrosequencing technique.
[0180] PCR-mediated attachment of a sequence encoding an N-terminal His.sub.6-tag and NcoI and XbaI restriction sites: The PCR reaction for each gene (AtHPPD and PfHPPD) was carried out in 24 wells of a 96 well PCR plate, respectively. Since the forward and reverse primers for this reaction differ in size by 18 (AtHPPD) and 22 bp (PfHPPD), an annealing temperature gradient from 40.9 C. to 64.5 C. was performed, each well being subjected to another annealing temperature within this range. When the primers anneal to the single stranded template for the first time, a 5 overhang was produced in the new strand until its complementary strand is synthesized and this overhang formed by the 5 region of the first primer is part of the template. The coding sequences were thereby extended at both ends, introducing a sequence encoding a N-terminal His.sub.6-tag and a restriction site at both ends.
[0181] The reaction mixtures contain 500 ng of pQE-30-AtHPPD DNA (1 L from plasmid maxipreparation) or 1 g of pKK233-2-PfHPPD DNA (0.75 L from plasmid maxipreparation), 1 l of kerfi001 and kerfi002, respectively, for AtHPPD or kerfi003 and kerfi004, respectively, for PfHPPD (all primer solutions have a concentration of 10 pmol*L.sup.1), 25 l HotStarTaq Master Mix (Qiagen) and HyPure Molecular Biology Grade Water to a final volume of 50 L. The PCR programme is set as follows:
1. 95 C. 15 min
2. 94 C. 30 s
[0182] 40.9 C.60.4 C. 30 s [0183] 72 C. 3 min
Step 2 is repeated 20 times.
3. 72 C. 10 min
[0184]
TABLE-US-00001 Primer name Primersequence kerfi001 5-CCATGGCTCATCACCATCACCATCACCAAAACGCCG CCGTTTCAG-3 kerfi002 5-TCTAGATCATCCCACTAACTGTTTGGC-3 kerfi003 5- CCATGGCTCATCACCATCACCATCACGCAGATCTATACG AAAACCCAATGG-3 kerfi004 5-TCTAGATTAATCGGCGGTCAATACACCAC-3
[0185] The PCR reactions were subjected to agarose gel electrophoresis which all produced clear bands corresponding to fragments of approximately 1500 bp (AtHPPD) or 1100 bp (PfHPPD). The bands were excised from the gel and DNA was purified using the QIAquick Gel Extraction Kit (Qiagen).
Cloning into pCR2.1-TOPO Vector (Invitrogen)
[0186] pCR 2.1-TOPO vector (3931 bp) was used for one-step cloning of Taq polymerase-amplified PCR products which display a 3-adenosine (A) overhangs. The vector, in turn, was linearized and displayed single 3-thymidine (T) overhangs at its ends. Topoisomerase I was covalently attached to these 3-thymidines which served to covalently link the vector to the PCR product. For selection of bacterial cells carrying the vector, either ampicillin or kanamycin could be used. The vector possessed an XbaI restriction site within its multiple cloning site and an NcoI restriction site within the KanR gene.
[0187] DNA solutions obtained from each gel extraction were used for TOPO TA cloning, respectively. After transformation of E. coli TOP10 cells, each reaction yielded three white colonies (A1-A3, P1-P3) that were used to inoculate 5 mL LB/amp medium.
[0188] To determine whether the vectors of these colonies carried the correct inserted fragment, plasmid DNA was prepared from 4 mL of pCR2.1-TOPO-AtHPPD cultures A1-A3 and -PfHPPD cultures P1-P3 using the QIAprep Spin Miniprep Kit (Qiagen). DNA solutions obtained from these plasmid preparations were subjected to a restriction digest with HindIII and XhoI which was then analyzed on a 1% agarose gel. Both HindIII and XhoI each possess a single restriction site in the pCR2.1-TOPO-AtHPPD/-PfHPPD vector, respectively. The restriction digest of DNA from clone A1 produced the expected bands representing a 1461 bp fragment (AtHPPD coding sequence) and the 3831 bp vector fragment; the restriction digest of P3 produced the expected bands representing a 1206 bp fragment (PfHPPD coding sequence) and the 3831 bp vector fragment on the agarose gel.
[0189] DNA obtained from plasmid maxipreparation using the QIAfilter Maxi Kit (Qiagen) and subsequent NaAc/EtOH precipitation from 100 mL of Al (AtHPPD) or P3 (PfHPPD) liquid LB/amp culture was used to determine the DNA sequence of the respective inserted HPPD gene in the pCR2.1-TOPO vector. DNA sequencing was carried out with the primers M13 uni (21) and M13 rev (29) by Eurofins MWG GmbH. Sequencing confirmed the correct DNA sequence of both AtHPPD and PfHPPD in the pCR2.1-TOPO vector, including the restriction sites at both ends of the coding sequences.
Cloning into pSE420(RI)NX
[0190] The cloning and expression vector pSE420(RI)NX (5261 bp) is based on the plasmid pSE420 by Invitrogen. Modifications of this vector include the addition of a kanamycin tolerance gene and the removal of the majority of the superlinker region (multiple cloning site).
[0191] The plasmid possesses the trp-lac (trc) promoter and the lacI.sup.q gene that provides the lac repressor in every E. coli host strain. The lac repressor binds to the lac operator (lacO) and restricts expression of the target gene; this inhibition can be alleviated by induction with Isopropyl -D-1-thiogalactopyranoside (IPTG).
[0192] The genes AtHPPD and PfHPPD were cloned into the vector pSE420(RI)NX in between the restriction sites of NcoI and XbaI.
[0193] PCR-Based Site-Directed Mutagenesis:
[0194] Template DNA (pSE420(RI)NX-AtHPPD and pSE420(RI)NX-PfHPPD) were isolated from E. coli TOP10 liquid culture by performing a plasmid minipreparation. The DNA solutions obtained from these minipreparations were diluted to a concentration of 0.05 g*L.sup.1.
[0195] PCR-based site-directed mutagenesis requires two chemically synthesized DNA primers (forward and reverse primer) that are complementary to the same DNA region, each of them to one strand of the double-stranded DNA template. These primers contain the desired mutation at their centre and cover a region of about 20-30 nucleotides of the template, including the mutation site and 10-15 bases on each of its sides. The mutation site covers three nucleotides that vary independently in the primers in order to obtain each possible codon at the selected site.
[0196] In circular PCR mutagenesis a plasmid template is completely copied by rolling circle replication starting from the 3 OH end of a primer that is incorporated into the growing strand. Each new DNA molecule then carries one or more altered nucleotides that were contained in the primer. A high fidelity DNA polymerase is used in order to reduce the possibility of further undesired mutations.
[0197] The oligonucleotide primer pairs kerfi007/kerfi008 (AtHPPD) and kerfi011/kerfi012 (PfHPPD) were dissolved in water to a concentration of 10 pmol*L.sup.1. For the mutagenesis PCR reaction, 50 ng of template plasmid from pSE420(RI)NX-AtHPPD or pSE420(RI)NX-PfHPPD minipreparations, diluted to a concentration of 0.05 g*L.sup.1, were used. The reaction mixture was composed as follows:
[0198] 1 L template plasmid (0.05 g*L.sup.1)
1.5 L primer kerfi007 (or kerfi011) (10 pmol*L.sup.1)
1.5 L primer kerfi008 (or kerfi012) (10 pmol*L.sup.1)
[0199] 5 L 10 reaction buffer
[0200] 1 L dNTP mix
[0201] 40 L HyPure Molecular Biology Grade Water
[0202] 1 L PfuUltra High-Fidelity DNA polymerase (2.5 U*L.sup.1)
[0203] The PCR programme was the same for mutagenesis of AtHPPD and PfHPPD and the elongation time was set to 7 minutes, assuming that it takes 1 minute to replicate 1 kb of plasmid DNA.
1. 95 C. 30 s
2. 95 C. 30 s
[0204] 55 C. 30 s [0205] 68 C. 7 min [0206] Step 2 is repeated 18 times.
After the PCR reaction, the reactions were set on ice to cool down to room temperature.
TABLE-US-00002 Primer name Primersequence kerfi007 5-GGTGGTTTTGGCAAANNNAATTTCTCTGAGCTC-3 kerfi008 5-GAGCTCAGAGAAATTNNNTTTGCCAAAACCACC-3 kerfi011 5-CAGCGCCTTGAAGTTNNNCTCGCCAAACCCATC-3 kerfi012 5-GATGGGTTTGGCGAGNNNAACTTCAAGGCGCTG-3
[0207] After the PCR reaction mutant plasmids were selected using the Dpn I restriction endonuclease. Only dam-methylated DNA is degraded by the restriction enzyme Dpn I whose restriction site G.sup.Me6ATC is relatively abundant. Template plasmids which were produced by bacteria have been methylated and are therefore degraded. PCR-amplified DNA, however, remains intact.
[0208] 1 L of Dpn I restriction enzyme (10 U*L.sup.1) was added to the PCR reactions and the solutions were mixed by pipetting up and down. After 1 minute of centrifugation (13,200 rpm) the reactions were incubated at 37 C. for 1 hour.
[0209] Mutant plasmids contained staggered nicks at the 5 end of each primer and could be directly transformed into competent cells.
[0210] To concentrate mutant plasmids, a NaAc/EtOH precipitation was carried out and the DNA was resuspended in 10 L of HyPure Molecular Biology Grade Water. 3 L of these plasmid solutions were later used for transformation of electro competent E. coli K-12 MG1655 cells, and, in the case of AtHPPD, 1 L was used for transformation of electro competent E. coli TOP10 cells.
[0211] For AtHPPD, a total of 62 E. coli K-12 MG1655 clones were obtained and cultivated for subsequent analysis of the mutated codon in Costar 96 well 2 mL deep well plates. To obtain higher numbers of clones, E. coli TOP10 was used as an alternative host for cloning of mutagenized plasmids. Transformation of E. coli TOP10 cells with mutagenized plasmids yielded several hundreds of clones.
[0212] Concerning PfHPPD, a total of 252 E. coli K-12 MG1655 clones were obtained and cultivated for analysis as described for clones transformed with AtHPPD plasmids
Example 2: Pyrosequencing Reactions for Verifying Point Mutations
[0213] The Pyrosequencing technology was used to verify point mutations by determining the nucleotide sequence of a short, defined section of DNA. A PCR reaction was performed first to amplify a short DNA fragment containing the section to be sequenced. The PCR-amplified template needs to be single-stranded and covalently attached to a biotin molecule at its 5 end. Biotin served to attach the template non-covalently to streptavidin which was attached to a stationary phase of cross-linked agarose (sepharose).
[0214] Amplification of biotinylated DNA fragments: The PCR reaction was carried out in 96 well PCR plates. The reaction mixture contains 1 L of forward primer solution (kerfi016 for AtHPPD, kerfi020 for PfHPPD; 10 pmol*L.sup.1), 1 L of reverse primer solution (contain a biotin modification at their 5 ends; kerfi019 for AtHPPD, kerfi014 for PfHPPD; 10 pmol*L.sup.1), 2 L of liquid bacterial culture of a clone cultivated in a deepwell plate, 25 L of HotStarTaq Master Mix and 21 L of HyPure Molecular Biology Grade Water.
[0215] The PCR programmes for AtHPPD and PfHPPD differed concerning the annealing temperatures which were set to 55 C. and 60 C., respectively.
1. 95 C. 15 min
2. 94 C. 30 s
[0216] 55 C./60 C. 30 s [0217] 72 C. 30 s
Step 2 was repeated 32 times.
3. 72 C. 10 min
[0218]
TABLE-US-00003 Primer name Primersequence kerfi014 5-GATCTTCTCGGAAACCCTGATG-3 (5bio) kerfi016 5-GGGATTCTTGTAGACAGAGATG-3 kerfi019 5-CCCACTAACTGTTTGGCTTC-3 (5bio) kerfi020 5-GGCGGTCAATACACCACGAC-3
[0219] Pyrosequencing reaction: the Pyrosequencing reaction (Biotage) was carried out in 96 well plates. To each 45 L PCR reaction, 40 L of Binding Buffer (10 mM Tris-HCl; 2 M NaCl; 1 mM EDTA; 0.1% Tween 20), 3 L streptavidin sepharose beads (composition proprietaryGE Healthcare BioScience AB) and 12 L ddH.sub.2O were added. These mixtures were shaken for 10 minutes in the 96 well PCR plate.
[0220] With a vacuum prep tool each solution was then drawn through a small filter attached to a small metal tube, while the streptavidin beads, now bound to the biotinylated PCR product, were retained on the filters by the suction. According to this principle, the filters were then immersed in 70% ethanol for 5 seconds to wash the DNA and remove primers, dNTPs and other components of the PCR reaction. The procedure was repeated with 0.2 M NaOH to denature dsDNA and to leave only the biotinylated DNA strand bound to the streptavidin beads. After a final washing of the DNA in Washing Buffer, the vacuum prep tool was held over a PSQ 96 plate that contained 40 L of Annealing Buffer and 0.1 L of Pyrosequencing primer solution (100 pmol*L*; kerfi018 for AtHPPD/kerfi015 for PfHPPD) per well. The vacuum was then shut off and each filter was dipped into its corresponding well to dissolve the DNA that was retained by the filter. The plate was then incubated at 80 C. for 2 min to resolve secondary structures eventually formed within the DNA templates. While the solutions cooled to room temperature the Pyrosequencing primers hybridized to their binding sites on the template.
[0221] The remaining components of the Pyrosequencing reactions (620 L of enzyme mixture, 620 L of substrate mixture and 130 L of each dNTP solution) were filled into separate wells of a cartridge. The cartridge and the PSQ plate were then placed inside the PyroMark ID.
[0222] The Pyrosequencing instrument automatically added enzyme and substrate to the reaction mixture before the sequencing reaction is started by addition of the first dNTP. To determine the DNA sequence downstream of the primer, a SQA-run is conducted. The order of nucleotides added to the reaction mixture is defined in advance. The PyroMark ID software can be used to translate the Pyrogram traces into the DNA sequence.
Results:
[0223] The PCR-amplified fragment of AtHPPD has a size of 239 bp and the biotin is attached to the non-coding strand; the PfHPPD fragment comprises 142 bp and the biotin is attached to the coding strand.
[0224] The mutated codon in AtHPPD is located three bases downstream of the kerfi018 primer sequence. The first three bases sequenced are adenines, followed by the mutated codon. The coding strand of the AtHPPD fragment is synthesized by the DNA polymerase, so the sequence could be directly translated into the amino acid sequence.
[0225] Screening of 438 AtHPPD colonies issued 146 mutant genes, 181 wild type genes (codon GGC at position 422) and 111 failed sequencing reactions or ambiguous results.
[0226] The production of mutant clones by transformation of mutant plasmids in either E. coli K-12 MG1655 or E. coli TOP10 was therefore successful in 33% of all cases. Codons encoding all amino acids except lysine could be obtained. The genes containing the codons for glutamic acid, histidine, isoleucine, threonine, tryptophan and tyrosine were present in E. coli TOP10 clones from which DNA was prepared and transformed into E. coli K-12 MG1655 cells. If possible, synonymous codons were selected considering codon usage in E. coli K-12. No codon used at a frequency lower than 10% was chosen, most selected codons are used at a frequency higher than 35% (Codon usage database; E. coli K-12: http://www.kazusa.or.jp/codon/cgi-bin/showcodon.cgi?species=83333).
[0227] Starting from the primer kerfi015, the non-coding strand of the PfHPPD fragment is synthesized by the DNA polymerase, so the nucleotide sequence needed to be translated into the reverse complement before it could be translated into the amino acid sequence. The mutated codon immediately succeeds the primer and is therefore represented by the first three bases sequenced in the reaction.
[0228] Screening of 252 PfHPPD colonies issued 119 mutant genes, 73 unaltered genes (codon TGG at position 336) and 60 failed sequencing reactions or ambiguous results.
[0229] The production of mutant clones by transformation of mutant plasmids in E. coli K-12 MG1655 cells was therefore successful in 47% of all cases. Codons encoding all amino acids except alanine could be obtained. If possible, synonymous codons were selected considering codon usage in E. coli K-12 as described above for AtHPPD codons.
TABLE-US-00004 Primer name Primersequence kerfi015 5-GACTCGAACAGCGCCTTGAAGTT-3 kerfi018 5-GGATGTGGTGGTTTTGGC-3
Example 3: Assay for HPPD Activity
[0230] HPPD produces homogentisate and CO.sub.2 from 4-HPP and O.sub.2. The enzyme is incubated with its substrate 4-HPP in the presence or absence of an inhibitor. L-ascorbic acid is present as a reductant to retain the active site iron in the ferrous form and Catalase is present to degrade toxic H.sub.2O.sub.2. After an incubation time of one hour, the reaction is stopped by addition of 2,4-Dinitrophenylhydrazine (DNP). DNP forms a hydrazone derivative with the remaining 4-HPP molecules in the assay mixture which appears in an amber-brown colour at an alkaline pH. The amount of unconsumed 4-HPP is measured photometrically at 405 nm.
[0231] For preparation of inhibitor stock solutions, Tembotrione (M.sub.w=440.82) and DKN (M.sub.w=359.3) are dissolved in DMSO to a concentration of 10 mM. This stock solution is first diluted 20-fold in 25% DMSO to a concentration of 0.5 mM. Further dilutions are made with ddH.sub.2O to obtain the inhibitor solutions used in the assay (5 M, 10 M and 20 M). The respective inhibitor solution accounts for half of the assay mixture volume, meaning that its active concentration is again reduced 2-fold. This results in inhibitor concentrations of 2.5 M, 5 M and 10 M. A 2% DMSO solution provides for half of the assay mixture in uninhibited reactions to normalize a possible inhibiting effect of DMSO.
[0232] The assay is designed for a HPPD concentration of 444 nM on a monomeric basis and a 4-HPP concentration of 500 M. This corresponds to 44.4 pmol HPPD and 50 nmol 4-HPP in a 100 L-assay mixture, resulting in an approximate 1000-fold excess of substrate in relation to the enzyme. The calculated theoretical molecular weight of an AtHPPD subunit is 49.515 kD which results in 2.2 g HPPD per assay mixture. The calculated theoretical molecular weight of a PfHPPD subunit is 41.205 kD, resulting in 1.8 g HPPD per assay mixture. The enzyme solution provides for one quarter of the assay mixture volume, so enzyme stock solutions are produced by diluting AtHPPD solutions to 88 g*mL.sup.1 with 50 mM TRIS buffer; PfHPPD solutions are diluted to 72 g*mL.sup.1.
[0233] The inhibitor concentrations (2.5 M, 5 M and 10 M) provide for 5-fold, 10-fold and 20-fold excess of inhibitor compared to the amount of enzyme. A buffer/substrate solution is prepared which provides for one quarter of the assay mixture. 2.5 mL of buffer/substrate solution contain 1 mL 1 M TRIS buffer, 500 L 10 mM 4-HPP solution, 500 L 200 mM L-ascorbic acid solution, 13 L Catalase solution and 487 L ddH.sub.2O. The assay is carried out in Greiner F-bottom 96 well microplates and all reactions are carried out as triplicates. The controls are carried out sixfold per plate and contain either 25 L 50 mM TRIS instead of HPPD solution (corresponding to 0% consumption of 4-HPP) or a buffer/substrate solution that contains 500 L 1 M TRIS instead of 500 L 10 mM 4-HPP (corresponding to 100% consumption of HPP). The reaction is started by addition of 25 L HPPD solution to a mixture of 50 L of the respective inhibitor solution or 50 L 2% DMSO and 25 L buffer/substrate solution. The reaction is allowed to proceed for 1 h at room temperature. The reaction is stopped and coloration of 4-HPP is induced by addition of 50 L 0.04% DNP/3.8 N HCl solution. After 15 min, addition of 100 L 5 N KOH leads to the colour shift of the hydrazone derivative. Photometric measurement with a BMG FLUOstar Galaxy microplate reader is carried out immediately at 405 nm and data obtained is used for analysis of HPPD activities in presence and absence of an inhibitor.
Results:
[0234] The AtHPPD mutants in position 422 with reference to the amino acid sequence of the Aradiposis HPPD of SEQ ID NO4 (i.e. Gly422Ala, -Arg, -Asn, -Asp, -Cys, -Glu, -His, -Leu, -Met, -Phe, -Pro, -Ser, -Tyr, and -Val) were tested along with the WT enzyme in the assay for HPPD activity (it is noted that Gly422 with reference to the amino acid sequence of the Aradiposis HPPD of SEQ ID NO4 corresponds to Gly336 with respect to the Pseudomonas reference sequence of SEQ ID NO: 2). All enzymes were active, but only the activities of the mutants Gly422Ala, -Asn, -Asp, -Cys, -His, -Met, -Phe, -Tyr and -Val were within or above the range 70%) of the WT enzyme. The WT enzyme retained 35% of its activity in the presence of 2.5 M Tembotrione; only the mutants Gly422Asn, -Cys, -His and -Val retained higher activities ranging at 39, 44, 51 and 43%, respectively. Activities were further reduced at higher concentrations of Tembotrione. Only the mutant Gly422His displayed a residual activity of about 40% in the presence of 5 and 10 M Tembotrione while all other enzymes displayed activities comparable to the WT enzyme at these inhibitor concentrations, ranging at approximately 20 and 10%, respectively (Table 1).
[0235] The PfHPPD mutants Gly336Arg, -Asp, -Gln, -Glu, His, -Leu, -Lys, -Met, -Phe, Thr, Trp and -Pro were tested along with the WT enzyme. With exception of the Gly336Pro mutant, whose uninhibited activity ranged below 70% of WT activity, the activities of the Gly336 mutants were within or above the range of the WT enzyme (75%). The WT enzyme retained only 5% of its activity in the presence of 2.5 M Tembotrione while the mutants Gly336Asp, -Arg, -Gln, -Glu, -His, -Met, -Phe and -Trp retained activities above 14%. The highest residual activities were those of Gly336His (26%) and Gly336Phe (33%). Interestingly, the Gly336His mutant displayed residual activities of 13 and 11.2% in the presence of 5 and 10 M Tembotrione, respectively, while the activities of Gly336Phe was reduced to 12.4 and 2.5%, respectively. The Gly336Met mutant, displayed residual activities of 7 and 10% respectively at these inhibitor concentrations, while the activity of the WT enzyme was reduced to zero. (Table 1).
TABLE-US-00005 TABLE 1 Relative activity (in percentage) of Pf HPPD and At HPPD mutants in presence and absence of Tembotrione; Activities are normalized by setting the uninhibited enzyme activity to 100% Pseudomonas fluorescens HPPD Concentration of Gly336 Tembotrione (M) mutant 0 2.5 5 10 Arg 100 14 7 2 Asp 100 18 9 0 Gln 100 14 0 0 Glu 100 15 7 0 Gly 100 5 0 0 His 100 26 13 11 Leu 100 4 0 0 Lys 100 6 0 0 Met 100 16 7 10 Phe 100 33 12 3 Pro 100 5 4 0 Thr 100 8 2 2 Trp 100 21 7 0 Arabidopsis thaliana HPPD Concentration of Gly422 Tembotrione (M) mutant* 0 2.5 5 10 Ala 100 25 21 15 Arg 100 17 1 1 Asn 100 39 26 15 Asp 100 20 7 10 Cys 100 44 27 19 Glu 100 24 24 0 Gly 100 35 21 12 His 100 50 31 40 Leu 100 31 23 14 Met 100 18 13 12 Phe 100 30 16 11 Pro 100 0 0 0 Ser 100 18 4 0 Tyr 100 26 11 0 Val 100 43 22 14 *Mutation at the gly in position 422 with reference to the amino acid sequence of the Aradiposis HPPD of SEQ ID NO4 (corresponds to Gly336 with reference to the amino acid sequence of the Pseudomonas HPPD of SEQ ID NO2)
Example 4: Assay for PDH Activity
[0236] The prephenate dehydrogenase activity was measured at 25 C. by spectrophotometric monitoring at 340 nm of the formation of NADH or NADPH in a solution containing 50 mM of tris-HCl, pH 8.6, 300 M of prephenate, and 1 mM of NAD or NADP in a total volume of 200 l.
Example 3: Construction of Chimeric Genes for the Evaluation of Unmutated and Mutated Pf HPPD in Tobacco
[0237] A) Construction of the Chimeric Genes:
[0238] The vector which is employed in order to make the constructs which HPPD (wild-type or mutants) to be expressed in type PBD6 tobacco plants is designated pRP-RD224. This vector was initially conceived for cloning all the Pseudomonas HPPD mutants by simply replacing the truncated HPPD gene of this vector between the KpnI and BstEII sites. Its construction from the binary vector pBI121 (Clontech) is extensively described in WO 99/24585.
[0239] Clone pRP-RD224 therefore has the following structure: [0240] RB/Nos promoter/NPTII/Nos terminator/double histone promoter/tev/otp/truncated HPPD/Nos terminator/LB
wherein truncated HPPD refers to the sequence encoding the Pf HPPD truncated of approximately 500 base pairs in order subsequently to facilitate screening of the transformed colonies which have integrated the mutant HPPDs (WO99/24585)
[0241] pRP-RD224 mutants: The DNAs of the vectors carrying the mutated and unmutated HPPDs were digested with KpnI and BstEII, purified and then ligated into vector pRP-RD224, which had been digested with KpnI and BstEII and purified. The transformants which had integrated the mutated HPPD gene were selected for the size of the insert by digesting with KpnI and BstEII. The resulting clones are designated pRP-RD224 to which is added the type of mutation which has been carried out on the HPPD; in this way, the following clones were created: pRP RD224 Pf (for the unmutated enzyme), pRP RD224 PfH336 (for the enzyme having a histidine at position 336), pRP RD224 PfM336 (for the enzyme having a methionine at position 336), and pRP RD224 PfF336 (for the enzyme having a phenylalanine at position 336).
Example 4: Construction of a Chimeric Gene Overexpressing PDH
[0242] The construction of a chimeric gene overexpressing PDH comprises assembling, in the direction of transcription, a double histone promoter (PdH4) as described in patent application EP 0 507 698, the tobacco etch virus translational enhancer (TEV) sequence described in Carrington and Freed (1990), a sequence encoding an optimized transit peptide (OTP) as described in patent application EP 0 508 909, the coding portion of the yeast PDH gene described in Mannhaupt et al. (1989) and the nos terminator of the nopaline synthase gene described in Bevan et al. (1983). The assembly was then cloned into the binary vector pRD 224 containing a kanamycin tolerance gene(NPTII), to give the vector pRD 224-PDH.
[0243] This binary vector was then used to transform the Agrobacterium strain EHA 105 and to give the Agrobacterium strain EHA 105-pRD 224-PDH. This Agrobacterium strain was used to transform tobacco plants transformed with the chimeric genes as described in example 3.
[0244] The transformed plants are selected on kanamycin.
CITED REFERENCES
[0245] Abou-Zeid et al., 1995, Applied Env Microb 41: 1298-1302 [0246] Ausubel F. M. et al., Current Protocols in Molecular Biology Volumes 1 and 2, published by Greene Publishing Associates and Wiley Interscience (1989) [0247] Bevan et al., 1983, Nucleic Acids Res. 11(2), 369-385 [0248] Bonner et al., 1995, Plant Cells Physiol. 36, 1013-1022 [0249] Byng et al., 1981, Phytochemistry 6: 1289-1292 [0250] Carrington and Freed, 1990; J. Virol. 64: 1590-1597 [0251] Christou et al., 1991, Biotechnology 9:957 [0252] Connely and Conn, 1986, Z. Naturforsch 41c: 69-78 [0253] Crouch N. P. et al., 1997, Tetrahedron, 53, 20, 6993-7010 [0254] Datla, R. et al., 1997, Biotechnology Ann. Rev. 3, 269-296 [0255] Gaines et al., 1982, Plants 156: 233-240 [0256] Henner et al., 1986, Gene 49 (1) 147-152 [0257] Hiei et al., 1994, Plant J 6:271-282 [0258] Hiei et al., 1997, Plant Mol Biol. 35:205-21 [0259] Hudson et al., 1984, J. Mol. Biol. 180(4), 1023-1051 [0260] Fritze et al., 2004, Plant Physiology 134:1388-1400 [0261] Garcia et al., 1997, Biochem. J. 325, 761-769 [0262] Garcia et al., 1999, Plant Physiol. 119, 1507-1516 [0263] Gould J. H. and Magallanes-Cedeno M., 1998, Plant Molecular Biology reporter, 16:1-10 [0264] Horsch et al., 1985, Science 227: 1229-1231 [0265] Lingens et al., 1967, European J. Biochem 1: 363-374 [0266] Maniatis T., Fritsch E. F., in Molecular cloning, Sambrook, 1982. [0267] Mannhaupt et al., 1989, Gene 85, 303-311 [0268] Matringe et al., 2005, Pest Management Science 61:269-276 [0269] Mitchell et al., 2001, Pest Management Science 57:120-128 [0270] Pallett et al., 2001, Pest Management Science 57:133-142 [0271] Sambrook et al., 1989, Molecular cloning: a laboratory manual, second edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) [0272] Sambrook J. and Russell D., 2001, Molecular Cloning: A laboratory Manual (third edition), ISBN 978-087969577-4 CSHL Press [0273] Sampathkumar and Morrisson, 1982, Bioch Biophys Acta 701: 204-211 [0274] Sawahel W. A., 2001, Plant Molecular Biology reporter, 19:377a-377f [0275] Schulz et al., 1993, FEBS Letters 318:162-166 [0276] Xia et al., 1992, J. Gen. Microbiol. 138(7), 1309-1316 [0277] Zapata C., 1999, theoretical Applied Genetics, 98(2):1432-2242