METHOD FOR ASSAYING ARYLSULFATASE ACTIVITY

20190040446 ยท 2019-02-07

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a method for determining activity of arylsulfatase in an aqueous system, which comprises a step in which arylsulfatase is subjected to reaction with a substrate, from which fluorophore or chromophore is liberated by suffering an action of the arylsulfatase, in an aqueous reaction system having high ionic strength. Also, provided are a lactase preparation having a lactase activity of 4,000 NLU/g or more according to the FCC IV method and having an arylsulfatase activity of 0.1% or less of the lactase activity as the basis, in which the arylsulfatase activity has been determined by the method for determining activity of arylsulfatase in an aqueous system according to the fluorescence method of the present invention; a method for producing this preparation; and a dairy product which comprises using this preparation.

Claims

1.-13. (canceled)

14. A method for producing a lactase preparation characterized by: culturing a diploid strain of yeast having a lactase gene, in which expression of arylsulfatase protein is restricted, or a gene-recombinant microorganism in which a lactase gene of yeast has been transformed and expression of arylsulfatase protein is restricted; gathering yeast or microorganism cells without destroying their cell walls, gathering culture fluid with yeast or microorganism cells after destruction of their cell walls, or gathering culture fluid without destroying cell walls; and preparing a lactase preparation by using, as a raw material, the gathered yeast or microorganism cells and/or gathered culture fluid without a step for removing arylsulfatase; wherein the lactase preparation has a lactase activity of 4.000 NLU/a or more according to the FCC IV method; and wherein the lactase preparation has an arylsulfatase activity of 0.1% or less of the lactase activity as the basis, in which the arylsulfatase activity (unit: U/g) has been determined and calculated by the method comprising following steps (1) to (10): (1) a specimen in which the existence of the arylsulfatase is predicted is arbitrarily diluted with 100 mM potassium phosphate buffer (pH6.5) comprising 0.5M potassium chloride to obtain a sample, (2) an aqueous solution comprising potassium 4-methylumbelliferone sulfate in a concentration of 2 mM is prepared, (3) the sample and the aqueous potassium 4-methylumbelliferone sulfate solution are mixed with each other at a ratio of 1:1 (volume basis) and are reacted at 37 degrees Celsius for 3 hours, (4) to the reacted solution, 0.1N aqueous sodium hydroxide solution having the same amount (volume basis) as that of the reacted solution is added to stop the reaction, thus obtaining a sample for determination, (5) fluorescence intensity is determined at an excitation wavelength of 360 nm and a fluorescence wavelength of 450 nm, (6) 4-methylumbelliferone is dissolved in 100 mM potassium phosphate buffer (pH6.5) comprising 0.5M potassium chloride to obtain a solution having an appropriate concentration, 0.1N aqueous sodium hydroxide solution is added in a similar way as that in step (4), and fluorescence intensity is determined under the same conditions as those in step (5), (7) from step (6), a calibration curve is prepared, (8) from the fluorescence intensity that was determined in step (5) and the calibration curve that was prepared in step (7), the concentration of 4-methylumbelliferone of the sample for determination is calculated, and the calculated value is divided by 3, thus obtaining the concentration of the 4-methylumbelliferone in the case where the reaction time of period is 1 hour; further from the volume of the reacted solution, the amount of the 4-methylumbelliferone that was liberated by the reaction of one hour is calculated, (9) because the amount of the 4-methylumbelliferone thus calculated is based on the amount of the specimen that was contained in the sample prepared in step (1), the calculated amount is converted to that of the 4-methylumbelliferone per 1 g of the specimen, and (10) when the amount of the 4-methylumbelliferone that was liberated per 1 hour of the time of period of the reaction of the substrate and the enzyme is 1 nmole, it is defined as 1 unit (U), and the unit is shown as a unit amount per 1 g of the specimen (i.e., an enzyme preparation), namely, unit (U)/g.

15. (canceled)

16. The method of claim 14, wherein the lactase preparation has an arylsulfatase activity of 0.02% or less of the lactase activity as the basis.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0037] FIG. 1 It is a graph that shows a result of determination of arylsulfatase activity by a colorimetric method.

[0038] FIG. 2 It is a graph that shows a result of determination of arylsulfatase activity by a fluorescence method.

[0039] FIG. 3 It is a schematic diagram that shows a method for constructing a vector pdSuC1 for disrupting arylsulfatase gene.

[0040] FIG. 4 It is a schematic diagram that shows a method for constructing a vector pdSuCM6 for disrupting arylsulfatase gene.

[0041] FIG. 5 It is a schematic diagram that shows a method for introducing two vectors for disrupting arylsulfatase genes.

[0042] FIG. 6 It is a photograph that shows results of Southern blottings of a strain comprising two arylsulfatase genes, another strain in which one arylsulfatase gene has been disrupted, and the other strain in which two arylsulfatase genes have been disrupted.

EMBODIMENTS FOR PERFORMING INVENTION

[0043] First, a method for determining activity of arylsulfatase will be explained.

[0044] The method that has been conventionally known as a method for determining activity of arylsulfatase is a colorimetric one, in which a compound comprising a chromophore such as p-nitrophenol and a sulfate group that is coupled to the chromophore is used as a substrate. In this method, the amount of the chromophore is determined by absorbance, in which the chromophore has been liberated because the sulfate group has left from the substrate by a reaction of the substrate with arylsulfatase. However when the amount of the liberated chromophore such as p-nitrophenol is low, the change of the absorbance is small and thus it is difficult to obtain a clear determination value.

[0045] As a method for determining activity of arylsulfatase, a fluorescence method has also been known (Method in Enzymology, 11/21), in which a compound comprising a fluorophore and a sulfate group that is coupled to the fluorophore, e.g., 4-methylumbelliferone sulfate, is used as a substrate. It is said that the sensitivity of a fluorescence method is generally at least hundred times that of a colorimetric one.

[0046] The present inventors have studied the conditions for determination, under which conditions a sensitivity higher than that of a conventional colorimetric or fluorescence method can be attained in a method for determining activity of arylsulfatase in an aqueous system. They have arrived at a version that the arylsulfatase activity can be determined with a high sensitivity by increasing ionic strength in a reaction system of an enzyme with a substrate. Thus, they have established the method for determining activity of arylsulfatase according to the present invention. It has been absolutely unknown in the past that by increasing ionic strength in an aqueous reaction system when arylsulfatase is reacted with its substrate, the enzyme reaction is remarkably activated and as a result a chromophore or fluorophore is liberated in a more amount. By performing the method for determining activity of arylsulfatase in an aqueous system according to the present invention in a fluorescence method, it has become possible to exactly know the amount of arylsulfatase contaminated in a lactase preparation. As a result, it has become possible to provide a lactase preparation, of which arylsulfatase amount is zero or a very, very small.

[0047] The method for determining activity of arylsulfatase in an aqueous system according to the present invention is characterized in that when arylsulfatase is reacted with its substrate (with the proviso that the substrate liberates fluorophore or chromophore by suffering an action of the arylsulfatase), ionic strength of the reaction system is increased. Specific means for increasing the ionic strength in the reaction system include one wherein an inorganic salt is coexisted and another one wherein the enzyme reaction is performed in a buffer system.

[0048] Examples of inorganic salts that should be added to the reaction system include potassium chloride, sodium chloride, ammonium sulfate, and the like. The concentration of such an inorganic salt is, for example, 10 to 1000 mM, and preferably 50 to 500 mM in the reaction system. Examples of buffer include phosphate buffers such as phosphoric acid-potassium phosphate buffers (wherein the concept of potassium phosphate includes potassium dihydroxyphosphate, dipotassium hydroxyphosphate, and tipotassium phosphate), phosphoric acid-sodium phosphate buffers (wherein the concept of sodium phosphate includes sodium dihydroxyphosphate, disodium hydroxyphosphate, and trisodium phosphate), and phosphate buffered saline, which do not denature an enzyme protein. The concentration of the buffer in the reaction system is, for example, 10 to 200 mM, and preferably 50 to 200 mM. To coexist the inorganic salt in the reaction system, for example, an inorganic salt may be added to an aqueous solution of a specimen in which the existence of arylsulfatase is predicted (for example, one obtained by dissolving the specimen in water or a buffer), or an inorganic salt may be added to an aqueous solution of a substrate.

[0049] A typical example of the method for determining activity of arylsulfatase in an aqueous system according to the present invention is as follows:

[0050] (1) A specimen in which the existence of arylsulfatase is predicted is arbitrarily diluted with 100 mM potassium phosphate buffer (pH6.5) comprising 0.5M potassium chloride to obtain a sample.

[0051] (2) An aqueous solution comprising potassium 4-methylumbelliferone sulfate in a concentration of 2 mM is prepared.

[0052] (3) The sample and the aqueous potassium 4-methylumbelliferone sulfate solution are mixed with each other at a ratio of 1:1 (volume basis) and are reacted at 37 degrees Celsius for 3 hours.

[0053] (4) To the reacted solution, 0.1N aqueous sodium hydroxide solution having the same amount (volume basis) as that of the reacted solution is added to stop the reaction, thus obtaining a sample for determination.

[0054] (5) Fluorescence intensity is determined at an excitation wavelength of 360 nm and a fluorescence wavelength of 450 nm.

[0055] (6) 4-Methylumbelliferone is dissolved in 100 mM potassium phosphate buffer (pH6.5) comprising 0.5M potassium chloride to obtain a solution having an appropriate concentration, 0.1N aqueous sodium hydroxide solution is added in a similar way as that in step (4), and fluorescence intensity is determined under the same conditions as those in step (5).

[0056] (7) From step (6), a calibration curve is prepared.

[0057] (8) From the fluorescence intensity that was determined in step (5) and the calibration curve that was prepared in step (7), the concentration of 4-methylumbelliferone of the sample for determination is calculated, and the calculated value is divided by 3, thus obtaining the concentration of the 4-methylumbelliferone in the case where the reaction time of period is 1 hour. Further, from the volume of the reacted solution, the amount of the 4-methylumbelliferone that was liberated by the reaction of 1 hour is calculated.

[0058] (9) Because the amount of the 4-methylumbelliferone thus calculated is based on the amount of the specimen that was contained in the sample prepared in step (1), the calculated amount is converted to that of the 4-methylumbelliferone per 1 g of the specimen.

[0059] (10) When the amount of the 4-methylumbelliferone that was liberated per 1 hour of the time of period of the reaction of the substrate and the enzyme is 1 nmole, it is defined as 1 unit (U), and the unit is shown as a unit amount per 1 g of the specimen (i.e., an enzyme preparation), namely, unit (U)/g.

[0060] The lactase preparation according to the present invention has a lactase activity of 4,000 NLU/g or more (preferably 4,500 NLU/g or more, still more preferably 5,000 NLU/g or more) according to the FCC IV method (Food Chemicals Codex Fourth Edition, effective Jul. 1, 1996, Committee on Food Chemicals odex p.p. 801-802), and an arylsulfatase activity of 0.1% or less (preferably 0.02% or less) of the lactase activity (unit: NLU/g) of the FCC IV method as the basis, in which the arylsulfatase activity is determined and calculated by the method that is described above as a specific example of the method for determining activity of arylsulfatase according to the present invention.

[0061] In the production of the lactase preparation according to the present invention, a diploid strain of yeast having a lactase gene is used, in which strain expression of arylsulfatase protein is restricted and by which strain lactase protein is produced. Further, the diploid strain of yeast that is used in the present invention is one that produces lactase protein with a high activity, which can provide a lactase preparation of 4,000 NLU/g or more as it is or by concentrating it. The diploid strain of yeast is, for example, a mutant that can be obtained by treating a microorganism to mutate it. Such a mutant can be obtained by, for example, a method wherein a diploid strain of yeast that produces lactase protein with high activity is exposed to ultraviolet irradiation or a chemical mutagen to perform mutation, thus disrupting or deleting arylsulfatase genes or genes to regulate expression of arylsulfatase protein about both genes of the diploid, or a method wherein arylsulfatase genes or genes to regulate expression of arylsulfatase protein are deleted by genetic engineering procedures about both genes of the diploid. To know whether a desired mutant can be obtained, arylsulfatase activity of a culture fluid in which the mutated yeast has been cultured should be determined by the method (fluorescence method) for determining activity of arylsulfatase according to the present invention.

[0062] Mutation induction by ultraviolet is performed by, for example, irradiating ultraviolet to a suspension of a diploid yeast. Chemical mutagenesis is performed by, for example, adding a chemical mutagen to a suspension of a diploid yeast. Examples of the chemical mutagen include 5-bromouracil, 2-aminopurine, nitrous acid, hydroxyl-amine, acriflavine, methanesulfonate compounds, nitrosoguanidine and the like.

[0063] To delete arylsulfatase genes or genes to regulate expression of an arylsulfatase protein by genetic engineering procedures, common genetic engineering procedures should be applied, for example, obtaining a gene fragment having a sequence that is homologous to the sequence of the gene that is intended to be deleted, sub-cloning the fragment to a vector to construct a new vector for disrupting the gene that is intended to be deleted, and transforming a diploid strain of yeast by using the new vector.

[0064] In the production of the lactase preparation according to the present invention, a gene-recombinant microorganism that produces lactase protein with high activity can also be used, in which a lactase gene of yeast has been transformed so that lactase protein is expressed and expression of arylsulfatase protein is restricted. As described before, expression of arylsulfatase protein is restricted means that arylsulfatase protein is not produced or its production amount is reduced, because, for example, genes that relate to the production of arylsulfatase protein are restricted, specifically because there are no arylsulfatase gene and/or no gene to regulate expression of arylsulfatase protein, or, because an arylsulfatase gene (structure gene) has been disrupted or an expression regulating gene that encourages arylsulfatage gene to express arylsulfatase protein has been disrupted.

[0065] The gene-recombinant microorganism in which a lactase gene of yeast has been transformed and expression of arylsulfatase protein is restricted can be produced by a known method. For example, to a plasmid that is tolerant to medicine A, a lactase gene is inserted, with a gene to regulate expression of lactase gene if necessary. By using the plasmid to express lactase thus prepared, a microorganism as a host is transformed. The microorganism that has been transformed is cultured in a medium comprising medicine A, and appeared colonies are selected.

[0066] As the host to obtain the gene-recombinant microorganism in which lactase gene of yeast has been transformed and expression of arylsulfatase protein is restricted, Escherichia coli yeast, Bacillus subtilis, and the like can be used.

[0067] As the host to obtain the gene-recombinant microorganism in which lactase gene of yeast has been transformed and expression of arylsulfatase protein is restricted, it is preferable to use a host intrinsically having no arylsulfatase gene nor a gene to regulate expression of arylsulfatase protein, or another host of which arylsulfatase gene or a gene to regulate expression of arylsulfatase protein has been disrupted or deleted.

[0068] The lactase for the lactase preparation is produced by culturing a diploid strain of yeast having a lactase gene in which expression of arylsulfatase protein is restricted or a gene-recombinant microorganism in which a lactase gene of yeast has been transformed and expression of arylsulfatase protein is restricted, wherein the diploid strain of yeast and the microorganism produce lactase protein having high activity; gathering the yeast or microorganic cells without destroying their cell walls, gathering culture fluid with yeast or microorganic cells after destruction of their cell walls, or gathering culture fluid without destroying cell walls; and using as a raw material the gathered yeast or microorganic cells and/or the culture fluid, without any step for removing arylsulfatase. The concept of culture fluid includes also a culture supernatant.

[0069] To culture microorganism such as yeast, an incubator such as a flask, a jar, and a tank can be used. As the culturing conditions, temperature, pH, a stirring number, and the like, which are suitable for an enzyme production by the microoraganism, are selected.

[0070] After the completion of culture, a culture fluid comprising lactase dissolved is obtained by generally destroying cell walls. In the case where the microorganism that has been cultured secretes lactase, it may be unnecessary to destroy the cell walls. In the case where a culture fluid is not used and only yeast cells (or microorganic cells) have been gathered, then cell walls of the yeast cells (or microorganic cells) are destroyed in distilled water, and constituents contained in the cells are dissolved in the distilled water to be an aqueous solution comprising the yeast cells (or microorganic cells).

[0071] The culture fluid or the aqueous solution comprising or not comprising the yeast or microorganic cells is generally divided into supernatant and residues by an appropriate method such as centrifugation, filtration, or the like, which is commonly performed in this technical field. The supernatant may be used as an enzyme fluid as it is. Or after its concentration is increased by using ultrafiltration membrane or the like, the concentrated one may be used as an enzyme fluid. The enzyme fluid may be pulverized by a method such as spray dry, freeze dry, or the like. The enzyme fluid itself can also be used as a lactase preparation.

[0072] The lactase preparation according to the present invention is produced by using a diploid strain of yeast or a microorganism that produces lactase protein having high activity and does not produce arylsulfatase protein or produces it only infinitesimal quantity. Therefore, generally it is unnecessary to do, for removing arylsulfatase only, one or more operations among purification operations such as adsorption, chromatography, crystallization, and the like by using the culture fluid or the like. The method for producing a lactase preparation according to the present invention does not include any step for removing arylsulfatase. As described before, purification methods by which lactase protein is not separated from arylsulfatase protein, such as solvent fractionation, ammonium sulfate fractionation, and the like, are not included within the definition of a step for removing arylsulfatase.

[0073] An essential constituent of the lactase preparation according to the present invention is lactase. In the lactase preparation, any other constituent may exist, as long as the substance does not inhibit the activity of lactase and its amount is one by which the activity of lactase is not inhibited; or as long as the substance does not undesirably interact with an objective for which the lactase preparation is used. Examples of the substance that may exist include those that contribute stabilization of lactase, such as metallic salts, various sugars, ascorbic acid, glycerol, and the like, excipients that are used to increase usability, such as starches and dextrin, and inorganic salts and the like that have buffering action. The state of the lactase preparation is not particularly restricted. Its state may be, for example, powder, granule, solution, or the like.

[0074] The present invention also relates to dairy products that have been produced by using the lactase preparation according to the present invention. The dairy products include milks such as shelf-stable milk at ordinary temperatures (UHT milk), yoghurts, fresh creams, sour creams, cheeses, and the like. The lactase preparation is used by a method and in usage (with the proviso that the amount is calculated based on its lactase activity) that are common in this technical field.

EXAMPLES

[0075] Below, the present invention will be specifically explained by referring to Examples.

[Example 1] Development of Method for Determining Arylsulfatase Activity (Part 1)

[0076] GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.) was subjected to 5-fold dilution with 100 mM potassium phosphate buffer (pH 6.5) containing 0, 0.2, 0.5, or 1.0M potassium chloride. To 0.5 mL of each solution, 0.5 mL of p-nitrophenyl sulfate in 100 mM potassium phosphate buffer (pH 6.5) was added and the solution was allowed to react at 37 degrees Celsius for 3 hours. The reaction was stopped by adding to the solution 1.5 mL of 1.5N aqueous sodium hydroxide solution and the absorbance was determined at 410 nm. Relative values are shown in Table 1, in which the case where there is no potassium chloride is specified as 100%.

TABLE-US-00001 TABLE 1 Increase of Determined Value of Arylsulfatase Activity by Potassium Chloride Concentration of Potassium Chloride 0 0.1 0.25 0.5 in Reaction System (M) Relative Value (%) 100 230 350 420

[0077] As shown in Table 1, the determined values of arylsulfatase activity increased by the addition of potassium chloride. In other words, by the addition of potassium chloride, a higher sensitive assay was able to be attained.

[Example 2] Development of Method for Determining Arylsulfatase Activity (Part 2)

[0078] (1) GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.) was subjected to 100-fold dilution with 100 mM potassium phosphate buffer (pH 6.5) containing 0, 125, 250, 500, or 1,000 mM sodium chloride. To 0.5 mL of each solution, 0.5 mL of 2 mM aqueous potassium 4-methylumbelliferone sulfate solution was added and the solution was allowed to react at 37 degrees Celsius for 3 hours. The reaction was stopped by adding to the solution 10 mL of 0.1N aqueous sodium hydroxide solution and the fluorescence intensity was determined at an excitation wavelength of 360 nm and a fluorescence wavelength of 450 nm. Relative values are shown in Table 2, in which the case where there is no sodium chloride is specified as 100%.

[0079] (2) The reaction and determination of fluorescence were performed in the same way as those described in the above (1), except that 100 mM sodium phosphate buffer (pH 6.5) was used as the diluent for the enzyme instead of 100 mM potassium phosphate buffer (pH 6.5). The results are shown in Table 2.

[0080] (3) The reaction and determination of fluorescence were performed in the same way as those described in the above (1), except that potassium chloride was added to the diluent for the enzyme instead of sodium chloride. The results are shown in Table 2.

[0081] (4) The reaction and determination of fluorescence were performed in the same way as those described in the above (1), except that 100 mM sodium phosphate buffer (pH 6.5) was used instead of 100 mM potassium phosphate buffer (pH6.5) as the diluent for the enzyme, and that potassium chloride was added to the diluent for the enzyme instead of sodium chloride. The results are shown in Table 2.

TABLE-US-00002 TABLE 2 Increase of Determined Value of Arylsulfatase Activity by Combination of Inorganic Salt and Buffer Type of Concentration of Buffer and Inorganic Salt in Concentration in Reaction System (nM) Relative Value (%) Reaction System Type of Inorganic Salt 0 62.5 125 250 500 50 mM Potassium Sodium Chloride 100 230 310 440 600 Phosphate Buffer 50 mM Sodium Sodium Chloride 100 200 310 410 550 Phosphate Buffer 50 mM Potassium Potassium Chloride 100 230 330 460 640 Phosphate Buffer 50 mM Sodium Potassium Chloride 100 220 340 470 600 Phosphate Buffer

[0082] As shown in Table 2, the determined values of arylsulfatase activity increased at an approximately similar rate when sodium chloride or potassium chloride was added as an inorganic salt, and the reaction and determination were performed in potassium phosphate or sodium phosphate buffer.

[Example 3] Development of Method for Determining Arylsulfatase Activity (Part 3)

[0083] (1) GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.) was subjected to 100-fold dilution with 100 mM, 125 mM, 250 mM, 500 mM, or 1,000 mM potassium phosphate buffer (pH 6.5). To 0.5 mL of each solution, 0.5 mL of 2 mM aqueous potassium 4-methylumbelliferone sulfate solution was added and the solution was allowed to react at 37 degrees Celsius for 3 hours. To the solution, 1.0 mL of 0.1N aqueous sodium hydroxide solution (for 100 mM, 125 mM, and 250 mM potassium phosphate buffers) or 1.0N aqueous sodium hydrochloride solution (for 500 mM and 1,000 mM potassium phosphate buffers) was added to stop the reaction, and the fluorescence intensity was determined at an excitation wavelength of 360 nm and a fluorescence wavelength of 450 nm. Relative values are shown in Table 3, in which the case where 100 mM potassium phosphate buffer was used is specified as 100%.

[0084] (2) The reaction was performed in the same way as that described in the above (1), except that the enzyme was diluted with 100 mM potassium phosphate buffer (pH 6.5) and 0, 125, 250, 500, or 1,000 mM ammonium sulfate was added. For the system to which 1,000 mM ammonium sulfate had been added, 1.0 mL of 1.0N aqueous sodium hydroxide solution was added to stop the reaction, and for other systems, 1.0 mL of 0.1N aqueous sodium hydroxide solution was added to stop the reaction. The fluorescence intensity was determined at an excitation wavelength of 360 nm and a fluorescence wavelength of 450 nm. Relative values are shown in Table 4, in which the determined value of activity of the system comprising no ammonium sulfate added is specified as 100%.

[0085] (3) The reaction and determination of fluorescence were performed in the same way as those described in the above (2), except that 0, 125, 250, 600, or 1,000 mM glucose was added to the diluent of the enzyme instead of ammonium sulfate. The results are shown in Table 4.

TABLE-US-00003 TABLE 3 Increase of Determined Value of Arylsulfatase Activity by Potassium Phosphate Buffer Concentration of Potassium Phosphate 60 62.5 125 250 500 Buffer in Reaction System (mM) Relative Value (%) 100 140 190 160 170

TABLE-US-00004 TABLE 4 Increase of Determined Value of Arylsulfatase Activity by Combination of Additive and Buffer Type of Buffer and Concentration of Additive Its Concentration in in Reaction System (mM) Relative Value (%) Reaction System Type of Additive 0 62.5 125 250 500 50 mM Potassium Ammonium Sulfate 100 270 370 390 400 Phosphate Buffer 50 mM Potassium Glucose 100 140 190 160 170 Phosphate Buffer

[0086] As shown in Table 3, although the increase in buffer concentration also contributed to rise of determined values of arylsulfatase activity, the effect was small. Further, as shown in Table 4, the addition of ammonium sulfate increased the determined values of arylsulfatase activity, whereas glucose showed a minor effect to increase the determined values of arylsulfatase activity.

[Example 4] Confirmation of Step in which Effect of Addition of Inorganic Salt is Arisen

[0087] It was confirmed that the effect of addition of an inorganic salt is due to promoted enzyme reaction or enhanced fluorescence intensity of fluorophore.

[0088] GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.) was subjected to 100-fold dilution with 100 mM potassium phosphate buffer (pH 6.5). Further, it was separately subjected to 100-fold dilution with 100 mM potassium phosphate buffer (pH 6.5) containing 0.5M potassium chloride. To 0.5 mL of each solution, 0.5 mL of 2 mM aqueous potassium 4-metylumbeliferone sulfate solution was added and the solution was allowed to react at 37 degrees Celsius for 1 hour. To the solution, 1.0 mL of 0.1N aqueous sodium hydroxide solution was added to stop the reaction. To 200 L of each solution after stopping the reaction, 200 L of an aqueous solution containing potassium chloride at a concentration of 0 mM, 125 mM, 250 mM, 500 mM, or 1,000 mM was added, and the fluorescence intensity was determined at an excitation wavelength of 360 nm and a fluorescence wavelength of 450 nm. As a blank, a solution was used, which solution had been prepared by adding 0.1N aqueous sodium hydroxide solution to a diluted enzyme solution to inactivate and then adding aqueous potassium 4-metylumbelliferon sulfate solution.

[0089] Relative values are shown in Table 5, in which the case where the lactase preparation that had been subjected to 100-fold dilution with 100 mM potassium phosphate buffer (pH 6.5) was used for the reaction and potassium chloride was not added after stopping the reaction (200 L of distilled water with potassium chloride concentration of 0 mM was added) is specified as 100%.

TABLE-US-00005 TABLE 5 Confirmation of Step in which Effect by Addition of Inorganic Salt Is Shown Concentration of Potassium Chloride (mM) in Aqueous Potassium Chloride Solution That Was Added after Stopping Reaction Relative Value (%) Condition during Reaction 0 125 250 500 1000 In Case where Reaction Was 100 100 100 100 100 Performed in 50 mM Potassium (basis) Phosphate Buffer (%) In Case where Reaction Was 520 520 520 510 490 Performed in 50 mM Potassium Phosphate Buffer +250 mM Potassium Chloride (%)

[0090] As shown in Table 5, when the inorganic salt had been added before starting the reaction, i.e., when the enzyme reaction was performed in the presence of the inorganic salt, the fluorescence intensity was enhanced, whereas the fluorescence intensity was not enhanced, when the inorganic salt was added after the completion of the enzyme reaction. Accordingly, it became clear that because the inorganic salt promoted the enzyme reaction to increase the absolute amount of the fluorophore liberated, the fluorescence intensity was enhanced.

[Example 5] Determination of Arylsulfatase Activity by Conventional Colorimetric Method

[0091] GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.) was diluted with distilled water to obtain a 1% (w/v) solution. The solution was diluted with 100 mM potassium phosphate buffer (pH 6.5) containing 0.5M potassium chloride to obtain 0.8% (w/v), 0.6% (w/v), 0.4% (w/v), and 0.2% (w/v) solutions. To 0.5 mL of each solution, 0.5 mL of 100 mM potassium phosphate buffer (pH 6.5) containing 20 mM p-nitrophenyl sulfate was added and the solution was allowed to react at 37 degrees Ceisius for 3 hours. The reaction was stopped by adding to this solution 1.5 mL of 1.5N aqueous sodium hydroxide solution, and the absorbance was determined at 410 nm.

[0092] The results are shown in FIG. 1. By the colorimetric method, no arylsulfatase activity was detected for the 1% (w/v) solution of the enzyme preparation.

[Example 6] Determination of Arylsulfatase Activity by Fluorescence Method

[0093] GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.) was diluted with 100 mM potassium phosphate buffer (pH 6.5) containing 0.5M potassium chloride to obtain a 1% (w/v) solution. This 1% solution was further diluted with the same buffer to obtain 0.8% (w/v), 0.6% (w/v), 0.4% (w/v), and 0.2% (w/v) solutions.

[0094] To 0.5 mL of each solution, 0.5 mL of 2 mM aqueous potassium 4-methylumbelliferyl sulfate solution was added and the solution was allowed to react at 37 degrees Celsius for 3 hours. To this solution, 1.0 mL of 0.1N aqueous sodium hydroxide solution was added to stop the reaction, and the fluorescence intensity was determined at an excitation wavelength of 360 nm and a fluorescence wavelength of 450 nm.

[0095] The results are shown in FIG. 2. By the fluorescence method, unlike the colorimetric method, the solutions of the enzyme preparation having its concentration of 1% (w/v) or lower also showed good quantitative performance.

[Example 7] Comparison of Colorimetric and Fluorescence Methods in Arylsulfatase Activity Determination

[0096] The difference between sensitivities of colorimetric and fluorescence methods in the determination of arylsulfatase activity was studied. First, purified lactase for use in this experiment was prepared.

[0097] (Preparation of Purified Lactase)

[0098] To 50 kg of GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.), water was added to desalt by using an ultrafiltration membrane (ACP membrane, produced by Asahi Kasei Corp.) until the conductivity became 3mSv or lower. The total amount was adjusted to 125 L by adding water. Then, it was adsorbed to ion exchange resin (DEAE TOYOPEARL 650M, 40 cm, 50 L, produced by Tosoh Corp.) pre-equilibrated with 10 mM potassium phosphate buffer (pH 7). The resin was washed with 40 L of 10 mM potassium phosphate buffer (pH 7) containing 50 mM sodium chloride, and then lactase was eluted with 200 L of 10 mM potassium phosphate buffer (pH 7) containing 100 mM sodium chloride. Upon elution, the eluate was divided into 20 L fractions. The lactase activity (by the FCC IV method; Food Chemicals Coder 4th Edition, Effective Jul. 1, 1996, Committee on Food Chemicals Codex, p.p. 801-802) and arylsulfatase activity (by the fluorescence method; it will be described below in detail) of each fraction were determined, and fractions with reduced arylsulfatase were collected, mixed, and concentrated using an ultrafiltration membrane (ACP membrane, produced by Asahi Kasei Corp.) to obtain a concentrated lactase solution. To this concentrated solution, glycerol was added to be 50% (w/v). Thus, a purified lactase preparation was obtained.

[0099] Arylsulfatase activity of GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.) and the purified lactase preparation prepared as described above, both of which had lactase activity by the FCC IV method of 5,000 to 5,500 NLU/g, were determined (the fluorescence method; it will be described below in detail). The arylsulfatase activity of purified lactase preparation was determined as being 1/840 as compared to that of pre-purification (see Table 6 below).

[0100] (Preparation of Enzyme Preparations with Various Contamination Rates of Arylsulfatase)

[0101] The purified lactase preparation prepared as described above and GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.) were appropriately mixed to prepare lactase preparations with various contamination rates of arylsulfatase, and the lactase activity (by the FCC IV method) and the arylsulfatase activity (by the calorimetric and fluorescence methods) were determined.

[0102] (Determination of Arylsulfatase Activity by Colorimetric Method)

[0103] To 0.5 mL of the lactase preparation, 0.5 mL of 100 mM potassium phosphate buffer (pH 6.5) containing 20 mM p-nitrophenyl sulfate was added and the solution was allowed to react at 37 degrees Celsius for 3 hours. To this solution, 1.5 mL of 1.5N aqueous sodium hydroxide solution was added to stop the reaction, and the absorbance was determined at 410 nm.

[0104] Separately, aqueous solutions containing p-nitrophenol at a concentration of 0 to 0.5 mM were prepared. To 0.5 mL of each solution, 0.5 mL of 100 mM potassium phosphate buffer (pH 6.5) was added. Further, 1.5 mL of 1.5N aqueous sodium hydroxide solution was added to obtain samples for determination. The absorbance at 410 nm was determined to prepare a calibration curve.

[0105] From the calibration curve, the concentration of p-nitrophenol contained in 1 mL of the reaction solution was determined, and divided by 3 (because the reaction time was 3 hours), to calculate the p-nitrophenol concentration for the reaction time of period of 1 hour. Then, from this concentration, the amount of p-nitrophenol contained in 1 mL of the reaction solution (unit: nmole) was calculated, and multiplied by 2 (for converting the value into per 1 g, because the amount of lactase preparation used was 0.5 g), to calculate the arylsulfatase activity. One U corresponds to the activity which produces 1 nmole of p-nitrophenol in 1 hour, and the arylsulfatase activity is represented by the unit U/g-enzyme preparation.

[0106] (Determination of Arylsulfatase Activity by Fluorescence Method)

[0107] The lactase preparation was diluted with 100 mM potassium phosphate buffer (pH 6.5) containing 0.51M potassium chloride to obtain a 1% (w/v) solution. To 0.5 mL of this 1% solution, 0.5 mL of 2 mM aqueous potassium 4-methylumbelliferyl sulfate solution was added and the solution was allowed to react at 37 degrees Celsius for 3 hours. To the solution 1 mL of 0.1N aqueous sodium hydroxide solution was added to stop the reaction, and the fluorescence intensity was determined at an excitation wavelength of 360 nm and a fluorescence wavelength of 450 nm.

[0108] Separately, 100 mM potassium phosphate buffers (pH 6.5) containing 0.5M potassium chloride and 4-methylumbelliferone at a concentration of 0 to 4 M were prepared. To 1.0 mL of each solution, 1 mL of 0.1N aqueous sodium hydroxide solution was added to obtain samples for determination. The fluorescence intensity was determined at an excitation wavelength of 360 nm and a fluorescence wavelength of 450 nm to prepare a calibration curve.

[0109] From the calibration curve, the concentration of 4-methylumbelliferone contained in 1 mL of the reaction solution was determined and it was divided by 3 (because the reaction time of period was 3 hours). Then, from the volume of the reaction solution, the absolute amount of 4-methylumbelliferone produced during the reaction was calculated. The amount was further multiplied by 200 (for converting the value into per 1 g of the specimen (lactase preparation), because the amount of lactase preparation used was 0.50.01=0.005 g), and thereby arylsulfatase activity was calculated. One U is such an activity that nmole of 4-methylumbelliferone is produced in 1 hour, and the arylsulfatase activity is represented by the unit U/g-enzyme preparation.

[0110] (Results)

[0111] The results are shown in Table 6. By the colorimetric method, determination was not possible when the content of arylsulfatase decreased, whereas by the fluorescence method it was possible to accurately determine until the concentration area of about 1/100 of the detection limit by the colorimetric method.

TABLE-US-00006 TABLE 6 Lactase Activity and Arylsulfatase Activity of Lactase Preparations Containing Arylsulfatase in Various Contamination Rates Arylsulfatase Arylsulfatase Activity (U/g) Activity of Method This Lactase Conventional of Invention/ Activity Colorimetric This Lactase (NLU/g) Method Invention Activity (%) GODO-YNL2 5400 39 84 1.56 Mixture of (5500) 8.7 20 0.36 GODO-YNL2 with (5400) ND 15 0.28 Purified Lactase (5300) ND 1 0.02 Purified Lactase 5500 ND 0.1 0.002 ND: Not Detected

[Example 8] Comparison of Fluorescence Method and the Method as Stated in WO07/060247 (Japanese Patent Laid-Open No. 2009-517061) in Determination of Arylsulfatase Activity, and Organoleptic Examination for Taste (Part 1)

[0112] In WO07/060247, it is described that a lactase preparation contaminated with 19 units (units that are defined in WO07/060247) or less of arylsulfatase does not produce off-flavor when the preparation is added to decompose lactose after sterilization of milk. However, this is an observation based on an examination that was performed with the limited lactase reaction time of period of 2 days. On the other hand, when a lactase preparation is actually added to shelf-stable milk at ordinary temperatures (UHT milk), it is thought that enzyme reaction would proceed for a long term of 1 month or more. Therefore, lactase preparations containing arylsulfatase at various contaminating rates were prepared and their taste was confirmed after predetermined days from the addition of the preparations to milk.

[0113] (Preparation of Lactase Preparations with Various Contamination Rates of Arylsulfatase)

[0114] Lactase preparations A to E having various contamination rates of arylsulfatase were produced by appropriately mixing the purified lactase preparation prepared in Example 7 and selected GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.) containing 100 units (based on that described in WO07/060247) of arylsulfatase activity.

[0115] The arylsulfatase activity of each of thus prepared lactase preparations A to E was determined by the method described in WO07/060247 and the fluorescence method shown in Example 7 above. Further, the lactase activity was determined by the FCC IV method. The results are shown in Table 7. In this Table, the unit as described in WO07/060247 means OD.sub.41010.sup.6/hour/NLU.

TABLE-US-00007 TABLE 7 Arylsulfatase Activity in Lactase Preparations Containing Arylsulfatase in Various Contamination Rates Arylsulfatase Activity (unit) that Arylsulfatase Was Determined Activity Arylsulfatase by the Method (U/g) that Was Activity Described in Determined of This Name of Lactase WO07/060247 by the Invention/ Preparation and (Japanese Patent Method of Lactase Lactase Activity Laid-open No. Present Activity (NLU/g) 2009-517061) Invention (%) A (5500) ND 0.1 0.002 B (5500) ND 1.0 0.02 C (5500) 8 27 0.5 D (5500) 18 59 1.1 E (5500) 100 320 5.8 ND: Not Detected

[0116] (Organoleptic Examination of Taste)

[0117] Referring to Example 4 of WO07/060247, each of the lactase preparations A to E was added to a commercially available cow milk (heat-sterilized one; sterile conditions: 130 degrees Celsius, 2 seconds) so that the lactase content would become 20,000 NLU/L-milk, and was kept at 30 degrees Celsius. After 2 days, 1 month, and 3 months of storage, an organoleptic examination was performed for the cow milk to which no lactase preparation had been added and the milks to which lactase preparations had been added.

[0118] The organoleptic examination was performed as a blind study. Eleven to thirteen panelists smelled and held in mouth the milk after storage for a certain period of time to judge the presence or absence of off-flavor. The evaluation was performed by scoring 0 point () for no off-flavor, 1 point (+) which meant that the panelist was aware of off-flavor, or 2 points (++) which meant that the panelist was strongly aware of off-flavor. The results are summarized in Table 8.

TABLE-US-00008 TABLE 8 Results of Organoleptic Examination of Taste (Off-flavor) of Cow Milks that Were Treated by Lactase Preparations Containing Arylsulfatase in Various Contamination Rates Lactase Reaction Time of Period Preparations 2 days 1 month 3 months Not Added A B C ++ ++ D ++ ++ E + ++ ++ ++: Strongly Aware +: Aware : Not Aware

[0119] After 2 days of the reaction time of period by the lactase preparation (i.e., storage time of period of cow milk), only preparation E exhibited apparent off-flavor. This was coincided with the description in WO07/060247. However, when the reaction time of period was 1 month or longer, preparations C and D also exhibited noticeable off-flavor. This indicates that unusual taste and off-flavor cannot be sufficiently controlled even though the arylsulfatase activity is 8 units, which is the detection limit in the unit described in WO07/060247, considering that the lactase preparations is used in, e.g., shelf-stable milk at ordinary temperatures (UHT milk).

[0120] On the other hand, preparations A and B exhibited no noticeable off-flavor for the reaction time of period of 1 and 3 months Considering the use of the lactase preparation in shelf-stable milk at ordinary temperatures (UHT milk), it is necessary to assume a reaction time of period of 1 month or longer. Therefore, for such usage, it became clear that it is preferable to use lactase preparation A or B (i.e., one having a ratio of the arylsulfatase activity by the method of present invention to the lactase activity by the FCC IV method of 0.02% or less) and that it is more preferable to use lactase preparation A. Further, it became clear that it is necessary to determine the arylsulfatase activity value which is comparable to that of lactase preparation A or B by the fluorescence method as described in this description or by an analysis method having a sensitivity similar to or higher than the above fluorescence method.

[Example 9] Obtaining a Mutant Having a Reduced Arylsulfatase Producibility

[0121] A loopful of Kluyveromyces lactis G14-427, which was a diploid strain, was inoculated into 10 ml of YPD medium (containing 1% of yeast extract, 1% of glucose, and 2% of peptone). The obtained suspension of cells was stored at 30 degrees Celsius to cultivate the cells. After arriving at a logarithmic phase, the suspension was centrifuged and then the cells were gathered. The gathered cells were dispersed in sterile water so that the absorbance of the obtained suspension would become 0.5 at 600 nm. By using a UV lamp, ultraviolet was irradiated to the suspension for 15 seconds. The cells were gathered by centrifugation, and then the gathered cells were dispersed in YPD medium by mixing. From the YPD medium comprising the cells, an optimal dose of the YPD medium was taken and applied onto a YPD agar plate. Static culture of the plate was performed at 37 degrees Celsius for 7 days. From a colony that had grown a small amount of cells were scratched, and then the scratched cells were mixed with 1 ml of a solution comprising Zymolyase (produced by Seikagaku Bio-business Corporation) in an amount of 1 mg/mL. Reaction was performed at 30 degrees Celsius for 2 hours to destroy cell walls. Thereafter centrifugation was performed and supernatant was gathered.

[0122] Lactase activity (the FCC IV method) and arylsulfatase activity (by the fluorescence method disclosed in Example 7) of the supernatant were determined. The ratio of the arylsulfatase activity to the lactase activity was calculated and strains that exhibit small values were selected.

[0123] Selected strains were repeatedly subjected to the above treatments for mutation and selection. As a result, a mutant (SM1182 strain) was able to be obtained, in which strain one arylsulfatase gene among two arylsulfatase genes that had existed in the diploid strain, Kluyveromyces lactis G14-427, became dysfunctional. The judgment that one arylsulfatase gene among two arylsulfatase genes became dysfunctional was based on the following fact: the culture supernatant of SM1182 strain exhibited an arylsulfatase activity of about one-half of that of the culture supernatant of the mother strain, G14-427 strain.

[0124] Furthermore, the obtained mutant (SM1182 strain) was used as a mother strain and treatments to cause mutation were performed. As a result, a mutant (SF-81 strain) in which the other arylsulfatase gene had also become dysfunctional namely, one having an arylsulfatase activity of zero, was obtained.

[0125] Kluyveromyces lactis G14-427 as a mother strain and two mutants that had been obtained by the methods described above were respectively cultivated by shaking in YPD medium (70 mL/flask) at 26 degrees Celsius for 4 days.

[0126] Thereafter, to each culture medium Zymolyase (produced by Seikagaku Bio-business Corporation) was added to be a concentration of 2 mg/mL. Reaction was performed at 30 degrees Celsius for 2 hours to destroy cell walls. Supernatants were respectively gathered by centrifugation, and were subjected to determinations of the lactase activity by the FCC IV method and the arylsulfatase activity by the method disclosed in Example 7. Table 9 shows the result.

TABLE-US-00009 TABLE 9 Comparison of Arylsulfatase Activity of Parent Strain and Mutant Strain Lactase Activity (NLU/g) Arylsulfatase Activity (Mg) G14-427 Strain 16 6 SM1182 Strain 16 3 SF-81 Strain 16 0

[Example 10] Obtaining Host Strain

[0127] To 10 mL of YPD medium, a loopful of Kluyveromyces lactis 014-427 strain, which was a diploid strain, was inoculated, and the cells were grown to log phase at 30 degrees Celsius. The cells were gathered by centrifuging the culture medium. The gathered cells were dispersed in sterile water so that the absorbance of the obtained suspension would become 0.5 at 600 nm. By using a UV lamp, ultraviolet was irradiated to the cell suspension for 15 seconds. The cells were gathered by centrifugation, and mixed and dispersed in YPD medium. An appropriate amount of YPD medium containing the cells was taken and was spread on a YPD agar plate. Static culture of the plate was performed at 37 degrees Celsius for 4 days under static conditions. The colonies that had grown were cultured on SD medium (0.67% amino acid-free yeast nitrogen base, 2% glucose, 2% agar) after their replica-plating, and those that had not be able to grow were selected.

[0128] These strains that had not be able to grow on the above SD medium were spread on another SD medium containing 20 mg/L of L-methionine from the original YPD agar plate, and those that had grown were designated as L-methionine-requiring mutant (7-19 strain).

[0129] To 10 mL of YPD medium, a loopful of the 7-19 strain was inoculated, and the cells were grown to log phase at 30 degrees Celsius. The cells were gathered by centrifuging the culture medium. The gathered cells were dispersed in sterile water so that the absorbance of the obtained suspension would become 0.5 at 600 nm. By using a UV lamp, ultraviolet was irradiated to the cell suspension for 15 seconds. The cells were gathered by centrifugation, and mixed and dispersed in YPD medium. An appropriate amount of YPD medium containing the cells was taken and was spread on a YPD agar plate. Static culture of the plate was performed at 37 degrees Celsius for 4 days. The colonies that had grown were cultured on SD medium containing 20 mg/L of L-methionine after their replica-plating, and those that had not be able to grow were selected.

[0130] These strains that had not be able to grow on the above SD medium containing L-methionine were spread on another SD medium containing 20 mg/L of L-histidine and 20 mg/L of L-methionine from the original YPD agar plate, and those that had grown were designated as L-methionine and L-histidine double nutrient-requiring mutant (8-23 strain). The growth of nutrient-requiring mutants obtained is shown in Table 10.

TABLE-US-00010 TABLE 10 Growth of Mutant Strains in Various Culture Media SD Medium + SD SD Medium + L-Methionine + Medium L-Methionine L-Histidine G14-427 Strain + + + 7-19 Strain + + 8-23 Strain + +: Grew : Not Grew

[Example 11] Obtaining Gene Double-Disrupted Strain which does not Produce Arylsulfatase

(Obtaining Host Strain)

[0131] It was confirmed that in the 8-23 strain that was the L-histidine and L-methionine double nutrient-requiring mutant obtained in Example 10, the nutrient requirements would be complemented by HIS4 gene and MET6 gene, respectively, introduced by the lithium acetate method.

[0132] (Obtaining Genomic DNA)

[0133] Kluyveromyces lactis G14-427 strain, which was a diploid strain, was cultured in YPD medium. From the culture fluid obtained, genomic DNA was prepared using Dr. GenTLE (from yeast) (produced by Takara Bio Inc.). The manipulation was performed according to the instructions in the operating manual attached to Dr. GenTLE (from yeast).

[0134] (Construction of Vector for Disrupting Arylsulfatase Gene)

[0135] Primers SuC-F and SuC-R were designed so that a fragment containing the open reading frame of arylsulfatase gene would be obtained. The sequences of used primers including them were as shown in Table 11.

TABLE-US-00011 TABLE11 UsedPrimer NameofPrimer Sequence(5 .fwdarw. 3) SuC-F ATGACCAAAACAGATGAACCTA SuC-R CCAGTCTCTTGCGTCGTGA BGLHIS4-F GAAGATCTCAGACCTGAGGTAA CGTTTC HIS4-R CTGGGTAACTTGTTCTGGTG SuCd-M6F ATCGATGTTGTTGAGCGGTACT GACAACCATTTGGCAGGTTTCA TCAACACACGAGCCG SuCd-M6R ATCGATAACTCTACCGATATTT TGGTCTAATTCATCAACCACTG TGGTGGAG

[0136] A DNA fragment was obtained by performing PCR under the following conditions with the genomic DNA prepared in advance as the template by using the above primers. As the polymerase, Takara Ex Taq (registered trademark; produced by Takara Bio Inc.) was used and the manipulation was performed according to the attached instructions.

TABLE-US-00012 (PCR conditions) Stage 1 (1 cycle) 94 degrees Celsius, 3 min. Stage 2 (30 cycles) 94 degrees Celsius, 1 min. 54 degrees Celsius, 1 min. 72 degrees Celsius, 3 min. Stage 3 (1 cycle) 72 degrees Celsius, 10 min. Kept at 4 degrees Celsius

[0137] The obtained fragment was purified by MagExtractor-PCR & Gel Clean up- (produced by Toyobo Co., Ltd.), and then a ligation reaction of the fragment with pGEM (registered trademark)T vector (produced by Promega) was performed. For the ligation reaction, DNA Ligation Kit <Mighty Mix> (produced by Takara Bio Inc.) was used. The methods of using were as stated in respective attached documents. Then, competent cells of E. coli DH5a strain that bad been prepared according to the Hanahan method (Hanahan, D., J. Mol. Biol., 166, 557 (1983)) were transformed, and from the culture fluid of the obtained transformant, plasmid was extracted by using MagExtractor-Plasmid- (produced by Toyobo Co., Ltd.). The method of using was as stated in the attached document. As a result, plasmid pGSuC, in which the intended fragment had been subcloned, was obtained.

[0138] Further, by performing PCR using primers BGLHIS4-F and HIS4-R with genomic DNA as the template, a fragment containing HIS4 gene was obtained. PCR was performed as the method described above. As shown in FIG. 3, the obtained fragment containing HIS4 gene was treated with Bgl II and Eco RI and then it was inserted into the Bgl II-EcoRI site of pGSuC. The thus constructed plasmid was designated as pdSuC1. The various methods used for construction were similar to those stated above.

[0139] To construct a vector for disrupting arylsulfatase gene with MET6 gene as a marker, primers SuCd-M6F and SuCd-M6R each having 40 bases of homologous sequence of arylsulfatase gene added to the 5-side were designed. The homologous sequences of arylsulfatase gene were near the restriction enzyme sites for Cla I, which existed two locations in the open reading frame. As shown in FIG. 4, a fragment having homologous sequences to arylsulfatase at the both ends of MET6 gene was obtained by using these primers and genomic DNA as the template. The obtained fragment was subcloned into pGEM (registered trademark)T vector (produced by Promega) to obtain pdSuCM6. The various methods used for construction were similar to those stated above.

[0140] (Transformation of L-Methionine and L-Histidine Double Nutrient-Requiring Mutant 8-23 Strain by Using a Vector for Disrupting Arylsulfatase Gene)

[0141] FIG. 5 represents a schematic diagram of construction of a transformant. Plasmid pdSuC1 was linearized by treating with Nco I and Aat II, followed by transformation of the 8-23 strain with the linearized plasmid by the lithium acetate method. Thus, a transformant, SuCD strain, was obtained, which strain grew on SD medium with 20 g/mL of methionine added.

[0142] Then, plasmid pdSuCM6 was linearized by treating with Cla I, followed by transformation of the SuCD strain with the linearized plasmid by the lithium acetate method. Thus, a transformant, SuCDD5-2 strain, was obtained, which strain grew on SD medium.

[0143] (Southern Blotting of DNAs from Parent Strain and Transformant Strains)

[0144] Obtained transformants were respectively cultured in YPD medium, and genomic DNAs were respectively prepared from the culture fluids using Dr. GenTLE (from yeast) (produced by Takara Bio Inc.). The obtained genomic DNAs were digested with Bam HI, followed by Southern analyses. As the probe, the Aat I-Eco RI fragment of arylsulfatase gene was used. For labeling and detection of nucleic acid, AlkPhos Direct Labeling and Detection System with CDP-Star (produced by GE Healthcare Bioscience Co., Ltd.) was used, and the method of using was according to the attached document.

[0145] The results of Southern blotting are shown in FIG. 6. Lanes 1, 2, and 3 represent the parent strain 014-427, the transformant SuCDD5-2, and the transformant SuCD, respectively. In lane 3, with the band (12.1 kb) of fragment containing arylsulfatase gene and HIS4 gene, a band at the same position (7.8 kb) in lane 1 was also detected. Thus, it was confirmed that only one of the arylsulfatase genes had been disrupted. On the other hand, in lane 2, the band of 7.8 kb shifted to 5.3 kb. Thus, it was confirmed that both arylsulfatase genes had been disrupted.

[0146] (Detection of Arylsulfatase Activity in Arylsulfatase Gene-Double Disrupted Strain)

[0147] The parent strain, Kluyveromyces lactis G14-427 strain (a diploid strain) and the SuCDD5-2 strain constructed as described above were respectively inoculated to YPD medium, and incubated at 30 degrees Celsius, with shaking at 210 rpm for 72 hours. To each culture fluid, Zymoliase (produced by Seikagaku Biobusiness Corp.) was added to be a concentration of 2 mg/mL, and reaction was performed at 30 degrees Celsius for 2 hours to disrupt the cell walls. Supernatants were respectively gathered by centrifugation, and the lactase activity and arylsulfatase activity were determined by the FCC IV method and the method as described in Example 7, respectively. The results are shown in Table 12.

[0148] It has been revealed that although in the culture fluid of the SuCDD5-2 strain, lactase is contained, arylsulfatase is not contained or is contained in a very small amount if any such that it cannot be detected by the fluorescence method. Namely, it has been confirmed that although the SuCDD5-2 strain maintains the productivity of lactase, productivity of arylsulfatase is zero or almost zero.

TABLE-US-00013 TABLE 12 Comparison between Arylsulfatase Activity of Strain having Two Arylsulfatase Genes and Other Strain in Which Both Arylsulfatase Genes Had Been Disrupted Strain that Produces Lactose Activity Arylsulfatase Activity Lactase (NLU/g) (U/g) G14-427 Strain 16 6 SucDD5-2 Strain 16 0

[Example 12] Preparation of Enzyme Preparations with SF-81 Strain and CBS2359 Strain

[0149] The SF-81 strain (a diploid mutant with reduced arylsulfatase productivity) obtained in Example 9 and CBS2359 strain (a monoploid strain) were respectively inoculated to a medium for lactase production containing 7% corn steep liquor and 2% lactose, and incubated at 30 degrees Celsius with shaking at 210 rpm for 96 hours. Then, the cells were respectively gathered by centrifugation. Sterile purified water was added to the cells and the cell walls of the gathered cells were disrupted with glass beads and ultrasonic waves. The thus obtained mixture containing cells, purified water, and the like, was centrifuged and supernatant was gathered. The lactase activity of the obtained supernatant was determined by the fluorescence method as described in Example 7. As a result, the relative activity of the CBS2359 strain was 2% as compared to the lactase activity of the SF-81 strain that was specified as 100%.

[0150] The above supernatant was fractionated with ammonium sulfate and concentrated with an ultrafiltration membrane. As a result, from cells of the SF-81 strain, lactase preparations were obtained, which preparations have respective lactase activity of about 1,000, 2,000, 3,000, 4,000, 5,000, or 6,000 NLU/g depending on the degree of concentration. On the other hand, no preparation was obtained having lactase activity of 1,000 NLU/g or higher from the CBS2359 strain although a similar concentration method was performed.

[Example 13] Preparation of Enzyme Preparation

[0151] The SF-81 strain was inoculated to a medium for lactase production containing 7% corn steep liquor and 2% lactose, and incubated at 30 degrees Celsius with shaking at 210 rpm for 96 hours. Then, the cells were gathered by centrifugation. Sterile purified water was added to the cells and the cell walls of the gathered cells were disrupted with glass beads and ultrasonic waves. The supernatant was gathered by centrifugation. The supernatant was fractionated with ammonium sulfate and concentrated by an ultrafiltration membrane to obtain a lactase preparation having lactase activity of about 5,000 NLU/g. The arylsulfatase activity of this lactase preparation was 1 U/g or less according to the method of the present invention (the fluorescence method).

[Example 14] Organoleptic Examination for Taste (Part 2)

[0152] (Preparation of Lactase Preparations with Various Contamination Rates of Arylsulfatase)

[0153] Five lactase preparations each having arylsulfatase activity of 1 to 20 U/g as determined by the fluorescence method shown in Example 7 were prepared from the lactase preparation per se produced from the SF-81 strain by the method as described in Example 13, and by appropriately mixing the lactase preparation with GODO-YNL2 (liquid lactase preparation, produced by Godo Shusei Co. Ltd.). Further, the lactase activity of each lactase preparation was determined by the FCC IV method.

[0154] (Organoleptic Examination for Taste)

[0155] As is in Example 8, each of the 5 lactase preparations was added to a commercially available cow milk to be the lactase content of 20,000 NLU/L-milk, and the obtained cow milks were stored at 30 degrees Celsius. After 1 month of storage, an organoleptic examination for taste was performed by a similar method as described in Example 8, in which the milks to which lactase preparations had been respectively added were compared to the milk to which lactase preparation had not been added. The results are shown in Table 13.

TABLE-US-00014 TABLE 13 Results of Organoleptic Examination for Taste (Off-flavor) of Cow Milks that Were Treated by Lactase Preparations Containing Arylsulfatase in Various Contamination Rates Lactase Preparations Off-flavor Lactage Arylsulfatase Arylsulfatase Reaction Activity Activity Activity/Lactase Time of (NLU/g) (U/g) Activity (%) Period: 1 month Not Added 5000 1 or less 0.02 or less 5000 5 0.1 5000 10 0.2 + 5000 15 0.3 + 5000 20 0.4 + +: Aware : Not Aware

[0156] From the results shown in Table 13, it has been concluded that arylsulfatase activity as determined by the method according to the present invention is preferably 5 U/g or less. Further, it has been demonstrated that the proportion of arylsulfatase activity (unit: U/g) as determined by the method according to the present invention is preferably 0.1% or less by using the lactase activity (unit: NLU/g) by the FCC IV method as the basis.