Compositions and methods for detecting pyrophosphate products of enzyme reactions using pyridylazoaniline dyes
11512342 · 2022-11-29
Assignee
Inventors
- Nathan Tanner (West Newbury, MA, US)
- Ivan R. Correa, JR. (Hamilton, MA, US)
- Yinhua Zhang (North Reading, MA)
- Ece Alpaslan (Malden, MA, US)
Cpc classification
C12Q1/6876
CHEMISTRY; METALLURGY
International classification
Abstract
Provided herein is a composition comprising an enzyme that releases pyrophosphate from a substrate and a dye of Formula 1. A method for detecting pyrophosphate is also provided. A kit comprising a polymerase that releases pyrophosphate by hydrolysis of nucleoside triphosphates during nucleic acid replication, a divalent manganese salt, and the dye are also provided. The present composition, method and kits provide a way to detect and/or quantify substrates or products of enzyme reacted substrates associated with the release pyrophosphate (e.g., nucleic acid amplification reactions and other reactions that hydrolyze ATP) via a distinct color change without substantially affecting the sensitivity and/or specificity of the reaction.
Claims
1. A composition, comprising; an enzyme that releases pyrophosphate from a substrate, a manganese ion (Mn.sup.2+) and a dye of Formula 1: ##STR00006## wherein: R1 and R5 are each independently selected from the group consisting of H, halogen, nitro, cyano, sulfonic acid, carboxy, trifluoromethyl, trichloromethyl and tribromomethyl; R2 and R3 are each independently a lower alkyl optionally comprising a terminal sulfonate group; and R4 is H, OH or COOH.
2. The composition of claim 1, wherein: at least one of R1 and R5 is F, Cl, Br or I; R2 and R3 are each independently n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, n-propyl, isopropyl, ethyl, or methyl and at least one of R2 and R3 comprises the terminal sulfonate group.
3. The composition according to claim 1, wherein the composition comprises a manganese salt, wherein the molar ratio of the manganese salt to dye is greater than 1.
4. The composition according to claim 1, wherein the composition further comprises one or more nucleoside triphosphates (NTPs) selected from rNTPs and dNTPs.
5. The composition according to claim 4, wherein the molar ratio of NTPs to manganese salt is greater than 1.
6. The composition according to claim 1, wherein the dye is 2-(5-Bromo-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-Br-PAPS) or 2-(5-Nitro-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-Nitro-PAPS).
7. The composition according to claim 1, wherein the enzyme is selected from the group consisting of a DNA polymerase, RNA polymerase, reverse transcriptase, primase, ligase, helicase, nucleotide pyrophosphatase (Ppase)/phosphodiesterase, RNA decapping enzyme (RNA 5′ pyrophosphohydrolase) and geranyl pyrophosphate synthase.
8. The composition according to claim 1, wherein the enzyme is a polymerase selected from the group consisting of a thermostable DNA polymerase, a strand displacing DNA polymerase, an RNA polymerase and a reverse transcriptase.
9. The composition according to claim 7, wherein the enzyme is a DNA polymerase selected from the group consisting of Bst polymerase, Bsu polymerase, an archaeal DNA polymerase, Taq polymerase, or a variant thereof.
10. The composition according to claim 1, wherein the composition is lyophilized or in an aqueous solution.
11. The composition according to claim 1, further comprising a substrate for the enzyme, wherein cleavage of the substrate by the enzyme results in production of pyrophosphate.
12. The composition according to claim 1, further comprising a nucleic acid sample that contains a target nucleic acid and, optionally, primers.
13. The composition according to claim 12, wherein the sample is a sample from an animal subject.
14. The composition according to claim 12, wherein the sample is a clinical sample selected from the group consisting of: saliva, nasal mucosa, urine, tissue biopsy, and a cell scrape or an environmental sample selected from the group consisting of water, sewerage, soil and plants or animal material for use as food.
15. A method for detecting pyrophosphate, comprising: (a) combining a manganese salt, an enzyme, a substrate for the enzyme that releases pyrophosphate when it is cleaved by the enzyme, and a dye of Formula 1 produce a reaction mix; ##STR00007## wherein: R1 and R5 are each independently selected from the group consisting of H, halogen, nitro, cyano, sulfonic acid, carboxy, trifluoromethyl, trichloromethyl and tribromomethyl; R2 and R3 are each independently a lower alkyl optionally comprising a terminal sulfonate group; and R4 is H, OH or COOH; (b) incubating the reaction mix under conditions by which the enzyme cleaves the substrate to produce pyrophosphate; and (c) observing a change in color of the reaction mix, wherein the change in color indicates production of pyrophosphate.
16. The method of claim 15, wherein the enzyme is selected from the group consisting of a DNA polymerase, an RNA polymerase, a reverse transcriptase, a primase, a ligase, a helicase, a nucleotide pyrophosphatase (Ppase)/phosphodiesterase, an RNA decapping enzyme (RNA 5′ pyrophosphohydrolase) and a geranyl pyrophosphate synthase.
17. The method of claim 15, wherein the substrate is an NTP.
18. The method of claim 15, wherein: the reaction mix comprises a polymerase, rNTPs or dNTPs, the manganese salt, a template nucleic acid and the dye; the reaction mix is incubated under conditions suitable for amplification of the nucleic acid; and the change in color indicates that a product has been amplified.
19. The method of claim 18, wherein the reaction mix comprises an amplification mix for loop-mediated isothermal amplification (LAMP), polymerase chain reaction (PCR), strand displacement amplification (SDA), helicase dependent amplification (HDA), multiple displacement amplification (MDA), rolling circle amplification, ligation mediated amplification, whole genome amplification (WGA), nucleic acid sequence-based amplification (NASBA) or recombinase polymerase amplification (RPA) mix.
20. The method according to claim 18, wherein the reaction mix is a PCR reaction mix and the method comprises thermocycling the reaction mix.
21. The method according to claim 18, wherein reaction mix is a LAMP reaction mix and the method comprises incubating the reaction mix under isothermal conditions.
22. The method according to claim 15, wherein the color change in (c) is red to yellow wherein yellow indicates production of pyrophosphate.
23. The method according to claim 15, wherein (c) further comprises detecting the color change by spectrophotometry, image analysis or by eye.
24. The method according to claim 15, wherein (c) further comprises detecting the color change by a change in hue or a change in peak wavelength.
25. The method according to claim 15, wherein the change in color is detected by observing a change in a ratio of wavelength peak heights, before and after step (b).
26. The method according to claim 25, wherein the wavelength peak heights are in the range of 350 nm-620 nm, 430 nm-480 nm and/or 520 nm-620 nm.
27. The method according to claim 18, further comprising, determining the amount of nucleic acid substrate or the amount of amplicon by determining the number of thermocycles in a PCR amplification reaction for producing a predetermined ratio of wavelength peak height.
28. The method according to claim 15, wherein the dye is 2-(5-Bromo-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-Br-PAPS) or 2-(5-Nitro-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-Nitro-PAPS).
29. A kit comprising a polymerase, manganese salt, and a dye of formula 1 ##STR00008## wherein: R1 and R5 are each independently selected from the group consisting of H, halogen, nitro, cyano, sulfonic acid, carboxy, trifluoromethyl, trichloromethyl and tribromomethyl; R2 and R3 are each independently a lower alkyl optionally comprising a terminal sulfonate group; and R4 is H, OH or COOH.
Description
BRIEF DESCRIPTION OF THE FIGURES
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the office upon request and payment of the necessary fee.
(2) The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
(3)
(4)
(5) R1 and R5 are each independently selected from the group consisting of H, halogen, nitro, cyano, sulfonic acid, carboxy, trifluoromethyl, trichloromethyl and tribromomethyl; and
(6) R2 and R3 are each independently a lower alkyl optionally comprising a terminal sulfonate group; and
(7) R4 is H, OH or COOH.
(8) In some embodiments, at least one of R1 and R5 is a halogen selected from F, Cl, Br or I, and R2 and R3 are each independently n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, n-propyl, isopropyl, ethyl, or methyl and at least one of R2 and R3 comprises the terminal sulfonate group.
(9)
(10) Left plate of 18 wells (before LAMP) and right plate of 18 wells (after LAMP) show the color of triplicate LAMP reactions with either lambda DNA (1 ng) or without (NTC). Each dye was tested using 0 μM Mn.sup.2+, 100 μM Mn.sup.2+ and 800 μM Mn.sup.2+. The labels for these three conditions are color-coded the same as their corresponding real-time curves on the right side of the figure that confirm that LAMP occurred. The best visual detection condition for each dye after LAMP is highlighted in the right plate with a dotted rectangle around 6 samples.
(11)
(12)
(13)
(14)
(15)
(16)
(17) In
(18)
(19)
(20)
(21)
(22)
(23)
(24) The colors of post-LAMP reactions and the real-time curves for each of the three concentrations of the PAPS dye are provided. The color coding for the real-time curves is the same as that of the labels for Mn2+ concentrations.
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37) Results for 24 reactions, each with approximately 10 copies of target RNA (A1-H3) and 8 NTC reactions (A4-H4) in the presence of 75 μM 5-Bromo-PAPS and 100 μM Mn.sup.2+.
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
DETAILED DESCRIPTION
(62) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Still, certain terms are defined herein with respect to embodiments of the disclosure and for the sake of clarity and ease of reference.
(63) Sources of commonly understood terms and symbols may include: standard treatises and texts such as Kornberg and Baker, DNA Replication, Second Edition (W.H. Freeman, New York, 1992); Lehninger, Biochemistry, Second Edition (Worth Publishers, New York, 1975); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Singleton, et al., Dictionary of Microbiology and Molecular biology, 2d ed., John Wiley and Sons, New York (1994), and Hale & Markham, the Harper Collins Dictionary of Biology, Harper Perennial, N.Y. (1991) and the like.
(64) As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, the term “a protein” refers to one or more proteins, i.e., a single protein and multiple proteins. The claims can be drafted to exclude any optional element when exclusive terminology is used such as “solely,” “only” are used in connection with the recitation of claim elements or when a negative limitation is specified.
(65) Aspects of the present disclosure can be further understood in light of the embodiments, section headings, figures, descriptions and examples, none of which should be construed as limiting the entire scope of the present disclosure in any way. Accordingly, the claims set forth below should be construed in view of the full breadth and spirit of the disclosure.
(66) Each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present teachings. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.
(67) Numeric ranges are inclusive of the numbers defining the range. All numbers should be understood to encompass the midpoint of the integer above and below the integer i.e. the number 2 encompasses 1.5-2.5. The number 2.5 encompasses 2.45-2.55 etc. When sample numerical values are provided, each alone may represent an intermediate value in a range of values and together may represent the extremes of a range unless specified.
(68) In the context of the present disclosure, “non-naturally occurring” refers to a polynucleotide, polypeptide, carbohydrate, lipid, or composition that does not exist in nature. Such a polynucleotide, polypeptide, carbohydrate, lipid, or composition may differ from naturally occurring polynucleotides polypeptides, carbohydrates, lipids, or compositions in one or more respects. For example, a polymer (e.g., a polynucleotide, polypeptide, or carbohydrate) may differ in the kind and arrangement of the component building blocks (e.g., nucleotide sequence, amino acid sequence, or sugar molecules). A polymer may differ from a naturally occurring polymer with respect to the molecule(s) to which it is linked. For example, a “non-naturally occurring” protein may differ from naturally occurring proteins in its secondary, tertiary, or quaternary structure, by having a chemical bond (e.g., a covalent bond including a peptide bond, a phosphate bond, a disulfide bond, an ester bond, and ether bond, and others) to a polypeptide (e.g., a fusion protein), a lipid, a carbohydrate, or any other molecule. Similarly, a “non-naturally occurring” polynucleotide or nucleic acid may contain one or more other modifications (e.g., an added label or other moiety) to the 5′-end, the 3′ end, and/or between the 5′- and 3′-ends (e.g., methylation) of the nucleic acid. A “non-naturally occurring” composition may differ from naturally occurring compositions in one or more of the following respects: (a) having components that are not combined in nature, (b) having components in concentrations not found in nature, (c) omitting one or components otherwise found in naturally occurring compositions, (d) having a form not found in nature, e.g., dried, freeze dried, crystalline, aqueous, and (e) having one or more additional components beyond those found in nature (e.g., buffering agents, a detergent, a dye, a solvent or a preservative).
(69) All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
(70) Dyes according to Formula 1 are a family of commercially available 4-(2-pyridylazo)aniline dyes that bind metals to form dye metal complexes and have been selected from a wide range of structures to provide an improvement to existing colorimetric detection of molecular biology reactions. This family of dyes are shown here to change color in the presence of pyrophosphate where the pyrophosphate is a product of an enzyme reaction. For example, pyrophosphate may be released by the conversion of nucleoside triphosphates (dNTPs or rNTPs, including ATP (the energy source)) sometimes referred to herein as NTPs, to nucleoside monophosphates by hydrolysis. Consequently, the dyes can be used as indicators that a specific enzyme reaction has occurred. In one embodiment, this family of dyes are used to determine reverse transcription of a target RNA and detect RNA and/or DNA by isothermal DNA amplification or PCR DNA amplification methods in a sample. It is desirable that color change of the dye that relies on a metal salt not interfere with the activity of the enzyme to perform the reaction. The observed improvements achieved with dyes of Formula 1 include an unambiguous difference in color between a sample in the presence of pyrophosphate (e.g., yellow) and a sample where no pyrophosphate is formed (e.g., red or purple brown) that also correspond to significantly different wavelengths for spectroscopic analysis.
(71) The dye used in the present compositions and methods has a structure of Formula 1 (also named 4-(2-pyridylazo) aniline), having the structure shown below:
(72) ##STR00002##
(73) wherein:
(74) R1 and R5 are each independently selected from the group consisting of H, halogen, nitro, cyano, sulfonic acid, carboxy, trifluoromethyl, trichloromethyl and tribromomethyl;
(75) R2 and R3 are each independently a lower alkyl optionally comprising a terminal sulfonate group; and
(76) R4 is H, OH or COOH.
(77) In some embodiments, at least one of R1 and R5 is a halogen selected from F, Cl, Br and I, and R2 and R3 are each independently n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, n-propyl, isopropyl, ethyl, or methyl and at least one of R2 and R3 comprises the terminal sulfonate group.
(78) The dyes of Formula 1 exemplified in
(79) Colorimetric visual detection can enable simple diagnostic detection of nucleic acid amplification, using a visible readout for presence or absence of a DNA or RNA target of interest. The family of dyes characterized by Formula 1 are complexed to a metal ion, preferably Mn.sup.2+ exemplified here. This family of dyes changes color in the reaction mix as a result of the amplification reaction that causes the removal of the metal ions from the dye. The selected metal ions such as manganese ions may be added to the dye in the form of a salt where the concentration of the salt is in the range of 2:1 to 1:2 dye to salt.
(80) The color change is preferably binary and is the result of an optical density maximum at different distinct wavelengths of light correlated with a positive signal (amplified nucleic acid) or a negative signal (no amplification and therefore no target nucleic acid).
(81) The DNA or RNA target of interest may be a nucleic acid from, for example, a pathogen, environmental sample, food or biopsy. The diagnostic detection of the nucleic acid may require large scale readout of plates in a diagnostic laboratory where the plates contain many samples for testing. In these circumstances, the use of a cheap effective spectrophotometer may be desirable that provides an optical density value for each sample at the selected positive and negative wavelengths where the data can be easily, accurately and cheaply processed by a computer to determine peak ratios or hues from the readout of the spectrophotometer.
(82) Another application of colorimetric detection of amplification is the determination of the concentration of the amplified DNA by determining the ratio of peaks corresponding to the red color and the yellow color after amplification has occurred and optionally comparing these to peak heights before amplification. Determining yield of amplification may be of particular use in NGS library preparation, cloning and synthetic biology.
(83) Alternatively, it may be desirable to perform a small numbers of diagnostic tests in the field or at point of care using for example, isothermal amplification. In these circumstances visual detection of target nucleic acid through a clear and unambiguous visual color change is desirable. In this circumstance it may be desirable to photograph the samples and perform image analysis using a cell phone camera or other means to quantify the results.
(84) Another application of colorimetric detection of amplification is in molecular biology workflows using colony PCR, amplification to screen for correct assembly of a DNA molecule, typically by agarose gel electrophoresis. Colorimetric PCR using Formula 1 dye-metal complexes in the reaction mix shown here and in the examples can be used for rapid screening of these reactions, avoiding electrophoresis, saving time and increasing throughput.
(85) In workflows where further processing or analysis is conducted on an in vitro or in vivo synthesized DNA or RNA, a colorimetric analysis ensures success of the amplification step before proceeding with secondary reactions. Examples of such workflows include library preparation for next-generation sequencing, first strand cDNA generation by reverse transcriptase, and in vitro transcription by RNA polymerase to produce RNA. An additional use for these colorimetric dyes is for DNA sequencing reactions, where incorporated dNTPs produce a local concentration of pyrophosphate and the corresponding change in color is tied to incorporation of a specific sequence-determined nucleotide.
(86) The sensitivity of the amplification assay for a target nucleic acid in the absence or presence of dye using a pyridylazoaniine dye-manganese complex was demonstrated to be similar. It was concluded therefore that the dye metal complex did not substantially adversely affect the activity of the DNA polymerase or reverse transcriptase.
(87) The Formula 1 dyes and metal salt for use in a non-pH dependent colorimetric nucleic acid amplification assay were selected to preferably have two or more, three or more, five or more, or seven or more of the following features:
(88) (a) Minimal adverse effect on the selected nucleic acid amplification reaction when included in the amplification reagent master mix;
(89) (b) Minimal negative effect on sensitivity of the amplification reaction for detecting low amounts of nucleic acid;
(90) (c) Minimal interference with primer binding to target nucleic acid and associated specificity of the reaction
(91) (d) Readily detectable color change direct resulting from nucleoside triphosphate hydrolysis;
(92) (e) Distinctly different wavelengths associated with changes in the dye color;
(93) (f) The dye produces a change in visible color in response to changes in concentration of a divalent metal that is not substantially affected by the presence of standard buffering agents or a pH between 7 and 9;
(94) (g) The dye is commercially available;
(95) (h) The dye is water soluble;
(96) (i) The dye can be lyophilized.
(97) In various enzyme dependent workflows that utilize NTPs, the dye-metal complex can be used as an indicator of nucleoside triphosphate hydrolysis. Enzymes that hydrolyze dNTPs or rNTPs include for example, DNA polymerase, RNA polymerase, reverse transcriptase, primase, ligase, helicase, nucleotide Ppase/phosphodiesterase, RNA decapping (RNA 5′ pyrophosphohydrolase) and geranyl pyrophosphate synthase (used in terpene precursor production).
(98) The dye-metal complex may be combined with any of these enzymes either separately or in combination with reagents where the reagents may be incorporated in a master mix in order to detect a reaction that generates pyrophosphates. Examples of such reactions include: amplification of nucleic acids to detect the presence of target nucleic acids; ligation of adaptors in NGS libraries; removal of pyrophosphates from capped RNA for various RNA workflows, measurement of RNA synthesis by RNA polymerase subject to selected promoters etc.
(99) A master mix is a mixture of reagents for adding to a substrate to execute a reaction or series of reactions. The master mix may include all the reagents required for the reaction except for sample. Alternatively, a master mix may contain core reagents for a reaction but may not include all the reagents.
(100) For example, a master mix for an amplification reaction may include a polymerase and dNTPs in a suitable buffer. If the master mix is for PCR, a reagent may be included such as an aptamer or antibody to block polymerase activity at room temperature. A pyridylazoaniline dye with manganese ions may also be included in the master mix or may be provided separately. Another master mix for amplification may include oligonucleotide primers for a specific target together with a DNA polymerase, dNTPs and optionally a pyridylazoaniline dyes with manganese ions. Another master mix may include a reverse transcriptase, DNA polymerase, dNTPs, optionally oligonucleotide primers and a pyridylazoalanine dye with manganese ions either separately or together. A master mix may contain the reagents at a concentration of at least 2×, 5× or 10× so that the master mix can be diluted into the sample resulting in a 1× solution.
(101) Optional additional reagents in a master mix may include any of a helicase, a nicking endonuclease, guanidine hydrochloride, a detergent, a reducing agent, glycerol, a hygroscopic sugar, a buffer, a uracil DNA glycosylase or dUTP for preventing DNA carryover between reaction samples, and/or magnesium salts where the concentration of magnesium salts should be carefully titrated so as not to inhibit the removal of manganese from the dye in the presence of pyrophosphates while being of sufficient concentration to enable enzyme reactions that require magnesium ions.
(102) The pyridylazoaniline dye metal complex may be stored separately or included in the master mix as a liquid formulation at cold temperatures such as 4° C., −20° C. or −70° C. or a temperature there between where the master mix may contain stabilizing agents such as at least 10% glycerol, preferably more than 20% glycerol such as at least 50% glycerol; detergents such as nonionic detergents, zwitterionic detergents, or anionic or cationic detergents.
(103) The master mix may be freeze dried. As shown in
(104) It has been demonstrated here that the reagents in the master mix do not substantially affect the sensitivity of the color change of a colorimetric dye following a target specific amplification. In certain circumstances according to the needs of the user, it may be desirable to combine a separate mix of pyridylazoaniline dye-metal complex with the master mix lacking the dye at the time of the reaction.
(105) In one embodiment, a kit may contain the dye combined with an amplification master mix as a single reagent. In another embodiment, a kit may contain a container for the dye and a container for the master mix lacking the dye suitable for their combination in a reaction.
(106) In one embodiment, a master mix is provided that is capable of amplifying nucleic acids when combined with a sample containing the nucleic acids. The pyridylazoaniline dye metal complex may be included in any master mix that is designed to accomplish amplification from a target DNA or RNA (in the presence of a reverse transcriptase) such as LAMP, polymerase chain reaction (PCR), strand displacement amplification (SDA/NEAR), helicase dependent amplification (HDA), multiple displacement amplification (MDA), rolling circle amplification (RCA), ligation mediated amplification, whole genome amplification (WGA), nucleic acid sequence-based amplification (NASBA), recombinase polymerase amplification (RPA), Cas-CrispR associated nonspecific amplification (CRISPR-NAS) and transcription mediated amplification (TMA). A master mix may be provided for first strand cDNA synthesis using a reverse transcriptase. A reverse transcriptase and an RNA polymerase may be included in the master mix for NASBA or TMA. The master mix may include an RNA polymerase but not a DNA polymerase or reverse transcriptase for in vitro transcription.
(107) An amplification master mix typically includes one or more DNA and/or RNA polymerases. Examples of DNA polymerases include Taq polymerase or archaea polymerase or variants thereof. Variants of archaea polymerases include fusion proteins where the fusion may be between an archaea polymerase and a DNA binding domain that may have specific or non-specific binding properties. The DNA polymerase may be a strand displacing DNA polymerase such as a bacterial polymerase such as Bst or Bsu polymerase where variants include truncations at the N-terminal end or C-terminal end, or mutations there between. Examples of Bst variants are described in U.S. Pat. Nos. 8,993,298, 9,127,258, 9,157,073, EP 2751264, U.S. Pat. Nos. 9,447,445 and 9,963,687. DNA polymerases, RNA Polymerases or reverse transcriptases may also be phage polymerases such as Phi 29 DNA polymerase. Optionally, the polymerase is a fusion protein for example, a fusion protein between two different polymerase, between a polymerase and a DNA binding domain and/or binding affinity moiety. The polymerase may be immobilized on a solid substrate such as a bead or column.
(108) The master mix may contain a reverse transcriptase and a DNA polymerase to enable detection of RNA target sequences where RNA is first converted to cDNA by the reverse transcriptase and then amplified by thermocycling (PCR) or isothermal amplification.
(109) The master mix containing the pyridylazoaniline dye metal complex and one or more polymerases and/or reverse transcriptases may also include nucleoside triphosphates. The master mix may additionally include primers, adaptors, ligases, nicking endonucleases, restriction endonucleases, DNA glycosylases and/or exonucleases.
(110) The master mixes containing the pyridylazoaniline dye metal complex may be lyophilized for room temperature storage. The master mix may contain a suitable sugar for lyophilization such as stachyose, trehalose or other suitable sugar for binding water molecules. In embodiments, the absorbance characteristics of the composition and the pyridylazoaniline dye-divalent metal complex is not substantially affected by the lyophilization process.
(111) Although for workflow convenience, the pyridylazoaniline dye metal complex can be contained in an amplification master mix as described above, the pyridylazoaniline dye metal complex may be combined with any single component from the master mix in place of the whole master mix for convenience depending on the design of the assay.
(112) Moreover, the pyridylazoaniline dye metal complex can be combined with a sample for testing or control sample, by addition in a separate step from the amplification master mix or portion thereof.
(113) Preferably the dyes change their absorbance characteristics in response to loss of metal ions in the pyridylazoaniline-metal ion complex so that the dye-metal ion complex shows absorbance characteristic at one wavelength while the dye alone after release of the metal has absorbance characteristics at a second wavelength that is distinct and distinguishable from the first wavelength.
(114) Pyridylazoaniline Dye-Metal Complex.
(115) Working examples are provided herein for pyridylazoaniline compounds of Formula I (
(116) In preferred embodiments, manganese ions were selected for improved sensitive and binary color change (see
(117) In the presence of metal ions, a reagent dye-metal ion complex is formed with a modified absorption signal (e.g. red for 5-Bromo-PAPS). During nucleic acid amplification, pyrophosphate is released when dNTPs are converted to dNMPs. The liberated pyrophosphate competes for metal ion binding with the pyridylazoaniline dye. The result is the release of the metal ion from the dye and the binding of the metal ions to pyrophosphate. This restores the dye's original absorption signal (e.g. yellow for 5-Bromo-PAPS and 5-Nitro-PAPS).
(118) Suitable dye to metal ratio were determined for 5-Bromo-PAPS and 5-Nitro-PAPS as shown in
(119) Examples of pyridylazoaniline dyes in embodiments of the compositions described herein for use in amplification reactions comprising compounds of Formula I and including associated counterions are provided below.
(120) In some embodiments, the R2 and R3 groups are each independently a lower alkyl group alkyl group with 1 to 10 carbon atoms (C1-C10), preferably from 1 to 4 carbon atoms (C1-C4), and is linear or branched; preferably, lower alkyl is butyl, such as n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, such as n-propyl or isopropyl, ethyl or methyl. Preferably lower alkyl is methyl. As noted above, one of R2 and R3 with have a terminal sulfonate group.
(121) The mono- or bicyclic heteroaromatic group is selected from 2H-pyrrolyl, pyrrolyl, imidazolyl, benzimidazolyl, pyrazolyl, indazolyl, purinyl, 8-azapurinyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, 4H-quinolizinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalyl, quinazolinyl, quinolinyl, pteridinyl, indolizinyl, 3H-indolyl, indolyl, isoindolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, tetrazolyl, furazanyl, thienyl, furanyl, or benzo[d]pyrazolyl. More preferably the mono- or bicyclic heteroaromatic group is selected from the group consisting of pyridyl, e.g. 2-, 3- or 4-pyridyl, and thiazolyl; e.g. 2-thiazolyl.
(122) Preferably the acyl group is lower alkylcarbonyl with 1 to 5 carbon atoms (C1-C5), e.g. acetyl, propionyl, n- or isopropylcarbonyl, or n-, iso- or tert-butylcarbonyl, or arylcarbonyl, e.g. benzoyl.
(123) Preferred azo dyes according to structural Formula I are those compounds, including any associated counterions, which have one or more features selected from:
(124) Preferred compounds according to structural Formula (I), including any associated counterions, are water-soluble azo dyes. Particularly preferred water-soluble azo dyes comprise a sulfonate group. Most preferred azo dyes are pyridylazo dyes which have an electron-withdrawing substituent at R1 position such as halogen, nitro, cyano, sulfonic acid, trifluoromethyl and trichloromethyl, most preferably bromo or nitro. Examples of preferred compounds according to structural Formula I are: 2-(5-bromo-2-pyridylazo)-5-[N-propyl-N-(3-sulfopropyl)amino]phenol disodium salt dihydrate (abbreviated as 5-Bromo-PAPS) and 2-(5-nitro-2-pyridylazo)-5-[N-propyl-N-(3-sulfopropyl)amino]phenol disodium salt dihydrate (abbreviated as 5-Nitro-PAPS).
(125) In some embodiments, one or more preferred dyes according to structural Formula I are combined with one or more divalent metals selected from the group of Mg(II), Mn(II), Fe(II), Co(II), Ni(II), Cu(II), and Zn(II) where the metal ion is capable of being removed from the dye-metal complex in the presence of pyrophosphate. 5-Bromo-PAPS and 5-Nitro-PAPS were shown in
(126) In some embodiments a detergent, especially a cationic detergent (e.g., cetylpyridinium chloride (CPC), cetyltrimethylammonium bromide (CTAB), dodecyltrimethylammonium bromide (DTAB), and polydiallyldimethylammonium chloride (PDADMAC)) is further combined to provide further enhancement in colorimetric dye response. In some embodiments, two or more dyes producing the same or different visual color in the presence of a divalent metal are combined in the amplification buffer to provide further contrast in colorimetric detection. In other embodiments, two or more divalent metals are combined with a one or more dyes in the amplification buffer to provide further contrast in colorimetric detection. In some embodiments, the concentration ratio between a preferred dye and a divalent metal in the amplification buffer is varied to provide further contrast in colorimetric detection.
(127) In some embodiments, the divalent metal forms insoluble precipitate with the pyrophosphate produced during an enzyme reaction such as amplification. Without wishing to be bound by theory, the formation of an insoluble metal pyrophosphate sequesters the metal away from dye-metal complexes resulting in a detectable hypsochromic shift. In some preferred embodiments, dye-metal complexes are not substantially affected by NTPs and any other phosphorylated species that may be present in the amplification buffer prior to the amplification reaction.
(128) Uses of the Formula 1 Dye Metal Complexes in Colorimetric Amplification Assays.
(129) The recent Covid pandemic has highlighted the need for easy, fast, sensitive and cost effective viral diagnostic tests for use in large scale (population testing) or small scale (personalized testing) that are capable of detecting viral nucleic acids from body fluids where the most readily accessible are nasal swabs and saliva. Formula 1 dye-metal complexes are here demonstrated to have the attributes required to achieve diagnostic tests such as these. Covid testing also has been used on environmental samples such as wastewater. Again, Formula 1 dye metal complex are a sensitive indicator that can be used with an amplification method of choice for use on site in real time.
(130) Synthetic biology requires creating clones of bacterial containing the synthetic constructs in plasmids. Being able to rapidly and easily identify correctly assembled clones can expedite the process of discovery. Formula 1 dye metal complexes enable colony PCR to be rapidly performed without the need for gels.
(131) Kits containing any of the above-described reagents are provided. In a kit the reagents may be mixed together, separate from one another, or any combination of the two. For example, a kit may contain an RNA or DNA polymerase, manganese salt, and a dye of formula 1 as described above. The kit may also contain NTPs, etc. and, in some case, instructions for use.
(132) All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference including: US Provisional Ser. Nos. 63/263,361 and 63/263,364.
Embodiments
(133) Embodiment 1. A composition comprising an enzyme that releases pyrophosphate from a substrate and a dye of Formula 1:
(134) ##STR00003##
(135) wherein:
(136) R1 and R5 are each independently selected from the group consisting of H, halogen, nitro, cyano, sulfonic acid, carboxy, trifluoromethyl, trichloromethyl and tribromomethyl;
(137) R2 and R3 are each independently a lower alkyl optionally comprising a terminal sulfonate group; and
(138) R4 is H, OH or COOH.
(139) Embodiment 2. The composition of embodiment 1, wherein:
(140) at least one of R1 and R5 is F, Cl, Br or I;
(141) R2 and R3 are each independently n-butyl, sec-butyl, isobutyl, tert-butyl, propyl, n-propyl, isopropyl, ethyl, or methyl and at least one of R2 and R3 comprises the terminal sulfonate group.
(142) Embodiment 3. The composition according to any prior embodiment, further comprising a divalent manganese salt (Mn.sup.2+).
(143) Embodiment 4. The composition according to any prior embodiment, wherein the composition comprises a divalent manganese salt wherein the molar ratio of the manganese salt to dye is greater than 1.
(144) Embodiment 5. The composition according to any prior embodiment, wherein the composition further comprises one or more nucleoside triphosphates (NTPs) selected from rNTPs and dNTPs.
(145) Embodiment 6. The composition according to any prior embodiment, wherein the molar ratio of NTPs to manganese salt is greater than 1.
(146) Embodiment 7. The composition according to any prior embodiment, wherein the dye is 2-(5-Bromo-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-Br-PAPS) or 2-(5-Nitro-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-Nitro-PAPS).
(147) Embodiment 8. The composition according to any prior embodiment, wherein the enzyme is a DNA polymerase, RNA polymerase, reverse transcriptase, primase, ligase, helicase, nucleotide Ppase/phosphodiesterase, RNA decapping enzyme (RNA 5′ pyrophosphohydrolase) or geranyl pyrophosphate synthase
(148) Embodiment 9. The composition according to any prior embodiment, wherein the enzyme is a polymerase selected from a thermostable DNA polymerase, a strand displacing DNA polymerase, an RNA polymerase and a reverse transcriptase.
(149) Embodiment 10. The composition according to embodiment 11, wherein the enzyme is Bst polymerase, Bsu polymerase, an archaeal DNA polymerase, Taq polymerase, or a variant thereof.
(150) Embodiment 11. The composition according to any prior embodiment, wherein the composition is lyophilized or in an aqueous solution.
(151) Embodiment 12. The composition according to any prior embodiment, further comprising a substrate for enzyme, wherein cleavage of the substrate by the enzyme results in production of pyrophosphate.
(152) Embodiment 13. The composition according to any prior embodiment, further comprising a nucleic acid sample that contains a target nucleic acid and, optionally, primers.
(153) Embodiment 14. The composition according to embodiment 14, wherein the sample is a sample from an animal subject.
(154) Embodiment 15. The composition according to embodiment 14, wherein the sample is a clinical sample selected from the group consisting of: saliva, nasal mucosa, urine, tissue biopsy, and a cell scrape or an environmental sample selected from water, sewerage, soil and plants or animal material for use as food.
(155) Embodiment 16. A method for detecting pyrophosphate, comprising:
(156) (a) combining a manganese salt, an enzyme, a substrate for the enzyme that releases pyrophosphate when it cleaved by the enzyme, and a dye of Formula 1 produce a reaction mix;
(157) ##STR00004##
(158) wherein:
(159) R1 and R5 are each independently selected from the group consisting of H, halogen, nitro, cyano, sulfonic acid, carboxy, trifluoromethyl, trichloromethyl and tribromomethyl;
(160) R2 and R3 are each independently a lower alkyl optionally comprising a terminal sulfonate group; and
(161) R4 is H, OH or COOH;
(162) (b) incubating the reaction mix under conditions by which the enzyme cleaves the substrate to produce pyrophosphate; and
(163) (c) observing a change in color of the reaction mix, wherein the change in color indicates that pyrophosphate has been produced.
(164) Embodiment 17. The method of embodiment 16, wherein the enzyme is a DNA polymerase, RNA polymerase, reverse transcriptase, primase, ligase, helicase, nucleotide Ppase/phosphodiesterase, RNA decapping enzyme (RNA 5′ pyrophosphohydrolase) or geranyl pyrophosphate synthase.
(165) Embodiment 18. The method of embodiment 16 or 17, wherein the substrate is an NTP.
(166) Embodiment 19. The method of any of embodiments 16-18, wherein:
(167) the reaction mix comprises a polymerase, rNTPs or dNTPs, the manganese salt, a template nucleic acid and the dye;
(168) the reaction mix is incubated under conditions suitable for amplification of the nucleic acid; and
(169) the change in color indicates that a product has been amplified.
(170) Embodiment 20. The method of embodiment 19, wherein the reaction mix comprises an amplification mix for loop-mediated isothermal amplification (LAMP), polymerase chain reaction (PCR), strand displacement amplification (SDA), helicase dependent amplification (HDA), multiple displacement amplification (MDA), rolling circle amplification, ligation mediated amplification, whole genome amplification (WGA), nucleic acid sequence-based amplification (NASBA) or recombinase polymerase amplification (RPA) mix.
(171) Embodiment 21. The method according to embodiment 19 or 20, wherein the reaction mix is a PCR reaction mix and the method comprises thermocycling the reaction mix.
(172) Embodiment 22. The method according to embodiment 19 or 20, wherein reaction mix is a LAMP reaction mix and the method comprises incubating the reaction mix under isothermal conditions.
(173) Embodiment 23. The method according to any of embodiments 16-22, wherein the color change in (c) is red to yellow wherein yellow indicates production of pyrophosphate.
(174) Embodiment 24. The method according to any of embodiments 16-23, wherein the color change is detected by spectrophotometry, image analysis or by eye.
(175) Embodiment 25. The method according to any of embodiments 16-24, wherein color change is a change in hue or a change in peak wavelength.
(176) Embodiment 26. The method according to any of embodiments 16-25, wherein the change in color is detected by observing a change in a ratio of wavelength peak heights, before and after step (b).
(177) Embodiment 27. The method according to embodiment 26, wherein the wavelength peak heights are in the range of 350 nm-620 nm, 430 nm-480 nm and/or 520 nm-620 nm.
(178) Embodiment 28. The method according to any of embodiments 16-27, further comprising, determining the amount of nucleic acid substrate or the amount of amplicon by determining the number of thermocycles in a PCR amplification reaction for producing a predetermined ratio of wavelength peak height.
(179) Embodiment 29. The method according to any of embodiments 16-28, wherein the dye is 2-(5-Bromo-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-Br-PAPS) or 2-(5-Nitro-2-pyridylazo)-5-(N-propyl-N-sulfopropylamino)phenol (5-Nitro-PAPS).
(180) Embodiment 30. A kit comprising a polymerase, manganese salt, and a dye of formula 1
(181) ##STR00005##
(182) wherein:
(183) R1 and R5 are each independently selected from the group consisting of H, halogen, nitro, cyano, sulfonic acid, carboxy, trifluoromethyl, trichloromethyl and tribromomethyl;
(184) R2 and R3 are each independently a lower alkyl optionally comprising a terminal sulfonate group; and
(185) R4 is H, OH or COOH.
EXAMPLES
(186) Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only and are not intended to limit the scope of the present invention in any way.
(187) Materials and Methods
(188) Purchased chemical reagents: 5-Bromo-PAPS, 4-(2-pyridylazo)resorcinol), Eriochrome® Black T, MnCl.sub.2, CaCl, CuCl.sub.2, ZnCl.sub.2, FeSO.sub.4, NiCl.sub.2, ReCl.sub.3, and CrCl.sub.2, were obtained from Sigma-Aldrich (St. Louis, Mo.), 5-Nitro-PAPS from Dojindo Molecular Technologies (Rockville, Md.), and hydroxynaphthol blue from Acros Organics. All molecular reagents were obtained from New England Biolabs (Ipswich, Mass.), unless otherwise noted.
(189) For screening metal sensing dyes and metal ions, 25 μL LAMP reactions were performed in triplicate using WarmStart® LAMP Kit (DNA & RNA) (New England Biolabs, Ipswich, Mass.) with a lambda DNA primer set (Tanner et. al., Biotechniques 58(2), 59-68 (2015)) using 1 ng lambda DNA or NTC. Dyes and metal ions were diluted to 25× concentration and then mixed into LAMP reactions to 1× concentration before incubation. The reactions were incubated at 65° C. on a Bio-Rad CFX96™ Real-Time PCR instrument (Bio-Rad Laboratories, Hercules, Calif.) with readings performed at 15 second intervals (108 cycles, .sup.˜40 minutes). Before and after incubation, the color of each reaction was recorded by scanning with an office scanner (Epson® Perfection Photo Scanner V600 (Epson, Los Alamitos, Calif.)). The absorbance of each reaction was measured on a SpectraMax® M5 Microplate Reader (Molecular Devices, San Jose, Calif.). Thermostable Inorganic Ppase was added (1 Unit) to 25 μL LAMP reactions in the test of pyrophosphate requirement. For comparing tolerance of carryover solutions, the elution buffer (10 mM Tris, pH8.5) from a QIAquick® PCR Purification Kit (Qiagen, Hilden, Germany) and VTM (BD™ Universal Viral Transport medium, (Becton Dickinson, Franklin Lakes, N.J.)) were used. The pH-based colorimetric LAMP reactions were performed with WarmStart Colorimetric LAMP 2× Master Mix (DNA & RNA) following the product recommendations. For RT-LAMP, the SARS-CoV-2 E1 and N2 primer sets were used along with synthetic SARS-CoV-2 RNA from Twist Bioscience (Twist Synthetic SARS-CoV-2 RNA Control 2) (Twist Bioscience, South San Francisco, Calif.) diluted to .sup.˜10 copies/μL in the presence of 10 ng/μL Jurkat total RNA.
(190) Colorimetric detection of PCR amplification was performed in 25 μL reactions by including 50 μM PAPS dye and 50 μM Mn.sup.2+ into reactions with either LongAmp Taq 2× Master Mix or OneTaq 2× Master Mix with Standard Buffer. The same concentrations of PAPS dye and Mn.sup.2+ were added to Q5 High-Fidelity 2× Master Mix and supplemented with Tween 20 to a final concentration 0.1%. The primer pairs for amplifying lambda DNA fragments had the same forward primer 5′ CCTGCTCTGCCGCTTCACGC (SEQ ID NO:1) with different reverse primers to create different product lengths. The reverse primers are shown below:
(191) 5′ TCCGGATAAAAACGTCGATGACATTTGC (SEQ ID NO:2); product length 0.5 kb;
(192) 5′ GATGACGCATCCTCACGATAATATCCGG (SEQ ID NO:3); product length 1 kb;
(193) 5′ CCATGATTCAGTGTGCCCGTCTGG (SEQ ID NO:4); product length 2.0 kb; and
(194) 5′ CGAACGTCGCGCAGAGAAACAGG (SEQ ID NO:5); product length 5.0 kb.
(195) For amplifying 1-2 kb fragments from E. coli and 0.5 kb-2 kb human genomic DNA, reactions were performing using LongAmp Hot Start Taq 2× Master Mix with 50 μM Bromo-PAPS, either 25 or 50 μM Mn.sup.2+, and either 1 ng E. coli DNA (˜200,000 copies) or 10 ng Jurkat cell DNA (.sup.˜2,900 copies).
(196) The primer sequences for the 1 kb E. coli fragment are: Forward: 5′ CCTGGATCCAGATGCAGTAATACCGC (SEQ ID NO:6); Reverse: 5′ TCCGAGGATGGTATTCGTCATG (SEQ ID NO:7). The primer sequences for the 0.5 kb human fragment are: Forward: 5′ GGGGCACCTTCTCCAACTCATACT (SEQ ID NO:8); Reverse: 5′ CGAGCTACCACGCAGACATCAACC (SEQ ID NO:9).
(197) The primer sequences for the 1 kb human fragment are:
(198) Forward: 5′ GGGGCACCTTCTCCAACTCATACT (SEQ ID NO:10);
(199) Reverse: 5′ CCTCATTTGGGGAGGGGTTATCT (SEQ ID NO:11).
(200) The primer sequences for the 2 kb human fragment are:
(201) Forward: 5′ GAAGAGCCAAGGACAGGTAC (SEQ ID NO:12);
(202) Reverse: 5′ CCTCCAAATCAAGCCTCTAC (SEQ ID NO:13).
(203) DNA yield for PCR reaction was determined using Quant-iT™ PicoGreen® dsDNA Assay Kits (Thermo Fisher Scientific, Waltham, Mass.).
(204) For colony PCR, a small portion of an E. coli colony was transferred using a pipette tip to 15 μL water. 1 μL of the bacterial suspension was used for each PCR reaction with LongAmp.
(205) Similar conditions were used for amplifying the 6,136 bp and 5,292 bp fragments, except that the extension time at 65° C. was adjusted to 5 minutes. 5 μL of each PCR product was analyzed by electrophoresis on 1% agarose gel along with a Quick-Load® 1 kb DNA Ladder (New England Biolabs, Ipswich, Mass.).
(206) The compounds shown in
(207) Results
(208) Metal binding dyes in combination with various metal ions were screened in fully buffered (20 mM Tris) reactions. Bright colors were observed with pyridylazoaniline dyes, 5-Bromo-PAPS and 5-Nitro-PAPS before LAMP when complexed with Cu.sup.2+, Zn.sup.2+, Fe.sup.2+ and Ni.sup.2+ but not with Ca.sup.2+, Cr.sup.2+ and Re.sup.3+. However, the observed colors were substantially unchanged after LAMP except for Mn.sup.2+ ions. Mn.sup.2+ changed the color of 5-Bromo-PAPS and 5-Nitro-PAPS from red to yellow at the end of LAMP (
(209) The hypothesis that the pyridylazoaniline dye complexes with Mn.sup.2+ to give a red color but is displaced by the Pyrophosphate (PPi) produced during amplification to form insoluble manganese(II) pyrophosphate, thereby restoring the dye original yellow color (
(210) Concentration ranges of 5-Bromo-PAPS dyes (50-100 μM) and Mn.sup.2+ (50 μM-150 μM) were tested to determine whether the ratio was critical.
(211) The absorbance spectrum shift of PAPS dyes in completed LAMP reactions is another useful indicator of a positive amplification reaction. In positive reactions, the absorbance at 450 nm significantly increased while the absorption around 550 nm decreased considerably. These shifts of absorbance peaks could be used to quantitatively determine positive reactions in objective automated measurement systems. Two approaches to quantitatively measure positive reactions are shown in
(212) Having determined factors that affect color change with the pyridylazoaniline dyes, the pyridylazoaniline-based detection method was then used to determine the sensitivity of detection of synthetic SARS-CoV-2 RNA using RT-LAMP. 24 reactions were performed with an input of approximately 10 copies of viral RNA per reaction, which is below the limit of detection of a commercially available kit based on a pH-dependent dye (.sup.˜50 copies, SARS-CoV-2 Rapid Colorimetric LAMP Assay Kit (New England Biolabs, Ipswich, Mass.). At this low level of nucleic acid, both positive and negative reactions could be detected by eye (
(213) To determine whether pyridylazoaniline dyes and Mn.sup.2+ affected RT-LAMP detection sensitivity, tests were performed with two primer sets for SARS-CoV-2, with or without guanidine hydrochloride (GuHCl) (Table 1). Each condition was tested with 24 replicates of .sup.˜10 copies of SARS-CoV-2 RNA. Comparing the number of positives across the different conditions, 75 μM PAPS dye and 100 μM Mn.sup.2+, added individually or in combination, had no impact on the detection sensitivity. Moreover, not only was GuHCl compatible with the reaction conditions, but also slightly increased the detection sensitivity.
(214) TABLE-US-00001 TABLE 1 Sensitivity of RT-LAMP in the presence of 75 μM Bromo-PAPS and/or 100 uM Mn++ E1700 only E1700 + 5-Bromo-PAPS Primer and GnCl No Mn.sup.++ 100 uM Mn.sup.++ No Mn.sup.++ 100 uM Mn.sup.++* N2 6/24 5/24 4/24 7/24 N2 (+GnCl) 10/24 8/24 9/24 9/24 E1 7/24 6/24 7/24 5/24 E1 (+GnCl) 12/24 12/24 13/24 12/24 N2 + E1 14/24 21/24 19/24 21/24 (+GnCl) *The results for reactions with both 5-Bromo-PAPS and Mn.sup.++ were determined based on color change and the results were identical to that by real time monitoring.
(215) Advantages of the pyridylazoaniline colorimetric reporter system over pH-based detection, were demonstrated by testing the tolerance of various buffer carryover (
(216) Pyridylazoaniline dyes exemplified by 5-Bromo-PAPS dyes are visual reporters for PCR reactions. 0.5 kb-5.0 kb long fragments from lambda DNA were amplified using PCR in the presence of 50 μM 5-Bromo-PAPS and 50 μM Mn2+ with three commercial PCR master mixes (
(217) The robustness and sensitivity of PAPS-based colorimetric PCR detection was determined by amplifying DNA fragments from E. coli and human genomes for 32-44 cycles and compared the color change with the yield of specific product bands by electrophoresis (
(218) When the human fragment size increased to 2 kb, the cycle numbers required for the color change reduced to 32-36 cycles. These results indicated that the color change depended on the amount of DNA produced, corroborating the product yields visualized by gel electrophoresis.
(219) The relationship between visual color change and DNA yield was quantified visually and by absorbance spectra (
(220) A further example of workflow improvement enabled by colorimetric PCR, can be observed for colony PCR using 5-Bromo-PAPS (