MODULATORS OF KLK3 ERNA
20190040395 ยท 2019-02-07
Assignee
Inventors
Cpc classification
C12N2310/3231
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The present embodiments provide methods, compounds, and compositions useful for inhibiting KLK3 eRNA expression, which may be useful for treating, preventing, or ameliorating cancer, such as prostate cancer.
Claims
1. A compound comprising of a modified oligonucleotide 16 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 3 (GAACCTTGGTTAGGCA), wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5 wing segment consisting of 3 linked nucleosides; and a 3 wing segment consisting of 3 linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment; wherein each nucleoside of each wing segment comprises a contrained ethyl (cEt) nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
2. A compound comprising a modified oligonucleotide 16 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 4 (ATGGTGCTGGCCACAC), wherein the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5 wing segment consisting of 3 linked nucleosides; and a 3 wing segment consisting of 3 linked nucleosides; wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment; wherein each nucleoside of each wing segment comprises a contrained ethyl (cEt) nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
3. A composition comprising the compound of claim 1 or 2 and a pharmaceutically acceptable carrier.
4. A composition comprising a compound of claim 1 or 2, for use in therapy.
5. A method of treating, preventing, or ameliorating cancer in an individual comprising administering to the individual the compound of claim 1 or 2 or composition of claim 3, thereby treating, preventing, or ameliorating the cancer.
6. The method of claim 5, wherein the cancer is prostate cancer.
7. A method of inhibiting expression of KLK3 eRNA in a cell comprising contacting the cell with the compound of claim 1 or 2, thereby inhibiting expression of KLK3 eRNA in the cell.
8. The method of claim 7, wherein the cell is in the prostate of an individual.
9. The method of claim 8, wherein the individual has, or is at risk of having, prostate cancer.
10. Use of the compound of claim 1 or 2 for treating, preventing, or ameliorating cancer.
11. The use of claim 10, wherein the cancer is prostate cancer.
12. Use of the compound of claim 1 or 2 in the preparation of a medicament for treating, preventing, or ameliorating cancer.
13. The use of claim 12, wherein the cancer is prostate cancer.
Description
DETAILED DESCRIPTION
[0009] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of or means and/or unless stated otherwise. Furthermore, the use of the term including as well as other forms, such as includes and included, is not limiting.
[0010] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.
[0011] It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase. Compounds described by ISIS number (ISIS #) indicate a combination of nucleobase sequence, chemical modification, and motif.
[0012] Unless otherwise indicated, the following terms have the following meanings:
[0013] 2-deoxynucleoside means a nucleoside comprising 2-H(H) furanosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).
[0014] 5-methylcytosine means a cytosine with a methyl group attached to the 5 position.
[0015] About means within 10% of a value. For example, if it is stated, the compounds affected about 70% inhibition of KLK3 eRNA, it is implied that KLK3 eRNA levels are inhibited within a range of 60% and 80%.
[0016] Administration or administering refers to routes of introducing a compound or composition provided herein to an individual to perform its intended function. An example of a route of administration that can be used includes, but is not limited to parenteral administration, such as subcutaneous, intravenous, or intramuscular injection or infusion.
[0017] Amelioration refers to an improvement or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.
[0018] Animal refers to a human or non-human animal, including, but not limited to, mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees.
[0019] cEt or constrained ethyl means a bicyclic furanosyl sugar moiety comprising a bridge connecting the 4-carbon and the 2-carbon, wherein the bridge has the formula: 4-CH(CH.sub.3)O-2.
[0020] Complementary in reference to an oligonucleotide means the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to the following pairs: adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methyl cytosine (.sup.mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. By contrast, fully complementary or 100% complementary in reference to oligonucleotides means that such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches.
[0021] Expression includes all the functions by which a gene's coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to, the products of transcription and translation.
[0022] Gapmer means an oligonucleotide comprising an internal region having a plurality of nucleosides that support RNase H cleavage positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions. The internal region may be referred to as the gap and the external regions may be referred to as the wings.
[0023] Hybridization means the annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target.
[0024] Individual means a human or non-human animal selected for treatment or therapy.
[0025] Inhibiting the expression or activity refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample.and does not necessarily indicate a total elimination of expression or activity.
[0026] internucleoside linkage means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. Modified internucleoside linkage means any internucleoside linkage other than a naturally occurring, phosphate internucleoside linkage. Non-phosphate linkages are referred to herein as modified internucleoside linkages.
[0027] KLK3 eRNA means the RNA transcript of the KLK3 enhancer. KLK3 eRNA is described, for example, in Hsieh et al. Proc. Natl. Acad. Sci. USA 2014 May 20; 111(20):7319-24, which is incorporated by reference herein in its entirety.
[0028] KLK3 eRNA specific inhibitor refers to any agent capable of specifically inhibiting KLK3 eRNA expression or activity at the molecular level. For example, KLK3 eRNA specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression of KLK3 eRNA.
[0029] Linked nucleosides means adjacent nucleosides linked together by an internucleoside linkage.
[0030] Modulating refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating KLK3 eRNA can mean to increase or decrease the level of KLK3 eRNA in a cell, tissue, organ or organism. A modulator effects the change in the cell, tissue, organ or organism. For example, a KLK3 eRNA compound can be a modulator that decreases the amount of KLK3 eRNA in a cell, tissue, organ or organism.
[0031] Nucleobase means a heterocyclic moiety capable of pairing with a base of another nucleic acid. As used herein a naturally occurring nucleobase is adenine (A), thymine (T), cytosine (C), uracil (U), and guanine (G). A modified nucleobase is a naturally occurring nucleobase that is chemically modified. A universal base or universal nucleobase is a nucleobase other than a naturally occurring nucleobase and modified nucleobase, and is capable of pairing with any nucleobase.
[0032] Nucleobase sequence means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or internucleoside linkage.
[0033] Nucleoside means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. Modified nucleoside means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.
[0034] Oligonucleotide means a polymer of linked nucleosides each of which can be modified or unmodified, independent one from another. Unless otherwise indicated, oligonucleotides consist of 8-80 linked nucleosides. Modified oligonucleotide means an oligonucleotide, wherein at least one sugar, nucleobase, or internucleoside linkage is modified. Unmodified oligonucleotide means an oligonucleotide that does not comprise any sugar, nucleobase, or internucleoside modification.
[0035] Parenteral administration means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
[0036] Pharmaceutically acceptable carrier or diluent means any substance suitable for use in administering to an individual. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection.
[0037] Pharmaceutical agent means a compound that provides a therapeutic benefit when administered to an individual.
[0038] Pharmaceutical composition means a mixture of substances suitable for administering to an individual. For example, a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.
[0039] Phosphorothioate linkage means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate internucleoside linkage is a modified internucleoside linkage.
[0040] Phosphorus moiety means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.
[0041] Prevent refers to delaying or forestalling the onset, development or progression of a disease, disorder, or condition for a period of time from minutes to indefinitely.
[0042] Reduce means to bring down to a smaller extent, size, amount, or number.
[0043] RefSeq No. is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene). Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).
[0044] Region is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
[0045] RNAi compound means an antisense compound that acts, at least in part, through RISC or Ago2, but not through RNase H, to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi compounds include, but are not limited to double-stranded siRNA, single-stranded RNA (ssRNA), and microRNA, including microRNA mimics.
[0046] Single-stranded in reference to a compound means the compound has only one oligonucleotide. Self-complementary means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self-complementary, is a single-stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex.
[0047] Specifically hybridizable refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.
[0048] Specifically inhibit with reference to a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids. Reduction does not necessarily indicate a total elimination of the target nucleic acid's expression.
[0049] Standard cell assay means assay(s) described in the Examples and reasonable variations thereof.
[0050] Targeting means the specific hybridization of a compound to a target nucleic acid in order to induce a desired effect.
[0051] Target nucleic acid, target RNA, target RNA transcript and nucleic acid target all mean a nucleic acid capable of being targeted by compounds described herein.
[0052] Therapeutically effective amount means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to an individual.
[0053] Treat refers to administering a compound or pharmaceutical composition to an animal in order to effect an alteration or improvement of a disease, disorder, or condition in the animal.
Certain Embodiments
[0054] Certain embodiments provide methods, compounds and compositions for inhibiting KLK3 eRNA expression. Certain embodiments provide methods, compounds and compositions for inhibiting KLK3 eRNA expression in a cell.
[0055] Certain embodiments provide compounds targeted to a KLK3 eRNA. In certain embodiments, the KLK3 eRNA has the sequence set forth in GENBANK Accession No NT_011109.17_TRUNC_23609000_23621000 (incorporated by reference, disclosed herein as SEQ ID NO: 1). In certain embodiments, the KLK3 eRNA has the sequence set forth in SEQ ID NO: 2. In certain embodiments, KLK3 eRNA has the sequence described in in Hsieh et al. Proc. Natl. Acad. Sci. USA 2014 May 20; 111(20):7319-24, which is incorporated by reference herein in its entirety.
[0056] In certain embodiments, the compound is single-stranded. In certain embodiments, the compound is double-stranded.
[0057] In certain embodiments, a compound comprises or consists of a modified oligonucleotide 16 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 3 (GAACCTTGGTTAGGCA), wherein the modified oligonucleotide comprises: [0058] a gap segment consisting of 10 linked deoxynucleosides; [0059] a 5 wing segment consisting of 3 linked nucleosides; and [0060] a 3 wing segment consisting of 3 linked nucleosides; [0061] wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment; wherein each nucleoside of each wing segment comprises a contrained ethyl (cEt) nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
[0062] In certain embodiments, a compound comprises or consists of a modified oligonucleotide 16 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 4 (ATGGTGCTGGCCACAC), wherein the modified oligonucleotide comprises: [0063] a gap segment consisting of 10 linked deoxynucleosides; [0064] a 5 wing segment consisting of 3 linked nucleosides; and [0065] a 3 wing segment consisting of 3 linked nucleosides; [0066] wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment; wherein each nucleoside of each wing segment comprises a contrained ethyl (cEt) nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
[0067] In any of the foregoing embodiments, the compound or oligonucleotide can be at least 85%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% complementary to KLK3 eRNA.
[0068] In any of the foregoing embodiments, the compound can be single-stranded. In certain embodiments, the compound comprises deoxyribonucleotides. In certain embodiments, the compound is double-stranded. In certain embodiments, the compound is double-stranded and comprises ribonucleotides.
Certain Indications
[0069] Certain embodiments provided herein relate to methods of inhibiting KLK3 eRNA expression, which can be useful for treating, preventing, or ameliorating cancer, such as prostate cancer, in an individual, by administration of a compound that targets KLK3 eRNA. In certain embodiments, such a compound is a KLK3 eRNA specific inhibitor. In certain embodiments, the compound is an antisense compound, oligomeric compound, or oligonucleotide targeted to KLK3 eRNA.
[0070] In certain embodiments, a method of treating, preventing, or ameliorating cancer, such as prostate cancer, in an individual comprises administering to the individual a specific inhibitor of KLK3 eRNA, thereby treating, preventing, or ameliorating the disease. In certain embodiments, the KLK3 eRNA specific inhibitor is a compound targeted to KLK3 eRNA, such as an oligonucleotide targeted to KLK3 eRNA.
[0071] In certain embodiments, a method of inhibiting expression of KLK3 eRNA in an individual having, or at risk of having cancer, such as prostate cancer, comprises administering a KLK3 eRNA specific inhibitor to the individual, thereby inhibiting expression of KLK3 eRNA in the individual. In certain embodiments, administering the inhibitor inhibits expression of KLK3 eRNA in the prostate. In certain embodiments, the individual has, or is at risk of having cancer, such as prostate cancer. In certain embodiments, the KLK3 eRNA specific inhibitor is a compound targeted to KLK3 eRNA, such as an oligonucleotide targeted to KLK3 eRNA. In certain embodiments, a method of inhibiting expression of KLK3 eRNA in a cell comprises contacting the cell with a KLK3 eRNA specific inhibitor, thereby inhibiting expression of KLK3 eRNA in the cell. In certain embodiments, the cell is a cancer cell, such as a prostate cancer cell. In certain embodiments, the cell is in the prostate. In certain embodiments, the cell is in the prostate of an individual who has, or is at risk of having cancer, such as prostate cancer.
[0072] Certain embodiments are drawn to a KLK3 eRNA specific inhibitor for use in treating cancer, such as prostate cancer. In certain embodiments, the disease is cancer, such as prostate cancer.
[0073] Certain embodiments are drawn to use of a KLK3 eRNA specific inhibitor for the manufacture or preparation of a medicament for treating cancer, such as prostate cancer. Certain embodiments are drawn to use of a KLK3 eRNA specific inhibitor for the preparation of a medicament for treating cancer, such as prostate cancer.
[0074] In any of the foregoing methods or uses, the compound targeted to KLK3 eRNA or specific inhibitor of KLK3 eRNA comprises or consists of a modified oligonucleotide 16 linked nucleobases in length having a nucleobase sequence comprising the sequence recited in SEQ ID NO: 3 or SEQ ID NO: 4, wherein the modified oligonucleotide comprises: [0075] a gap segment consisting of 10 linked deoxynucleosides; [0076] a 5 wing segment consisting of 3 linked nucleosides; and [0077] a 3 wing segment consisting of 3 linked nucleosides; [0078] wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment; wherein each nucleoside of each wing segment comprises a contrained ethyl (cEt) nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
[0079] In any of the foregoing methods or uses, the compound can be administered parenterally. For example, in certain embodiments the compound can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.
Hybridization
[0080] In some embodiments, hybridization occurs between a compound disclosed herein and a KLK3 eRNA nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.
[0081] Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.
[0082] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the compounds provided herein are specifically hybridizable with a KLK3 eRNA nucleic acid.
Certain Modified Compounds
[0083] In certain embodiments, compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified internucleoside linkage).
A. Modified Nucleosides
[0084] Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.
[0085] 1. Modified Sugar Moieties
[0086] In certain embodiments, modified oligonucleotides comprise 4-CH(CH.sub.3)O-2 (referred to as constrained ethyl or cEt when in the S configuration) sugar modifications. cEt modifications are described in U.S. Pat. No. 7,399,845; U.S. Pat. No. 7,741,457; U.S. Pat. No. 8,022,193; and U.S. Pat. No. 7,569,686, which are incorporated by reference herein in their entireties.
[0087] 2. Modified Nucleobases
[0088] Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to antisense compounds.
[0089] In certain embodiments, compounds targeted to a KLK3 eRNA comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.
[0090] 3. Modified Internucleoside Linkages
[0091] The naturally occuring internucleoside linkage of RNA and DNA is a 3 to 5 phosphodiester linkage. In certain embodiments, compounds described herein having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
[0092] In certain embodiments, compounds targeted to a KLK3 eRNA comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is a phosphorothioate (P=S) internucleoside linkage.
[0093] 4. Certain Modified Oligonucleotides
[0094] In certain embodiments, compounds described herein comprise modified oligonucleotides. In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into a modified oligonucleotide. In certain embodiments, modified oligonucleotides are 16 linked nucleosides in length comprising: [0095] a gap segment consisting of 10 linked deoxynucleosides; [0096] a 5 wing segment consisting of 3 linked nucleosides; and [0097] a 3 wing segment consisting of 3 linked nucleosides; [0098] wherein the gap segment is positioned between the 5 wing segment and the 3 wing segment; wherein each nucleoside of each wing segment comprises a contrained ethyl (cEt) nucleoside; wherein each internucleoside linkage is a phosphorothioate linkage; and wherein each cytosine is a 5-methylcytosine.
EXAMPLES
Non-Limiting Disclosure and Incorporation by Reference
[0099] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.
Example 1
Antisense Inhibition of Human KLK3 eRNA in C4-2 Cells
[0100] Antisense oligonucleotides were designed targeting human KLK3 eRNA and were tested for their effects on KLK3 eRNA levels in vitro. The antisense oligonucleotides were tested in a series of experiments that had similar culture conditions. The results for each experiment are presented in separate tables shown below. Cultured C4-2 human prostate cancer cells at a density of 30,000 cells per well were transfected using electroporation with 10,000 nM antisense oligonucleotide. After a treatment period, RNA was isolated from the cells and KLK3 eRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS4882 (forward sequence GGAGAATTGCCTCCCAACAC, designated herein as SEQ ID NO: 5; reverse sequence TTAATGGTGGAACGTTGAGACTGT, designated herein as SEQ ID NO: 6; probe sequence TTCAGCCAGAGCCTTCCACCCTTG, designated herein as SEQ ID NO: 7) was used to measure RNA levels. KLK3 eRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN. Results are presented as percent inhibition of KLK3 eRNA, relative to untreated control cells.
[0101] The newly designed chimeric antisense oligonucleotides were designed as 3-10-3 (S)-cET gapmers. The gapmers are 16 nucleosides in length, wherein the central gap segment consists of ten 2-deoxynucleosides and is flanked by wing segments on both the 5 direction and on the 3 direction consisting of three nucleosides per wing. Each nucleoside in the 5 wing segment and each nucleoside in the 3 wing segment has an (S)-cEt modification. The internucleoside linkages throughout each gapmer are phosphorothioate linkages. All cytosine residues throughout each gapmer are 5-methylcytosines. Start site indicates the 5-most nucleoside to which the gapmer is targeted in the human enhancer gene sequence. Stop site indicates the 3-most nucleoside to which the gapmer is targeted in the human enhancer gene sequence. Each gapmer listed in the tables below is targeted to the KLK3 eRNA sequence represented by SEQ ID NO: 2.
TABLE-US-00001 TABLE1 Target Target % SEQ StartSite StopSite ISISNo Sequence inhibition IDNO 408 423 735245 GAACCTTGGTTAGGCA 60 3
TABLE-US-00002 TABLE2 Target Target % SEQ StartSite StopSite ISISNo Sequence inhibition IDNO 408 423 735245 GAACCTTGGTTAGGCA 56 3
TABLE-US-00003 TABLE3 Target Target % SEQ StartSite StopSite ISISNo Sequence inhibition IDNO 1028 1043 735285 ATGGTGCTGGCCACAC 76 4
TABLE-US-00004 TABLE4 Target Target % SEQ StartSite StopSite ISISNo Sequence inhibition IDNO 1028 1043 735285 ATGGTGCTGGCCACAC 71 4