ZIKA VIRUS TREATMENT OF CD24-POSITIVE TUMORS AND DISEASES ASSOCIATED WITH ABNORMAL T CELL ACTIVATION AND TREATING OR PREVENTING ZIKA VIRUS INFECTIONS
20190038685 ยท 2019-02-07
Assignee
Inventors
- Kenneth Andrew ALEXANDER (Orlando, FL, US)
- Terri Helman FINKEL (Orlando, FL, US)
- Joseph MAZAR (Orlando, FL, US)
- Amy Lynn ROSADO (Orlando, FL, US)
- Jiangfang Wang (Orlando, FL)
- Tamarah Jeanette WESTMORELAND (Orlando, FL, US)
Cpc classification
A61K35/768
HUMAN NECESSITIES
C07K16/2896
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N2770/24132
CHEMISTRY; METALLURGY
International classification
A61K35/768
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
Abstract
CD24-positive malignant and benign tumors are treated by administration of a naturally occurring or modified oncolytic Zika virus. Diseases associated with abnormal T cell activation or T cell-mediated autoimmunity, wherein CD24 expression is increased, are also expected to be treated by administration of a naturally occurring or modified oncolytic Zika virus. Also contemplated are compounds and methods for treating and/or preventing Zika virus infection in a subject.
Claims
1. A method for treating a CD24 positive tumor in an individual in need of such treatment, the tumor comprising malignant cells characterized by the presence of CD24, the method comprising administering to the individual an effective amount of an oncolytic Zika virus.
2. The method according to claim 1, wherein the CD24 positive tumor is selected from the group consisting of an ovarian cancer, a colorectal cancer, a B cell lymphoma, erythroleukemia, a glioma, a small cell lung cancer, an esophageal squamous cell carcinoma, a hepatocellular carcinoma, a hepatoblastoma, a cholangiocarcinoma, a pancreatic adenocarcinoma, a melanoma, an urothelial carcinoma, a breast cancer, a primary neuroendocrine carcinoma, a neural crest-derived tumor, an HPV-associated malignancy, an Epstein-Barr virus-induced malignancy, and a prostate carcinoma.
3. The method according to claim 2, wherein the tumor is a neural crest-derived tumor and is located in the brain.
4. The method according to claim 2, wherein the neural crest-derived tumor is selected from the group consisting of: a neuroblastoma, a glioma, and a melanoma.
5. The method according to claim 2, wherein the HPV-associated malignancy is selected from the group consisting of cervical cancer or precancer, vaginal, vulvar, and anal precancers or cancers, and oropharyngeal precancers or cancers, and wherein the Epstein-Barr virus-induced malignancy is selected from the group consisting of nasopharyngeal carcinoma, lymphoma, and post transplantation lymphoma proliferative disease,
6. The method according to claim 1, wherein the tumor is a refractory tumor.
7. The method according to claim 1, wherein the oncolytic Zika virus is a naturally-occurring Zika virus, is a modified Zika virus, is in the form of virus particles, or is in the form of naked viral RNA that is optionally contained in liposomes.
8. The method according to claim 1, wherein at least about 10% or at least about 50% of the cells of the CD24 positive tumor are lysed.
9. The method according to claim 1, wherein the oncolytic Zika virus is administered intralesionally to the CD24 positive tumor, is administered by injection at the site of the CD24 positive tumor, is administered topically, is administered intradermally, is administered systemically, or is administered by intravenous injection or infusion.
10. The method according to claim 1, further comprising administering to the subject an immunosuppressive therapy to facilitate or enhance lysis of the oncolytic Zika virus treatment.
11. The method according to claim 10, wherein the immunosuppressive therapy comprises administration of an immunosuppressive pharmaceutical agent, administration of anti-antivirus antibody directed against antibodies that recognize the administered oncolytic Zika virus, plasmaphoresis of the subject to remove antibodies that recognize the administered oncolytic Zika virus, administration of non-specific immunoglobulin, administration of anti-CD4 and/or anti-CD8 antibodies, or complement neutralization.
12. The method according to claim 1, further comprising another anti-neoplasm treatment selected from chemotherapy, radiotherapy, surgery, hormone therapy and/or immunotherapy.
13. A monoclonal antibody that binds to Zika virus and blocks binding by the Zika virus to CD24 on a CD24-expressing cell, or a monoclonal antibody that binds to CD24 and blocks binding by a Zika virus to CD24 on a CD24-expressing cell.
14. A method of preventing or treating a Zika virus infection in a subject by administering the monoclonal antibody of claim 13 to the subject in an effective amount.
15. The method of claim 14, wherein the subject is a pregnant human.
16. A method of preventing a Zika virus infection in a subject by administering an attenuated Zika virus or a Zika virus CD24 binding protein, to induce antibodies that bind to the Zika virus and block binding by the Zika virus to CD24 on a CD24-expressing cell.
17. The method of claim 16, wherein the subject is a human.
18. A method for treating a disease associated with abnormal T cell activation or a T cell-mediated autoimmunity in an individual in need of such treatment, wherein abnormal T cell activation or T cell-mediated autoimmunity results in increased CD24 expression in the individual, the method comprising administering to the individual an effective amount of an oncolytic Zika virus.
19. The method according to claim 18, wherein the oncolytic Zika virus is a naturally-occurring Zika virus, is a modified Zika virus, is in the form of virus particles, or is in the form of naked viral RNA that is optionally contained in liposomes.
20. The method according to claim 18, wherein the diseases associated with abnormal T cell activation or T cell-mediated autoimmunity is: a rheumatologic disorder selected from the group consisting of rheumatoid arthritis, juvenile idiopathic arthritis, lupus nephritis, lupus vasculitis, pyomyositis, dermatomyositis, scleroderma, Sjogren's disease, ankylosing spondylitis, temporal arteritis, autoimmune vasculitis, sarcoidosis, Kawasaki disease, psoriatic arthritis, system sclerosis, Behet's disease, and mixed connective tissue disorder; a neurological disease selected from the group consisting of multiple sclerosis, chronic inflammatory demyelinating polyneuropathy, and Guillain-Barre syndrome; a gastroenterological disease selected from the group consisting of ulcerative colitis, Crohn's disease, primary biliary cirrhosis, autoimmune pancreatitis, and autoimmune hepatitis; a dermatological disease selected from the group consisting of alopecia areata, psoriasis, vitiligo, and eczema; an endocrine disease selected from the group consisting of Hashimoto thyroiditis, type 1 diabetes mellitus, Graves' disease, and autoimmune polyendocrine syndrome; a hematological disease selected from the group consisting of autoimmune myelodysplastic syndromes, aplastic anemia, graft-versus-host disease, and hemophagocytic syndromes; an infectious disease selected from the group consisting of HIV infection, post-transplantation lymphoproliferative disorder due to Epstein-Barr virus, and myocarditis; or a T-cell-mediated acute graft rejection.
Description
DESCRIPTION OF THE FIGURES
[0040] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
DEFINITIONS
[0057] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.
[0058] Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
[0059] The articles a and an are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, an element means one element or more than one element.
[0060] As used herein, the term and/or includes any and all combinations of one or more of the associated listed items.
[0061] About as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, indicates that the calculation or the measurement allows some slight imprecision in the value (with some approach to exactness in the value; approximately or reasonably close to the value; nearly). If, for some reason, the imprecision provided by about is not otherwise understood in the art with this ordinary meaning, then about as used herein indicates at least variations that may arise from ordinary methods of measuring or using such parameters. As used herein, the term about means that the number being described can deviate by plus or minus five percent of the number. For example, about 250 g means from 237.5-262.5 g. When the term about is used in a range, then the lower limit may be as much as minus 5% of the lower number and the upper limit may extend up to plus 5% of the upper number. For example, a range of about 100 to about 200 g indicates a range that extends from as low as 95 g up to 210 g.
[0062] An effective amount as used herein, means an amount which provides the intended effect. For an oncolytic virus used to treat or ameliorate a tumor, an effective amount is an amount of the virus sufficient to alleviate or eliminate the symptoms of the tumor or to slow down the progression of the tumor in a subject. It is understood, however, that the full therapeutic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, an effective amount may be administered in one or more administrations. In the context of therapeutic or prophylactic applications, the amount of active agent administered to the subject will depend on the type and severity of the disease or condition and on the characteristics of the subject, such as general health, age, sex, body weight and tolerance to drugs. It will also depend on the degree, severity and type of disease or condition. The skilled artisan will be able to determine appropriate dosages depending on these and other factors.
[0063] As used herein, individual or patient or subject (as in the subject of the treatment) means both mammals and non-mammals. Mammals include, for example, humans; non-human primates, e.g. apes and monkeys; cattle; horses; sheep; and goats. Non-mammals include, for example, fish and birds.
[0064] As used herein, level of amplification with reference to a particular gene means the gene's copy number in the genome of a cell. A copy number of about 10-fold or more above the copy number of a gene in normal cells of a corresponding normal tissue means that the gene is amplified.
[0065] As used herein, the term pharmaceutically acceptable refers to a formulation of a compound that does not significantly abrogate the biological activity, a pharmacological activity and/or other properties of an active agent when the formulated compound is administered to a patient. In certain embodiments, a pharmaceutically acceptable formulation does not cause significant irritation to a patient.
[0066] To treat a disease as the term is used herein, means to reduce the frequency or severity of at least one sign or symptom of a disease or disorder experienced by a subject. Treating may include the postponement of further disease progression, or reduction in the severity of symptoms that have or are expected to develop, ameliorating existing symptoms and preventing additional symptoms. Treat a tumor means alleviating or eliminating the symptoms of a tumor, or slowing down the progression of the tumor. The alleviation is preferably at least about 10%, more preferably at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95%.
[0067] Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
DETAILED DESCRIPTION
[0068] Embodiments of the materials and methods are described below.
[0069] It has been found that Zika virus effectively kills neural crest-derived tumor cells characterized by N-myc amplification, but not such cells lacking N-myc amplification. The cells having N-myc amplification also were discovered to express the marker, CD24 (also known as CD24A, signal transducer C24A; see e.g., GenBank FJ226006 for the nucleotide sequence and ACI46150.1 for the protein sequence and also GenBank NG_041768.1; see also L. Wang et al., A dinucleotide deletion in CD24 confers protection against autoimmune diseases, PLoS Genet. 3(4): E49, 2007).
[0070] Based on the clinical observation that Zika virus infections in children and adults are most often asymptomatic, wild-type or genetically modified or attenuated Zika viruses may be safely and effectively therapeutically administered to children or adults with tumors that express CD24 alone or also having N-myc-amplification. Even symptomatic patients have only mild disease marked by rash, fever, and conjunctivitis. Severe symptoms from Zika virus disease are rare.
[0071] The infecting Zika viruses will cause tumor lysis with little or no effect on normal host cells, providing a safe, effective, and novel means for treating these malignancies. It is believed that Zika viruses can be used to eliminate or reduce neural crest-derived tumors as well as other tumors expressing CD24 with minimal long term adverse effect. CD24 positive tumors include ovarian cancer, colorectal cancer, B cell lymphomas, erythroleukemia, gliomas, small cell lung cancer, esophageal squamous cell carcinoma, hepatocellular carcinoma, cholangiocarcinoma, pancreatic adenocarcinoma, urothelial carcinoma, breast cancer, primary neuroendocrine carcinoma, and prostate carcinomas. Z. Fang et al., CD24: From A to Z, Cell. & Mol. Immun. 7: 100-13 (2010).
[0072] A Brazilian strain of Zika virus infection has been linked to major birth defects, including microcephaly in the babies of women who are pregnant at the time they are infected with the virus and has been tied to an increase to the number of cases of Guillain-Barr syndrome in adults. Fetal injury appears to be more likely when maternal infection occurs during the first trimester. Most later-pregnancy maternal Zika infections do not appear to result in an overtly injured infant.
[0073] The range of subjects treated with a composition comprising an oncolytic Zika virus (wild type or attenuated) includes pregnant females having a CD24 positive cancer, but excludes such patients in the first trimester of pregnancy. Also contemplated are compositions and methods of treating a pregnant woman who is believed to have been exposed to Zika virus or who resides in an area where Zika is prevalent with a neutralizing antibody or composition that will prevent Zika virus from interacting with CD24 as well as other high-risk immunocompromised individuals. Similarly, many CD24-expressing tumors (e.g., melanomas, ovarian carcinomas, gliomas, and glioblastomas) are resistant or refractory to currently available cancer treatments.
[0074] For treatment of neuroblastoma, patients receiving therapy are likely to be young children.
[0075] As is the case with any potential cancer therapy, the risks of Zika virus infection (which are minimal) must be balanced against both the toxicity and poor efficacy of current chemotherapy. If should be noted that N-myc-amplified neuroblastomas are more resistant to chemotherapy, and carry a worse prognosis; thus, a Zika virus therapy may be ideal for otherwise treatment-refractory tumors. It should also be noted that there is no known passive human-to-human transmission of Zika virus infection. While sexual intercourse and blood transfusions have been indicated as possible means of transmitting Zika virus, these modes of transmission are both avoidable and largely irrelevant in the treatment of children with neuroblastomas.
[0076] Following infection, an oncolytic Zika virus can kill a susceptible cancerous cell by direct lytic infection, induction of apoptosis or by initiating an immune response to viral antigens. The effect of the oncolytic virus is thus not limited to a single input dose. Susceptible cells can undergo a multi-cycle infection, resulting in the production of large numbers of progeny virus. These progeny virions can spread either locally to adjacent tumor cells, or systemically to distant metastatic sites. This feature of oncolytic therapy is particularly attractive for the treatment of inaccessible tumors or un-diagnosed micro-metastases.
[0077] Accordingly, a method for treating a neural crest-derived neoplasm in a subject is provided, by administration of an oncolytic Zika virus, where cells of the neoplasm are characterized by the expression of CD24. The subject may be a mammal, particularly one selected from the group consisting of dogs, cats, sheep, goats, cattle, horses, pigs, humans, and non-human primates. The mammal is preferably human.
[0078] Tumors treatable comprise those that are populated by tumor cells that are of embryonic neural crest origin or which express CD24. Neural crest-derived tumors include tumors of sympatho-adrenal lineage, which comprise neuroblastoma, paraganglioma and pheochromocytoma; tumors of melanocytes, i.e., melanomas; tumors of Schwann cell lineage including neurofibromas (type 1, also known as von Recklinghausen's disease; and type 2), malignant peripheral nerve sheath tumors, and schwannomas; and type A/B multiple endocrine neoplasias. For a discussion of neural crest-derived tumors, see Dundr, P. and Ehrmann, J., Neuronal Crest Cell-Derived Tumors: An Overview, Chapter 4 in Stem Cells and Cancer Stem Cells, Therapeutic Applications in Disease and Injury: Volume 1, p. 29-40, M. A Hayat, ed., Springer Science+Business Media B.V., 2012.
[0079] Tumors that can be treated using the compositions and methods disclosed herein include tumors that are refractory to treatment with chemotherapeutics. The term refractory, when used herein in reference to a tumor, refers to a tumor (and/or metastases thereof) that shows no or only weak anti-proliferative response (i.e., nor or only weak inhibition of tumor growth) after treatment with at least one chemotherapeutic agent. Thus, a refractory tumor cannot be treated at all or only with unsatisfying results with at least one (preferably standard) chemotherapeutic agent. Treatment of refractory tumors as mentioned is to be understood to encompass not only (1) tumors where one or more chemotherapeutics have already failed during treatment of a patient, but also (2) tumors that can be shown to be refractory by other means, e.g., biopsy and culture in the presence of chemotherapeutics and radiation treatment.
[0080] Subjects that can receive a treatment according to the present invention generally include any patient diagnosed with a neural crest-derived tumor or a tumor characterized as CD24 positive (CD24.sup.+) tumor. The CD24 positive tumor may be selected from the group consisting of: an ovarian cancer, a colorectal cancer, a B cell lymphoma, erythroleukemia, a glioma, a small cell lung cancer, an esophageal squamous cell carcinoma, a hepatocellular carcinoma, a hepatoblastoma, a cholangiocarcinoma, a pancreatic adenocarcinoma, a melanoma, an urothelial carcinoma, a breast cancer, a primary neuroendocrine carcinoma, a neural crest-derived tumor, a human papillomavirus (HPV)-associated malignancy, an Epstein-Barr virus-induced malignancy, and a prostate carcinoma. The HPV-associated malignancy may be selected from the group consisting of cervical cancer or precancer, vaginal, vulvar, and anal precancers or cancers, and oropharyngeal precancers or cancers. An Epstein-Barr virus-induced malignancy may be selected from the group consisting of nasopharyngeal carcinoma, lymphoma, and post transplantation lymphoma proliferative disease.
[0081] Patients harboring CD24 positive tumors or who are at risk of developing such tumors are selected for Zika virus therapy on the basis of CD24 cells populating the tumor mass. Tumor cells may be assessed for the presence of CD24 using common histopathology methods.
[0082] For the determination of N-myc copy number in biopsied cells, N-myc copy numbers may be determined if needed by known molecular biological techniques. Southern blot analysis may be used to determine gene copy number. This typically involves extracting a significant quantity of genomic DNA, undergoing restriction digestions prior to blotting, followed by probing with labeled hybridization probes. Southern blot analysis is therefore laborious, time-consuming and requires considerable amounts of DNA from fresh or frozen samples. Southern blot assay-based determination of gene copy number has largely been supplanted by quantitative PCR (qPCR), including real-time RT-qPCR and fluorescence in situ hybridization (FISH). RT-qPCR is PCR visualized in real time by the use of fluorescent or intercalating dyes. Basic protocols for RT-qPCR gene copy number analysis are described, for example, by Ma et al., Curr. Protoc. Hum. Genet. (2014) 80:Unit 7.21. doi: 10.1002/04711 42905.hg0721 s80. Gene copy number analyses may be carried out according to known protocols, e.g., utilizing commercially available equipment, e.g., SYBR Green I Dye Detection Protocol, Protocol 17 in A Technical Guide to PCR Technologies, Sigma-Aldrich Co. LLC., 2017, sigmaaldrich<dot>com/technical-documents/protocols/biology/sybr-green-i-dye-quantitative-pc<dot>html.
[0083] Additional methods of N-myc copy number analysis include fluorescence in situ hybridization FISH and RT-qPCR. FISH allows rapid and accurate determination of gene copy number, allows gene copy number evaluation at the single cell level and can be performed on tumor imprints of biopsies that can be evaluated for tumor cell morphology and content by combination with immunohistochemical staining. FISH may be employed for determination of N-myc copy number as described by Ambros, et al., British Journal of Cancer (2009) 100, 1471-1482).
[0084] A given tumor may contain a mixture of both CD24 positive and CD24 negative cells. Such tumors will also benefit from Zika virus oncolytic treatment since the eradication of the Zika-sensitive CD24 positive tumor cell may lead to tumor shrinkage and/or reduction in growth, thus resulting in some therapeutic benefit to the patient. Accordingly, the Zika virus oncolytic treatment may be carried out on tumors comprising both CD24.sup.+ and CD24.sup.+ cells, although greater anti-tumor response would occur in tumors comprising predominately CD24.sup.+ tumor cells.
[0085] Zika virus has a positive-sense, single-stranded RNA genome approximately 11 kilobases (kb) in length. The genome contains 5 and 3 untranslated regions flanking a single open reading frame that encodes a polyprotein that is cleaved into three structural proteins: the capsid (C), pre-membrane/membrane (prM), and envelope (E), and seven non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, 2K, NS4B, and NS5). The Zika virus for use is an oncolytic virus, that is, it is a virus that preferentially replicates in, and kills, neoplastic cells. Delivery of the oncolytic Zika virus to a neoplasm can result in substantial lysis of the neoplastic cells infected by the virus. The term substantial lysis means at least about 10% of the cells of a neoplasm are lysed. More preferably, at least about 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the cells are lysed. Most preferably, at least about 95% of the cells are lysed. The percentage of tumor cell lysis can be determined, for example, by measuring the reduction in the size of the tumor or reduction of symptoms of the tumor.
[0086] The Zika virus for administration may comprise naturally occurring (wild-type) Zika virus or modified Zika virus. The virus is naturally occurring when it can be isolated from a source (natural vector for the virus or an infected subject such as a human) in nature (or has been previously isolated from a natural source and stored in a biological depository).
[0087] A modified Zika virus is a Zika virus other than a naturally-occurring Zika virus. Accordingly, the term Zika virus as used herein refers to both a naturally-occurring and a modified virus, and encompass both Zika virus particles and naked Zika virus RNA.
[0088] The modified Zika virus is still capable of lytically infecting a target neoplastic cell of a host subject. For example, the genetic material of the virus may be mutated, or the virus particle may be modified. The modified virus may be a recombinant virus, for example a virus engineered to express a heterologous protein.
[0089] The virus may be modified by incorporation of mutated coat proteins, such as for example, into the virion capsid. The proteins may be mutated by replacement, insertion, or deletion. Replacement includes the insertion of different amino acids in place of the native amino acids. Insertions include the insertion of additional amino acid residues into the protein at one or more locations. Deletions include deletions of one or more amino acid residues in the protein. Such mutations may be generated by methods known in the art. For example, oligonucleotide site directed mutagenesis of the gene encoding for one of the coat proteins could result in the generation of the desired mutant coat protein. Expression of the mutated protein in virus infected mammalian cells in vitro such as COS 1 cells or Vero cells will result in the incorporation of the mutated protein into the virus virion particle.
[0090] The virus may be modified to reduce or eliminate an immune reaction to the virus. Such a modified virus is termed an immunoprotected virus. Such modifications could include packaging of the virus in a liposome, a micelle, or other vehicle to mask the virus from the host immune system. For example, the virion may be treated with chymotrypsin in the presence of micelle-forming concentrations of alkyl sulfate detergents to generate a new infectious subvirion particle. Alternatively, the outer capsid of the virion particle may be removed since the proteins present in the outer capsid are the major determinant of the host humoral and cellular responses.
[0091] The virus may be a recombinant virus resulting from the recombination/reassortment of genomic segments from two or more genetically distinct viruses. Recombination/reassortment of virus genomic segments may occur in nature following infection of a host organism with at least two genetically distinct viruses. Recombinant virions can also be generated in cell culture, for example, by co-infection of permissive host cells with genetically distinct viruses.
[0092] It is preferable to avoid immune responses against the virus, particularly in animals that have previously received large amounts of the same virus or closely-related virus. Immune responses may be avoided if the virus is of a subtype or strain to which the mammal has not developed immunity or has not been vaccinated against.
[0093] While genetic modifications of the oncolytic Zika virus (that do not result in loss of oncolytic activity) may be carried out, modification may not be required from a safety standpoint. For example, the oncolytic Zika virus strain PRVABC59 (ATCC VR-1843), utilized in the Examples, has no intended genetic modifications, although the virus has been passaged through and maintained in Vero cells, and as a consequence, may differ in RNA sequence from the originally-isolated virus. While longitudinal studies are ongoing to determine whether or not Zika virus infection in children and adults causes some subtle brain injury, nothing is yet reported. Zika virus infection in children and adults are generally asymptomatic in roughly 80% of individuals. Symptomatic cases or most often mild cases present with fever, rash, and conjunctivitis. Rarely, immunocompetent children and adults may develop Guillain-Barre syndrome, but direct causation of Guillain-Barre syndrome has not been proven, although the incidence of it has increased dramatically in Brazil which also has the greatest incidence of hydrocephalus in infants.
[0094] While attenuated Zika viruses may be considered for therapeutic use, the fact that 80% of Zika virus infections are asymptomatic, and the remaining 20% of infections are generally very mild, as well as the rarity of severe Zika virus disease, attenuation of Zika viruses for therapy may be unnecessary.
[0095] Moreover, since the anti-cancer effect of the Zika virus as demonstrated herein relies on virus-mediated lysis of target tumor cells, attenuation may adversely hinder the therapeutic effect of the virus. In general, genetically modified Flaviviruses are unstable and frequently nonfunctional, suggesting that native Zika viruses may be more suitable for therapeutic use.
[0096] Any suitable source of the oncolytic Zika virus may be used. The oncolytic activity of a candidate Zika strain for use may be determined by appropriate oncolytic assay, as described in the Examples that follow. For example, an N-myc-amplified neuroblastoma cell lines, e.g., IMR-32, SMS-KAN and SK-N-Be(1), or panel of such cell lines, is infected with the candidate Zika virus strain for oncolytic therapy, and cell toxicity can be determined by an appropriate proliferation assays. One such assay, known as the MTS assay, is a colorimetric method to determine the number of viable cells in proliferation or cytotoxicity assays toxicity assays. The test relies on an tetrazolium compound, MTS: [3-(4,5-dimethyl-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt]. One such MTS assay is available from Promega Corp., Madison, Wis. as the CellTiter 96 AQueous One Solution Cell Proliferation Assay System.
[0097] A representative oncolytic assay test protocol comprises laying down 10.sup.4 N-myc-amplified neuroblastoma cells in a flat bottom 96-well tissue culture treated plated, and allowing the cells to attach overnight. The following day, cells are infected at an MOI (multiplication of infection, and refers to the number of virions that are added per cell during infection of the cell) of 10 with candidate Zika virus or left untreated (as controls). Cells are maintained at 37 C. and 5% CO.sub.2. At time intervals following infection, the plates are examined using the CellTiter 96 AQueous One Solution Cell Proliferation (MTS) assay (Promega Corp, Madison, Wis.) according to the manufacturer's instructions. A loss of neuroblastoma cell viability indicates that the candidate Zika virus strain has oncolytic activity. The oncolytic activity of Zika virus strain PRVABC59 (ATCC VR-1843), also known as PR2015 was determined in this manner. PRVABC59 (ATCC VR-1843) is available from American Type Culture Collection, 10801 University Boulevard, Manassas, Va., 20110.
[0098] Wild-type Zika strains that may be screened for oncolytic activity in this manner include, for example, the following strains commercially available from the American Type Culture Collection, 10801 University Boulevard, Manassas, Va., 20110: MR 766 (ATCC VR84), originally isolated by Dick et al, Trans R Soc Trop Med Hyg 46: 509-520, 1952; and an MR 766 tissue culture-adapted strain from ATCC VR-84 (ATCC VR-1838). The following Zika strains commercially available from BEI Resources, 10801 University Boulevard, Manassas, Va., 20110, a depository established by the National Institute of Allergy and Infectious Diseases (NIAID) and managed by ATCC, may likewise be screened for oncolytic activity: MR 766 (NR-50065); IbH 30656 (NR-50066); FLR (NR-50183); H/PAN/2016/BEI-259634 (NR-50210); HIPAN/2015/CDC-259359 (NR-50219); H/PAN/2015/CDC-259249 (NR-50220); H/PAN/2015/CDC-259364 (NR-50221); PRVABC59 (NR-50240); P 6-740 (NR-50245); MEX 1-44 (NR-50279); DAK AR 41524 (NR-50338); R103451 (NR-50355); PLCal_ZV (NR-50234); MEX 2-81 (NR-50280); and MEX I-7 (NR-50281). The candidate virus may be one or more isolates from one or more species, including but not limited to avian, insect and mammalian species. An oncolytic Zika virus may be modified as described above to provide a modified Zika virus for administration, or the native unmodified virus may be administered.
[0099] PRVABC59 (ATCC VR-1843) is an oncolytic Zika virus strain that can be used. It is an Asian-lineage Zika virus. Virus strains circulating in the Caribbean, and in Central and South America are Asian-lineage Zika viruses. Reports suggesting that African-lineage Zika virus strains are less neurotoxic than Asian-lineage Zika virus strains. Accordingly, Asian-lineage Zika virus strains are preferred, as they are likely to have increased lytic action in comparison to African-lineage Zika viruses. However, the oncolytic Zika virus strain selected for a patient should not be the same strain used in any eventual Zika virus vaccine administered to the patient, which could impact the oncolytic ability of that virus.
[0100] The oncolytic Zika virus may be administered to the subject in its native state, i.e., virus particles. Alternatively, the virus may be administered as naked viral nucleic acid, e.g., viral RNA, encoding the virus. Accordingly, unless indicated otherwise, Zika virus as used herein means other the native virus in the form of virus particles for naked Zika RNA. It should be appreciated that by naked viral RNA means RNA without the associated proteins that comprise a virus particle. Thus, naked viral RNA does not exclude RNA combined with formulation agents, such as liposome-forming agents, or other pharmaceutical vehicles. Naked viral RNA may be isolated from viral particles by known techniques, or may be synthetically made.
[0101] The naked viral RNA may be administered in the form of liposomes. Liposomes are generally derived from phospholipids or other lipid substances, and are formed by mono- or multi-lamellar hydrated liquid crystals that are dispersed in an aqueous medium. Any non-toxic, physiologically acceptable and metabolizable lipid capable of forming liposomes can be used. Compositions in liposome form may contain stabilizers, preservatives, excipients and the like. The preferred lipids are the phospholipids and the phosphatidyl cholines (lecithins), both natural and synthetic. Methods for forming liposomes are known in the art. See, Prescott, Ed., Methods in Cell Biology, Volume XIV, Academic Press, New York, N.Y. (1976), p. 33 et seq. In one exemplary embodiment, liposomes are formed with the cationic liposome formulation Lipofectamine 2000. Viral RNA: Lipofectamine 2000 complexes (vRNA:lipid) may be prepared according to manufacturer's instructions (Thermo Fisher Scientific Inc.). Briefly, various amounts of vRNA and 2 l Lipofectamine 2000 can be diluted separately in 50 l serum and antibiotic free media and gently mixed. Five minutes following Lipofectamine 2000 dilution, the corresponding vRNA and lipid solutions can be combined and gently mixed. The mixture is incubated at room temperature for 45 minutes to allow vRNA:lipid complexes to form. Once formed, the complexes can be administered to the subject in need of cancer treatment for a CD24.sup.+ tumor.
[0102] The therapeutic agent may comprise a single species of oncolytic Zika viruses. Alternatively, a combination of at least two oncolytic Zika viruses may be administered. The viruses may be administered at the same time, by the same route, or at different times, by different routes.
[0103] The oncolytic Zika virus is administered to a subject in a manner that results in contact of the virus with target neoplastic cells. The route by which the virus is administered, as well as the formulation, carrier or vehicle, will depend on the location as well as the type of the neoplasm. A wide variety of administration routes can be employed. For example, for a solid neoplasm that is accessible, the virus can be administered by injection directly to the neoplasm. For neoplasms that are not easily accessible within the body, such as metastases or brain tumors, the virus can be administered in a manner such that it can be transported systemically through the body of the mammal and thereby reach the neoplasm (e.g., intravenously, or intramuscularly).
[0104] Because neuroblastomas may be metastatic to many sites (including bone marrow), local/intratumor administration may or may not be effective. Zika virus may be administered intradermally, subcutaneously, or intravenously, with the anticipation that the patient will become transiently viremic, with the consequent hematogenous delivery of virus to the tumor.
[0105] In such cases, viruses that are administered systemically, i.e., by intravenous injection, will spread to the locations of the neoplastic cells, resulting in lysis of the cells. Brain metastases occur in patients with Stage IV neuroblastoma, and in patients with relapsed neuroblastoma (Zhu et al., Chin. J. Cancer 2015 34: 49). The ability of Zika virus to cross the blood brain barrier (BBB) could be beneficial in cases of neuroblastoma metastatic to the brain.
[0106] Alternatively, the virus can be administered directly to a single solid neoplasm, where it then is carried systemically through the body to metastases. The virus can also be administered topically, e.g., for melanoma. The virus can be administered systemically to mammals which are immune compromised or which have not developed immunity to the virus. More than one route of administration may be used to deliver the oncolytic Zika virus.
[0107] In certain embodiments, the oncolytic virus is delivered by direct injection to a tumor (e.g., intralesional injection), or by systemic administration. Intralesional injection of a tumor may be performed by any appropriate means known to the skilled person, taking into account factors such as the type of tumor being treated, the size and location of the tumor, accessibility of the tumor to direct injection. Injection techniques that increase or maximize the distribution of the virus throughout the tumor may offer improved therapeutic outcomes. For example, in the treatment of melanoma and other solid tumors, multiple lesions may be injected in a dose hyper-fraction pattern, starting with the largest lesion(s) (2.0 mL injected into tumors >2.5 cm, 1.0 mL into 1.5 to 2.5 cm; 0.5 mL into 0.5 to 1.5 cm) to a 4.0 mL maximum.
[0108] Direct administration to the brain (or to a specific region of the brain) may be achieved, for example, and not by way of limitation, by local infusion (e.g., during surgery), by injection (e.g., intracerebroventricular injection), by means of a catheter, or by means of a ventricular reservoir or pump placed in the tumor cavity during surgery or implanted subcutaneously in the scalp and connected to the brain via an outlet catheter. Alternatively or additionally, local administration can be achieved via the use of an implant device (e.g., a wafer implant containing the active ingredient) or a drug depot that can be placed locally during surgery. Such systems provide sustained oncolytic virus release.
[0109] Since neuroblastomas can be widely metastatic, intratumor injection is not likely to be an effective therapy for most neuroblastoma patients, unless there is a subsequent systemic dissemination of virus.
[0110] Before, during or after the administration of the oncolytic Zika virus, the subject may be given an immunosuppressive therapy to facilitate or enhance the effect of the virus treatment. The immunocompetency of the subject of the oncolytic Zika virus treatment may be suppressed by an immunosuppressive therapy comprising the co-administration (or prior or subsequent) administration of pharmaceuticals known in the art to suppress the immune system in general or alternatively by administration of anti-idiotypic antibodies that recognize the antibodies for the administered virus.
[0111] The oncolytic Zika virus may be administered to immunocompetent mammals in conjunction with the administration of immunosuppressants and/or immunoinhibitors. Such immunosuppressants and immunoinhibitors are known to those of skill in the art and include but are not limited to such agents as cyclosporin, rapamycin, tacrolimus, mycophenolic acid, azathioprine and their analogs, and the like. Other agents are known to have immunosuppressant properties as well (see, e.g., G
[0112] Such immunoinhibitors also include anti-antivirus antibodies, which are antibodies directed against anti-virus antibodies that specifically recognize the virus of interest. Such antibodies can be made by methods known in the art. See for example Antibodies: A laboratory Manual, E. Harlow and D. Lane, Cold Spring Harbor Laboratory, 1988). Such anti-antivirus antibodies may be administered prior to, at the same time, or shortly after the administration of the virus. Preferably an effective amount of the anti-antivirus antibodies are administered in sufficient time to reduce or eliminate an immune response by the mammal to the administered virus.
[0113] The humoral immunity of the mammal against virus may also be temporarily reduced or suppressed by plasmaphoresis of the mammal's blood to remove antibodies specific for that virus. The humoral immunity of the mammal against the virus may additionally be temporarily reduced or suppressed by the intravenous administration of non-specific immunoglobulin to the mammal. The immune system may also be suppressed by anti-CD4 and/or anti-CD8 antibodies, or complement neutralization.
[0114] Zika viruses may be grown to high titer in Vero cells. Vero cells are a commercially available immortal cell like derived from the kidney of an African Green Monkey. Vero cells are commonly used for the expansion of viruses. Zika virions may be purified by ultrafiltration and/or by gradient sedimentation, according to known techniques.
[0115] The oncolytic Zika virus may be purified for therapeutic administration by standard methodology. As used herein, purified viruses refer to viruses that have been separated from cellular components that naturally accompany them. Typically, viruses are considered purified when they are at least 70% (e.g., at least 75%, 80%, 85%, 90%, 95%, or 99%) by dry weight, free from the proteins and other cellular components with which they may be naturally associated.
[0116] The oncolytic Zika virus may be formulated appropriately for pharmaceutical administration. Pharmaceutical compositions comprises one or more oncolytic Zika viruses and a pharmaceutically acceptable carrier. A pharmaceutically acceptable carrier can be a solid, semi-solid, or liquid material that can act as a vehicle, carrier or medium for the virus. For infusion, particularly intravenous infusion, the virus may be formulated in an aqueous solution of mineral salts or other water-soluble molecules, e.g., normal saline, a solution of sodium chloride at 0.9% concentration; Ringer's lactate or Ringer's acetate; or a solution of 5% dextrose in water (D5W). Pharmaceutical compositions can be formulated to provide quick, sustained or delayed release of a virus after administration by employing procedures known in the art. Various other formulations for use in a pharmaceutical composition can be found in Remington, The Science and Practice of Pharmacy 22nd ed., Loyd V. Allen et al, editors, Pharmaceutical Press (2013). The oncolytic Zika virus may be administered topically, particularly for the treatment of melanoma, in the form of a gel, ointment or other semi-solid formulation, for example. The virus may be contained in a transdermal device to provide continuous or discontinuous virus delivery. The construction and use of transdermal patches for the delivery of pharmaceutical agents is known in the art. See, for example, U.S. Pat. No. 5,023,252. Such patches can be constructed for continuous, pulsatile, or on-demand delivery of viruses.
[0117] The oncolytic Zika virus is administered to a subject in need of such treatment in an amount that is sufficient to treat the neoplasm. A neoplasm is treated when administration of virus to the proliferating cells effects lysis of the proliferating cells. This may result in a reduction in size of the neoplasm or a complete elimination of the neoplasm. The reduction in size of the neoplasm, or elimination of the neoplasm, is generally caused by lysis of neoplastic cells by the virus. Preferably the effective amount is that amount able to at least inhibit tumor cell growth. Preferably the effective amount is from about 1 pfu/kg body weight to about 10.sup.15 pfu/kg body weight, and more preferably from about 100 pfu/kg body weight to about 10.sup.13 pfu/kg body weight. For example, for treatment of a human subject, approximately 100 to 10.sup.17 pfU of virus can be used, depending on the type, size, location and number of tumors present. The effective amount will be determined on an individual basis and may be based, at least in part, on consideration of the type of virus; the chosen route of administration; the individual's size, age, gender; the severity of the patient's symptoms; the size and location or other characteristics of the neoplasm; and the like. Given that Zika viruses are transmitted in nature by mosquitos at very low concentration, dosages of less than 100 pfU may be possible.
[0118] Treatment efficacy may be assessed both by tumor size and based upon biochemical markers, such as homovanillic acid (HVA) and vanillylmandelic acid (VMA). Elevated values of HVA, and VMA, and other catecholamine metabolites, are markers for the presence of suggestive of the presence of neural crest tumors, particularly neuroblastoma.
[0119] Because of the likely development of humoral immunity, an initial course of treatment an initial treatment course is likely to be limited to, e.g., five days in the absence of steps taken temporarily reduce or suppress patient humoral immunity.
[0120] The compositions are preferably formulated in a unit dosage form, each dosage containing from about 10.sup.2 pfu to about 10.sup.13 pfu of virus. The term unit dosage forms refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of virus calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient.
[0121] A stock of the oncolytic Zika virus composition may be diluted to an appropriate volume suitable for dosing, for example to achieve the desired dose of viral particles administered in a desired volume. The volume in which the virus is administered will be influenced by the manner of administration. For example, intravenous administration of virus may typically use about 5 ml to about 500 ml of virus diluted in normal saline, infused by an automatic pump over approximately 30 minutes.
[0122] Dosages of oncolytic Zika virus vary and are administered in one or more dose administrations, for example, daily, for one or several days. The virus is administered in a single dose or in multiple doses (e.g., two, three, four, six, or more doses). The multiple doses can be administered concurrently, or consecutively. The virus can also be administered to more than one neoplasm in the same individual. The virus may be administered, for example, continuously to a subject at least once per day or up to intermittently or continuously throughout the day on consecutive days, for a period of time.
[0123] Because the patient will become viremic in response to Zika virus administration, the patient will mount a humoral and cellular response that is likely to be neutralizing, within 5-10 days of first administration. Such a virus-neutralizing response will render further virus administrations ineffective, unless Zika viruses with capsids that express divergent epitopes are used in subsequent administrations, or steps are taken to reduce or suppress the patient immune response.
[0124] In certain embodiments, the virus is administered, for example, to subjects by means of intravenous administration in any pharmacologically acceptable solution, or as an infusion over a period of time. For example, the substance may be administered systemically by injection, or administered by infusion in a manner that results in the daily delivery into the tissue or blood stream of the subject. Where the administration is by infusion, the infusion can be a single sustained dose or can be delivered by multiple infusions.
[0125] The oncolytic Zika virus-based treatment may be combined with other anti-neoplasm treatment modalities, such as chemotherapy (with another chemotherapeutic agent active agent other than an oncolytic Zika virus), radiotherapy, surgery, hormone therapy and/or immunotherapy. For example, the virus may be administered in conjunction with surgery or removal of the neoplasm. Administration of virus at or near to the site of the neoplasm can be combined with surgical removal. The oncolytic Zika virus may be administered in conjunction with or in addition to radiation therapy. The oncolytic Zika virus may be administered in conjunction with or in addition to one or more anti-cancer agents, also known as chemotherapeutic agents. These terms refer to those medications that are used to treat cancer or cancerous conditions. Anti-cancer drugs are conventionally classified in one of the following group: alkylating agents, purine antagonists, pyrimidine antagonists, plant alkaloids, intercalating antibiotics, aromatase inhibitors, anti-metabolites, mitotic inhibitors, growth factor inhibitors, cell cycle inhibitors, enzymes, topoisomerase inhibitors, biological response modifiers, anti-hormones and anti-androgens. Examples of such anti-cancer agents include, but are not limited to, BCNU, cisplatin, gemcitabine, hydroxyurea, taxanes (e.g., docetaxel, paclitaxel), temozomide, topotecan, fluorouracil, vincristine, vinblastine, procarbazine, decarbazine, altretamine, methotrexate, mercaptopurine, thioguanine, fludarabine phosphate, cladribine, pentostatin, cytarabine, azacitidine, etoposide, teniposide, irinotecan, docetaxel, doxorubicin, daunorubicin, dactinomycin, idarubicin, plicamycin, mitomycin, bleomysin, tamoxifen, flutamide, leuprolide, goserelin, aminogluthimide, anastrozole, amsacrine, asparaginase, mitoxantrone, mitotane, and amifostine.
[0126] Methods of the present invention can also be employed together with one or more further combinations of cytotoxic agents as part of a treatment regimen, wherein the further combination of cytotoxic agents is selected from: CHOPP (cyclophosphamide, doxorubicin, vincristine, prednisone, and procarbazine); CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone); COP (cyclophosphamide, vincristine, and prednisone); CAP-BOP (cyclophosphamide, doxorubicin, procarbazine, bleomycin, vincristine, and prednisone); m-BACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine, dexamethasone, and leucovorin); ProMACE-MOPP (prednisone, methotrexate, doxorubicin, cyclophosphamide, etoposide, leucovorin, mechloethamine, vincristine, prednisone, and procarbazine); ProMACE-CytaBOM (prednisone, methotrexate, doxorubicin, cyclophosphamide, etoposide, leucovorin, cytarabine, bleomycin, and vincristine); MACOP-B (methotrexate, doxorubicin, cyclophosphamide, vincristine, prednisone, bleomycin, and leucovorin); MOPP (mechloethamine, vincristine, prednisone, and procarbazine); ABVD (adriamycin/doxorubicin, bleomycin, vinblastine, and dacarbazine); MOPP (mechloethamine, vincristine, prednisone and procarbazine) alternating with ABV (adriamycin/doxorubicin, bleomycin, and vinblastine); MOPP (mechloethamine, vincristine, prednisone, and procarbazine) alternating with ABVD (adriamycin/doxorubicin, bleomycin, vinblastine, and dacarbazine); ChlVPP (chlorambucil, vinblastine, procarbazine, and prednisone); IMVP-16 (ifosfamide, methotrexate, and etoposide); MIME (methyl-gag, ifosfamide, methotrexate, and etoposide); DHAP (dexamethasone, high-dose cytaribine, and cisplatin); ESHAP (etoposide, methylpredisolone, high-dose cytarabine, and cisplatin); CEPP(B) (cyclophosphamide, etoposide, procarbazine, prednisone, and bleomycin); CAMP (lomustine, mitoxantrone, cytarabine, and prednisone); CVP-1 (cyclophosphamide, vincristine, and prednisone), ESHOP (etoposide, methylpredisolone, high-dose cytarabine, vincristine and cisplatin); EPOCH (etoposide, vincristine, and doxorubicin for 96 hours with bolus doses of cyclophosphamide and oral prednisone), ICE (ifosfamide, cyclophosphamide, and etoposide), CEPP(B) (cyclophosphamide, etoposide, procarbazine, prednisone, and bleomycin), CHOP-B (cyclophosphamide, doxorubicin, vincristine, prednisone, and bleomycin), CEPP-B (cyclophosphamide, etoposide, procarbazine, and bleomycin), and P/DOCE (epirubicin or doxorubicin, vincristine, cyclophosphamide, and prednisone).
[0127] As will be appreciated by one skilled in the art, the selection of one or more therapeutic agents to be administered in combination with a method of treatment of the present invention will depend on the tumor of neural crest origin to be treated.
[0128] Combinations of the oncolytic Zika virus and chemotherapeutic agents are administered either concomitantly (e.g., as an admixture), separately but simultaneously (e.g., via separate intravenous lines into the same subject), or sequentially (e.g., one of the compounds or agents is given first followed by the second). Thus, the term combination is used to refer to concomitant, simultaneous, or sequential administration of two or more agents.
[0129] In one embodiment, oncolytic Zika virus is administered for the management of minimal residual disease, particularly neuroblastoma. In this case, the disease is not amenable to surgical treatment, and, in most cases, patients will have already received chemical cancer chemotherapy such that the remaining tumor cells may be drug-resistant. Because Zika viruses would be administered systemically with hematogenous delivery of virus to tumor cells, Zika viruses may be an effective means for treating minimal residual disease.
[0130] The interaction between a virus and its cellular receptor(s) is important for the determination of viral tissue and host tropisms. For instance, viral infection may be blocked by a viral-receptor binding protein. Accordingly, a viral cell receptor, and the viral molecule(s) that bind the receptor, are promising targets for developing anti-viral strategies. As demonstrated herein, human CD24, a cell surface glycoprotein, has been identified as a part of the Zika virus host cell entry pathway. The identification of a cell surface receptor for Zika virus enables a focused strategy to, for instance, identify the CD24-binding molecule(s) of Zika virus. For instance, preparing anti-Zika virus antibodies that specifically block binding to CD24 provides a handle to identify the Zika virus CD24-binding molecule(s). The viral CD24-binding molecule(s) is a candidate as an effective vaccine antigen. It is worth noting that Zika virus tends to mutate fast. However, given the strong selective pressure presented by CD24 binding being a part of viral entry into a host cell, it is not unreasonable to expect that the portion of the viral molecule(s) that binds CD24 is less likely to mutate. Therefore, identifying the viral CD24-biding molecule is a promising avenue for obtaining effective vaccine antigens.
[0131] Additionally, developing anti-human CD24 antibodies that block Zika virus binding to CD24 are also useful. For instance, an anti-CD24 antibody (monoclonal antibodies or fragments thereof such as Fab, scFv, F(ab)2, and domain antibodies) that blocks Zika virus binding to CD24 is a candidate as prophylactic therapeutics for persons at risk of Zika virus exposure. An anti-CD24 antibody that blocks Zika virus binding to CD24 may also be useful in screening small molecule libraries for candidate molecules that block Zika virus binding to CD24. Such molecules are also candidates as prophylactic therapeutics for persons at risk of Zika virus exposure.
[0132] The practice of the invention is illustrated by the following non-limiting examples.
Examples
An Array of Neuroblastoma Cells are Permissive to Zika Virus Infection
[0133] Six human neuroblastoma cell lines (including 3 MYCN-amplified and 3 non-MYCN-amplified) along with Vero cells (a control cell line) were infected with Zika virus (strain=PR2015) at an MOI=10. The cells were allowed to incubate for a total of 10 days, with samples acquired every two days (starting with Day 0). Acquired cell samples were screened for cell viability (by MTS assay) and compared to uninfected cells (
[0134] The results indicate that the three MYCN-amplified cell lines (i.e., IMR-32, SMS-KAN, and SK-N-Be(1) cells) all showed losses in cell viability that surpassed even the Vero control cells. Of the non-MTCN-amplified cells, only CHLA-42 showed a strong response to infection. Surprisingly, the non-MYCN-amplified cell line SK-N-AS not only did not succumb to Zika infection, but actually recovered after only a slight dip in cell viability. Overall, these observations indicate that a phenotypic range of neuroblastoma cells are susceptible to Zika virus infection, independent of MYCN amplification.
Neuroblastoma Cell Lines Tested were Permissive of Zika Virus Infection, with the Exception of SK-N-AS Cells
[0135] Zika virus binding to exposed cells was examined by demonstrating the presence of cell-associated viral envelope protein. Because the NS1 protein is not expressed until early in the course of infection, Zika virus infection was inferred by demonstration of de novo synthesis of the Zika virus NS1 protein. In these experiments, neuroblastoma cell lines were infected with an MOI=10 of Zika virus particles for four days. At the time of harvest, the culture medium was removed and cells were thoroughly washed in PBS to remove residual virus particles. Total cellular protein was extracted and the viral envelope and NS1 proteins were analyzed by Western blot (
[0136] To determine whether SK-N-AS cells were permissive to Zika viral infection, the culture media viral titers of infected SK-N-AS cells to IMR-32 cells were compared at 2-days and 3-days post-infection (
Permissive Zika Virus Infection in Neuroblastoma Cells Directly Correlates with CD24 Expression
[0137] Given the above data, Zika virus particles bound to all cell types tested but caused a poorly productive infection in SKN-AS cells. To determine why Zika virus produced such a poor infection in SK-N-AS cells, the global transcriptomes were compared between the poorly productive SK-N-AS cells and the highly productive IMR-32 cells. It was hypothesized that neuroblastoma cell permissivity to Zika virus infection would correlate with expression of a membrane-associated protein. Analysis of global transcriptomics by Next Gen sequencing suggested possible differentially expressed genes that might serve as down-regulated receptors. One such gene, CD24, was selected for further analysis. CD24 is a GPI-linked surface glycoprotein expressed in differentiating neuroblasts and B lymphocytes (Hough et al, 1994, doi: 10.1006/geno. 1994.1356) and is known to be crucial for neuronal development (Gilliam et al., 2017, doi:10.1016/j.nbd.2016.12.011).
[0138] An analysis of the CD24 transcripts revealed three separate transcripts, all of which were significantly higher expressed in IMR-32 cells than in SK-N-AS cells. The three transcripts encode two distinct open reading frames, two of the transcripts (NM_013230 & NM_001291738) having the same open reading frame, whereas transcript NM_001291739 utilizes an alternate first exon. Both ORFs utilize the same sequence in their second exon. The two splice variants were identified as variant-001 and variant-007 (
[0139] CD24 was cloned from IMR-32 cells and recombinant expression vectors were constructed containing two possible splice variants (variant-001 and variant-007). These expression plasmids were transiently transfected into SK-N-AS cells for 48 hours (along with vector only control cells and Vero cells), after which the cells were infected with Zika virus (MOI=10) and incubated for 4 additional days. The samples were then analyzed by Western blot (
CD24 Expression is Necessary for the Production of NS1 Protein in Neuroblastoma Cells Infected with Zika Virus
[0140] It is worth noting that Vero cells do not express CD24 (
[0141] Though the experiments indicate a relevance for CD24 in the productive Zika infection of neuroblastomas, the impact is difficult to judge in a transient system. To more accurately assess the impact of CD24 activity in this process, both splice variants (Variant 1 and variant 7) were stably expressed in SK-N-AS cells. Stable expression of the CD24 variants was then validated compared to Vector Only control cells and wild type SK-N-AS cells (
[0142] A bright field analysis of the cells revealed some loss of cells in the wild type (WT) and Vector Only (VO) cells (
Transgenic CD24 Expression in SK-N-AS Cells Increases Zika Virus Permissiveness
[0143] The robust differences observed in Zika virus permissiveness, as shown in the bright field images in
[0144] The results indicated that both WT and VO cells infected by Zika virus showed a marked decrease in viability, with losses varying between 30-35% of uninfected cells, consistent with
[0145] Viral titers within the culture media were also measured from these cells to determine if virus production coincided with cellular pathology (
[0146] Immunofluorescent labeling of Zika Envelope protein remained difficult to detect in SK-N-AS/VO cells, similar to that seen in wild type SK-N-AS cells. However, Zika Envelope protein was prominently expressed in both CD24-expressing stable cell line (
[0147] Together, these data indicate that expression of either CD24 variant 1 or 7 renders SK-N-AS cells highly permissive to Zika virus cytotoxicity, and the mechanism of cell death includes induction of apoptosis. In addition, a correlation can be observed between viral pathology and an increase in viral titers produced in the presence of CD24 as well as the production of Zika Envelope protein in CD24-permissive cells.
Zika Virus Reference Strains MR766 and IBH 30656 Induce Severe Cytopathic Effects in CD24-Expressing SK-N-AS Cells
[0148] To confirm that Zika virus-mediated cytotoxicity of CD24-expressing SK-N-AS cells was not limited to the PRVABC59 strain, the cytotoxicity of two additional Zika virus strains, MR 766 (ATCC VR-1838; the Zika virus index strain, derived from a rhesus monkey in Uganda in 1947) and strain IBH 30656 (ATCC VR-1839; a 1968 Nigerian human isolate), was also assessed. Zika virus strains PRVABC59, MR766, and IBH 30656 were assessed in parallel for their ability to induce cytopathic effects in CD24 variant 1- and 7-expressing SK-N-AS cells, as well as in wild type and Vector Only SK-N-AS control cells by infecting cells (MOI=10 for all respective strains) and examining them after 96 hours (
[0149] It is important to note that therapy for neuroblastoma often includes the use of retinoids (13-cis-retinoic acid, isotretinoin) (see, e.g., Reynolds C P, Matthay K K, Villablanca J G, Maurer B J. Retinoid therapy of high-risk neuroblastoma. Cancer Lett. 2003 Jul. 18; 197(1-2): 185-92). Retinoids are thought to drive differentiation of neuroblastoma cells to form benign ganglioneuroma. It is possible that retinoid treatment of neuroblastoma cells will lead to reduction or loss of CD24 expression, rendering the cells insensitive to Zika virus induced lysis. Thus, it may be important that patients with neuroblastoma who are to be treated with Zika viruses avoid retinoid therapy prior to Zika virus treatment.
Zika Viruses could be Useful for the Treatment of Other Tumors
[0150] As shown in
[0151] A triple-negative breast cancer line (MBA231) was identified to be susceptible to Zika virus-mediated lysis.
[0152] It is important to note that CD24 expression in breast cancer cells is suggested to be affected by previous breast cancer treatment. Specifically, previous treatment of breast cancer with taxanes is associated with increased expression of CD24 and decreased expression of CD44. Conversely, treatment of cancer cells with doxorubicin is associated with decreased expression of CD24 and increased expression of CD 44. It could be hypothesized that taxane-induced increases in CD24 expression may render cells previously resistant to Zika virus-induced lysis susceptible to Zika virus-induced lysis. Thus, it would be useful to study whether the taxane-induced increase in CD24 expression occurs with other tumors. For this, wild type SK-N-AS neuroblastoma cells (the neuroblastoma cell line that does not express CD24 and is resistant to Zika virus-mediated lysis) will be treated with paclitaxel to determine if paclitaxel treatment induces CD24 expression. It will be further determined whether paclitaxel or other taxanes increase CD24 expression in CD24-negative and CD24-heterogeneous tumors and cell lines.
[0153] Several brain tumors, including gliomas, glioblastomas, medulloblastomas, and pontine gliomas express CD24. Thus, Zika viruses could be used for treatment of CD24-positive malignant brain tumors. Similarly, benign brain tumors, neural sheath tumors, and tumors of the peripheral nervous system, including schwannomas and neurofibromatosis related tumors (including plexiform neurofibromatosis) likely express CD24. In addition, CD24 may be expressed on the tumors associated with tuberous sclerosis. Zika viruses and engineered Zika viruses may be used for treatment of CD24-positive benign central and peripheral nervous system tumors.
[0154] Three cell lines derived from HPV induced cervical tumors (HeLa cells, which maintain integrated HPV 18 genomes, and SiHa and CaSki cells, which maintain integrated HPV 16 genomes) were characterized for their susceptibility to Zika virus mediated lysis. For this, HeLa, SiHa, and CaSki cells were seeded at the concentration of 110.sup.5 cells per well into a 12-well tissue culture treated plates and allowed to attach for 4-5 hrs under normal conditions for those cells. After attachment, the cells were infected with Zika virus at multiplicity of infection (moi) of 0.3 and maintained at 37 C., 5% CO.sub.2. The media was replaced 16-18 hrs post infection. Cytopathic effect was observed in HeLa and CaSki cell lines within 72 hrs after infection, whereas in SiHa cell line cytopathic was observed within 7 days of infection. Thus, these three cell lines derived from HPV induced cervical tumors are susceptible to Zika virus-mediated lysis. The level of CD24 expression in the cells will be further characterized. Given the observed susceptibility, Zika viruses may be useful for the treatment of HPV associated pre-cancers and cancers, including cervical precancers and cancers, vaginal precancers and cancers, vulvar precancers and cancers, anal precancers and cancers, penile precancers and cancers, and HPV-positive oropharyngeal cancers.
[0155] Insofar as Zika viruses are thought to cause cell death by induction of autophagy with subsequent activation of cellular apoptosis (see, e.g., Chiramel A I et al., Virus Res. 2017 Sep. 9. pii: S0168-1702(17)30467-7. doi: 10.1016/j.virusres.2017.09.006), Zika viruses may have a therapeutic role in the treatment of apoptosis-resistant tumors, restoring tumor cell sensitivity to proapoptotic agents by being given in combination with proapoptotic chemotherapy agents (e.g., anthracyclines).
Zika Viruses could be Useful for the Treatment of Diseases/Disorders Involved in CD24 Expression
[0156] It was shown that resting T lymphocytes do not express significant levels of CD24. Nevertheless, activation of resting T cells with CD3/CD28 antibody leads to a marked increase in CD24 expression. These data indicate that CD3/CD28 antibody stimulation of CD4-positive T-cells (which are, at baseline, CD24-negative), markedly increased levels of CD24. Studies will now be performed to determine if CD24 expression confers to T-lymphocytes susceptibility to Zika virus-mediated lysis.
[0157] Because activation of T cells leads to increased CD24 expression, and because CD24 appears to be an important determinant of susceptibility to Zika virus mediated lysis, it can be proposed that other diseases associated with abnormal T cell activation might be amenable to therapeutic Zika virus-induced lysis of activated T cells.
[0158] As demonstrated in
[0159] Neurological diseases associated with abnormal T cell activation/T cell mediated autoimmunity may include, but are not limited to, multiple sclerosis, chronic inflammatory demyelinating polyneuropathy, and Guillain-Barre syndrome.
[0160] Gastroenterological diseases associated with abnormal T cell activation/T cell-mediated autoimmunity may include, but are not limited to, ulcerative colitis, Crohn's disease, primary biliary cirrhosis, autoimmune pancreatitis, and autoimmune hepatitis.
[0161] Dermatological diseases associated with abnormal T cell activation/T cell-mediated autoimmunity may include, but are not limited to, alopecia areata, psoriasis, vitiligo, and eczema.
[0162] Endocrine diseases associated with abnormal T cell activation/T cell-mediated autoimmunity may include, but are not limited to, Hashimoto thyroiditis, type 1 diabetes mellitus, Graves' disease, and autoimmune polyendocrine syndrome.
[0163] Hematological diseases associated with abnormal T cell activation/T cell-mediated autoimmunity may include, but are not limited to, autoimmune myelodysplastic syndromes, aplastic anemia, graft-versus-host disease, and hemophagocytic syndromes.
[0164] Infectious diseases associated with abnormal T cell activation/T cell-mediated autoimmunity may include, but are not limited to, HIV infection, post-transplantation lymphoproliferative disorder due to Epstein-Barr virus, and myocarditis.
[0165] Furthermore, while there are considerations to giving a potentially pathogenic virus to immune suppressed patients, insofar as Zika viruses may be used to target activated T-cell, Zika viruses could have a role in treatment of T-cell-mediated acute graft rejection.
Protocols for Experiments
[0166] The experiments for the discussion above were performed as follows.
Cell Lines Used & Conditions:
[0167] MR-32 cells were cultured in Minimum Essential Medium (MEM) Alpha and GlutaMAX [Gibco Life Sciences] supplemented with 10% fetal bovine serum [FBS]. SK-N-AS, 3T3, and Vero cells were cultured in Dulbecco's modified Eagle's medium (DMEM) [Gibco Life Sciences] supplemented with 10% FBS and 1% non-essential amino acids (NEAA). CHLA-42 cells were cultured in HyClone Iscove's Modified Dulbecco's Medium (IMDM) [GE Healthcare Life Sciences] supplemented with 20% FBS and 1ITS (5 g/mL insulin, 5 g/mL transferrin, 5 ng/mL selenous acid). LA-N-6, SK-N-Be(1), and SMS-KAN cells were cultured in HyClone RPMI-1640 [GE Healthcare Life Sciences] supplemented with 10% FBS. 3T3 cells were acquired as a generous gift from the lab of Dr. Ken Alexander. All cells were incubated and maintained at 37 C. and 5% CO.sub.2.
Cell Line Infection & Cell Viability Assays:
[0168] 10.sup.4 cells of each cell line were laid down in two rows in sextuplicate (thus, 12 wells total) in a flat bottom 96-well tissue culture treated plate and allowed to attach overnight. The following day, each cell line was either infected at an MOI=10 of Zika virus (strain=PR2015) or left uninfected (as controls). Six plates were prepared simultaneously for each cell line (allowing for assays on Days 0, 2, 4, 6, 8, & 10). All cells were maintained at 37 C. and 5% CO.sub.2. Two hours after infection, the first plate was examined using the CellTiter 96 AQueous One Solution Cell Proliferation (MTS) assay (Promega Corp.) and used according to the manufacturer's instructions. All samples were read on a SpectraMax M5 (Molecular Devices Corp.) system at a wavelength of 490 nm using SoftMax Pro (version 6.2.1) software. Plates were examined again at each time point (Days 2, 4, 6, 8, & 10). Data graphed is the composite of experiments performed in triplicate.
Western Blot Analysis of Zika-Infected Cell Lines:
[0169] 2.510.sup.5 cells were laid down in 12-well tissue culture treated plates and allowed to attach overnight. The following day, each cell line was either infected at an MOI=10 of Zika virus (strain=PR2015) or left uninfected (as controls). The plates were allowed to incubate for 4 days at 37 C. and 5% CO.sub.2. Following the 4 day incubation, the cells were acquired and counted. 210.sup.5 cells of each cell sample were boiled under denaturing conditions and proteins separated on 10% Tris-glycine denaturing polyacrylamide gels by electrophoresis. Proteins were transferred to nitrocellulose membranes and probed with the following primary antibodies: anti-NS1 (One World Lab, Cat#55964) at 1/200, anti-Env (Envelope) (GeneTex, Cat# GTX133314) at 1/1000, and anti-GAPDH (Santa Cruz, FL-335) at 1/2000 according to standard methods. Blots were probed with horseradish peroxidase-conjugated secondary antibodies (Invitrogen, Goat anti-Mouse, Cat#62-6520, Goat anti-Rb, Cat#65-6120) and visualized with ECL chemiluminescence (Pierce).
Quantitative Real-Time PCR
[0170] Total RNA was isolated from cells using an RNeasy Mini Kit (Qiagen) and RNA concentrations were determined by UV spectrophotometry. Reverse transcription (RT) reactions were used to convert 1.0 g of total RNA into cDNA using the Applied Biosystems High Capacity cDNA RT kit (Thermo Fisher Scientific). Reaction volumes were then brought to 100 l with nuclease-free water. Quantitative real-time PCR (qPCR) was performed by using the CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories, Hercules, Calif.). Gene-specific primers for quantitative real-time PCR were designed from their respective gene sequences using PrimerQuest (Integrated DNA Technologies) to generate sequences for PCR amplicons of 75 to 150 nucleotides that span exon-exon junctions. Gene-specific qPCR primer sequences used were as follows: GAPDH, sense primer, 5-ACATCGCTCAGACACCATG-3 (SEQ ID NO: 1), and anti-sense primer, 5-TGTAGTTGAGGTCAATGAAGGG-3 (SEQ ID NO: 2); CD24 variant 001, sense primer, 5-CTGCTGCTGCTGGCACTGCTCC-3 (SEQ ID NO: 3), and anti-sense primer, 5-GGGGCCAACCCAGAGTTGGAAG-3(SEQ ID NO: 4); and CD24 variant 007, sense primer, 5-CTGGGCCTGGGAGACCCTAGCG-3 (SEQ ID NO: 5), and anti-sense primer, 5-GGGGCCAACCCAGAGTTGGAAG-3 (SEQ ID NO: 6). Synthetic double-stranded, linear DNA gBlock gene fragments (Integrated DNA Technologies) corresponding to each gene-specific PCR amplicon were designed for qPCR standards. Standard curve copy numbers were calculated using the precise molecular weight of each dsDNA gBlock. The 384-well real-time PCR format included duplicate 10-fold dilutions of the linear dsDNA gene Block standards ranging from 210 to 210 copies per qPCR reaction. Human GAPDH was used to normalize the starting quantity of RNA. Reactions were performed in a 10-l volume comprised of 2 l of cDNA reaction, 5.0 l of 2 SsoFast EvaGreen Supermix (Bio-Rad), and 500 nM concentrations of each primer. The 2-step cycling parameters were 95 C. for 30 sec to activate the polymerase, followed by 40 cycles of 95 C. for 5 sec and 60 C. for 5 sec. Fluorescence measurements were taken at each cycle during the 60 C. annealing step. Melt curve analysis of generated PCR amplicons was performed upon completion of the 40 amplification cycles, which consisted of a 65 C. to 95 C. gradient at 0.5 C. increments for 2 sec plus fluorescence measurements. The copy number for each reaction was calculated by the CFX Manager 3.1 software (Bio-Rad). Copy number values were normalized to the corresponding GAPDH values to determine the relative copy number.
Construction of CD24 Recombinant Expression Vectors:
[0171] Total RNA was isolated from IMR-32 cells using the RNeasy Mini Kit (Qiagen) and reverse transcribed using M-MLV reverse transcriptase. The cDNA was then used as a template for PCR amplification using GoTaq (Promega). The primers were designed as follows: CD24-001 ORF For (BamHI)TGGATCCATGGGCAGAGCAATGGTGGCC (SEQ ID NO: 7), or CD24-007 ORF For (BamHI)TGGATCCATGGTGGGACGATTCTGTCCC (SEQ ID NO: 8) and CD24 ORF Rev (EcoRI)AGAATTCTTAAGAGTAGAGATGCAGAAGAGAGAGTG (SEQ ID NO: 9). Both PCR products were gel purified (QIAquick Gel Extraction kit, Qiagen), TOPO-cloned into pCR4-TOPO (Life Technologies), transformed into Top 10 Chem comp cells and plated on LB Amp plates (100 g/mL). Colonies were grown in LB Amp (100 g/mL) overnight (O/N) at 37 C., with plasmids harvested by miniprep (QIAprep Spin Miniprep kit, Qiagen). All clones were sequenced (Retrogen), then analyzed using VectorNTi and AlignX (Life Technologies). Both CD24 splice variants 001 and 007 were sub-cloned into pcDNA6/V5-HisA by restriction digestion using BamHI and EcoRI and ligated using T4 Ligase (NEB, Inc.). Final clones were confirmed by restriction digestion and quantified for transfection. The kits mentioned all were used pursuant to manufacturers' instructions.
Examination of Cells after Transient-Transfection of CD24 Cells Followed by Zika Infection:
[0172] SK-N-AS cells were seeded into single wells of a 6-well plate at a density of 2.510.sup.5 cells per well and transfected using Fugene 6 (Promega Corp.) with 2 g of either pcDNA6/V5-HisA (Vector Only), pcDNA6/CD24-v001 or pcDNA6/CD24-v007. The transfection was allowed to continue 6 hours, after which the media was removed, the cells were washed with PBS, and fresh media was added. 48 hours after transfection, the cells were lifted (Accumax), counted, and 2.810.sup.5 cells of each sample were laid down in two wells of a 12-well tissue culture treated plate. Each sample was then either infected at an MOI=10 of Zika virus (strain=PR2015) or left uninfected (as controls). The samples were allowed to incubate for 4 additional days at 37 C. and 5% CO.sub.2 after which they were acquired and counted. Western blot analysis was again performed (as above).
Western Blot Analysis of Native CD24 Expression in Neuroblastoma Cell Lines:
[0173] 210.sup.5 cells of 6 neuroblastoma cell lines (i.e., IMR-32, SMS-KAN, SK-N-AS, LA-N-6, SK-N-Be(1), and CHLA-42 cells) along with Vero cells were acquired and counted, then boiled under denaturing conditions and proteins separated on an 12% Tris-Glycine denaturing polyacrylamide gels by electrophoresis. Proteins were transferred to nitrocellulose membranes (0.2 m, BioRad, Cat#1620112) and probed with the following primary antibodies: anti-CD24 (Monoclonal SN3, Cat# MA5-11828, ThermoFisher) at 1/200, and anti-GAPDH (Santa Cruz, FL-335) at 1/2000 according to standard methods. Blots were probed with horseradish peroxidase-conjugated secondary antibodies (Invitrogen, Goat anti-Mouse, Cat#62-6520) and visualized with ECL chemiluminescence (Pierce).
Examination of IMR-32 Cells after Transient-Transfection of CD24 siRNA into Cells Followed by Zika Infection:
[0174] IMR-32 cells were seeded into single wells of a 6-well plate at a density of 2.510.sup.5 cells per well and transfected with 50 M of CD24 Silencer Select Pre-designed siRNA (Cat #4392420, ID: s2616) or Silencer Select Negative Control siRNA #1 (Cat #4390843). The transfection was allowed to continue 6 hours, after which the media was removed, the cells were washed with 1 phosphate buffered saline (PBS), and fresh media was added. 48 hours after transfection, the cells were lifted (Accumax), counted, and 2.810.sup.5 cells of each sample were laid down in two wells of a 12-well tissue culture treated plate. Each sample was then either infected at an MOI=10 of Zika virus (strain=PR2015) or left uninfected (as controls). The samples were allowed to incubate for 4 additional days at 37 C. and 5% CO.sub.2 after which they were acquired and counted. Western blot analysis was performed once again (as above).
Construction of SK-N-AS Cells Stably-Expressing CD24 Variants 1 and 7:
[0175] SK-N-AS cells were seeded into single wells of a 6-well plate at a density of 2.510.sup.5 cells per well and transfected using Fugene 6 (Promega Corp.) with 2 g of either pcDNA6/V5-HisA (Vector Only), pcDNA6/CD24-v001, or pcDNA6/CD24-v007. The transfection was allowed to continue 6 hours, after which the media was removed, the cells were washed with PBS, and fresh media was added. 24 hours after transfection, the cells began selection at 6 g/mL with Blasticidin (Life Technologies Corp.). Selection continued for 10 days until individual colonies could be isolated.
Validation of SK-N-AS Cells Stably-Expressing CD24 Variants 1 and 7:
[0176] 2.510.sup.5 cells of each selected SK-N-AS cell sample (to include WT SK-N-AS, SK-N-ASNO, SK-N-AS/CD24-v001, and SK-N-AS/CD24-v007) were acquired and counted, then boiled under denaturing conditions and proteins separated on an 18% Tris-Glycine denaturing polyacrylamide gel by electrophoresis. Proteins were transferred to nitrocellulose membranes and probed with the following primary antibodies: anti-CD24 (Monoclonal SN3, Cat# MA5-11828, ThermoFisher) at 1/200, and anti-GAPDH (Santa Cruz, FL-335) at 1/2000 according to standard methods. Blots were probed with horseradish peroxidase-conjugated secondary antibodies and visualized with ECL chemiluminescence (Pierce).
Examination of SK-N-AS CD24 Stable Cells Following Zika Infection:
[0177] 2.810.sup.5 cells of each selected SK-N-AS cell sample (to include WT SK-N-AS, SK-N-AS/VO, SK-N-AS/CD24-v001, and SK-N-AS/CD24-v007) were laid down in two wells of a 12-well tissue culture treated plate. Each sample was then either infected at an MOI=10 of Zika virus (strain=PR2015) or left uninfected (as controls). The samples were allowed to incubate for 4 additional days at 37 C. and 5% CO.sub.2. The plates were then examined under bright field conditions using a Nikon AIR VAAS laser point- and resonant-scanning confocal microscope, after which they were acquired and counted for examination by Western blot analysis (as above).
Cell Viability (MTS) of SK-N-AS CD24 Stable Cells Following Zika Infection:
[0178] 810.sup.3 cells were seeded into 12 wells of a 96-well plate for each SK-N-AS sample (to include WT SK-N-AS, SK-N-AS/VO, SK-N-AS/CD24-v001, and SK-N-AS/CD24-v007). Each sample was then either infected at an MOI=10 of Zika virus (strain=PR2015) or left uninfected (as controls) (thus, each sample was performed in sextuplicate). The samples were allowed to incubate for 4 additional days at 37 C. and 5% CO.sub.2. After treatment, the CellTiter 96 Aqueous One Solution Cell Proliferation (Promega Corp.) assay was performed according to the manufacturer's instructions (PerkinElmer Multilabel Plate ReaderModel 2104) with each well measured in triplicate.
Caspase 3/7 Assay of SK-N-AS CD24 Stable Cells Following Zika Infection:
[0179] 810.sup.3 cells were seeded into 12 wells of a 96-well plate for each SK-N-AS sample (to include WT SK-N-AS, SK-N-ASNO, SK-N-AS/CD24-v001, and SK-N-AS/CD24-v007). Each sample was then either infected at an MOI=10 of Zika virus (strain=PR2015) or left uninfected (as controls) (thus, each sample was performed in sextuplicate). The samples were allowed to incubate for 4 additional days at 37 C. and 5% CO.sub.2. After treatment, Caspase-Glo 3/7 (Promega Corp.) reagent was added to each well, and allowed to incubate at room temperature for 2 hrs. Caspase activity was then measured for luminescence using a GloMax luminometer (Promega) with each well measured in triplicate.
Construction of 3T3 and Vero Cells Stably-Expressing CD24 Variants 1 and 7:
[0180] 3T3 or Vero cells will be seeded into single wells of a 6-well plate at a density of 2.510.sup.5 cells per well and transfected using Fugene 6 (Promega Corp.) with 2 g of either pcDNA6N/V5-HisA (Vector Only), pcDNA6/CD24-v001 or pcDNA6/CD24-v007. The transfection will continue for 6 hours, after which the media will be removed, the cells washed with 1PBS, and fresh media will be added. 24 hours after transfection, the cells will begin selection with Blasticidin (Life Technologies Corp.) as described in the experiments above. Selection will continue until individual colonies can be isolated and assayed.
[0181] The disclosures of each and every patent, patent application, GenBank record, and publication cited herein are hereby incorporated herein by reference in their entirety.
[0182] While the invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope used in the practice of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.