RECOMBINANT YEAST AND A METHOD FOR PRODUCING ETHANOL USING THE SAME
20190040379 ยท 2019-02-07
Assignee
Inventors
- Nobuki TADA (Nisshin-shi, JP)
- Toru Onishi (Toyota-shi, JP)
- Junji ITO (Nisshin-shi, JP)
- Rie HIRAO (Handa-shi, JP)
Cpc classification
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Y501/03001
CHEMISTRY; METALLURGY
C12N9/92
CHEMISTRY; METALLURGY
C12N9/1022
CHEMISTRY; METALLURGY
C12N9/0008
CHEMISTRY; METALLURGY
C12P7/08
CHEMISTRY; METALLURGY
International classification
Abstract
An acetic acid metabolizing ability of a recombinant yeast strain having xylose-metabolizing ability is to be improved. In such a recombinant yeast strain having xylose-metabolizing ability, the acetaldehyde dehydrogenase gene has been introduced and a gene encoding NADH dehydrogenase involved in reoxidation of cytoplasmic NADH on the mitochondrial outer membrane has been suppressed.
Claims
1. A recombinant yeast strain having xylose-metabolizing ability comprising the acetaldehyde dehydrogenase gene introduced thereinto, wherein a gene encoding NADH dehydrogenase involved in reoxidation of cytoplasmic NADH on the mitochondrial outer membrane is suppressed.
2. The recombinant yeast strain according to claim 1, wherein the gene encoding NADH dehydrogenase encodes a protein (a) or (b) below: (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 2 or 4; or (b) a protein comprising an amino acid sequence exhibiting 70% or higher identity with the amino acid sequence as shown in SEQ ID NO: 2 or 4 and having enzymatic activity of catalyzing a reaction of converting NADH into NAD.sup.+.
3. The recombinant yeast strain according to claim 1 comprising a xylose isomerase gene introduced thereinto.
4. The recombinant yeast strain according to claim 3, wherein the xylose isomerase gene encodes a protein (a) or (b) below: (a) a protein comprising the amino acid sequence as shown in SEQ ID NO: 6; or (b) a protein comprising an amino acid sequence exhibiting 70% or higher identity with the amino acid sequence as shown in SEQ ID NO: 6 and having enzymatic activity of converting xylose into xylulose.
5. The recombinant yeast strain according to claim 1, which further comprises a xylulokinase gene introduced thereinto.
6. The recombinant yeast strain according to claim 1, which comprises a gene encoding an enzyme selected from a group of enzymes constituting a non-oxidative process in the pentose phosphate pathway introduced thereinto.
7. The recombinant yeast strain according to claim 6, wherein the group of enzymes constituting a non-oxidative process in the pentose phosphate pathway includes ribose-5-phosphate isomerase, ribulose-5-phosphate-3-epimerase, transketolase, and transaldolase.
8. The recombinant yeast strain according to claim 1, which allows high-level expression of the alcohol dehydrogenase gene having activity of converting acetaldehyde into ethanol.
9. The recombinant yeast strain according to claim 1, which shows a lowered expression level of the alcohol dehydrogenase gene having activity of converting ethanol into acetaldehyde.
10. A method for producing ethanol comprising a step of culturing the recombinant yeast strain according to claim 1 in a xylose-containing medium to perform ethanol fermentation.
11. The method for producing ethanol according to claim 10, wherein the medium contains cellulose and the ethanol fermentation proceeds simultaneously with saccharification by at least the cellulose.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
DETAILED DESCRIPTION
[0027] Hereafter, the present disclosure is described in greater detail with reference to the drawings and the examples.
[0028] A recombinant yeast strain used in the method for producing ethanol of the present disclosure has a xylose-metabolizing ability and comprises the acetaldehyde dehydrogenase gene introduced thereinto, which results from suppression of a gene encoding NADH dehydrogenase involved in reoxidation of cytoplasmic NADH on the mitochondrial outer membrane. The recombinant yeast strain of the present disclosure can metabolize acetic acid contained in a medium. According to the method for producing ethanol using the recombinant yeast strain of the present disclosure, accordingly, acetic acid concentration in a medium is lowered as ethanol fermentation proceeds.
<Recombinant Yeast Strain>
[0029] A recombinant yeast strain used in the method for producing ethanol of the present disclosure has xylose-metabolizing ability, which results from introduction of the acetaldehyde dehydrogenase gene and suppression of a gene encoding NADH dehydrogenase involved in reoxidation of cytoplasmic NADH on the mitochondrial outer membrane (hereafter, it is referred to as the NADH dehydrogenase gene). The term yeast strain having xylose-metabolizing ability refers to: a yeast strain to which xylose-metabolizing ability has been imparted as a result of introduction of a xylose metabolism-associated gene into a yeast strain that does not inherently has xylose-metabolizing ability; and a yeast strain inherently comprising a xylose metabolism-associated gene and having xylose-metabolizing ability. More specifically, a yeast strain having xylose-metabolizing ability can be a yeast strain to which xylose-metabolizing ability has been imparted as a result of introduction of a xylose isomerase gene into a yeast strain that does not inherently have xylose-metabolizing ability or a yeast strain to which xylose-metabolizing ability has been imparted as a result of introduction of another xylose metabolism-associated gene.
[0030] In the recombinant yeast strain of the present disclosure, the NADH dehydrogenase gene is suppressed. When the NADH dehydrogenase gene is to be suppressed, a yeast strain is modified to show a lowered expression level of the NADH dehydrogenase gene. The NADH dehydrogenase gene is not particularly limited, and examples thereof include the NDE1 gene and the NDH2 gene of Saccharomyces cerevisiae. SEQ ID NO: 1 and SEQ ID NO: 2 show the nucleotide sequence of the coding region of the NDE1 gene and the amino acid sequence of a protein encoded by such gene, respectively. Also, SEQ ID NO: 3 and SEQ ID NO: 4 show the nucleotide sequence of the coding region of the NDE2 gene and the amino acid sequence of a protein encoded by such gene, respectively.
[0031] The NADH dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 1 to 4. It may be a paralogous gene or a homologous gene in the narrow sense having different nucleotide and amino acid sequences.
[0032] The NADH dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 1 to 4. For example, it may be a gene comprising an amino acid sequence having 70% or higher, preferably 80% or higher, more preferably 90% or higher, and most preferably 95% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 2 or 4 and encoding a protein having NADH dehydrogenase activity (i.e., an activity of catalyzing a reaction of converting NADH into NAD.sup.+). The degree of sequence similarity or identity can be determined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the amino acid residues.
[0033] Further, the NADH dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 1 to 4. For example, it may be a gene comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 2 or 4 by substitution, deletion, insertion, or addition of one or several amino acids and encoding a protein having NADH dehydrogenase activity (i.e., an activity of catalyzing a reaction of converting NADH into NAD.sup.+). The term several used herein refers to, for example, 2 to 50, preferably 2 to 30, more preferably 2 to 15, and most preferably 2 to 7.
[0034] Furthermore, the NADH dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 1 to 4. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 1 or 3 and encoding a protein having NADH dehydrogenase activity (i.e., an activity of catalyzing a reaction of converting NADH into NAD.sup.+). Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 mM and preferably 25 to 300 mM, and the temperature is 42 C. to 68 C. and preferably 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.
[0035] As described above, whether or not a gene comprising a nucleotide sequence that differs from the sequence as shown in SEQ ID NO: 1 or 3 or a gene encoding an amino acid sequence that differs from the sequence as shown in SEQ ID NO: 2 or 4 would function as the NADH dehydrogenase gene may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an E. coli host using such expression vector, and assaying the NADH dehydrogenase activity (i.e., an activity of catalyzing a reaction of converting NADH into NAD.sup.+) of the protein expressed. The term NADH dehydrogenase activity is synonymous with oxidoreductase activity of transferring 2 electrons from NADH to ubiquinone (CoQ). NADH dehydrogenase catalyzes a reaction of converting NADH and decyl ubiquinone into NAD.sup.+ and decyl ubiquinol, respectively. Accordingly, the NADH dehydrogenase activity can be evaluated based on, for example, the amount of NADH decrease determined based on a change in the absorbance at 340 nm.
[0036] The recombinant yeast strain of the present disclosure has xylose-metabolizing ability; that is, it is capable of assimilating xylose contained in a medium to produce ethanol. Xylose contained in a medium may be obtained by saccharification of xylan or hemicellulose comprising xylose as a constituent sugar. Alternatively, it may be supplied to a medium as a result of saccharification of xylan or hemicellulose contained in a medium by a saccharification-enzyme. The latter case refers to the so-called simultaneous saccharification and fermentation process.
[0037] Examples of yeast strains having xylose-metabolizing ability include a yeast strain to which xylose-metabolizing ability has been imparted as a result of introduction of a xylose isomerase gene into a yeast strain that does not inherently has xylose-metabolizing ability and a yeast strain to which xylose-assimilating ability has been imparted as a result of introduction of another xylose assimilation-associated gene.
[0038] The xylose isomerase gene (the XI gene) is not particularly limited, and a gene originating from any organism species may be used. For example, a plurality of the xylose isomerase genes derived from the intestinal protozoa of termites disclosed in JP 2011-147445 A can be used without particular limitation. Examples of the xylose isomerase genes that can be used include a gene derived from the anaerobic fungus Piromyces sp. strain E2 (JP 2005-514951 A), a gene derived from the anaerobic fungus Cyllamyces aberensis, a gene derived from a bacterial strain (i.e., Bacteroides thetaiotaomicron), a gene derived from a bacterial strain (i.e., Clostridium phytofermentans), and a gene derived from the Streptomyces murinus cluster.
[0039] Specifically, use of a xylose isomerase gene derived from the intestinal protozoa of Reticulitermes speratus as the xylose isomerase gene is preferable. The nucleotide sequence of the coding region of the xylose isomerase gene derived from the intestinal protozoa of Reticulitermes speratus and the amino acid sequence of a protein encoded by such gene are as shown in SEQ ID NOs: 5 and 6, respectively.
[0040] The xylose isomerase genes are not limited to the genes identified by SEQ ID NO: 5 and SEQ ID NO: 6. It may be a paralogous gene or a homologous gene in the narrow sense having different nucleotide and amino acid sequences.
[0041] The xylose isomerase genes are not limited to the genes identified by SEQ ID NO: 5 and SEQ ID NO: 6. For example, it may be a gene comprising an amino acid sequence having 70% or higher, preferably 80% or higher, more preferably 90% or higher, and most preferably 95% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 6 and encoding a protein having xylose isomerase activity. The degree of sequence similarity or identity can be determined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.
[0042] Further, the xylose isomerase genes are not limited to the genes identified by SEQ ID NO: 5 and SEQ ID NO: 6. For example, it may be a gene comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 6 by substitution, deletion, insertion, or addition of one or several amino acids and encoding a protein having xylose isomerase activity. The term several used herein refers to, for example, 2 to 30, preferably 2 to 20, more preferably 2 to 10, and most preferably 2 to 5.
[0043] Furthermore, the xylose isomerase genes are not limited to the genes identified by SEQ ID NO: 5 and SEQ ID NO: 6. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 5 and encoding a protein having xylose isomerase activity. Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 mM and preferably 25 to 300 mM, and the temperature is 42 C. to 68 C. and preferably 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.
[0044] As described above, whether or not a gene comprising a nucleotide sequence that differs from the sequence as shown in SEQ ID NO: 5 or a gene encoding an amino acid sequence that differs from the sequence as shown in SEQ ID NO: 6 would function as a xylose isomerase gene may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an E. coli host using such expression vector, and assaying the xylose isomerase activity of the protein expressed. The term xylose isomerase activity refers to activity of isomerizing xylose into xylulose. Accordingly, xylose isomerase activity can be evaluated by preparing a xylose-containing solution as a substrate, allowing the target protein to react at an adequate temperature, and measuring the amount of xylose that has decreased and/or the amount of xylulose that has been generated.
[0045] It is particularly preferable to use, as a xylose isomerase gene, a gene comprising an amino acid sequence resulting from introduction of a particular mutation into a particular amino acid residue in the amino acid sequence as shown in SEQ ID NO: 6 and encoding mutant xylose isomerase with improved xylose isomerase activity. A specific example of a gene encoding mutant xylose isomerase is a gene encoding an amino acid sequence resulting from substitution of asparagine with cysteine at position 337 in the amino acid sequence as shown in SEQ ID NO: 6. Xylose isomerase activity of such mutant xylose isomerase is superior to that of wild-type xylose isomerase. In addition, mutant xylose isomerase is not limited to the xylose isomerase resulting from substitution of asparagine with cysteine at position 337. It may be xylose isomerase resulting from substitution of asparagine at position 337 with an amino acid other than cysteine, xylose isomerase resulting from substitution of asparagine at position 337 and another amino acid with other amino acids, or xylose isomerase resulting from substitution of an amino acid other than cysteine at position 337.
[0046] Meanwhile, examples of xylose metabolism-associated genes other than the xylose isomerase gene include a xylose reductase gene encoding a xylose reductase that converts xylose into xylitol, a xylitol dehydrogenase gene encoding a xylitol dehydrogenase that converts xylitol into xylulose, and a xylulokinase gene encoding a xylulokinase that phosphorylates xylulose to produce xylulose 5-phosphate. Xylulose 5-phosphate produced by a xylulokinase enters the pentose phosphate pathway, and it is then metabolized therein.
[0047] Examples of xylose metabolism-associated genes include, but are not particularly limited to, a xylose reductase gene and a xylitol dehydrogenase gene derived from Pichia stipitis and a xylulokinase gene derived from Saccharomyces cerevisiae (see Eliasson A. et al., Appl. Environ. Microbiol., 66: 3381-3386; and Toivari M. N. et al., Metab. Eng., 3: 236-249). In addition, xylose reductase genes derived from Candida tropicalis and Candida prapsilosis, xylitol dehydrogenase genes derived from Candida tropicalis and Candida prapsilosis, and a xylulokinase gene derived from Pichia stipitis can be used.
[0048] Examples of yeast strains that inherently have xylose-metabolizing ability include, but are not particularly limited to, Pichia stipitis, Candida tropicalis, and Candida prapsilosis.
[0049] An acetaldehyde dehydrogenase gene to be introduced into a yeast strain having xylose-metabolizing ability is not particularly limited, and a gene derived from any organism species may be used. When acetaldehyde dehydrogenase genes derived from organisms other than a fungus such as yeast (e.g., genes derived from bacteria, animals, plants, insects, or algae) are used, it is preferable that the nucleotide sequence of the gene be modified in accordance with the frequency of codon usage in a yeast strain into which the gene of interest is to be introduced.
[0050] More specifically, the mhpF gene of E. coli or the ALDH1 gene of Entamoeba histolytica as disclosed in Applied and Environmental Microbiology, May 2004, pp. 2892-2897, Vol. 70, No. 5 can be used as the acetaldehyde dehydrogenase genes. The nucleotide sequence of the mhpF gene of E. coli and the amino acid sequence of a protein encoded by the mhpF gene are shown in SEQ ID NOs: 7 and 8, respectively.
[0051] The acetaldehyde dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 7 and 8. It may be a paralogous gene or a homologous gene in the narrow sense having different nucleotide and amino acid sequences as long as it encodes an enzyme defined with EC No. 1.2.1.10. Examples of the acetaldehyde dehydrogenase genes include an adhE gene of E. coli, an acetaldehyde dehydrogenase gene derived from Clostridium beijerinckii, and an acetaldehyde dehydrogenase gene derived from Chlamydomonas reinhardtii. Here, the nucleotide sequence of the adhE gene of E. coli and the amino acid sequence of a protein encoded by the adhE gene are as shown in SEQ ID NOs: 9 and 10, respectively.
[0052] The acetaldehyde dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 7, 8, 9, and 10. For example, it may be a gene comprising an amino acid sequence having 70% or higher, preferably 80% or higher, more preferably 90% or higher, and most preferably 95% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 8 or 10 and encoding a protein having acetaldehyde dehydrogenase activity. The degree of sequence similarity or identity can be determined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.
[0053] Further, the acetaldehyde dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 7, 8, 9, and 10. For example, it may be a gene comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 8 or 10 by substitution, deletion, insertion, or addition of one or several amino acids and encoding a protein having acetaldehyde dehydrogenase activity. The term several used herein refers to, for example, 2 to 30, preferably 2 to 20, more preferably 2 to 10, and most preferably 2 to 5.
[0054] Furthermore, the acetaldehyde dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 7, 8, 9, and 10. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 7 or 9 and encoding a protein having acetaldehyde dehydrogenase activity. Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 mM and preferably 25 to 300 mM, and the temperature is 42 C. to 68 C. and preferably 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.
[0055] As described above, whether or not a gene comprising a nucleotide sequence that differs from the sequence as shown in SEQ ID NO: 7 or 9 or a gene encoding an amino acid sequence that differs from the sequence as shown in SEQ ID NO: 8 or 10 would function as the acetaldehyde dehydrogenase gene may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an E. coli host using such expression vector, and assaying the acetaldehyde dehydrogenase of the protein expressed. Acetaldehyde dehydrogenase activity can be assayed by preparing a solution containing acetaldehyde, CoA, and NAD.sup.+ as substrates, allowing the target protein to react at adequate temperature, and converting the generated acetyl phosphate into acetyl phosphate with the aid of a phosphate acetyl transferase or spectroscopically assaying the generated NADH.
[0056] The recombinant yeast strain of the present disclosure may further comprise other gene(s) introduced thereinto, and such other gene(s) are not particularly limited. For example, a gene involved in the sugar metabolism of glucose may be introduced into such recombinant yeast strain. For example, a recombinant yeast strain can have -glucosidase activity resulting from the introduction of the -glucosidase gene.
[0057] The term -glucosidase activity used herein refers to the activity of catalyzing a hydrolysis reaction of a -glycoside bond of a sugar. Specifically, -glucosidase is capable of degrading a cellooligosaccharide, such as cellobiose, into glucose. The -glucosidase gene can be introduced in the form of a cell-surface display gene. The term cell-surface display gene used herein refers to a gene that is modified to display a protein to be encoded by the gene on a cell surface. For example, a cell-surface display -glucosidase gene is a gene resulting from fusion of a 3-glucosidase gene with a cell-surface localized protein gene. A cell-surface localized protein is fixed and present on a yeast cell surface layer. Examples include agglutinative proteins, such as - or a-agglutinin and FLO proteins. In general, a cell-surface localized protein comprises an N-terminal secretory signal sequence and a C-terminal GPI anchor attachment recognition signal. While a cell-surface localized protein shares properties with a secretory protein in terms of the presence of a secretory signal, its secretory signal differs in that the cell-surface localized protein is transported while fixed to a cell membrane through a GPI anchor. When a cell-surface localized protein passes through a cell membrane, a GPI anchor attachment recognition signal sequence is selectively cut, it binds to a GPI anchor at a newly protruded C-terminal region, and it is then fixed to the cell membrane. Thereafter, the root of the GPI anchor is cut by phosphatidylinositol-dependent phospholipase C (PI-PLC). Subsequently, a protein separated from the cell membrane is integrated into a cell wall, fixed onto a cell surface layer, and then localized on a cell surface layer (see, for example, JP 2006-174767 A).
[0058] The -glucosidase gene is not particularly limited, and an example is a -glucosidase gene derived from Aspergillus aculeatus (Mural, et al., Appl. Environ. Microbiol., 64: 4857-4861). In addition, a -glucosidase gene derived from Aspergillus oryzae, a -glucosidase gene derived from Clostridium cellulovorans, and a -glucosidase gene derived from Saccharomycopsis fibligera can be used.
[0059] In addition to or other than the -glucosidase gene, a gene encoding another cellulase-constituting enzyme may have been introduced into a recombinant yeast strain used in the method for producing ethanol of the present disclosure. Examples of cellulase-constituting enzymes other than -glucosidase include exo-cellobiohydrolases that liberate cellobiose from the terminus of crystalline cellulose (CBH1 and CBH2) and endo-glucanase (EG) that cannot degrade crystalline cellulose but cleaves a non-crystalline cellulose (amorphous cellulose) chain at random.
[0060] Examples of other genes to be introduced into a recombinant yeast strain include an alcohol dehydrogenase gene (the ADH1 gene) having activity of converting acetaldehyde into ethanol, an acetyl-CoA synthetase gene (the ACS1 gene) having activity of converting acetic acid into acetyl-CoA, and genes having activity of converting acetaldehyde into acetic acid (i.e., the ALD4, ALD5, and ALD6 genes). The alcohol dehydrogenase gene (the ADH2 gene) having activity of converting ethanol into acetaldehyde may be disrupted.
[0061] In addition, it is preferable that a recombinant yeast strain used in the method for producing ethanol of the present disclosure allow high-level expression of the alcohol dehydrogenase gene (the ADH1 gene) having activity of converting acetaldehyde into ethanol. In order to realize high-level expression of such gene, for example, a promoter of the inherent gene may be replaced with a promoter intended for high-level expression, or an expression vector enabling expression of such gene may be introduced into a yeast strain.
[0062] The nucleotide sequence of the ADH1 gene of Saccharomyces cerevisiae and the amino acid sequence of a protein encoded by such gene are shown in SEQ ID NOs: 11 and 12, respectively. The alcohol dehydrogenase gene to be expressed at high level is not limited to the genes identified by SEQ ID NOs: 11 and 12. It may be a paralogous gene or a homologous gene in the narrow sense having different nucleotide and amino acid sequences.
[0063] The alcohol dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 11 and 12. For example, it may be a gene comprising an amino acid sequence having 70% or higher, preferably 80% or higher, more preferably 90% or higher, and most preferably 95% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 12 and encoding a protein having alcohol dehydrogenase activity. The degree of sequence similarity or identity can be determined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.
[0064] Further, the alcohol dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 11 and 12. For example, it may be a gene comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 12 by substitution, deletion, insertion, or addition of one or several amino acids and encoding a protein having alcohol dehydrogenase. The term several used herein refers to, for example, 2 to 30, preferably 2 to 20, more preferably 2 to 10, and most preferably 2 to 5.
[0065] Furthermore, the alcohol dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 11 and 12. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 11 and encoding a protein having alcohol dehydrogenase activity. Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 mM and preferably 25 to 300 mM, and the temperature is 42 C. to 68 C. and preferably 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.
[0066] As described above, whether or not a gene comprising a nucleotide sequence that differs from the sequence as shown in SEQ ID NO: 11 or a gene encoding an amino acid sequence that differs from the sequence as shown in SEQ ID NO: 12 would function as the alcohol dehydrogenase gene having activity of converting acetaldehyde into ethanol may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an yeast host using such expression vector, and assaying the alcohol dehydrogenase activity of the protein expressed. Alcohol dehydrogenase activity of converting acetaldehyde into ethanol can be assayed by preparing a solution containing aldehyde and NADH or NADPH as substrates, allowing the target protein to react at adequate temperature, and assaying the generated alcohol or spectroscopically assaying NAD.sup.+ or NADP.sup.+.
[0067] A recombinant yeast strain used in the method for producing ethanol of the present disclosure is preferably characterized by a lowered expression level of the alcohol dehydrogenase gene (the ADH2 gene) having activity of converting ethanol into aldehyde. In order to lower the expression level of such gene, a promoter of the inherent gene of interest may be modified, or such gene may be deleted. In order to delete the gene, either or both of a pair of ADH2 genes present in diploid recombinant yeast may be deleted. Examples of techniques for suppressing gene expression include the transposon technique, the transgene technique, post-transcriptional gene silencing, the RNAi technique, the nonsense mediated decay (NMD) technique, the ribozyme technique, the anti-sense technique, the miRNA (micro-RNA) technique, and the siRNA (small interfering RNA) technique.
[0068] The nucleotide sequence of the ADH2 gene of Saccharomyces cerevisiae and the amino acid sequence of a protein encoded by such gene are shown in SEQ ID NOs: 13 and 14, respectively. The target alcohol dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 13 and 14. It may be a paralogous gene or a homologous gene in the narrow sense having different nucleotide and amino acid sequences.
[0069] Also, the alcohol dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 13 and 14. For example, it may be a gene comprising an amino acid sequence having 70% or higher, preferably 80% or higher, more preferably 90% or higher, and most preferably 95% or higher sequence similarity to or identity with the amino acid sequence as shown in SEQ ID NO: 14 and encoding a protein having alcohol dehydrogenase activity. The degree of sequence similarity or identity can be determined using the BLASTN or BLASTX Program equipped with the BLAST algorithm (at default settings). The degree of sequence similarity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues and amino acid residues exhibiting physicochemically similar functions, determining the total number of such amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by the total number of such amino acid residues. The degree of sequence identity is determined by subjecting a pair of amino acid sequences to pairwise alignment analysis, identifying completely identical amino acid residues, and calculating the percentage of all the amino acid residues subjected to comparison accounted for by such amino acid residues.
[0070] Further, the alcohol dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 13 and 14. For example, it may be a gene comprising an amino acid sequence derived from the amino acid sequence as shown in SEQ ID NO: 14 by substitution, deletion, insertion, or addition of one or several amino acids and encoding a protein having alcohol dehydrogenase activity. The term several used herein refers to, for example, 2 to 30, preferably 2 to 20, more preferably 2 to 10, and most preferably 2 to 5.
[0071] Furthermore, the alcohol dehydrogenase genes are not limited to the genes identified by SEQ ID NOs: 13 and 14. For example, it may be a gene hybridizing under stringent conditions to the full-length sequence or a partial sequence of a complementary strand of DNA comprising the nucleotide sequence as shown in SEQ ID NO: 13 and encoding a protein having alcohol dehydrogenase activity. Under stringent conditions, so-called specific hybrids are formed, but non-specific hybrids are not formed. For example, such conditions can be adequately determined with reference to Molecular Cloning: A Laboratory Manual (Third Edition). Specifically, the degree of stringency can be determined in accordance with the temperature and the salt concentration of a solution used for Southern hybridization and the temperature and the salt concentration of a solution used for the step of washing in Southern hybridization. Under stringent conditions, more specifically, the sodium concentration is 25 to 500 mM and preferably 25 to 300 mM, and the temperature is 42 C. to 68 C. and preferably 42 C. to 65 C. Further specifically, the sodium concentration is 5SSC (83 mM NaCl, 83 mM sodium citrate), and the temperature is 42 C.
[0072] As described above, whether or not a gene comprising a nucleotide sequence that differs from the sequence as shown in SEQ ID NO: 13 or a gene encoding an amino acid sequence that differs from the sequence as shown in SEQ ID NO: 14 would function as the alcohol dehydrogenase gene having activity of converting ethanol into aldehyde may be determined by, for example, preparing an expression vector comprising the gene of interest incorporated into an adequate site between a promoter and a terminator, transforming an yeast host using such expression vector, and assaying the alcohol dehydrogenase activity of the protein expressed. Alcohol dehydrogenase activity of converting ethanol into aldehyde can be assayed by preparing a solution containing alcohol and NAD.sup.+ or NADP.sup.+ as substrates, allowing the target protein to react at adequate temperature, and assaying the generated aldehyde or spectroscopically assaying NADH or NADPH.
[0073] Further examples of other genes that can be introduced into a recombinant yeast strain include genes associated with the metabolic pathway of L-arabinose, which is a pentose contained in hemicellulose constituting a biomass. Examples of such genes include an L-arabinose isomerase gene, an L-ribulokinase gene, and an L-ribulose-5-phosphate-4-epimerase gene derived from prokaryotes and an L-arabitol-4-dehydrogenase gene and an L-xylose reductase gene derived from eukaryotes.
[0074] In particular, an example of another gene to be introduced into a recombinant yeast strain is a gene capable of promoting the use of xylose in a medium. A specific example thereof is a gene encoding xylulokinase having activity of generating xylulose-5-phosphate using xylulose as a substrate. The metabolic flux of the pentose phosphate pathway can be improved through the introduction of the xylulokinase gene.
[0075] Further, a gene encoding an enzyme selected from the group of enzymes constituting a non-oxidative process in the pentose phosphate pathway can be introduced into a recombinant yeast strain. Examples of enzymes constituting a non-oxidative process in the pentose phosphate pathway include ribose-5-phosphate isomerase, ribulose-5-phosphate-3-epimerase, transketolase, and transaldolase. It is preferable that one or more genes encoding such enzymes be introduced. It is more preferable that two or more such genes be introduced in combination, further preferable that three or more genes in combination be introduced, and the most preferable that all of the genes above be introduced.
[0076] More specifically, the xylulokinase (XK) gene of any origin can be used without particular limitation. A wide variety of microorganisms, such as bacterial and yeast strains, which assimilate xylulose, possess the XK gene. Information concerning XK genes can be obtained by searching the website of NCBI or other institutions, according to need. Preferable examples of such genes include the XK genes derived from yeast strains, lactic acid bacteria, E. coli bacteria, and plants. An example of an XK gene is XKS1, which is an XK gene derived from the S. cerevisiae S288C strain (GenBank: Z72979) (the nucleotide sequence and the amino acid sequence in the CDS coding region).
[0077] More specifically, a transaldolase (TAL) gene, a transketolase (TKL) gene, a ribulose-5-phosphate epimerase (RPE) gene, and a ribose-5-phosphate ketoisomerase (RKI) gene of any origin can be used without particular limitation. A wide variety of organisms comprising the pentose phosphate pathway possess such genes. For example, a common yeast strain such as S. cerevisiae possesses such genes. Information concerning such genes can be obtained from the website of NCBI or other institutions, according to need. Genes belonging to the same genus as the host eukaryotic cells, such as eukaryotic or yeast cells, are preferable, and genes originating from the same species as the host eukaryotic cells are more preferable. A TAL1 gene, a TKL1 gene and a TKL2 gene, an RPE1 gene, and an RKI gene can be preferably used as the TAL gene, the TKL genes, the RPE gene, and the RKI gene, respectively. Examples of such genes include a TAL1 gene derived from the S. cerevisiae S288 strain (GenBank: U19102), a TKL1 gene derived from the S. cerevisiae S288 strain (GenBank: X73224), an RPE1 gene derived from the S. cerevisiae S288 strain (GenBank: X83571), and an RKI1 gene derived from the S. cerevisiae S288 strain (GenBank: Z75003).
<Production of Recombinant Yeast Strain>
[0078] The recombinant yeast strain of the present disclosure can be produced by, for example, introducing the acetaldehyde dehydrogenase gene and the xylose metabolism-associated gene into a yeast strain having no xylose-metabolizing ability and modifying the yeast strain to lower the NADH dehydrogenase gene expression level in the yeast genome. Alternatively, the recombinant yeast strain of the present disclosure can be produced by, for example, introducing the acetaldehyde dehydrogenase gene into a yeast strain having xylose-metabolizing ability and disrupting the NADH dehydrogenase gene in the yeast genome. When producing the recombinant yeast strain of the present disclosure, other genes described above may be introduced into a yeast strain, or the recombinant yeast strain may be modified to lower the expression level of the alcohol dehydrogenase gene (the ADH2 gene) having activity of converting ethanol into aldehyde.
[0079] In order to lower the expression level of, for example, the NADH dehydrogenase gene, a promoter of the inherent gene of interest may be modified, or such gene may be deleted. In order to delete the gene, either or both of a pair of genes present in diploid recombinant yeast may be deleted. Examples of techniques for suppressing gene expression include the transposon technique, the transgene technique, post-transcriptional gene silencing, the RNAi technique, the nonsense mediated decay (NMD) technique, the ribozyme technique, the anti-sense technique, the miRNA (micro-RNA) technique, and the siRNA (small interfering RNA) technique.
[0080] When the xylose metabolism-associated gene, the acetaldehyde dehydrogenase gene, and other genes described above are introduced into a yeast strain, such genes may be simultaneously introduced thereinto, or such genes may be successively introduced with the use of different expression vectors.
[0081] Examples of host yeast strains that can be used include, but are not particularly limited to, Candida Shehatae, Pichia stipitis, Pachysolen tannophilus, Saccharomyces cerevisiae, and Schizosaccaromyces pombe, with Saccharomyces cerevisiae being particularly preferable. Experimental yeast strains may also be used from the viewpoint of experimental convenience, or industrial (practical) strains may also be used from the viewpoint of practical usefulness. Examples of industrial strains include yeast strains used for the production of wine, sake, and shochu.
[0082] Use of a host yeast strain having homothallic properties is preferable. According to the technique disclosed in JP 2009-34036 A, multiple copies of genes can be easily introduced into a genome with the use of a yeast strain having homothallic properties. The term yeast strain having homothallic properties has the same meaning as the term homothallic yeast strain. Yeast strains having homothallic properties are not particularly limited, and any yeast strains can be used. An example of a yeast strain having homothallic properties is, but is not limited to, the Saccharomyces cerevisiae OC-2 train (NBRC2260). Examples of other yeast strains having homothallic properties include an alcohol-producing yeast (Taiken No. 396, NBRCO216) (reference: Alcohol kobo no shotokusei (Various properties of alcohol-producing yeast), Shuken Kaiho, No. 37, pp. 18-22, 1998.8), an ethanol-producing yeast isolated in Brazil and in Japan (reference: Brazil to Okinawa de bunri shita Saccharomyces cerevisiae yaseikabu no idengakuteki seishitsu (Genetic properties of wild-type Saccharomyces cerevisiae isolated in Brazil and in Okinawa), the Journal of the Japan Society for Bioscience, Biotechnology, and Agrochemistry, Vol. 65, No. 4, pp. 759-762, 1991.4), and 180 (reference: Alcohol Hakkoryoku no tsuyoi kobo no screening (Screening of yeast having potent alcohol-fermenting ability), the Journal of the Brewing Society of Japan, Vol. 82, No. 6, pp. 439-443, 1987.6). In addition, the HO gene may be introduced into a yeast strain exhibiting heterothallic phenotypes in an expressible manner, and the resulting strain can be used as a yeast strain having homothallic properties. That is, the term yeast strain having homothallic properties used herein also refers to a yeast strain into which the HO gene has been introduced in an expressible manner.
[0083] The Saccharomyces cerevisiae OC-2 strain is particularly preferable since it has heretofore been used for wine brewing, and the safety thereof has been verified. As described in the examples below, the Saccharomyces cerevisiae OC-2 strain is preferable in terms of its excellent promoter activity at high sugar concentrations. In particular, the Saccharomyces cerevisiae OC-2 strain is preferable in terms of its excellent promoter activity for the pyruvate decarboxylase gene (PDC1) at high sugar concentrations.
[0084] Promoters of genes to be introduced are not particularly limited. For example, promoters of the glyceraldehyde-3-phosphate dehydrogenase gene (TDH3), the 3-phosphoglycerate kinase gene (PGK1), and the high-osmotic pressure response 7 gene (HOR7) can be used. The promoter of the pyruvate decarboxylase gene (PDC1) is particularly preferable in terms of its high capacity for expressing target genes in a downstream region at high levels.
[0085] Specifically, such gene may be introduced into the yeast genome together with an expression-regulating promoter or another expression-regulated region. Such gene may be introduced into a host yeast genome in such a manner that expression thereof is regulated by a promoter or another expression-regulated region of a gene that is inherently present therein.
[0086] The gene can be introduced into the genome by any conventional technique known as a yeast transformation technique. Specific examples include, but are not limited to, electroporation (Meth. Enzym., 194, p. 182, 1990), the spheroplast technique (Proc. Natl. Acad. Sci., U.S.A., 75, p. 1929, 1978), and the lithium acetate method (J. Bacteriology, 153, p. 163, 1983; Proc. Natl. Acad. Sci., U.S.A., 75, p. 1929, 1978; Methods in yeast genetics, 2000 Edition: A Cold Spring Harbor Laboratory Course Manual).
<Production of Ethanol>
[0087] When producing ethanol with the use of the recombinant yeast strain described above, ethanol fermentation is carried out by culture in a medium containing at least xylose. Specifically, a medium in which ethanol fermentation is carried out contains at least xylose as a carbon source. The medium may contain another carbon source, such as glucose, in advance.
[0088] Xylose that is contained in a medium to be used for ethanol fermentation can be derived from a biomass. In other words, a medium to be used for ethanol fermentation may comprise a cellulosic biomass and hemicellulase that generates xylose through saccharification of hemicellulose contained in a cellulosic biomass. The cellulosic biomass may have been subjected to a conventional pretreatment technique. Examples of pretreatment techniques include, but are not particularly limited to, degradation of a lignin with a microorganism and grinding of a cellulosic biomass. For example, a ground cellulosic biomass may be subjected to pretreatment, such as soaking thereof in a dilute sulfuric acid solution, alkaline solution, or ionic solution, hydrothermal treatment, or fine grinding. Thus, the efficiency of biomass saccharification can be improved.
[0089] When producing ethanol with the use of the recombinant yeast strain described above, the medium may further comprise cellulose and cellulase. In such a case, the medium would contain glucose generated by the action of cellulase upon cellulose. When a medium used for ethanol fermentation contains cellulose, such cellulose can be derived from a biomass. In other words, a medium used for ethanol fermentation may comprise cellulase that is capable of saccharifying cellulase contained in a cellulosic biomass.
[0090] A saccharified solution resulting from saccharification of a cellulosic biomass may be added to the medium used for ethanol fermentation. In such a case, the saccharified solution contains remaining cellulose or cellulase and xylose derived from hemicellulose contained in a cellulosic biomass.
[0091] As described above, the method for producing ethanol of the present disclosure comprises a step of ethanol fermentation involving the use of at least xylose as a saccharide source. According to the method for producing ethanol of the present disclosure, ethanol can be produced through ethanol fermentation using xylose as a saccharide source. According to the method for producing ethanol with the use of the recombinant yeast strain of the present disclosure, ethanol fermentation is followed by recovery of ethanol from the medium. Ethanol may be recovered by any conventional means without particular limitation. After the completion of the process of ethanol fermentation mentioned above, for example, a liquid layer containing ethanol is separated from a solid layer containing the recombinant yeast strain or solid matter via solid-solution separation. Thereafter, ethanol contained in a liquid layer is separated and purified by distillation, so that highly purified ethanol can be recovered. The degree of ethanol purification can be adequately determined in accordance with the purpose of use of the ethanol.
[0092] When producing ethanol with the use of a saccharide derived from a biomass, in general, a fermentation inhibitor, such as acetic acid or furfural, may occasionally be generated in the process of pretreatment or saccharification. In particular, acetic acid is known to inhibit the growth and multiplication of yeast strains and to lower the efficiency for ethanol fermentation conducted with the use of xylose as a saccharide source.
[0093] The recombinant yeast strain of the present disclosure, however, is modified to show a lowered expression level of the NADH dehydrogenase gene as described above. It is thus considered that NADH is accumulated in cells. NADH accumulated in cells is used for a reaction for metabolizing and degrading acetic acid by acetaldehyde dehydrogenase. Thus, the recombinant yeast strain of the present disclosure can maintain the acetic acid concentration in a medium at a low level. Accordingly, the method for producing ethanol of the present disclosure can achieve an ethanol yield superior to that achieved with the use of a recombinant yeast strain in which the NADH dehydrogenase gene has not been suppressed.
[0094] According to the method for producing ethanol of the present disclosure, acetic acid concentration in a medium remains low after the recombinant yeast strain has been cultured for a given period of time. Even if part of the medium after such given period of time is used for a continuous culture system in which a new culture process is initiated, accordingly, the amount of acetic acid carry-over can be reduced. According to the method for producing ethanol of the present disclosure, therefore, the amount of acetic acid carry-over can be reduced even when cells are recovered and reused after the completion of the process of ethanol fermentation.
[0095] The method for producing ethanol of the present disclosure may employ the so-called simultaneous saccharification and fermentation process, in which the step of saccharification of cellulose contained in a medium with a cellulase proceeds simultaneously with the process of ethanol fermentation carried out with the use of saccharide sources (i.e., xylose and glucose generated by saccharification). With the simultaneous saccharification and fermentation process, the step of saccharification of a cellulosic biomass is carried out simultaneously with the process of ethanol fermentation.
[0096] Methods of saccharification are not particularly limited, and, for example, an enzymatic method involving the use of a cellulase preparation, such as cellulase or hemicellulase, may be employed. A cellulase preparation contains a plurality of enzymes involved in degradation of a cellulose chain and a hemicellulose chain, and it exhibits a plurality of types of activity, such as endoglucanase activity, endoxylanase activity, cellobiohydrolase activity, glucosidase activity, and xylosidase activity. Cellulase preparations are not particularly limited, and examples include cellulases produced by Trichoderma reesei and Acremonium cellulolyticus. Commercially available cellulase preparations may also be used.
[0097] In the simultaneous saccharification and fermentation process, a cellulase preparation and the recombinant microorganism are added to a medium containing a cellulosic biomass (a biomass after pretreatment may be used), and the recombinant yeast strain is cultured at a given temperature. Culture may be carried out at any temperature without particular limitation, and the temperature may be 25 C. to 45 C., and preferably 30 C. to 40 C. from the viewpoint of ethanol fermentation efficiency. The pH level of the culture solution is preferably 4 to 6. When conducting culture, stirring or shaking may be carried out. Alternatively, the simultaneous saccharification and fermentation process may be carried out irregularly in such a manner that saccharification is first carried out at an optimal temperature for an enzyme (40 C. to 70 C.), temperature is lowered to a given level (30 C. to 40 C.), and a yeast strain is then added thereto.
EXAMPLES
[0098] Hereafter, the present disclosure is described in greater detail with reference to the examples, although the technical scope of the present disclosure is not limited to these examples.
Example 1
[0099] In the present example, a recombinant yeast strain was prepared through introduction of a xylose isomerase gene and an acetaldehyde dehydrogenase gene of E. coli and disruption of the NADH dehydrogenase gene, and the acetic acid metabolizing ability of the recombinant yeast strain was evaluated.
<Production of Vectors for Gene Introduction>
(1) Plasmid for XI, XKS1, TKL1, TAL1, RKI1, and RPE1 Gene Introduction and for GRE3 Gene Disruption
[0100] A plasmid (pUC-5U_GRE3-P_HOR7-TKL1-TAL1-FBA1_P-P_ADH1-RPE1-RKI1-TEF1_P-P_TDH1-XI_N337C-T_DIT1-P_TDH3-XKS1-T_HIS3-LoxP-G418-LoxP-3U_GRE3) was prepared. This plasmid comprises, at the GRE3 gene locus, a sequence necessary for disruption of the GRE3 gene and introduction of the following genes into yeast: a mutant gene with an improved xylose assimilation speed resulting from substitution of asparagine with threonine at amino acid 377 of the xylose isomerase gene derived from the intestinal protozoa of Reticulitermes speratus (see XI_N377C; WO 2014/156194), a yeast-derived xylulokinase (XKS1) gene, the transketolasel (TKL1) gene of the pentose phosphate pathway, the transaldolasel (TAL1) gene, the ribulose-phosphate-epimerase 1 (RPE1) gene, and the ribose-phosphate ketoisomerase (RKI1) gene.
[0101] This plasmid was constructed to comprise: the TKL1 gene derived from the Saccharomyces cerevisiae BY4742 strain in which an HOR7 promoter is added on the 5 side; the TAL1 gene in which an FBA1 promoter is added; the RKI1 gene in which an ADH1 promoter is added; the RPE1 gene in which a TEF1 promoter is added; XI_N337C in which a TDH1 promoter and a DIT1 terminator are added (prepared through the total synthesis on the basis of a sequence designed by changing codons over the entire region in accordance with the frequency of codon usage of the yeast strain); the XKS1 gene in which a TDH3 promoter and an HIS3 terminator are added; a gene sequence (5U_GRE3) of an upstream region of approximately 700 bp from the 5 terminus of the GRE3 gene and a DNA sequence (3U_GRE3) of a downstream region of approximately 800 bp from the 3 terminus of the GRE3 gene, which are regions to be integrated into the yeast genome via homologous recombination; and a gene sequence (a G418 marker) comprising the G418 gene, which is a marker. The LoxP sequences were introduced on the both sides of the marker gene, so that the marker can be removed.
[0102] In addition, each DNA sequence can be amplified via PCR using the primers listed in Table 1 below. In order to ligate DNA fragments, a desired plasmid to be obtained as a final product was prepared in the following manner. A DNA sequence was added to each primer, so that the DNA sequence would overlap with its adjacent DNA sequence by approximately 15 bp. The primers were used to amplify desired DNA fragments using, as templates, Saccharomyces cerevisiae BY4742 genome, DNA of the XI_N337C-synthesizing gene, and synthetic DNA of the LoxP sequence. The DNA fragments were sequentially ligated using an In-Fusion HD Cloning Kit (Takara Bio Inc.) or the like, followed by cloning into the pUC19 plasmid.
TABLE-US-00001 TABLE1 AmplifiedDNA SEQID fragment Primersequence(5-3) No: 5U_GRE3 TGGGAATATTACCGCTCGAAG 17 CTTTAAAAAATTTCCAATTTTCCTTTACG 18 HOR7promoter GGAAATTTTTTAAAGTCGCAGCCACGGGTCAAC 19 GTGAATTGAGTCATTTTTTATTATTAGTCTTTTTTTTTTTTGACAATATC 20 TKL1 ATGACTCAATTCACTGACATTGATAAGCTAG 21 (terminatorregion CCTTAAATCAACGTCATATTCTTTATTGGCTTTATAC 22 included) TAL1 GACGTTGATTTAAGGTGGTTCCGG 23 (terminatorregion ATGTCTGAACCAGCTCAAAAGAAAC 24 included) FBA1promoter AGCTGGTTCAGACATTTTGAATATGTATTACTTGGTTATGGTTATATATGAC 25 ACTGGTAGAGAGCGACTTTGTATGC 26 ADH1promoter CAAAGTCGCTCTCTACCAGTCGCTTTCAATTCATTTGGGTG 27 TGTATATGAGATAGTTGATTGTATGC 28 RPE1 ACTATCTCATATACAATGGTCAAACCAATTATAGCTCCC 29 (terminatorregion AAATGGATATTGATCTAGATGGCGG 30 included) RKI1 GATCAATATCCATTTCTTGGTGTGTCATCGGTAGTAACGCC 31 (terminatorregion AGTTTTAATTACAAAATGGCTGCCGGTGTCCCAAA 32 included) TEF1promoter TTGTAATTAAAACTTAGATTAGATTGCTATGCTTTC 33 AGGAACAGCCGTCAAGGG 34 TDH1promoter TTGACGGCTGTTCCTCTTCCCTTTTACAGTGCTTC 35 TTTGTTTTGTGTGTAAATTTAGTGAAGTACTG 36 XI_N337C TACACACAAAACAAAATGTCTCAAATTTTTAAGGATATCCC 37 AGCGCTCTTACTTTAGCGATCGCACTAGTTTATTGAAAC 38 DIT1terminator TAAAGTAAGAGCGCTACATTGGTCTACC 39 TAACATTCAACGCTATTACTCCGCAACGCTTTTCTG 40 TDH3promoter TAGCGTTGAATGTTAGCGTCAACAAC 41 TTTGTTTGTTTATGTGTGTTTATTCGAAACTAAGTTCTTGG 42 XKS1 ACATAAACAAACAAAATGTTGTGTTCAGTAATTCAGAGACAG 43 AAATAATCGGTGTCATTAGATGAGAGTCTTTTCCAGTTC 44 HIS3terminator TGACACCGATTATTTAAAGCTGCAG 45 AGAGCGCGCCTCGTTCAG 46 LoxP AACGAGGCGCGCTCTAATTCCGCTGTATAGCTC 47 (linkersequence ATAATGTATGCTATACGAAGTTATAGGGAAAGATATGAGCTATAC 48 included) CYC1promoter TATAGCATACATTATACGAAGTTATACGACATCGTCGAATATG 49 TATTAATTTAGTGTGTGTATTTGTGTTTGTGTG 50 G418 CACACTAAATTAATAATGAGCCATATTCAACGGG 51 TTTAGTAGACATGCATTACAACCAATTAACCAATTCTG 52 URA3terminator TGCATGTCTACTAAACTCACAAATTAGAGCTTCAATT 53 ATAATGTATGCTATACGAAGTTATGGGTAATAACTGATATAATTAAATTGAAGC 54 LoxP TATAGCATACATTATACGAAGTTATTGACACCGATTATTTAAAGCTG 55 (linkersequence ATTTTACTGGCTGGAGTATGCTGCAGCTTTAAATAATCG 56 included) 3U_GRE3 TCCAGCCAGTAAAATCCATACTCAAC 57 GTCTTTTTGCCAGCCAGTCC 58 pUC19 CACACCTTCCCCCTTGATCCTCTAGAGTCGACC 59 GCGGTAATATTCCCAGATCCCCGGGTACCGAGCTC 60
(2) Plasmid for mhpF and ADH1 Gene Introduction and ADH2 Gene Disruption
[0103] A plasmid (pUC-5U_ADH2-P_TDH3-ADH1-T_ADH1-DIT1_T-mhpF-HOR7_P-URA3-3U_ADH2) was prepared. This plasmid comprises, at the ADH2 gene locus, a sequence necessary for disruption of the ADH2 gene and for introduction of the acetaldehyde dehydrogenase gene (mhpF) derived from E. coli and the alcohol dehydrogenase 1 (ADH1) gene derived from yeast into yeast.
[0104] This plasmid was constructed to comprise: the ADH1 gene derived from the Saccharomyces cerevisiae BY4742 strain in which a TDH3 promoter is added on the 5 side; the mhpF gene in which an HOR7 promoter and a DIT1 terminator are added (NCBI Accession Number 945008, prepared through the total synthesis on the basis of a sequence designed by changing codons over the entire region in accordance with the frequency of codon usage of the yeast strain); a gene sequence (5U_ADH2) comprising an upstream region of approximately 700 bp from the 5 terminus of the ADH2 gene and a DNA sequence (3U_ADH2) comprising a downstream region of approximately 800 bp from the 3 terminus of the ADH2 gene, which are regions to be integrated into the yeast genome via homologous recombination; and a gene sequence (a URA3 marker) comprising the URA3 gene, which is a marker.
[0105] In addition, each DNA sequence can be amplified via PCR using the primers listed in Table 2 below. In order to ligate DNA fragments, a desired plasmid to be obtained as a final product was prepared in the following manner. A DNA sequence was added to each primer, so that the DNA sequence would overlap with its adjacent DNA sequence by approximately 15 bp. The primers were used to amplify desired DNA fragments using, as a template, Saccharomyces cerevisiae BY4742 genome or DNA of the mhpF-synthesizing gene. The DNA fragments were sequentially ligated using an In-Fusion HD Cloning Kit or the like, followed by cloning into the pUC19 plasmid.
TABLE-US-00002 TABLE2 Amplified SEQID DNAfragment Primersequence(5-3) No: 5U_ADH2 CGGTACCCGGGGATCCTATGGGACTTCCGGGAA 61 TAACATTCAACGCTATGTGTATTACGATATAGTTAATAGTTGATAG 62 TDH3promoter TAGCGTTGAATGTTAGCGTCAACAAC 63 TTTGTTTGTTTATGTGTGTTTATTCGAAACTAAGTTCTTGG 64 ADH1 ACATAAACAAACAAAATGTCTATCCCAGAAACTCAAAAAG 65 (terminatorregion TTGTCCTCTGAGGACATAAAATACACACCG 66 included) DIT1terminator GTCCTCAGAGGACAATTACTCCGCAACGCTTTTC 67 GGAGAGGCCGCATAATAAAGTAAGAGCGCTACATTGG 68 mhpF TTATGCGGCCTCTCCTGC 69 AGACTAATAATAAAAATGTCAAAGAGAAAAGTTGCTATTATCG 70 HOR7promoter TTTTTATTATTAGTCTTTTTTTTTTTTGACAATATCTGTATGATTTG 71 GGAGATTACCGAATCTCGCTCGCAGCCACGGGT 72 URA3 GATTCGGTAATCTCCGAGCAG 73 (promoterand ACATAAGAGATCCGCGGGTAATAACTGATATAATTAAATTG 74 terminatorregions included) 3U_ADH2 GCGGATCTCTTATGTCTTTACGATTTATAGTTTTC 75 GAGGGTTGGGCATTCATCAG 76 pUC19 AATGCCCAACCCTCGATCCTCTAGAGTCGACC 77 GATCCCCGGGTACCGAGC 78
(3) Plasmid for adhE and ADH1 Gene Introduction and ADH2 Gene Disruption
[0106] A plasmid (pUC-5U_ADH2-P_TDH3-ADH1-T_ADH1-DIT1 T-adhE-HOR7_P-URA3-3U_ADH2) was prepared. This plasmid comprises, at the ADH2 gene locus, a sequence necessary for disruption of the ADH2 gene and for introduction of the E. coli-derived acetaldehyde dehydrogenase gene (adhE) and the yeast-derived alcohol dehydrogenase 1 (ADH1) gene into yeast.
[0107] This plasmid was constructed to comprise: the ADH1 gene derived from the Saccharomyces cerevisiae BY4742 strain in which a TDH3 promoter is added on the 5 side; the adhE gene in which an HOR7 promoter and a DIT1 terminator are added (NCBI Accession Number 945837, prepared through the total synthesis on the basis of a sequence designed by changing codons over the entire region in accordance with the frequency of codon usage of the yeast strain), a gene sequence (5U_ADH2) comprising an upstream region of approximately 700 bp from the 5 terminus of the ADH2 gene and a DNA sequence (3U_ADH2) comprising a downstream region of approximately 800 bp from the 3 terminus of the ADH2 gene, which are regions to be integrated into the yeast genome via homologous recombination; and a gene sequence (a URA3 marker) comprising the URA3 gene, which is a marker.
[0108] In addition, each DNA sequence can be amplified via PCR using the primers listed in Table 3 below. In order to ligate DNA fragments, a desired plasmid to be obtained as a final product was prepared in the following manner. A DNA sequence was added to each primer, so that the DNA sequence would overlap with its adjacent DNA sequence by approximately 15 bp. The primers were used to amplify desired DNA fragments using, as a template, the pUC-5U_ADH2-P_TDH3-ADH1-T_ADH1-DIT1_T-mhpF-HOR7_P-URA3-3U_ADH2 plasmid or DNA of the adhE-synthesizing gene. The DNA fragments were sequentially ligated using an In-Fusion HD Cloning Kit or the like, followed by cloning into the pUC19 plasmid.
TABLE-US-00003 TABLE3 Amplified SEQID DNAfragment Primersequence(5-3) No: Sequenceother TTTTATTATTAGTCTTTTTTTTTTTTGACAATATCTG 79 thanadhE TAAAGTAAGAGCGCTACATTGGTCTACC 80 adhE AGCGCTCTTACTTTATTAAGCTGATTTCTTTGCTTTCTTC 81 AGACTAATAATAAAAATGGCAGTTACGAACGTTGCAG 82
(4) Plasmid for NDE1 Gene Disruption
[0109] A plasmid (PUC19-5U_NDE1-RPL41B_T-eutE-TDH3_P-LoxP66-P_CYC1-HPH-T_URA3-CYC1_T-Crei-GAL1_P-LoxP71-3U_NDE1) was prepared. This plasmid comprises a sequence necessary for disruption of the NDE1 gene. This plasmid was constructed to comprise: a DNA sequence (5U_NDE1) comprising an upstream region of approximately 800 bp of the NDE1 gene, a DNA sequence (3U_NDE1) comprising a downstream region of approximately 1050 bp of the NDE1 gene, and the eutE gene in which a TDH3 promoter and a RPL41B terminator are added (NCBI Accession Number 946943, prepared through the total synthesis on the basis of a sequence designed by changing codons over the entire region in accordance with the frequency of codon usage of the yeast strain), which are regions to be integrated into the yeast genome via homologous recombination and for disruption of the NDE1 gene, and, as a marker, a gene sequence (an HPH marker) comprising a hygrocymin-resistant gene.
[0110] In addition, each DNA sequence can be amplified via PCR using the primers listed in Table 4 below. In order to ligate DNA fragments, a desired plasmid to be obtained as a final product was prepared in the following manner. A DNA sequence was added to each primer, so that the DNA sequence would overlap with its adjacent DNA sequence by approximately 15 bp. The primers were used to amplify desired DNA fragments using, as a template, genome DNA of the yeast OC2 strain or a plasmid containing a hygromycin-resistant gene. The DNA fragments were sequentially ligated using an In-Fusion HD Cloning Kit or the like, followed by cloning into the pUC19 plasmid.
[0111] The eutE gene encodes an aldehyde oxidoreductase derived from E. coli. SEQ ID NO: 15 and SEQ ID NO: 16 show the nucleotide sequence of the coding region of the eutE gene and the amino acid sequence of the aldehyde oxidoreductase encoded by the eutE gene, respectively.
TABLE-US-00004 TABLE4 AmplifiedDNA SEQID fragment Primersequence(5-3) No: 5U_NDE1 CGGTACCCGGGGATCATTTTGATGCTGATGTTGATGTATAGTAAAC 83 AAGATATGAGCTATACAGCGGAATTCAATCGACACACTTATAGTTCTAGCCCC 84 RPL41B AGAGGCATAGCGGCAAACTAAG 85 GCGGATTGAGAGCAAATCGTTAAGT 86 eutE TTGCTCTCAATCCGCCTAAACAATTCTGAATGCATCGAC 87 ACATAAACAAACAAAATGAACCAACAAGACATAGAACAAG 88 TDH3P TTTGTTTGTTTATGTGTGTTTATTCGAAACTAAGTTCTTGGTGTTTTAAAACTAA 89 TAGCGTTGAATGTTAGCGTCAACAAC 90 Hygromycin AATTCCGCTGTATAGCTCATATCTTTC 91 resistancemarker GTATGCTGCAGCTTTAAATAATCGG 92 3U_NDE1 AAAGCTGCAGCATACGCAGAGGCCTTGTCCCTTTTTTATG 93 CGACTCTAGAGGATCCAGTCGAGGCATGAAGTGGAAG 94 pUC19 GATCCTCTAGAGTCGACCTGCAGGC 95 GATCCCCGGGTACCGAGC 96
(5) Fragment for URA3 Gene Introduction
[0112] A wild-type URA3 gene fragment used for reversion of a non-functioning URA3 gene at the URA3 gene locus back to the wild-type gene via homologous recombination was amplified from the OC2 strain. This DNA fragment can be amplified via PCR using the primers listed in Table 5 below.
TABLE-US-00005 TABLE5 AmplifiedDNA SEQID fragment Primersequence(5-3) No: AGGCTACTGCGCCAATTGAT 97 TGCCCTACACGTTCGCTATG 98
(6) Plasmid for Cre Gene Expression
[0113] The pYES-Cre plasmid to allow expression of multiple copies of the Cre gene was prepared. This plasmid was constructed by introducing the Cre gene (NCBI Accession Number NP_415757.1, prepared through the total synthesis on the basis of a sequence designed by changing codons over the entire region in accordance with the frequency of codon usage of the yeast strain) fused to the GAL1 promoter, which is induced by galactose, into pYES6/CT (Life Technologies).
[0114] Each DNA sequence necessary for plasmid construction can be amplified using the primers listed in Table 6 below. In order to ligate DNA fragments, a desired plasmid to be obtained as a final product was prepared in the following manner. A DNA sequence was added to each primer, so that the DNA sequence would overlap with its adjacent DNA sequence by approximately 15 bp. The primers were used to amplify desired DNA fragments using, as a template, the YES6/CT plasmid or DNA of the Cre-synthesizing gene. The DNA fragments were ligated using an In-Fusion HD Cloning Kit or the like.
TABLE-US-00006 TABLE6 AmplifiedDNA SEQID fragment Primersequence(5-3) No: pYES6/CT GGTTTTTTCTCCTTGACGTTAAAGTATAG 99 TTAGTTATGTCACGCTTACATTCACG 100 Cre ATGTCTAACTTGTTGACTGTTC 101 TCAATCACCATCTTCCAACAATC 102
<Production of Yeast Strains Comprising Vectors Introduced Thereinto>
[0115] The diploid yeast strains, Saccharomyces cerevisiae OC2-T (NBRC2260), were selected in a 5-fluoroorotic acid-supplemented medium (Boeke, J. D., et al., 1987, Methods Enzymol., 154: 164-75), and uracil auxotrophic strains (OC2U) were designated as host strains. Yeast strains were transformed using the Frozen-EZ Yeast Transformation II (ZYMO RESEARCH) in accordance with the protocols included therein.
[0116] A homologous recombination region of the plasmid prepared in (1) above (pUC-5U_GRE3-P_HOR7-TKL1-TAL1-FBA1_P-P_ADH1-RPE1-RKI1-TEF1_P-P_TDH1-XI_N337C-T_DIT1-P_TDH3-XKS1-T_HIS3-LoxP-G418-LoxP-3U_GRE3) was amplified via PCR, the OC2U strains were transformed using the resulting fragment, the resulting transformants were applied to a G418-containing YPD agar medium, and the grown colonies were then subjected to acclimatization. The acclimatized elite strain was designated as the Uz1252 strain. This strain was applied to a sporulation medium (1% potassium phosphate, 0.1% yeast extract, 0.05% glucose, and 2% agar) for sporulation, and a diploid of the strain was formed by utilizing homothallism. The strain in which the mutant XI, TKL1, TAL1, RPE1, RKI1, and XKS1 genes had been incorporated into the GRE3 gene locus of a diploid chromosome and the GRE3 gene had been disrupted was obtained. The resulting strain was designated as the Uz1252 strain. The plasmid for Cre gene expression was introduced into the Uz1252 strain, the G418 marker gene flanked by the LoxP sequences was removed via Cre/LoxP site-directed recombination, a strain from which the Cre plasmid had been removed was selected in the end, and the elite strain was designated as the Uz1252m strain.
[0117] Subsequently, fragments amplified via PCR from the homologous recombination regions of the plasmid prepared in (2) above (pUC-5U_ADH2-P_TDH3-ADH1-T_ADH1-DIT1_T-mhpF-HOR7_P-URA3-3U_ADH2) and the plasmid prepared in (3) above (pUC-5U_ADH2-P_TDH3-ADH1-T_ADH1-DIT1_T-adhE-HOR7_P-URA3-3U_ADH2) and a fragment for URA3 gene introduction directly amplified from the genome of the OC2 strain were used to transform the Uz1252m strain, the resulting strains were applied to a uracil-free SD agar medium or G418-containing YPD agar medium, and the grown colonies were subjected to acclimatization. The acclimatized elite strains were designated as the Uz1298 strain and the Uz1317 strain.
[0118] Heterozygous recombination (1 copy) was observed in the above strains. Sporulation was induced in a sporulation medium for the Uz1298 strain and the Uz1317 strain. The strains obtained through diploid formation by utilizing homothallism were designated as the Uz1319 strain and the Uz1318 strain, respectively.
[0119] Subsequently, a fragment amplified via PCR from the homologous recombination region of the plasmid prepared in (4) above (UC19-5U_NDE1-RPL41B_T-eutE-TDH3_P-LoxP66-P_CYC1-HPH-T_URA3-CYC1_T-Crei-GAL1_P-LoxP71-3U_NDE1) was used to transform the Uz1252m strain, the Uz1318 strain, and the Uz1319 strain, the resulting strains were applied to a hygromycin-containing YPD agar medium, and the grown colonies were subjected to acclimatization. The acclimatized elite strains were designated as the Uz2452 strain, the Uz2454 strain, and the Uz2456 strain, respectively. Sporulation was induced in a sporulation medium for the Uz2452, Uz2454, and Uz2456 strains, respectively. The strains obtained through diploid formation by utilizing homothallism were designated as the Uz2452dS strain, the Uz2454dS strain, and the Uz2456dS strain, respectively.
[0120] The genotypes of the strains produced in the examples are summarized in Table 7.
TABLE-US-00007 TABLE 7 Strain Genotype Uz1252m gre3:: XI_N337C XKS1 TKL1 TAL1 RKI1 RPE1 Uz1319 adh2:: mhpF ADH1 gre3:: XI_N337C XKS1 TKL1 TAL1 RKI1 RPE1 Uz1318 adh2:: adhE ADH1 gre3:: XI_N337C XKS1 TKL1 TAL1 RKI1 RPE1 Uz2452 nde1::NDE1/eutE gre3:: XI_N337C XKS1 TKL1 TAL1 RKI1 RPE1 Uz2454 nde1::NDE1/eutE adh2:: adhE ADH1 gre3:: XI_N337C XKS1 TKL1 TAL1 RKI1 RPE1 Uz2456 nde1::NDE1/eutE adh2:: mhpF ADH1 gre3:: XI_N337C XKS1 TKL1 TAL1 RKI1 RPE1 Uz2452dS nde1::eutE gre3:: XI_N337C XKS1 TKL1 TAL1 RKI1 RPE1 Uz2454dS nde1::eutE adh2:: adhE ADH1 gre3:: XI_N337C XKS1 TKL1 TAL1 RKI1 RPE1 Uz2456dS nde1::eutE adh2:: mhpF ADH1 gre3:: XI_N337C XKS1 TKL1 TAL1 RKI1 RPE1
<Fermentation Test>
[0121] From among the strains obtained in the manner described above, strains exhibiting high fermentation ability were selected and subjected to a fermentation test in flasks in the manner described below. The test strains were inoculated into 100-ml baffled flasks each comprising 20 ml of YPD liquid medium (yeast extract concentration: 10 g/1; peptone concentration: 20 g/1; and glucose concentration: 20 g/l), and culture was conducted at 30 C. and 120 rpm for 24 hours. The strains were harvested and inoculated into 10-ml flasks each comprising 8 ml of a medium for ethanol production (glucose concentration: 46 g/1; xylose concentration: 40 g/1; yeast extract concentration: 10 g/1; peptone concentration: 20 g/1; and acetic acid concentration: 3.0 g/l) (concentration: 0.3 g dry cells/1), and the fermentation test was carried out via agitation culture (80 rpm; an amplitude: 35 mm; 30 C.) while adjusting a temperature at 31 C. or 34 C. A rubber stopper into which a needle (i.d.: 1.5 mm) has been inserted was used to cap each flask, and a check valve was mounted on the tip of the needle to maintain the anaerobic conditions in the flask.
[0122] Ethanol and acetic acid in the fermentation liquor were assayed via HPLC (LC-10A; Shimadzu Corporation) under the conditions described below.
Column: Aminex HPX-87H
[0123] Mobile phase: 0.01N H.sub.2SO.sub.4
Flow rate: 0.6 ml/min
Temperature: 30 C.
[0124] Detection apparatus: Differential refractometer (RID-10A)
<Results of Fermentation Test>
[0125] The results of fermentation test are shown in Table 8 and
TABLE-US-00008 TABLE 8 Acetic acid Ethanol concentration concentration (g/l) (g/l) Uz1252m control 2.24 34.36 Uz2452 NDE1/nde1 1.36 33.11 eutE Uz2452dS nde1 eutE 0 32.2 Uz2454 adh2:: adhE 2.16 34.2 ADH1 NDE1/nde1 eutE Uz2454dS adh2::adhE 0.02 34.5 ADH1 nde1 eutE Uz2456 adh2::mhpF 2.04 34.3 ADH1 NDE1/nde1 eutE Uz2456dS adh2::mhpF 0.03 34.6 ADH1 nde1 eutE
[0126] As shown in Table 8 and
[0127] When the strains in which the NDE1 genes had been homozygously disrupted (i.e., Uz2452dS, Uz2454dS, and Uz2456dS strains) were used, acetic acid contained in the medium was almost completely metabolized. This demonstrates that a lowered expression level of the NADH dehydrogenase gene leads to an improved acetic acid metabolizing ability.