Microorganism for methionine production with improved methionine synthase activity and methionine efflux
10196658 ยท 2019-02-05
Assignee
Inventors
- Wanda Dischert (Vic-le-Comte, FR)
- Perrine Vasseur (Martres-sur-Morges, FR)
- Rainer Figge (Le crest, FR)
Cpc classification
C12N15/70
CHEMISTRY; METALLURGY
C07K14/24
CHEMISTRY; METALLURGY
International classification
C12N15/70
CHEMISTRY; METALLURGY
C07K14/24
CHEMISTRY; METALLURGY
Abstract
The present application is related to a recombinant microorganism optimized for the fermentative production of methionine and/or its derivatives, wherein in said recombinant microorganism, the cobalamin-dependent methionine synthase activity and the methionine efflux are enhanced. The application is also related to a method for optimizing the fermentative production of methionine and/or its derivatives comprising the steps of: c. culturing a recombinant microorganism wherein in said microorganism, the cobalamin-dependent methionine synthase activity and the methionine efflux are enhanced, in an appropriate culture medium comprising a fermentable source of carbon and a source of sulphur, and d. recovering methionine and/or its derivatives from the culture medium.
Claims
1. A recombinant microorganism genetically modified to improve the production of methionine in comparison with an endogenous production of methionine in the corresponding wild-type microorganism, wherein said recombinant microorganism is recombinant E. coli and wherein in said recombinant microorganism, the expression of the E. coli metH, E. coli fldA and E. coli fpr genes is enhanced compared to the expression of said genes in the corresponding unmodified microorganism and the E. coli ygaZH genes, Citrobacter species ygaZH genes, Shigella species ygaZH genes, Raoultella species ygaZH genes, Enterobacter species ygaZH genes, Yersinia species ygaZH genes, or Photorhabdus species ygaZH genes are overexpressed compared to the expression of said genes in the corresponding unmodified microorganism, and wherein the enhanced expression and the overexpression are achieved by: i) increasing the number of copies of the gene in the microorganism and/or ii) using a promoter leading to a high level of expression of the gene.
2. The recombinant microorganism of claim 1, wherein said E. coli metH, fldA and fpr genes are overexpressed chromosomally compared to the expression of said genes in the corresponding unmodified microorganism.
3. The recombinant microorganism of claim 1, wherein said Citrobacter species ygaZH genes, Shigella species ygaZH genes, Raoultella species ygaZH genes, Enterobacter species ygaZH genes, Yersinia species ygaZH genes, or Photorhabdus species ygaZH genes are Citrobacter koseri ygaZH genes, Shigella flexneri ygaZH genes, Raoultella ornithinolytica ygaZH genes, Enterobacter sp. ygaZH genes, Yersinia enterocolitica ygaZH genes, Photorhabdus luminescens ygaZH genes, Citrobacter youngae ygaZH genes, or Citrobacter freundii ygaZH genes.
4. The recombinant microorganism of claim 1, wherein said E. coli ygaZH genes, Citrobacter species ygaZH genes, Shigella species ygaZH genes, Raoultella species ygaZH genes, Enterobacter species ygaZH genes, Yersinia species ygaZH genes, or Photorhabdus species ygaZH genes are expressed under control of an inducible promoter.
5. The recombinant microorganism of claim 1, wherein the expression of at least one E. coli gene is also increased compared to the expression of said genes in the corresponding unmodified microorganism, wherein said at least one E. coli gene is selected from the group consisting of ptsG, pyc, pntAB, cysP, cysU, cysW, cysA, cysM, cysJ, cysI, cysH, gcvT, gcvH, gcvP, lpd, serA, serB, serC, cysE, metF, metA, metA* allele encoding for an enzyme with reduced feed-back sensitivity to S-adenosylmethionine and/or methionine, thrA, and a thrA* allele encoding for an enzyme with reduced feed-back inhibition to threonine, wherein said increased expression are achieved by: i) increasing the number of copies of said genes and/or ii) using a promoter leading to a high level of expression of said genes.
6. The recombinant microorganism of claim 5, wherein at least one of said E. coli genes is under the control of an inducible promoter.
7. The recombinant microorganism of claim 1, wherein the expression of at least one E. coli gene is also attenuated, wherein said at least one E. coli gene is selected from the group consisting of metJ, pykA, pykF, purU, ybdL, yncA, metE, dgsA, metN, metI, metQ and udhA, compared to the expression of said genes in the corresponding unmodified microorganism, wherein said attenuation is achieved by mutations, deletions, and/or insertions in the promoter or coding regions of said genes.
8. The recombinant microorganism of claim 3, wherein: a. the expression of the E. coli metA*, cysPUWAM, cysJIH, gcvTHP, metF, serA, serB, serC, cysE, thrA*, ptsG and pyc genes is enhanced compared to the expression of said genes in the corresponding unmodified microorganism, b. the expression of the E. coli metJ, pykA, pykF, purU, dgsA, metE and yncA genes is attenuated compared to the expression of said genes in the corresponding unmodified microorganism, c. said E. coli metH, fldA and fpr genes are overexpressed compared to the expression of said genes in the corresponding unmodified microorganism, and d. said E. coli ygaZ and ygaH genes, Citrobacter koseri ygaZ and ygaH genes, Shigella flexneri ygaZ and ygaH genes, Raoultella ornithinolytica ygaZ and ygaH genes, Enterobacter sp. ygaZ and ygaH genes, Yersinia enterocolitica ygaZ and ygaH genes, Photorhabdus luminescens ygaZ and ygaH genes, Citrobacter youngae ygaZ and ygaH genes, or Citrobacter freundii ygaZ and ygaH genes are overexpressed compared to the expression of said genes in the corresponding unmodified microorganism, wherein the enhanced expression and the overexpression are achieved by: i) increasing the number of copies of the gene in the microorganism and/or ii) using a promoter leading to a high level of expression of the gene; and wherein said attenuation is achieved by mutations, deletions, and/or insertions in the promoter or coding regions of said genes.
9. A method for the fermentative production of methionine comprising: a. culturing the recombinant microorganism as defined in claim 1 in an appropriate culture medium comprising a fermentable source of carbon and a source of sulphur, and b. recovering methionine from the culture medium.
Description
DETAILED DESCRIPTION OF THE INVENTION
(1) Before describing the present invention in detail, it is to be understood that this invention is not limited to particularly exemplified methods and may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting, which will be limited only by the appended claims.
(2) All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.
(3) Furthermore, the practice of the present invention employs, unless otherwise indicated, conventional microbiological and molecular biological techniques within the skill of the art. Such techniques are well known to the skilled worker, and are explained fully in the literature.
(4) It must be noted that as used herein and in the appended claims, the singular forms a, an, and the include plural reference unless the context clearly dictates otherwise. Thus, for example, a reference to a microorganism includes a plurality of such microorganisms, and a reference to an endogenous gene is a reference to one or more endogenous genes, and so forth. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any materials and methods similar or equivalent to those described herein can be used to practice or test the present invention, the preferred materials and methods are now described.
(5) In the claims that follow and in the consecutive description of the invention, except where the context requires otherwise due to express language or necessary implication, the word comprise, contain, involve or include or variations such as comprises, comprising, containing, involved, includes, including are used in an inclusive sense, i.e. to specify the presence of the stated features but not to preclude the presence or addition of further features in various embodiments of the invention.
(6) The term methionine and L-methionine designate the essential sulphur-containing amino-acid with chemical formula HO.sub.2CCH(NH.sub.2)CH.sub.2CH.sub.2SCH.sub.3 and CAS number 59-51-8 or 63-68-3 for the specific L-isomer.
(7) Derivatives of methionine refers to molecules analogs to methionine which present the same chemical backbone but differ from methionine with at least one chemical group. In this invention, preferred methionine derivatives are N-acetyl methionine (NAM), S-adenosyl methionine (SAM) and hydroxy-methionine (or methionine hydroxy analogue or MHA).
(8) The term microorganism, as used herein, refers to a bacterium, yeast or fungus which is not modified artificially. Preferentially, the microorganism is selected among Enterobacteriaceae, Bacillaceae, Streptomycetaceae and Corynebacteriaceae. More preferentially the microorganism is a species of Escherichia, Klebsiella, Pantoea, Salmonella, or Corynebacterium. Even more preferentially the microorganism of the invention is either the species Escherichia coli or Corynebacterium glutamicum.
(9) The term recombinant microorganism or genetically modified microorganism, as used herein, refers to a bacterium, yeast or fungus that is not found in nature and is genetically different from its equivalent found in nature. It means, it is modified either by introduction or by deletion or by modification of genetic elements. It can also be transformed by forcing the development and evolution of new metabolic pathways by combining directed mutagenesis and evolution under specific selection pressure (see, for example, WO2004/076659 or WO2007/011939).
(10) A microorganism may be modified to express exogenous genes if these genes are introduced into the microorganism with all the elements allowing their expression in the host microorganism. The modification or transformation of microorganisms with exogenous DNA is a routine task for those skilled in the art.
(11) A microorganism may be modified to modulate the expression level of an endogenous gene.
(12) The term endogenous gene means that the gene was present in the microorganism before any genetic modification. Endogenous genes may be overexpressed by introducing heterologous sequences in addition to, or to replace endogenous regulatory elements, or by introducing one or more supplementary copies of the gene into the chromosome or a plasmid. Endogenous genes may also be modified to modulate their expression and/or activity. For example, mutations may be introduced into the coding sequence to modify the gene product or heterologous sequences may be introduced in addition to or to replace endogenous regulatory elements. Modulation of an endogenous gene may result in the up-regulation and/or enhancement of the activity of the gene product, or alternatively, down regulate and/or lower the activity of the endogenous gene product.
(13) Another way to modulate their expression is to exchange the endogenous promoter of a gene (e.g., wild type promoter) with a stronger or weaker promoter to up or down regulate expression of the endogenous gene. These promoters may be homologous or heterologous. It is well within the ability of the person skilled in the art to select appropriate promoters.
(14) Contrariwise, exogenous gene means that the gene was introduced into a microorganism, by means well known by the man skilled in the art whereas this gene is not naturally occurring in the microorganism. Exogenous genes may be integrated into the host chromosome, or be expressed extra-chromosomally by plasmids or vectors. A variety of plasmids, which differ with respect to their origin of replication and their copy number in the cell, are well known in the art. These genes may be homologous.
(15) In the context of the invention, the term homologous gene is not limited to designate genes having a theoretical common genetic ancestor, but includes genes which may be genetically unrelated that have, none the less, evolved to encode protein which perform similar functions and/or have similar structure. Therefore the term functional homolog for the purpose of the present invention relates to the fact that a certain enzymatic activity may not only be provided by a specific protein of defined amino acid sequence, but also by proteins of similar sequence from other (un)related microorganisms.
(16) Using the references given in Genbank for known genes, those skilled in the art are able to determine the equivalent genes in other organisms, bacterial strains, yeast, fungi, mammals, plants, etc. This routine work is advantageously done using consensus sequences that can be determined by carrying out sequence alignments with genes derived from other microorganisms and designing degenerate probes to clone the corresponding gene in another organism. These routine methods of molecular biology are well known to those skilled in the art.
(17) The terms improved methionine production, improve methionine production and grammatical equivalents thereof, as used herein, refer to an increased methionine/carbon source yield (ratio of gram/mol methionine produced per gram/mol carbon source consumed that it can be expressed in percent) and/or an improved purity of produced methionine. In this invention, the purity of the produced methionine may be increased by decreasing the production of ketomethylvalerate and/or homolanthionine. Methods for determining the amount of carbon source consumed and of methionine produced are well known to those in the art. The yield and/or the purity of produced methionine are higher in the recombinant microorganism compared to the corresponding unmodified microorganism.
(18) The terms microorganism optimised for the fermentative production of methionine refers to microorganisms evolved and/or genetically modified to present an improved methionine production in comparison with the endogenous production of the corresponding wild-type microorganisms. Such microorganisms optimised for methionine production are well known in the art, and have been disclosed in particular in patent applications WO2005/111202, WO2007/077041, WO2009/043803 and WO2012/098042.
(19) According to the invention the terms fermentative production, culture or fermentation are used to denote the growth of bacteria. This growth is generally conducted in fermenters with an appropriate culture medium adapted to the microorganism being used and containing at least one simple carbon source, and if necessary co-substrates.
(20) An appropriate culture medium designates a medium (e.g., a sterile, liquid media) comprising nutrients essential or beneficial to the maintenance and/or growth of the cell such as carbon sources or carbon substrates, nitrogen sources, for example, peptone, yeast extracts, meat extracts, malt extracts, urea, ammonium sulfate, ammonium chloride, ammonium nitrate and ammonium phosphate; phosphorus sources, for example, monopotassium phosphate or dipotassium phosphate; trace elements (e.g., metal salts), for example magnesium salts, cobalt salts and/or manganese salts; as well as growth factors such as amino acids and vitamins.
(21) The term carbon source or carbon substrate or source of carbon according to the present invention denotes any source of carbon that can be used by those skilled in the art to support the normal growth of a microorganism, including monosaccharides (such as glucose, galactose, xylose, fructose or lactose), oligosaccharides, disaccharides (such as sucrose, cellobiose or maltose), molasses, starch or its derivatives, hemicelluloses and combinations thereof. An especially preferred simple carbon source is glucose. Another preferred simple carbon source is sucrose. The carbon source can be derived from renewable feed-stock. Renewable feed-stock is defined as raw material required for certain industrial processes that can be regenerated within a brief delay and in sufficient amount to permit its transformation into the desired product. Vegetal biomass treated or not, is an interesting renewable carbon source.
(22) The term source of sulphur according to the invention refers to sulphate, thiosulfate, hydrogen sulphide, dithionate, dithionite, sulphite, methylmercaptan, dimethylsulfide and other methyl capped sulphides or a combination of the different sources. More preferentially, the sulphur source in the culture medium is sulphate or thiosulfate or a mixture thereof.
(23) The terms source of nitrogen corresponds to either an ammonium salt or ammoniac gas. The nitrogen source is supplied in the form of ammonium or ammoniac.
(24) The terms attenuation or expression attenuated mean in this context that the expression of a gene or the production of an enzyme is decreased or suppressed compared to the non modified microorganism leading to a decrease in the intracellular concentration of a ribonucleic acid, a protein or an enzyme compared to the non modified microorganism. The man skilled in the art knows different means and methods to measure ribonucleic acid concentration or protein concentration in the cell including for instance use of Reverse Transcription Polymerase Chain Reaction (RT-PCR) and Real-time Polymerase Chain Reaction (qPCR) to determine ribonucleic acid concentration and use of specific antibody to determine concentration of specific protein.
(25) Decrease or suppression of the production of an enzyme is obtained by the attenuation of the expression of gene encoding said enzyme.
(26) Attenuation of genes may be achieved by means and methods known to the man skilled in the art. Generally, attenuation of gene expression may be achieved by: Mutating the coding region or the promoter region or, Deleting of all or a part of the promoter region necessary for the gene expression or, Deleting of all or a part of the coding region of the gene by homologous recombination or, Inserting an external element into coding region or into promoter region or, Expressing the gene under control of a weak promoter or an inducible promoter.
(27) The man skilled in the art knows a variety of promoters which exhibit different strength and which promoter to use for a weak or an inducible genetic expression.
(28) The term activity of an enzyme is used interchangeably with the term function and designates, in the context of the invention, the reaction that is catalyzed by the enzyme. The man skilled in the art knows how to measure the enzymatic activity of said enzyme.
(29) The terms attenuated activity or reduced activity of an enzyme mean either a reduced specific catalytic activity of the protein obtained by mutation in the aminoacids sequence and/or decreased concentrations of the protein in the cell obtained by mutation of the nucleotidic sequence or by deletion of the coding region of the gene.
(30) The terms enhanced activity or increased activity of an enzyme designate either an increased specific catalytic activity of the enzyme, and/or an increased quantity/availability of the enzyme in the cell, obtained for example by overexpressing the gene encoding the enzyme.
(31) The terms increased expression, enhanced expression or overexpression and grammatical equivalents thereof, are used interchangeably in the text and have a similar meaning. These terms mean that the expression of a gene or the production of an enzyme is increased compared to the non modified microorganism leading to an increase in the intracellular concentration of a ribonucleic acid, a protein or an enzyme compared to the non modified microorganism. The man skilled in the art knows different means and methods to measure ribonucleic acid concentration or protein concentration in the cell including for instance use of Reverse Transcription Polymerase Chain Reaction (RT-PCR) and Real-time Polymerase Chain Reaction (qPCR) to determine ribonucleic acid concentration and use of specific antibody to determine concentration of specific protein.
(32) Increase production of an enzyme is obtained by increasing expression of the gene encoding said enzyme.
(33) To increase the expression of a gene, the man skilled in the art knows different techniques such as: Increasing the number of copies of the gene in the microorganism. The gene is encoded chromosomally or extrachromosomally. When the gene is located on the chromosome, several copies of the gene can be introduced on the chromosome by methods of recombination, known by the expert in the field (including gene replacement). When the gene is located extra-chromosomally, it may be carried by different types of plasmids that differ with respect to their origin of replication and thus their copy number in the cell. These plasmids are present in the microorganism in 1 to 5 copies, or about 20 copies, or up to 500 copies, depending on the nature of the plasmid: low copy number plasmids with tight replication (e.g for E. coli pSC101, RK2), low copy number plasmids (e.g for E. coli pACYC, pRSF1010) or high copy number plasmids (e.g for E. coli pSK bluescript II). Using a promoter leading to a high level of expression of the gene. The man skilled in the art knows which promoters are the most convenient, for example promoters Ptrc, Ptac, Plac, or the lambda promoter a are widely used. These promoters can be inducible by a particular compound or by specific external condition like temperature or light. These promoters may be homologous or heterologous. Attenuating the activity or the expression of a transcription repressor, specific or non-specific of the gene. Using elements stabilizing the corresponding messenger RNA (Carrier and Keasling, 1999) or elements stabilizing the protein (e.g., GST tags, GE Healthcare).
(34) The terms encoding or coding refer to the process by which a polynucleotide, through the mechanisms of transcription and translation, produces an amino-acid sequence. The gene(s) encoding the enzyme(s) can be exogenous or endogenous.
(35) The terms feed-back sensitivity or feed-back inhibition refer to a cellular mechanism control in which an or several enzymes that catalyse the production of a particular substance in the cell are inhibited or less active when that substance has accumulated to a certain level. So the terms reduced feed-back sensitivity or reduced feed-back inhibition mean that the activity of such a mechanism is decreased or suppressed compared to a non modified microorganism. The man skilled in the art knows how to modify the enzyme to obtain this result. Such modifications have been described in the patent application WO2005/111202 or in the U.S. Pat. No. 7,611,873.
(36) In a first aspect of the invention, a recombinant microorganism is optimised for the fermentative production of methionine and/or its derivatives by enhancing the cobalamin-dependent methionine synthase activity and by enhancing the methionine efflux in said microorganism. Preferably, the recombinant microorganism is chosen among Enterobacteriaceae or Corynebacteriaceae. More preferably, the recombinant microorganism of the invention is chosen among Escherichia coli or Corynebacterium glutamicum.
(37) As described above, cobalamin-dependent methionine synthase activity is mediated by MetH enzyme. This enzyme needs a reactivation system for having a sustained activity. This system is encoded by two genes, fldA and fpr in E. coli and by respectively gene chosen among fdxC, fdxD or fdxA and among fprA1, fprA2, fprA3 or fldR1 in C. glutamicum. In this application, the terms MetH and its reactivation system or metH, fldA, fpr relate to the cobalamin-dependent methionine synthase and its reactivation system both in E. coli and in C. glutamicum or their encoding genes both from E. coli and from C. glutamicum. Thus, enhancement of cobalamin-dependent methionine synthase activity is preferably carried out by overexpression of metH gene and also of its reactivation system encoded by fldA and fpr genes.
(38) In one embodiment of the invention, the cobalamin-dependent methionine synthase activity is enhanced by overexpressing (enhancing their expression) genes metH, fldA, fpr from E. coli or their homologous genes from C. glutamicum. Preferably, these genes are overexpressed under a promoter different from their wild-type promoter.
(39) More preferably, the genes metH, fldA or fpr or their homologous genes from C. glutamicum are overexpressed chromosomally, i.e. these genes are overexpressed from the chromosome. One or several supplementary copies of each gene are introduced on the chromosome of the microorganism. They are integrated at different loci selected from the list disclosed in the patent application WO2011/073122, and whose deletions do not have impact on methionine production. The wild-type copy of the coding sequence of each gene is conserved, but their promoter region may be replaced by artificial promoter and/or Ribosome Binding Site (RBS).
(40) In a specific embodiment of the invention: wild-type metH gene is conserved with replacement of its natural promoter and RBS, and two additional copies are introduced on the chromosome, and wild-type fldA and fpr genes and their promoter regions are conserved, and one additional copy of each gene is introduced on the chromosome.
(41) Additional copies of the introduced genes are expressed under control of artificial promoter and RBS.
(42) In amino-acid producer microorganisms, methionine is excreted by a specific efflux transporter. Notably, in E. coli, this transporter is called YgaZH and is encoded by the ygaZ and ygaH genes whereas in C. glutamicum, it is named BrnFE and is encoded by the brnF and brnE genes. Functional homologues of this methionine efflux system have been identified in several other microorganisms. In the invention, recombinant microorganism overexpresses ygaZH genes from E. coli or brnFE genes from C. glutamicum. Alternatively, the recombinant microorganism of the invention may overexpress functional homologues of YgaZH or of BrnFE transporters. YgaZ and YgaH homologous protein are presented respectively in Table 1 and Table 2.
(43) TABLE-US-00001 TABLE 1 YgaZ homologous proteins Acession Number Name Organism YP_001455539.1 hypothetical protein CKO_04031 [Citrobacter koseri Citrobacter koseri NC_009792.1. ATCC BAA-895] ABV15103.1 WP_005122932.1 membrane protein [Shigella flexneri] Shigella flexneri EIQ78635.1 YP_007877063.1 hypothetical protein RORB6_24155 [Raoultella Raoultella ornithinolytica AGJ89511.1 ornithinolytica B6] WP_015585890.1 YP_008107733.1 membrane protein [Enterobacter sp. R4-368] Enterobacter sp. AGN85393.1 WP_020454909.1 WP_004959353.1 membrane protein [Serratia odorifera] Serratia odorifera EFE95945.1 YP_003884334.1 amino acid transporter [Dickeya dadantii 3937] Dickeya dadantii ADM99777.1 Erwinia chrysanthemi (strain 3937) YP_006647984.1 amino acid transporter Pectobacterium AFR04731.1 [Pectobacterium carotovorum subsp. carotovorum carotovorum subsp. PCC21] Carotovorum YP_001007412.1 putative amino acid transporter Yersinia enterocolitica CAL13268.1 [Yersinia enterocolitica subsp. enterocolitica 8081] subsp. Enterocolitica NP_928590.1 hypothetical protein plu1279 Photorhabdus luminescens CAE13573.1 [Photorhabdus luminescens subsp. laumondii subsp. Laumondii TTO1] WP_004847360.1 membrane protein [Hafnia alvei] Hafnia alvei EHM42581.1 WP_016157304.1 inner membrane protein YgaZ [Citrobacter sp. Citrobacter sp. KTE32 EOQ28426.1 KTE32] WP_006687199.1 membrane protein [Citrobacter youngae] Citrobacter youngae EFE06904.1 putative azaleucine resistance protein AzlC [Citrobacter youngae ATCC 29220] YP_005198838.1 putative branched-chain amino acid permease Rahnella aquatilis AEX50698.1 (azaleucine resistance) [Rahnella aquatilis CIP 78.65 = ATCC 33071] WP_009111644.1 membrane protein [Brenneria sp. EniD312] Brenneria sp. EHD20336.1. YP_003469114.1 amino acid transporter [Xenorhabdus bovienii SS- Xenorhabdus bovienii CBJ82350.1 2004] WP_000841919.1 membrane protein [Shigella flexneri] Shigella flexneri WP_000445647.1 membrane protein [Shigella dysenteriae] Shigella dysenteriae WP_000445645.1 membrane protein [Shigella flexneri] Shigella flexneri EFP71467.1 azlC family protein [Shigella dysenteriae 1617] Shigella dysenteriae WP_005063865.1 membrane protein [Shigella flexneri] Shigella flexneri WP_001428008.1 membrane protein [Shigella dysenteriae] Shigella dysenteriae WP_005031133.1 membrane protein [Shigella dysenteriae] Shigella dysenteriae WP_004993748.1 membrane protein [Shigella boydii] Shigella boydii WP_005099151.1 membrane protein [Shigella flexneri] Shigella flexneri NP_708495.1 hypothetical protein SF2709 [Shigella flexneri 2a Shigella flexneri str. 301] YP_409184.1. hypothetical protein SBO_2835 [Shigella boydii Shigella boydii NC_007613.1. Sb227] ABB67356 WP_005119769.1 branched-chain amino acid permease [Shigella Shigella flexneri flexneri] WP_003825971.1 membrane protein [Citrobacter sp. 30_2] Citrobacter sp. WP_016154156.1 inner membrane protein YgaZ [Citrobacter sp. Citrobacter sp. KTE151] WP_003839672.1 hypothetical protein [Citrobacter freundii] Citrobacter freundii WP_016150871.1 inner membrane protein YgaZ [Citrobacter sp. Citrobacter sp. KTE30] WP_019077531.1 membrane protein [Citrobacter freundii] Citrobacter freundii WP_003037292.1 membrane protein [Citrobacter sp. L17] Citrobacter sp. WP_009652545.1 membrane protein [Klebsiella sp. OBRC7] Klebsiella sp. WP_004853460.1 membrane protein [Klebsiella oxytoca] Klebsiella oxytoca YP_005016079.1 AzlC family protein [Klebsiella oxytoca KCTC 1686] Klebsiella oxytoca WP_004866792.1 membrane protein [Klebsiella oxytoca] Klebsiella oxytoca WP_017459327.1 membrane protein [Enterobacter cloacae] Enterobacter cloacae WP_004205700.1 AzlC family protein [Klebsiella pneumoniae] Klebsiella pneumoniae CDA02044.1 azlC family protein [Klebsiella variicola CAG:634] Klebsiella variicola WP_004123979.1 membrane protein [Klebsiella oxytoca] Klebsiella oxytoca WP_004132932.1 azlC family protein [Klebsiella oxytoca] Klebsiella oxytoca WP_017900616.1 membrane protein [Klebsiella pneumoniae] Klebsiella pneumoniae YP_002236980.1 AzlC family protein [Klebsiella pneumoniae 342] Klebsiella pneumoniae YP_005228384.1 putative amino acid transport protein Klebsiella pneumoniae [Klebsiella pneumoniae subsp. pneumoniae subsp. Pneumoniae HS11286] YP_001336647.1 putative amino acid transport protein Klebsiella pneumoniae [Klebsiella pneumoniae subsp. pneumoniae MGH subsp. Pneumoniae 78578] WP_016947585.1 membrane protein [Klebsiella pneumoniae] Klebsiella pneumoniae YP_005956056.1 putative amino acid transport protein [Klebsiella Klebsiella pneumoniae pneumoniae KCTC 2242] WP_020803754.1 inner membrane protein YgaZ [Klebsiella Klebsiella pneumoniae pneumoniae] WP_016161678.1 inner membrane protein YgaZ [Klebsiella sp. Klebsiella sp. KTE92] WP_004174723.1 membrane protein [Klebsiella pneumoniae] Klebsiella pneumoniae WP_004114705.1 membrane protein [Klebsiella oxytoca] Klebsiella oxytoca YP_007990259.1 ygaZ [Klebsiella pneumoniae] Klebsiella pneumoniae WP_004104780.1 membrane protein [Klebsiella oxytoca] Klebsiella oxytoca WP_007370573.1 membrane protein [Kosakonia radicincitans] Kosakonia radicincitans WP_007370573.1 membrane protein [Kosakonia radicincitans] Kosakonia radicincitans NP_668256.1 hypothetical protein y0925 [Yersinia pestis KIM10+] Yersinia pestis WP_005119769.1 branched-chain amino acid permease [Shigella Shigella flexneri flexneri] YP_069400.1 LIV-E family branched chain amino acid exporter Yersinia large subunit pseudotuberculosis [Yersinia pseudotuberculosis IP 32953] WP_017893772.1 membrane protein [Serratia sp. S4] Serratia sp. YP_001479963.1 AzlC family protein [Serratia proteamaculans 568] Serratia proteamaculans WP_005189088.1 membrane protein [Yersinia intermedia] Yersinia intermedia YP_004297214.1 putative amino acid transporter Yersinia enterocolitica [Yersinia enterocolitica subsp. palearctica subsp. Palearctica 105.5R(r)] WP_019081387.1 membrane protein [Yersinia enterocolitica] Yersinia enterocolitica WP_004392936.1 membrane protein [Yersinia kristensenii] Yersinia kristensenii WP_016929851.1 membrane protein [Serratia marcescens] Serratia marcescens WP_019845222.1 membrane protein [Dickeya zeae] Dickeya zeae YP_003334823.1 AzlC family protein [Dickeya dadantii Ech586] Dickeya dadantii YP_003042011.1 conserved hypothetical protein [Photorhabdus Photorhabdus asymbiotica asymbiotica] WP_016941678.1 membrane protein [Dickeya zeae] Dickeya zeae WP_005274999.1 membrane protein [Yersinia bercovieri] Yersinia bercovieri CAC44347.1 YgaZ protein [Erwinia chrysanthemi] Erwinia chrysanthemi WP_004704053.1 membrane protein [Yersinia aldovae] Yersinia aldovae YP_003003219.1 AzlC family protein [Dickeya zeae Ech1591] Dickeya zeae WP_004707388.1 membrane protein [Yersinia frederiksenii] Yersinia frederiksenii WP_008812528.1 membrane protein [Enterobacteriaceae bacterium Enterobacteriaceae 9_2_54FAA] bacterium YP_008231812.1 membrane protein [Serratia liquefaciens ATCC Serratia liquefaciens 27592] YP_051597.1 amino acid transporter [Pectobacterium Pectobacterium atrosepticum SCRI1043] atrosepticum WP_019455591.1 membrane protein [Serratia marcescens] Serratia marcescens YP_007407667.1 putative amino acid transporter YgaZ [Serratia Serratia marcescens AGE19648.1 marcescens WW4] NC_020211.1. WP_004716726.1 membrane protein [Yersinia rohdei] Yersinia rohdei YP_003018879.1 AzlC family protein [Pectobacterium carotovorum Pectobacterium subsp. carotovorum PC1] carotovorum subsp. Carotovorum WP_004873538.1 membrane protein [Yersinia mollaretii] Yersinia mollaretii WP_005975645.1 membrane protein [Pectobacterium wasabiae] Pectobacterium wasabiae YP_003260827.1 AzlC family protein [Pectobacterium wasabiae Pectobacterium wasabiae WPP163] YP_002986523.1 AzlC family protein [Dickeya dadantii Ech703] Dickeya dadantii YP_007345875.1 putative branched-chain amino acid permease Serratia marcescens AGB83690.1 (azaleucine resistance) [Serratia marcescens FGI94] YP_004211503.1 AzlC family protein [Rahnella sp. Y9602] Rahnella sp. YP_005400523.1 AzlC family protein [Rahnella aquatilis HX2] Rahnella aquatilis WP_010305354.1 membrane protein [Pectobacterium carotovorum] Pectobacterium carotovorum WP_010848732.1 conserved hypothetical protein [Xenorhabdus Xenorhabdus nematophila nematophila] YP_003711585.1 hypothetical protein XNC1_1315 [Xenorhabdus Xenorhabdus nematophila CBJ89380.1 nematophila ATCC 19061] YP_006500218.1 hypothetical protein A225_4537 [Klebsiella oxytoca Klebsiella oxytoca AFN33798.1 E718] EHT06520.1 inner membrane protein YgaZ [Klebsiella oxytoca Klebsiella oxytoca 10-5246] EKP29343.1 AzlC family protein [Klebsiella oxytoca M5aI] Klebsiella oxytoca EJK15416.1 putative amino acid transport protein Klebsiella pneumoniae [Klebsiella pneumoniae subsp. pneumoniae subsp. Pneumoniae KPNIH18] YP_006500218.1 hypothetical protein A225_4537 [Klebsiella oxytoca Klebsiella oxytoca E718] YP_002920871.1 putative amino acid transport protein Klebsiella pneumoniae [Klebsiella pneumoniae subsp. pneumoniae NTUH- subsp. Pneumoniae K2044] YP_003437997.1 AzlC family protein [Klebsiella variicola At-22] Klebsiella variicola YP_003260827.1 AzlC family protein [Pectobacterium wasabiae Pectobacterium wasabiae WPP163] WP_010305354.1 membrane protein [Pectobacterium carotovorum] Pectobacterium carotovorum YP_404404.1 hypothetical protein SDY_2877 [Shigella Shigella dysenteriae ABB62913.1 dysenteriae Sd197] YP_311671.1. hypothetical protein SSON_2826 [Shigella sonnei Shigella sonnei NC_007384.1. Ss046] AAZ89436.1
(44) TABLE-US-00002 TABLE 2 YgaH homologous proteins Acession Number Name Organism YP_001455540.1 hypothetical protein CKO_04032 [Citrobacter koseri Citrobacter koseri ABV15104.1 ATCC BAA-895] WP_005122930.1 branched-chain amino acid ABC transporter Shigella flexneri EIQ78634.1 permease [Shigella flexneri] YP_007877062.1 L-valine exporter [Raoultella ornithinolytica B6] Raoultella ornithinolytica AGJ89510.1 YP_008107734.1 branched-chain amino acid ABC transporter Enterobacter sp. WP_020454910.1 permease [Enterobacter sp. R4-368] AGN85394.1 WP_004959351.1 branched-chain amino acid ABC transporter Serratia odorifera EFE95944.1 permease [Serratia odorifera] YP_003884335.1 hypothetical protein Dda3937_00895 [Dickeya Dickeya dadantii ADM99778.1 dadantii 3937] YP_006647985.1 hypothetical protein PCC21_033290 Pectobacterium AFR04732.1 [Pectobacterium carotovorum subsp. carotovorum carotovorum subsp. PCC21] carotovorum YP_001007413.1 hypothetical protein YE3239 [Yersinia enterocolitica Yersinia enterocolitica CAL13269.1 subsp. enterocolitica 8081] subsp. enterocolitica NP_928589.1 hypothetical protein plu1278 [Photorhabdus Photorhabdus luminescens CAE13572.1 luminescens subsp. laumondii TTO1] subsp. laumondii WP_004847362.1 branched-chain amino acid ABC transporter Hafnia alvei EHM42582.1 permease [Hafnia alvei] WP_016154157.1 L-valine exporter [Citrobacter sp. KTE32] Citrobacter sp. EOQ28427.1 EOQ47452.1 WP_006687198.1 branched-chain amino acid ABC transporter Citrobacter youngae EFE06903.1 permease [Citrobacter youngae] YP_005198837.1 Branched-chain amino acid transport protein AzlD Rahnella aquatilis AEX50697.1 [Rahnella aquatilis CIP 78.65 = ATCC 33071] WP_009111643.1 branched-chain amino acid ABC transporter Brenneria sp. EniD312 EHD20335.1. permease [Brenneria sp. EniD312] YP_003469115.1 transporter [Xenorhabdus bovienii SS-2004] Xenorhabdus bovienii CBJ82351.1 NP_708496.1 L-valine exporter [Shigella flexneri 2a str. 301] Shigella flexneri YP_409183.1. conserved hypothetical protein [Shigella boydii Shigella boydii NC_007613.1. Sb227] ABB67355.1. WP_000119765.1 branched-chain amino acid ABC transporter Shigella flexneri permease [Shigella flexneri] WP_003825969.1 branched-chain amino acid ABC transporter Citrobacter sp. permease [Citrobacter sp. 30_2] WP_003037297.1 branched-chain amino acid ABC transporter Citrobacter freundii permease [Citrobacter freundii] WP_003037297.1 branched-chain amino acid ABC transporter Citrobacter freundii permease [Citrobacter freundii] EKU35015 liv-e family branched chain amino acid small Citrobacter sp. subunit [Citrobacter sp. L17] WP_009652550.1 branched-chain amino acid ABC transporter Klebsiella sp. permease [Klebsiella sp. OBRC7] WP_004853462.1 branched-chain amino acid ABC transporter Klebsiella oxytoca permease [Klebsiella oxytoca] YP_005016080.1 putative L-valine exporter [Klebsiella oxytoca KCTC Klebsiella oxytoca 1686] WP_017459326.1 branched-chain amino acid ABC transporter Enterobacter cloacae permease [Enterobacter cloacae] WP_004205699.1 L-valine exporter [Klebsiella pneumoniae] Klebsiella pneumoniae WP_004123982.1 branched-chain amino acid ABC transporter Klebsiella oxytoca permease [Klebsiella oxytoca] WP_004132928.1 L-valine exporter [Klebsiella oxytoca] Klebsiella oxytoca YP_002236979.1 hypothetical protein KPK_1115 [Klebsiella Klebsiella pneumoniae pneumoniae 342] YP_005228385.1 hypothetical protein KPHS_40850 [Klebsiella Klebsiella pneumoniae pneumoniae subsp. pneumoniae HS11286] subsp. Pneumoniae YP_001336648.1 hypothetical protein KPN_03012 [Klebsiella Klebsiella pneumoniae pneumoniae subsp. pneumoniae MGH 78578] subsp. Pneumoniae YP_005956057.1. putative L-valine exporter [Klebsiella pneumoniae Klebsiella pneumoniae NC_017540.1. KCTC 2242] WP_020803764.1 hypothetical protein [Klebsiella pneumoniae] Klebsiella pneumoniae WP_004114708.1 branched-chain amino acid ABC transporter Klebsiella oxytoca permease [Klebsiella oxytoca] WP_004104783.1 branched-chain amino acid ABC transporter Klebsiella oxytoca permease [Klebsiella oxytoca] WP_007370572.1 branched-chain amino acid transport family protein Kosakonia radicincitans EJI92176.1 [Kosakonia radicincitans] EJI93105.1 branched-chain amino acid transport family protein Enterobacter radicincitans [Enterobacter radicincitans DSM 16656] NP_668255.1 hypothetical protein y0924 [Yersinia pestis KIM10+] Yersinia pestis YP_069399.1 hypothetical protein YPTB0858 [Yersinia Yersinia pseudotuberculosis IP 32953] pseudotuberculosis YP_001479964.1 hypothetical protein Spro_3740 [Serratia Serratia proteamaculans proteamaculans 568] WP_005189085.1 branched-chain amino acid ABC transporter Yersinia intermedia permease [Yersinia intermedia] YP_004297213.1 hypothetical protein YE105_C1014 [Yersinia Yersinia enterocolitica enterocolitica subsp. palearctica 105.5R(r)] subsp. Palearctica WP_019081388.1 branched-chain amino acid ABC transporter Yersinia enterocolitica permease [Yersinia enterocolitica] WP_004392937.1 branched-chain amino acid ABC transporter Yersinia kristensenii permease [Yersinia kristensenii] WP_016929852.1 branched-chain amino acid ABC transporter Serratia marcescens permease [Serratia marcescens] WP_019845221.1 branched-chain amino acid ABC transporter Dickeya zeae permease [Dickeya zeae] YP_003334824.1 hypothetical protein Dd586_3285 [Dickeya dadantii Dickeya dadantii Ech586] YP_003042012.1. conserved hypothetical protein [Photorhabdus Photorhabdus asymbiotica NC_012962.1. asymbiotica] WP_016941677.| branched-chain amino acid ABC transporter Dickeya zeae permease [Dickeya zeae] WP_005275000.1 branched-chain amino acid ABC transporter Yersinia bercovieri permease [Yersinia bercovieri] CAC44348.1 YgaH protein [Erwinia chrysanthemi] Erwinia chrysanthemi WP_004704054.1 branched-chain amino acid ABC transporter Yersinia aldovae permease [Yersinia aldovae] YP_003003218.1 hypothetical protein Dd1591_0860 [Dickeya zeae Dickeya zeae Ech1591 Ech1591] WP_004707387.1 branched-chain amino acid ABC transporter Yersinia frederiksenii permease [Yersinia frederiksenii] WP_008812527.1 branched-chain amino acid ABC transporter Enterobacteriaceae permease [Enterobacteriaceae bacterium bacterium 9_2_54FAA] YP_008231813.1 branched-chain amino acid ABC transporter Serratia liquefaciens permease [Serratia liquefaciens ATCC 27592] YP_051598.1 hypothetical protein ECA3510 [Pectobacterium Pectobacterium atrosepticum SCRI1043] atrosepticum WP_019455592.1 branched-chain amino acid ABC transporter Serratia marcescens permease [Serratia marcescens] YP_007407668.1 putative amino acid transporter YgaH [Serratia Serratia marcescens marcescens WW4] WP_004716724.1 branched-chain amino acid ABC transporter Yersinia rohdei permease [Yersinia rohdei] YP_003018880.1. hypothetical protein PC1_3328 [Pectobacterium Pectobacterium NC_012917.1. carotovorum subsp. carotovorum PC1] carotovorum subsp. Carotovorum WP_004873539.1 branched-chain amino acid ABC transporter Yersinia mollaretii permease [Yersinia mollaretii] WP_005975643.1 branched-chain amino acid ABC transporter Pectobacterium wasabiae permease [Pectobacterium wasabiae] YP_003260828.1 hypothetical protein Pecwa_3484 [Pectobacterium Pectobacterium wasabiae wasabiae WPP163] YP_002986522.1 hypothetical protein Dd703_0892 [Dickeya dadantii Dickeya dadantii Ech703] YP_007345876.1 Branched-chain amino acid transport protein (AzID) Serratia marcescens [Serratia marcescens FGI94] YP_004211502.1 branched-chain amino acid transport [Rahnella sp. Rahnella sp. Y9602] YP_005400522.1 putative L-valine exporter [Rahnella aquatilis HX2] Rahnella aquatilis NC_017047.1. WP_010305358.1 branched-chain amino acid ABC transporter Pectobacterium permease [Pectobacterium carotovorum] carotovorum YP_003711584.1. hypothetical protein XNC1_1314 [Xenorhabdus Xenorhabdus nematophila NC_014228.1. nematophila ATCC 19061] YP_006500219.1 branched-chain amino acid transport [Klebsiella Klebsiella oxytoca AFN29790.1 oxytoca E718] EHT06521.1 hypothetical protein HMPREF9690_03780 Klebsiella oxytoca [Klebsiella oxytoca 10-5246] EKP29342.1. L-valine exporter [Klebsiella oxytoca M5aI] Klebsiella oxytoca EJK15417.1. putative L-valine exporter [Klebsiella pneumoniae Klebsiella pneumoniae subsp. pneumoniae KPNIH18] subsp. Pneumoniae YP_006500219.1 branched-chain amino acid transport [Klebsiella Klebsiella oxytoca oxytoca E718] BAH64805.1. hypothetical protein KP1_4275 [Klebsiella Klebsiella pneumoniae pneumoniae subsp. pneumoniae NTUH-K2044]- subsp. Pneumoniae ygaH YP_003437996.1 hypothetical protein Kvar_1056 [Klebsiella variicola Klebsiella variicola At-22] YP_003260828.1 hypothetical protein Pecwa_3484 [Pectobacterium Pectobacterium wasabiae wasabiae WPP163] WP_010282658.1 branched-chain amino acid ABC transporter Pectobacterium permease [Pectobacterium carotovorum] carotovorum YP_404405.1. hypothetical protein SDY_2878 [Shigella Shigella dysenteriae NC_007606.1. dysenteriae Sd197] ABB62914.1. WP_000119748.1 branched-chain amino acid ABC transporter Shigella dysenteriae permease [Shigella dysenteriae] YP_311672.1 hypothetical protein SSON_2827 [Shigella sonnei Shigella sonnei AAZ89437.1 Ss046] WP_005150562.1 putative membrane protein [Shigella sonnei] Shigella sonnei WP_000119744.1 branched-chain amino acid ABC transporter Shigella boydii permease [Shigella boydii] WP_002427075.1 branched-chain amino acid ABC transporter Yersinia pestis permease [Yersinia pestis] WP_017491438.1 branched-chain amino acid ABC transporter gamma proteobacterium permease [gamma proteobacterium WG36] WP_002366138.1 branched-chain amino acid transport family protein, Yersinia pestis partial [Yersinia pestis]
With accession number disclosed in the tables for each homolog the man skilled in the art is able to obtain the amino acid sequence and its nuceotidic coding sequence on NCBI databases for instance.
From the amino acid sequence or nucleotidic sequence, it is a routine task for the man skilled in the art to obtain genes encoding these homologues. It can be done either by artificial synthesis of the gene coding the protein of interest from its amino acid sequence or by PCR amplification of the coding region of interest from the corresponding genomic DNA. In the context of the invention, these genes are called ygaZ or ygaH homologous genes. The sequences of these ygaZH homologous genes may be adjusted to the codon bias of the host microorganism.
In a specific embodiment of the invention, the recombinant microorganism overexpresses the genes ygaZ and ygaH from E. coli coding the proteins whose sequences are respectively disclosed in SEQ ID NO: 1 and SEQ ID NO: 2 or brnF and brnE from C. glutamicum or their homologous genes. Preferably, ygaZ and ygaH homologous genes are composed by the gene pair originating from the same organism and composed by the homologous gene of ygaZ and the homologous gene of ygaH. However mismatch pair of an ygaZ homologous gene from a first organism and an ygaH homologous gene from a second organism could be used. Preferably, the genes ygaZH, brnFE or their homologous genes are overexpressed.
YgaZH homologous genes are chosen among genes encoding the YgaZ and YgaH homologues disclosed respectively in table 1 and in table 2. Preferably, ygaZH homologous genes are chosen among genes encoding YgaZH homologues from Citrobacter species, Shigella species, Raoultella species, Enterobacter species, Yersinia species and Photorhabdus species. More preferably ygaZH homologous genes originate from Citrobacter koseri, Shigella flexneri, Raoultella ornithinolytica, Enterobacter sp., Yersinia enterocolitica, Photorhabdus luminescens, Citrobacter youngae or Citrobacter freundii. Most preferably, ygaZH homologous genes originate from Citrobacter koseri, Citrobacter youngae, Citrobacter freundii or Enterobacter sp.
Therefore, ygaZH homologous genes are preferably chosen among genes coding the pair of YgaZ homolog and YgaH homolog defined respectively by: SEQ ID NO: 3 and SEQ ID NO: 4 from Citrobacter koseri, SEQ ID NO: 5 and SEQ ID NO: 6 from Shigella flexneri, SEQ ID NO: 7 and SEQ ID NO: 8 from Raoultella ornithinolytica, SEQ ID NO: 9 and SEQ ID NO: 10 from Enterobacter sp. (R4-368), SEQ ID NO: 11 or 12 and SEQ ID NO: 13 or 14 from Yersinia enterocolitica subsp. enterocolitica, SEQ ID NO: 15 and SEQ ID NO: 16 from Photorhabdus luminescens subsp. laumondii, SEQ ID NO: 17 and SEQ ID NO: 18 from Citrobacter youngae, SEQ ID NO: 19 and SEQ ID NO: 20 from Citrobacter freundii.
(45) In a preferred embodiment of the invention, these genes ygaZH or brnFE or homologous genes originating from Citrobacter koseri, Shigella flexneri, Raoultella ornithinolytica, Enterobacter sp., Yersinia enterocolitica, Photorhabdus luminescens, Citrobacter youngae or Citrobacter freundii are overexpressed under the control of an inducible promoter. The man skilled in the art knows such inducible promoters. For instance, promoters like P.sub.R or P.sub.L may be used to overexpress ygaZH genes or brnFE genes or ygaZH homologous genes originating from Citrobacter koseri, Shigella flexneri, Raoultella ornithinolytica, Enterobacter sp., Yersinia enterocolitica, Photorhabdus luminescens, Citrobacter youngae or Citrobacter freundii in the recombinant microorganism of the invention.
(46) It is another object of the invention to identify ygaZH homologous genes and to overexpress said genes in amino-acid producer microorganism, alone or in combination with other genetic modifications as disclosed below.
(47) Optimisation of Methionine Biosynthesis Pathway
(48) The recombinant microorganism according to the invention is modified for improving the production of methionine. Genes involved in methionine production are well known in the art, and comprise genes involved in the methionine specific biosynthesis pathway as well as genes involved in precursor-providing pathways and genes involved in methionine consuming pathways.
(49) Efficient production of methionine requires the optimisation of the methionine specific pathway and several precursorproviding pathways. Methionine producing strains have already been described, in particular in patent applications WO2005/111202, WO2007/077041 and WO2009/043803. These applications are incorporated as reference into this application.
(50) Except otherwise stated, all the genes mentioned below concerning optimisation of methionine biosynthesis pathway are referring to those from E. coli.
(51) In a specific embodiment of the invention, the recombinant microorganism is modified as described below: the expression of at least one gene chosen among ptsG, pyc, pntAB, cysP, cysU, cysW, cysA, cysM, cysJ, cysI, cysH, gcvT, gcvH, gcvP, lpd, serA, serB, serC, cysE, metF, metA, metA* allele encoding for an enzyme with reduced feed-back sensitivity to S-adenosylmethionine and/or methionine, thrA, and thrA* allele encoding for an enzyme with reduced feed-back inhibition to threonine is increased. ptsG encodes the PTS enzyme IICB.sup.Glc as described in patent application WO2013/001055, pyc encodes a pyruvate carboxylase as described in patent application WO2013/001055. In a preferred embodiment, the pyc gene is heterologous and is chosen from pyc genes from Rhizobium etli, Bacillus subtilis, Lactococcus lactis, Pseudomonas fluorescens or Corynebacterium species, pntAB encode subunits of a membrane-bound transhydrogenase, such as described in patent application WO2012/055798, cysP encodes a periplasmic sulphate binding protein, as described in WO2007/077041 and in WO2009/043803, cysU encodes a component of sulphate ABC transporter, as described in WO2007/077041 and in WO2009/043803, cysW encodes a membrane bound sulphate transport protein, as described in WO2007/077041 and in WO2009/043803, cysA encodes a sulphate permease, as described in WO2007/077041 and in WO2009/043803, cysM encodes an O-acetyl serine sulfhydralase, as described in WO2007/077041 and in WO2009/043803, cysI and cysJ encode respectively the alpha and beta subunits of a sulfite reductase as described in WO2007/077041 and in WO2009/043803. Preferably cysI and cysJ are overexpressed together, cysH encodes an adenylylsulfate reductase, as described in WO2007/077041 and in WO2009/043803.
(52) Increasing C1 metabolism is also a modification that leads to improved methionine production. It relates to the increase of the activity of at least one enzyme involved in the C1 metabolism chosen among GcvTHP, Lpd, MetF or MetH. In a preferred embodiment of the invention, the one carbon metabolism is increased by enhancing the expression and/or the activity of at least one of the following: gcvT, gcvH, gcvP, and lpd, coding for the glycine cleavage complex, as described in patent application WO 2007/077041. The glycine-cleavage complex (GCV) is a multienzyme complex that catalyzes the oxidation of glycine, yielding carbon dioxide, ammonia, methylene-THF and a reduced pyridine nucleotide. The GCV complex consists of four protein components, the glycine dehydrogenase said P-protein (GcvP), the lipoyl-GcvH-protein said H-protein (GcvH), the aminomethyltransferase said T-protein (GcvT), and the dihydrolipoamide dehydrogenase said L-protein (GcvL or Lpd). P-protein catalyzes the pyridoxal phosphate-dependent liberation of CO2 from glycine, leaving a methylamine moiety. The methylamine moiety is transferred to the lipoic acid group of the H-protein, which is bound to the P-protein prior to decarboxylation of glycine. The T-protein catalyzes the release of NH3 from the methylamine group and transfers the remaining C1 unit to THF, forming methylene-THF. The L protein then oxidizes the lipoic acid component of the H-protein and transfers the electrons to NAD.sup.+, forming NADH; MetF encoding a methylenetetrahydrofolate reductase, as described in patent application WO2007/07704.
(53) The overexpression of at least one of the following genes involved in serine biosynthesis also reduces the production of the by-product isoleucine: serA which encodes a phosphoglycerate dehydrogenase, as described in WO2007/077041 and in WO2009/043803, serB which encodes a phosphoserine phosphatase, as described in WO2007/077041 and in WO2009/043803, serC which encodes a phosphoserine aminotransferase, as described in WO2007/077041 and in WO2009/043803.
(54) The overexpression of the following genes has already been shown to improve the production of methionine: cysE encodes a serine acyltransferase; its overexpression allows an increase in methionine production, as described in WO2007/077041; metA encodes a homoserine succinyltransferase. The allele metA* codes for an enzyme with reduced feed-back sensitivity to S-adenosylmethionine and/or methionine. Preferentially, the allele metA* described in the patent application WO2005/111202 is used; thrA encodes an aspartokinase/homoserine dehydrogenase; the thrA* allele codes for an enzyme with reduced feed-back inhibition to threonine, as described in WO2005/111202.
In a specific embodiment of the invention, at least one of said genes is under control of an inducible promoter. In a preferred embodiment of the invention, at least one of these genes is under the control of a temperature inducible promoter. Preferably, the expression of at least one of the genes: thrA, cysE, metA, is under the control of an inducible promoter, directly or indirectly. More preferably, the genes thrA, cysE and metA are under control of an inducible promoter, directly or indirectly. In a preferred embodiment of the invention, expression of thrA gene is under direct control of an inducible promoter and expression of cysE gene is under polar effect of inducible expression of thrA gene. In another preferred embodiment of the invention, expression of thrA gene is under direct control of an inducible promoter and expressions of cysE and metA genes are under polar effect of inducible expression of thrA gene.
(55) In a most preferred embodiment, the temperature inducible promoter belongs to the family of P.sub.R promoters. A methionine producing strain having genes under control of inducible promoters is described in patent application WO2011/073122.
(56) In another specific embodiment of the invention, the microorganism has been further modified, and the expression of at least one of the following genes is attenuated: metJ, pykA, pykF, purU, ybdL, yncA, metE, dgsA, metN, metI, metQ or udhA. The gene metJ codes for the repressor protein MetJ (GenBank 1790373), responsible for the down-regulation of the methionine regulon as was suggested in patent application JP2000/157267, The genes pykA and pykF code for the enzymes pyruvate kinase. The attenuation of the expression of at least one or both of the pyruvate kinases decreases the consumption of phosphoenol pyruvate (PEP). Increased availability of PEP can increase the production of oxaloacetate, an important precursor of aspartate, which in turn is a precursor of methionine, as described in WO2007/077041 and in WO2009/043803, purU codes for a formyltetrahydrofolate deformylase, an enzyme that catalyzes the formyl-THF deformylase reaction. The attenuation of the deformylase activity increases the production of methyl-THF that is required for methylation of homocysteine. Loss of C1 metabolites by deformylation leads to an increased production of homocysteine that cannot be transformed into methionine. Homocysteine can then be a substrate for the enzyme cystathionine gamma synthase (MetB) that can catalyze the reaction between 0-succinylhomoserine and homocysteine resulting in the production of homolanthionine, as described in WO2007/077041 and in WO2009/043803, ybdL encodes an aminotransferase as described in patent application WO2012/090021, yncA encodes a N-acyltransferase, as described in patent application WO2010/020681, metE encodes a cobalamin-independent methionine synthase, as described in patent application PCT/IB2012/001336, dgsA, better known as Mlc, encodes a transcriptional dual regulator that controls the expression of genes encoding enzymes of the phosphotransferase (PTS) and phosphoenolpyruvate (PEP) systems as described in patent application WO2013/001055, metN, metI, metQ, encode a methionine uptake system, udhA encodes soluble pyridine nucleotide transhydrogenase, as described in patent application WO2012/055798.
(57) In a more preferred embodiment of the invention, the fermentative production of methionine and/or its derivatives by a recombinant microorganism, wherein the methionine import is attenuated and the methionine efflux is enhanced, from glucose as a main carbon source, may be achieved through a combination of the above discussed modifications in said microorganism, for example: the expression of the gene metJ is attenuated and the expression of a metA* allele encoding for an enzyme with reduced feed-back sensitivity to S-adenosylmethionine and/or methionine (MetA*) is enhanced; the expression of the gene metJ is attenuated; the expression of a metA* allele encoding for an enzyme with reduced feed-back sensitivity to S-adenosylmethionine and/or methionine (MetA*) is enhanced; and the expression of a thrA* allele encoding for an enzyme with reduced feed-back inhibition to threonine (thrA*) is enhanced; the expression of the gene metJ is attenuated; the expression of a metA* allele encoding for an enzyme with reduced feed-back sensitivity to S-adenosylmethionine and/or methionine (MetA*) is enhanced; the expression of a thrA* allele encoding for an enzyme with reduced feed-back inhibition to threonine (thrA*) is enhanced; and the expression of the gene cysE is enhanced; the expression of the gene metJ is attenuated; the expression of a metA* allele encoding for an enzyme with reduced feed-back sensitivity to S-adenosylmethionine and/or methionine (MetA*) is enhanced; the expression of a thrA* allele encoding for an enzyme with reduced feed-back inhibition to threonine (thrA*) is enhanced; the expression of the gene cysE is enhanced; and the expression of the genes metF is enhanced.
In a particular aspect of the invention, the recombinant microorganism comprises the following genetic modifications: the genes metH, and fldA and fpr from E. coli or their homologous genes from C. glutamicum are overexpressed, the genes ygaZ and ygaH from E. coli or the genes brnF and brnE from C. glutamicum or their homologous genes originating from Citrobacter koseri, Shigella flexneri, Raoultella ornithinolytica, Enterobacter sp., Yersinia enterocolitica, Photorhabdus luminescens, Citrobacter youngae or Citrobacter freundii are overexpressed, the expression of the genes metA*, cysPUWAM, cysJIH, gcvTHP, metF, serA, serB, serC, cysE, thrA*, ptsG and pyc are enhanced, and the expression of genes metJ, pykA, pykF, purU, metE, dgsA and yncA are attenuated.
In a particular embodiment of the invention, the microorganism to be modified is from the bacterial family Enterobacteriaceae or Corynebacteriaceae.
Preferentially, the microorganism to be modified is Escherichia coli or Corynebacterium glutamicum.
Culture Conditions
(58) In a second aspect of the invention, a method is optimised for the fermentative production of methionine and/or its derivatives. It comprises the followings steps: Culturing a recombinant microorganism wherein the cobalamin-dependent methionine synthase activity and the methionine efflux are enhanced by overexpressing respectively the genes metH, and optionally the genes fldA and fpr genes from E. coli or their homologous genes from C. glutamicum and the genes ygaZH from E. coli or the genes brnFE from C. glutamicum or their homologous genes in an appropriate culture medium comprising a fermentable source of carbon and a source of sulphur, and, Recovering methionine and/or its derivatives from the culture medium.
(59) Those skilled in the art are able to define the culture conditions for the microorganisms according to the invention. In particular the bacteria are fermented at a temperature between 20 C. and 55 C., preferentially between 25 C. and 40 C., and more specifically about 30 C. for C. glutamicum and about 37 C. for E. coli.
(60) For E. coli, the culture medium can be of identical or similar composition to an M9 medium (Anderson, 1946), an M63 medium (Miller, 1992); or a medium such as defined by Schaefer et al., (1999).
(61) For C. glutamicum, the culture medium can be of identical or similar composition to BMCG medium (Liebl et al., 1989) or to a medium such as described by Riedel et al., (2001).
(62) In the method of the invention, the ygaZH homologous genes which are overexpressed in the recombinant microorganism are preferably chosen among the group consisting in homologous genes from Citrobacter species, Shigella species, Raoultella species, Enterobacter species, Yersinia species and Photorhabdus species, and more preferably originate from Citrobacter koseri, Shigella flexneri, Raoultella ornithinolytica, Enterobacter sp., Yersinia enterocolitica, Photorhabdus luminescens, Citrobacter youngae or Citrobacter freundii.
(63) In a specific embodiment of the method, the recombinant microorganism comprises the following genetic modifications: a. overexpression of the genes metH, and fldA and fpr from E. coli, or their homologous genes from C. glutamicum and b. overexpression of the genes ygaZH from E. coli, or brnFE from C. glutamicum or their homologous genes.
(64) In this specific embodiment of the invention, said ygaZH homologous genes are preferably chosen among the group consisting in homologous genes from Citrobacter species, Shigella species, Raoultella species, Enterobacter species, Yersinia species and Photorhabdus species, and more preferably chosen among the groups consisting in homologous genes from Citrobacter koseri, Shigella flexneri, Raoultella ornithinolytica, Enterobacter sp., Yersinia enterocolitica, Photorhabdus luminescens, Citrobacter youngae or Citrobacter freundii.
(65) In the method of the invention, the ygaZH homologous genes which are overexpressed in the recombinant microorganism are most preferably originating from Citrobacter koseri, Citrobacter youngae, Citrobacter freundii or Enterobacter sp.
(66) In some embodiment of the invention, the growth of the recombinant microorganism is subjected to a limitation or starvation/deficiency for one or several inorganic substrate, in particular phosphate and/or potassium, in the culture medium. It refers to condition under which growth of the microorganisms is governed by the quantity of an inorganic chemical supplied that still permits weak growth. Such limitation in microorganism growth has been described in the patent application WO2009/043372. In a preferred embodiment of the invention, the culture is subjected to phosphate limitation.
The action of recovering methionine and/or its derivatives from the culture medium designates the action of recovering L-methionine and/or one of its derivatives, in particular N-acetyl methionine (NAM) and S-adenosyl methionine (SAM) and all other derivatives that may be useful such as hydroxy-methionine (or methionine hydroxy analogue or MHA). The methods for the recovery and purification of the produced compounds are well known to those skilled in the art (see in particular WO2005/007862, WO2005/059155). Preferably, the step of recovering methionine and/or its derivatives comprises a step of concentration of methionine and/or its derivatives in the fermentation broth.
(67) The amount of product in the fermentation medium can be determined using a number of methods known in the art, for example, high performance liquid chromatography (HPLC) or gas chromatography (GC). For example the quantity of methionine obtained in the medium is measured by HPLC after OPA/Fmoc derivatization using L-methionine (Fluka, Ref 64319) as a standard. The amount of NAM is determinated using refractometric HPLC using NAM (Sigma, Ref 01310) as a standard.
EXAMPLES
(68) The following experiments demonstrate how overexpression of genes encoding for the L-methionine excretion system together with the overexpression of genes encoding for the B12-dependent methionine synthase and its reactivation system in microorganisms such as E. coli and C. glutamicum improved methionine production.
In the examples given below, methods well known in the art were used to construct E. coli and C. glutamicum strains containing replicating vectors and/or various chromosomal insertions, deletions, and substitutions using homologous recombination well described by Datsenko & Wanner, (2000) for E. coli and in patent WO2007012078 for C. glutamicum.
In the same manner, the use of plasmids or vectors to express or overexpress one or several genes in a recombinant microorganisms are well known by the man skilled in the art.
(69) Examples of suitable E. coli expression vectors include pTrc, pACYC184n pBR322, pUC18, pUC19, pKC30, pRep4, pHS1, pHS2, pPLc236 etc. . . . .
(70) Examples of suitable C. glutamicum and E. coli shuttle vectors are e. g. pClik5aMCS (WO2005059093) or can be found in Eikmanns et al., (1991).
(71) Examples for suitable vectors to manipulate Corynebacteria can be found in the handbook of Corynebacteria edited by Eggeling and Bott in 2005.
(72) Protocols
(73) Several protocols have been used to construct methionine producing strains described in the following examples.
(74) Protocol 1 (Chromosomal modifications by homologous recombination, selection of recombinants and antibiotic cassette excision) and protocol 2 (Transduction of phage P1) used in this invention have been fully described in patent application WO2013/001055.
(75) Protocol 3: Construction of Recombinant Plasmids
(76) Recombinant DNA technology is well described and known by the man skilled in the art.
(77) Briefly, the DNA fragments are PCR amplified using oligonucleotides (the person skilled in the art will is able to design) and MG1655 genomic DNA as matrix. The DNA fragments and selected plasmid are digested with compatible restriction enzymes, ligated and then transformed in competent cells. Transformants are analysed and recombinant plasmids of interest are verified by DNA sequencing.
(78) TABLE-US-00003 TABLE3 Sequencescitedinthefollowingexamples SEQ IDNO Sequence5 .fwdarw. 3 21 AACACTGCAAAATCCTGCTATTTGATTTGTATGAGTGATA AGTGTAACGCCGAATAATCGTCGTTGGCGAATTTTACGAC TCTGACAGGAGGTGGCAATG 22 GAGAAAGTAAACGTAACATGATGACGACAATTCTGACGAT TCATGTTCCTTCAACGCCGGGGCGCGCATGGAATATGCTG GTGGCACTTCAGGCAGGAAA 23 TGAGGAATAGACAATGTTAGTTAGTAAAAGCAACGGATTT AACGCTAGCGCAGTTTTGGGTAGTGGAAGTTATAATGAAA ATAAATCTTCTAAACACATG 24 TGCGCTAAAAGAAATGAATAGAACCTTTTCGATAATATAA GAAAAAGTGATTTTCATGTTGGTTTACTTAAGCCAAGTAG TACGCGTAGTGTTATTTTAG 25 AAATTATTCTTGTATCTTTGTTATAATATGGGAAAGTGCA ACCAT 26 CGTTAATCAGCAGGTTAGCCAGCCACAAAAAGCCATTGAG AAAATTATTGATTTTACATGGGATTATTATATTGCTAATC CTTGGTTTTTAAAAATTGTG 27 TCATCTACCGCGCACGAATAAAACTGCCATCCGGCTGGCG GGTGAACAGGACCTGTTGATTATTCCCCGTATCAATGGTT AAGCCCGTCACCACGCCGCT
Example 1: Overproduction of the Cobalamin-Dependent Methionine Synthase or Overproduction of a L-Methionine Secretion System in a L-Methionine Overproducer E. coli Recombinant StrainStrain 1 and Construction of Strains 2, 3, 4, 5 and 6
(79) Strain 1Reference Strain
(80) Methionine producing strain 17 described in patent application WO2013/001055 (which is incorporated as reference into this application) was renamed strain 1 in this present application. For reminder this strain overexpressed metH owing artificial promoter and ribosome binding site integrated in front of metH gene at its endogenous locus (for details see as patent application WO2007/077041). This strain contains also the mutation in metE gene disclosed in patent application WO2013/190343.
Construction of Strain 5Overproduction of the Cobalamin-Dependent Methionine Synthase, Overexpression of metH, fldA and Fpr
The E. coli gene encoding the cobalamin-dependent methionine synthase, metH and genes fldA and fpr encoding for the reactivation system of MetH, were all overexpressed in genetic background of strain 1.
Before using strain 1, the antibiotic cassette was removed from dgsA modification using the Flp recombinase as described by Datsenko & Wanner, 2000 (according to Protocol 1).
The kanamycin sensible transformants were selected and the absence of antibiotic cassette at dgsA locus was verified by a PCR analysis with appropriate oligonucleotides. The strain retained was designated strain 2.
To overexpress metH, this gene, operatively linked to the same promoter and ribosome binding site as described in patent application WO2007/077041 was integrated on the chromosome at two different loci ybeM and ypjC (selected from the list disclosed in the patent application WO2011/073122 and whose deletion do not have impact on methionine production).
To strongly overexpress metH, the homologous recombination strategy described by Datsenko & Wanner, 2000 (according to Protocol 1) was used. For both chromosomal integrations, a fragment carrying metH gene linked to its artificial promoter and a resistance marker both flanked by DNA sequences homologous to the targeted integration locus ybeM or ypjC was PCR amplified by the overlapping PCR technique (overlapping oligonucleotides). The sequences for recombination into ybeM and ypjC are referred as SEQ ID NO 21 and 22, and SEQ ID NO 23 and 24 (listed in table 3), for ybeM and ypjC respectively. The PCR products ybeM::metH::Km and ypjC::metH::Cm obtained were then introduced by electroporation into the strain MG1655 metA*11 (pKD46), separately. The antibiotic resistant transformants were selected and the insertion of the metH gene with the resistance cassette at the targeted locus was verified by a PCR analysis with appropriate oligonucleotides. The strains retained were designated MG1655 metA*11 ybeM::metH::Km and MG1655 metA*11 ypjC::metH::Cm. Finally, the ybeM::metH::Km and ypjC::metH::Cm chromosomal integrations were transferred by P1 phage transduction successively (according to Protocol 2) from the MG1655 metA*11 ybeM::metH::Km and MG1655 metA*11 ypjC::metH to strain 2. Chloramphenicol or kanamycin resistant transductants were selected and the presence of ybeM::metH::Km and ypjC::metH::Cm chromosomal integrations were verified by a PCR analysis with appropriate oligonucleotides. The strain retained was called strain 3.
The antibiotic cassettes were removed from chromosomal integrations made at ybeM and ypjC loci into strain 3 using the Flp recombinase as described by Datsenko & Wanner, 2000 (according to Protocol 1). The kanamycin and chloramphenicol sensible transformants were selected and the absence of antibiotic cassette at both loci was verified by a PCR analysis with appropriate oligonucleotides. The strain retained was designated strain 4.
To overexpress fldA and fpr, these genes, were operatively linked to artificial promoters and to artificial ribosome binding site and were integrated onto the chromosome at the ytfA locus (same selection criteria as ybeM and ypjC loci, see above). The artificial promoters were constructed with SEQ ID NO 25 for fldA and as described for the overexpression of cysPUWAM operon in patent application WO2009/043803 for fpr. The artificial ribosome binding sites are the same as described to overexpress ptsG gene in strain 17 disclosed in patent application WO2013/001055.
To add copies of fldA and fpr overexpression onto the chromosome, the homologous recombination strategy described by Datsenko & Wanner, 2000 (according to Protocol 1) was used. A fragment carrying fldA and fpr genes, with their respective promoters, and a resistance marker, both flanked by DNA sequence homologous to the integration locus ytfA was PCR amplified by overlapping PCR technique (overlapping oligonucleotides). The sequences for recombination into the ytfA locus are referred as SEQ ID NO 26 and 27 (listed in table 3). The PCR product ytfA::fldA-fPr::Km obtained was then introduced by electroporation into the MG1655 metA*11 (pKD46) strain. The antibiotic resistant transformants were then selected and the insertion of the fldA-fpr genes with the resistance cassette at the ytfA locus was verified by a PCR analysis with appropriate oligonucleotides.
The strain retained was designated MG1655 metA*11 ytfA::fldA-fpr::Km. Finally, the ytfA::fldA-fpr::Km chromosomal integration was transferred by P1 phage transduction (according to Protocol 2) from the MG1655 metA*11 ytfA::fldA-fpr::Km to strain 4. Kanamycin resistant transductants were selected and the presence of ytfA::fldA-fpr::Km chromosomal integration was verified by a PCR analysis with appropriate oligonucleotides. The strain retained was called strain 5.
Construction of Strain 6Overproduction of a L-Methionine Secretion System, Overexpression of ygaZH
The E. coli genes ygaZH encoding the exporter of methionine were overexpressed in strain 1. They were cloned on the moderate plasmid copy number pCL1920 (Lerner & Inouye, 1990) with the use of the natural promoter of ygaZ. This plasmid was named pME1247. Finally, the plasmid pME1247 was transformed into strain 1, giving the strain 6.
Example 2: Overproduction of the Cobalamin-Dependent Methionine Synthase and Overproduction of a L-Methionine Secretion System in a L-Methionine Overproducer E. coli StrainConstruction of Strain 7
(81) The E. coli genes ygaZH encoding the exporter of methionine, were overexpressed in strain 5. The plasmid pME1247 was transformed into strain 5, giving rise to strain 7.
Example 3: Overproduction of the Cobalamin-Dependent Methionine Synthase or its Reactivation System or Overproduction of a L-Methionine Secretion System in a L-Methionine Overproducer C. glutamicum Recombinant StrainConstruction of Strains A to F
(82) The C. glutamicum strain ATCC 13032 hom* ask* metH (designated strain A in the following) is described in patent WO2007/012078.
(83) In that strain A, hom* and ask* correspond to feedback resistant alleles of homoserine dehydrogenase encoding the protein Hsdh S393F and of aspartate kinase encoding the protein Ask T311I also called LysC T311I, respectively.
(84) This strain A is subsequently mutagenized with N-Methyl-N-nitroguanidine as described in patent WO2007/012078. Clones that show a methionine titer that is at least twice that in strain A are isolated. One such clone, used in further experiments, is named strain B. This strain B is a C. glutamicum L-methionine producer.
Then, the C. glutamicum strain B is modified as described in patents WO2007/012078 and WO2004/050694 to obtain the strain C including hsk* metY metA metF DmcbR.
The mutated allele hsk* encoding the homoserine kinase Hsk T190A is overexpressed as well as metY encoding the O-acetylhomoserine sulfhydrylase, metA encoding the homoserine acetyl-transferase, metF encoding the homocysteine methylase and mcbR gene is deleted.
In order to increase the cobalamin-dependent methionine synthase activity in C. glutamicum L-methionine producer strain C, metHcg (metH gene from C. glutamicum) is overexpressed together with fprA1 gene encoding a ferredoxin reductase working as MetH reoxidation protein. These modifications are performed according the description of patent WO2009/144270. The resulting strain is called strain D.
Another way to increase the cobalamin-dependent methionine synthase activity in C. glutamicum L-methionine producer strain C, is to overexpress metHEc (metH gene from E. coli) together with fldA and fpr genes from E. coli encoding the flavodoxins involved into the reactivation of MetH enzyme. This is achieved according to the description of patent WO2009/144270. The resulting strain is called strain E.
In order to increase the L-methionine excretion system specific of C. glutamicum in strain C, the brnFE operon is overexpressed from the E. coli-C. glutamicum shuttle expression vector pEC-XT99A (EP1085094). The plasmid was constructed in E. coli from PCR-generated fragments by using C. glutamicum ATCC 13032 DNA as a template. The plasmid was constructed as described by Trotschel et al., (2005) in pEC-XT99A, and the resulting plasmid pCB1 is subsequently transformed into strain C giving rise to strain F.
Example 4: Combined Overproduction of the Cobalamin-Dependent Methionine Synthase with the Overproduction of a L-Methionine Secretion System in a C. glutamicum L-Methionine Overproducer StrainConstruction of Strains G and H
(85) In order to combine the overproduction of MetH.sub.CG, FprA1 or MetH.sub.EC, FldA, Fpr in C. glutamicum with the overproduction of the specific L-methionine excretion system BrnFE, the plasmid pCB1 described above is introduced by electroporation into strains D and E giving rise to strains G and H respectively.
Strain G carries only genes belonging to C. glutamicum whereas strain H carries the cobalamin-dependent methionine synthase and its reactivation system from E. coli.
The exporter is in all cases BrnFE.
Example 5: Production of L-Methionine by Fermentation in Bio-Reactor with E. coli Strains
(86) Strains described in previous examples were tested under production conditions in 2.5 L reactors (Pierre Guerin) using a fedbatch strategy.
(87) Briefly, an 24 hours culture grown in 10 mL LB medium with 2.5 g.Math.L.sup.1 glucose was used to inoculate a 24 hours preculture in minimal medium (B1a). These incubations were carried out in 500 mL baffled flasks containing 50 mL of minimal medium (B1a) in a rotary shaker (200 RPM). The first preculture was realized at a temperature of 30 C., the second one at a temperature of 34 C.
(88) A third preculture step was carried out in bio-reactors (Sixfors) filled with 200 mL of minimal medium (Bib) inoculated to a biomass concentration of 1.2 g.Math.L.sup.1 with 5 mL concentrated preculture. The preculture temperature was maintained constant at 34 C. and the pH was automatically adjusted to a value of 6.8 using a 10% NH.sub.4OH solution. The dissolved oxygen concentration was continuously adjusted to a value of 30% of the partial air pressure saturation with air supply and/or agitation. After glucose exhaustion from the batch medium, the fedbatch was started with an initial flow rate of 0.7 mL.Math.h.sup.1, before increasing exponentially for 26 hours with a growth rate of 0.13 If in order to obtain a final cellular concentration of about 20 g.Math.L.sup..
(89) TABLE-US-00004 TABLE 4 Preculture batch mineral medium composition (B1a and B1b) B1a B1b Compound Concentration (g .Math. L.sup.1) Concentration (g .Math. L.sup.1) Zn(CH.sub.3COO).sub.22H.sub.2O 0.0130 0.0130 CuCl.sub.22H.sub.2O 0.0015 0.0015 MnCl.sub.24H.sub.2O 0.0150 0.0150 CoCl.sub.26H.sub.2O 0.0025 0.0025 H.sub.3BO.sub.3 0.0030 0.0030 Na.sub.2MoO.sub.42H.sub.2O 0.0025 0.0025 Fe(III) citrate H.sub.2O 0.1064 0.1064 EDTA 0.0084 0.0084 MgSO.sub.47H.sub.2O 1.00 1.00 CaCl.sub.22H.sub.2O 0.08 0.08 Citric acid 1.70 1.70 KH.sub.2PO.sub.4 4.56 4.56 K.sub.2HPO.sub.43H.sub.2O 2.53 2.53 (NH.sub.4).sub.2HPO.sub.4 1.11 1.11 (NH.sub.4).sub.2SO.sub.4 4.90 4.90 (NH.sub.4).sub.2S.sub.2O.sub.3 1.00 1.00 Thiamine 0.01 0.01 Vitamin B12 0.01 0.01 Glucose 30.00 5.00 MOPS 30.00 0.00 NH.sub.4OH 28% Adjusted to pH 6.8 Adjusted to pH 6.8
(90) TABLE-US-00005 TABLE 5 Preculture fedbatch mineral medium composition (F1) Compound Concentration (g .Math. L.sup.1) Zn(CH.sub.3COO).sub.2H.sub.2O 0.0104 CuCl.sub.22H.sub.2O 0.0012 MnCl.sub.24H.sub.2O 0.0120 CoCl.sub.26H.sub.2O 0.0020 H.sub.3BO.sub.3 0.0024 Na.sub.2MoO.sub.42H.sub.2O 0.0020 Fe(III) citrate H.sub.2O 0.0524 EDTA 0.0067 MgSO.sub.4 5.00 (NH.sub.4).sub.2SO.sub.4 8.32 Na.sub.2SO.sub.4 8.95 (NH.sub.4).sub.2S.sub.2O.sub.3 24.80 Thiamine 0.01 Glucose 500.00 Vitamin B12 0.01 NH.sub.4OH 28% Adjusted to pH 6.8
(91) Subsequently, 2.5 L fermentors (Pierre Guerin) were filled with 600 or 620 mL of minimal medium (B2) and were inoculated to a biomass concentration of 3.2 g.Math.L.sup.1 with a preculture volume ranging between 80 to 100 mL.
(92) Cell growth is controlled by phosphate, that is why the final phosphate concentration in batch medium B2 was adjusted to a value comprised between 0 to 20 mM, by addition of different concentrations of KH.sub.2PO.sub.4, K.sub.2HPO.sub.4 and (NH.sub.4).sub.2HPO.sub.4. In the same manner, the final phosphate concentration of F2 medium was adjusted to a value comprise between 5 to 30 mM, by addition of different concentrations of KH.sub.2PO.sub.4, K.sub.2HPO.sub.4 and (NH.sub.4).sub.2HPO.sub.4. Thiosulfate concentration in fedbatch medium can be adjusted in order to prevent a starvation of this compound during the culture.
(93) TABLE-US-00006 TABLE 6 Culture batch mineral medium composition (B2) Compound Concentration (g .Math. L.sup.1) Zn(CH.sub.3COO).sub.22H.sub.2O 0.0130 CuCl.sub.22H.sub.2O 0.0015 MnCl.sub.24H.sub.2O 0.0150 CoCl.sub.26H.sub.2O 0.0025 H.sub.3BO.sub.3 0.0030 Na.sub.2MoO.sub.42H.sub.2O 0.0025 Fe(III) citrate H.sub.2O 0.1064 EDTA 0.0084 MgSO.sub.47H.sub.2O 1.00 CaCl.sub.22H.sub.2O 0.08 Citric acid 1.70 (NH.sub.4).sub.2S.sub.2O.sub.3 7.74 Thiamine 0.01 Vitamin B12 0.01 Biotin 0.10 Glucose 10 NH.sub.4OH 28% Adjusted to pH 6.8 IPTG 0.0047
(94) TABLE-US-00007 TABLE 7 Culture fedbatch medium composition (F2) Compound Concentration (g .Math. L.sup.1) Zn(CH.sub.3COO).sub.22H.sub.2O 0.0104 CuCl.sub.22H.sub.2O 0.0012 MnCl.sub.24H.sub.2O 0.0120 CoCl.sub.26H.sub.2O 0.0020 H.sub.3BO.sub.3 0.0024 Na.sub.2MoO.sub.42H.sub.2O 0.0020 Fe(III) citrate H.sub.2O 0.0524 EDTA 0.0067 MgSO.sub.4 5.00 (NH.sub.4).sub.2S.sub.2O.sub.3 60.00 Thiamine 0.01 Vitamin B12 0.01 Biotin 0.10 Glucose 500 IPTG 0.0047
(95) The culture temperature was maintained constant at 37 C. and pH was maintained to the working value (6.8) by automatic addition of NH.sub.4OH solutions (10% and 28%). The initial agitation rate was set at 200 RPM during the batch phase and was increased up to 1000 RPM during the fedbatch phase. The initial airflow rate was set at 40 NL.Math.h.sup.1 during the batch phase and was augmented to 100 NL.Math.h.sup.1 at the beginning of the fedbatch phase. The dissolved oxygen concentration was maintained at values between 20 and 40%, preferentially 30% saturation by increasing the agitation.
(96) IPTG was added in batch and fedbatch media when it was necessary at a final concentration of 20 M. When it was needed, antibiotics were added at a concentration of 50 mg.Math.L.sup.1 for spectinomycin, 30 mg.Math.L.sup.1 for chloramphenicol, 50 mg.Math.mL.sup.1 for kanamycin and 100 mg.Math.L.sup.1 for ampicillin.
(97) When the cell mass reached a concentration close to 5 g.Math.L.sup.1, the fedbatch was started with an initial flow rate of 5 mL.Math.h.sup.1. Feeding solution was injected with a sigmoid profile with an increasing flow rate that reached 24 mL.Math.h.sup.1 after 25 hours. The precise feeding conditions were calculated by the equation:
(98)
where Q(t) is the feeding flow rate in mL.Math.h.sup.1 with p1=1.80, p2=22.4, p3=0.27, p4=6.50. This flow rate was increased from 10 to 50%, preferentially between 20 and 30% throughout the entire culture.
(99) After 25 hours fedbatch, feeding solution pump was stopped and culture was finalized after glucose exhaustion.
(100) Extracellular amino acids were quantified by HPLC after OPA/Fmoc derivatization and other relevant metabolites were analyzed using HPLC with refractometric detection (organic acids and glucose) and GC-MS after silylation.
(101) Impact of the combination of metH, fldA, fpr overexpression and ygaZH overexpression in E. coli was tested. The results are presented in Table 8.
(102) TABLE-US-00008 TABLE 8 Maximal and final methionine yields and homolanthionine concentrations produced in fedbatch cultures by the different strains.The performances of the strains of interest, strains 5, 6 and 7 are compared to the reference strain 1 and were cultivated in same conditions. The symbol ~ indicates that there is no difference between the strains, the symbol + indicates an increase between 1 to 5%, the symbol ++ indicates an increase between 5 to 10% and the symbol +++ indicates an increase greater than 10%. For the definition of methionine/glucose yield see below. Strain Strain 1 Strain 6 Strain 5 Strain 7 Number of repetitions n = 4 n = 1 n = 1 n = 2 Max methionine yield reference ~ ++ +++ Final methionine yield reference ~ ~ ++ Homolanthionine (mM) 14.8 ND 3.6 2.5 Concentration at the final point MetH Specific activity 230 230 1500 ND (mUI/mg of protein)
(103) These results show that in E. coli, the overexpression of ygaZH genes only is of no benefit to the production of methionine (strain 6). The overexexpression of the cobalamin-dependent methionine synthase system in E. coli (strain 5) leads to an improved production of methionine. Surprisingly, we observe that the combination of overexpression of the genes ygaZH and the cobalamin-dependent methionine synthase system has a synergistic effect on the methionine production leading to an unexpected increased production of methionine. Moreover this combination has also a favourable impact on the homolanthionine production leading to a methionine with better purity.
(104) Determination of Methionine/Glucose Yield (Y.sub.met)
(105) The reactor volume was calculated by adding to the initial volume the amount of solutions added to regulate the pH and to feed the culture and by subtracting the volume used for sampling and lost by evaporation.
(106) The fedbatch volume was followed continuously by weighing the feeding stock. The amount of injected glucose was then calculated on the basis of the injected weight, the density of the solution and the glucose concentration determined by the method of Brix ([Glucose]). The methionine yield was expressed as followed:
(107)
With Methionine.sub.0 and Methionine.sub.t respectively the initial and final methionine concentrations and V.sub.0 and V.sub.t the initial and the instant t volumes.
The consumed glucose was calculated as follows:
(108)
Injected Glucose.sub.t=fed volume.sub.t*[Glucose]
Consumed glucose.sub.t=[Glucose].sub.0*V.sub.0+Injected Glucose[Glucose].sub.residual*V.sub.t With [Glucose].sub.0,[Glucose],[Glucose].sub.residual respectively the initial, the fed and the residual glucose concentrations.
Cobalamin-Dependent Methionine Synthase Activity Assay
The cobalamin-dependent methionine activity assay is an adaptation of the assay described by Drummond et al., in 1995.
The Cobalamin-dependent methionine synthase activity was assayed by measuring the product tetrahydrofolate (H4folate) concentration with a spectrophotometer at a wavelength of 350 nm and at a constant temperature of 37 C.
The reaction mixture was carried out in 80 mM potassium phosphate pH7.2, 20 mM DTT, 15 M S-adenosylmethionine (SAM), 0.6 mM (6R,S)-5-Methyl-5,6,7,8-tetrahydrofolic acid, 40 M Hydroxocobalamin, 0.1 mM Zinc chloride and 8 g of crude extract in a final volume of 800 l. The reaction mixture was incubated for 10 min at 37 C. before to start the reaction by the addition of the substrate homocysteine at a final concentration of 0.8 mM. After 5 min at 37 C., 200 l of acidic derivatization solution (4M HCl in 60% formic acid) was added to quench the turnover bringing the volume to 1 ml, and the tubes are heated at 80 C. for 10 min. This step is necessary to stabilize the enzymatic product of the reaction, the tetrahydrofolate which is not stable in acid. The heat leads to the formation of the methenyltetrahydrofolate which absorbs light at 350 nm, while residual substrate 5-methyltetrahydrofolate does not contribute to the absorbance at 350 nm. The reaction blank contained all components of the reaction mixture except the substrate homocysteine.
Quantification of the FldA and Fpr Proteins Levels
In order to quantify the two proteins, antibodies were generated against the flavodoxin-1 (fldA) and the flavodoxin reductase (fpr) (Antibodies from rabbit, Eurogentec) and used in Western blot experiments. Western blot detection was carried out using goat anti-rabbit AP. The proteins levels of FldA and Fpr on stained blots were quantified with a commercially available imaging system (Epson Expression 1680 professional) and compared in the different strains described in this patent.
Example 6: Production of L-Methionine by Fermentation with C. glutamicum Strains
(109) Strains are cultivated in flask in the same conditions as described in patent application WO2009/144270.
(110) TABLE-US-00009 TABLE 9 Methionine titers produced by C. glutamicum strains D, E, F, G and H compared to reference strain C. Strain Strain Strain Strain Strain Strain Strain C F D E G H Number of n = 10 n = 2 n = 2 n = 2 n = 2 n = 2 repetitions Methionine Titer % reference ~ + ~ ++ + compared to the strain The symbol ~ indicates that there is no difference between the strains, the symbol + indicates an increase between 1 to 3%, the symbol ++ indicates an increase greater than 3%.
Similarly to E. coli, in C. glutamicum, the combination of overexpression of the genes brnFE and the cobalamin-dependent methionine synthase system (from E. colistrain H and from C. glutamicumstrain G) has a synergistic effect on the methionine production leading to an unexpected increased production of methionine.
Example 7: Overproduction of the Cobalamin-Dependent Methionine Synthase and Overproduction of Homologous L-Methionine Secretion Systems in an E. coli Strain Overproducer of L-MethionineConstruction of Strains 8 to 17
(111) The ygaZH homologous genes from Citrobacter species, Raoultella species, Shigella species, Enterobacter species, Yersinia species and Photorhabdus species were overexpressed in genetic background of strain 5.
(112) Before using strain 5, the antibiotic cassette of the chromosomal integration made at ytfA locus was removed using the Flp recombinase as described by Datsenko & Wanner, 2000 (according to Protocol 1). The kanamycin sensible transformants were selected and the absence of antibiotic cassette at ytfA locus was verified by a PCR analysis with appropriate oligonucleotides. The resulting strain was named strain 8.
Construction of Strain 9Overproduction of the Endogenous L-Methionine Secretion System, Overexpression of ygaZH from E. coli
To compare the effect of the overexpression of ygaZH from E. coli and overexpression of ygaZH homologues in the same genetic background, the plasmid pME1247 carrying ygaZH from E. coli was transformed into strain 8, giving rise to strain 9.
Construction of Strains 10 to 17Overproduction of Homologous L-Methionine Secretion Systems, Overexpression of ygaZH from Genus and Species Listed in Table 10
To overexpress the ygaZH homologous genes listed in table 10, each couple of genes was cloned on the moderate copy number plasmid pCL1920 (Lerner & Inouye, 1990) with the use of the natural promoter and natural ribosome binding site of E. coli ygaZ gene as previously described for E. coli ygaZH genes, As specified in table 11, the ygaZH homologue genes were either amplified from genomic DNA of the corresponding strain or chemically synthesized, with or without optimizing the codon usage to E. coli (as proposed by GeneArt Gene Synthesis service with GeneOptimizer softwareLifetechnologies). The amplified DNA fragments comprising the ygaZH homologous genes are disclosed in SEQ ID indicated in the Table 11. The resulting plasmids were named as mentioned in table 11. Finally each plasmid was transformed into strain 8, giving the strains 10 to 17, as mentioned in table 11.
(113) TABLE-US-00010 TABLE 10 YgaZH homologue proteins ygaZ ygaH Acession Acession Organism Number Name Number Name Citrobacter koseri YP_001455539.1 hypothetical YP_001455540.1 hypothetical NC_009792.1. protein ABV15104.1 protein ABV15103.1 CKO_04031 CKO_04032 [Citrobacter [Citrobacter koseri koseri ATCC ATCC BAA-895] BAA-895] Shigella flexneri WP_005122932.1 membrane WP_005122930.1 branched-chain EIQ78635.1 protein [Shigella EIQ78634.1 amino acid ABC flexneri] transporter permease [Shigella flexneri] Raoultella YP_007877063.1 hypothetical YP_007877062.1 L-valine exporter ornithinolytica AGJ89511.1 protein AGJ89510.1 [Raoultella WP_015585890.1 RORB6_24155 ornithinolytica B6] [Raoultella ornithinolytica B6] Enterobacter sp. YP_008107733.1 membrane YP_008107734.1 branched-chain AGN85393.1 protein WP_020454910.1 amino acid ABC WP_020454909.1 [Enterobacter sp. AGN85394.1 transporter R4-368] permease [Enterobacter sp. R4-368] Yersinia EKA28834.1 putative amino EKA288331 ou hypothetical enterocolitica YWA314-01718 acid transporter YWA314-01713 protein YE3239 subsp. [Yersinia [Yersinia Enterocolitica enterocolitica enterocolitica subsp. subsp. enterocolitica Enterocolitica WA- WA-314] 314] Photorhabdus NP_928590.1 hypothetical NP_928589.1 hypothetical luminescens CAE13573.1 protein plu1279 CAE13572.1 protein plu1278 subsp. Laumondii [Photorhabdus [Photorhabdus luminescens luminescens subsp. laumondii subsp. laumondii TTO1] TTO1] Citrobacter WP_006687199.1 membrane WP_006687198.1 branched-chain youngae EFE06904.1 protein EFE06903.1 amino acid ABC [Citrobacter transporter youngae] permease putative [Citrobacter azaleucine youngae] resistance protein AzlC [Citrobacter youngae ATCC 29220] Citrobacter WP_003839672.1 hypothetical WP_003037297.1 branched-chain freundii protein amino acid ABC [Citrobacter transporter freundii] permease [Citrobacter freundii]
(114) TABLE-US-00011 TABLE 11 Plasmids and strains carrying ygaZH homologue genes SEQ Chemical Codon usage ID Plasmid Strain Microorganism synthesis optimisation N.sup.o name name Citrobacter no no 28 pME1277 Strain 10 koseri Shigella yes no 29 pME1274 Strain 11 flexneri Raoultella yes yes 30 pME1275 Strain 12 ornithinolytica Enterobacter yes yes 31 pME1283 Strain 13 sp. Yersinia no no 32 pME1287 Strain 14 enterocolitica subsp. Enterocolitica Photorhabdus no no 33 pME1281 Strain 15 luminescens subsp. Laumondii Citrobacter yes yes 34 pME1311 Strain 16 youngae Citrobacter yes yes 35 pME1307 Strain 17 freundii
Example 8: Production of L-Methionine by Fermentation in Flask Experiments
(115) Recombinant L-methionine producers overeproducing the cobalamin dependant methionine synthase MetH as well as different L-methionine secretion systems from various microorganisms (homologous to YgaZH from E. coli) were evaluated in small Erlenmeyer flasks.
(116) Production strains were evaluated in small Erlenmeyer flasks. A 5.5 mL preculture was grown at 30 C. for 21 hours in a mixed medium (10% LB medium (Sigma 25%) with 2.5 g.Math.L.sup.1 glucose and 90% minimal medium PC1). It was used to inoculate a 50 mL culture to an OD.sub.600 of 0.2 in medium PC1. Spectinomycin was added at a concentration of 50 mg.Math.L.sup.1 and gentamycin at 10 mg.Math.L.sup.1 when it was necessary. The temperature of the cultures was 37 C. When the culture had reached an OD.sub.600 of 5 to 7, extracellular amino acids were quantified by HPLC after OPA/Fmoc derivatization and other relevant metabolites were analyzed using HPLC with refractometric detection (organic acids and glucose) and GC-MS after silylation.
(117) TABLE-US-00012 TABLE 12 Minimal medium composition (PC1) Concentration Compound (g .Math. L.sup.1) ZnSO.sub.47H.sub.2O 0.0040 CuCl.sub.22H.sub.2O 0.0020 MnSO.sub.4H.sub.2O 0.0200 CoCl.sub.26H.sub.2O 0.0080 H.sub.3BO.sub.3 0.0010 Na.sub.2MoO.sub.42H.sub.2O 0.0004 MgSO.sub.47H.sub.2O 1.00 Citric acid 6.00 CaCl.sub.22H.sub.2O 0.04 K.sub.2HPO.sub.4 8.00 Na.sub.2HPO.sub.4 2.00 (NH.sub.4).sub.2HPO.sub.4 8.00 NH.sub.4Cl 0.13 NaOH 4M Adjusted to pH 6.8 FeSO.sub.47H.sub.2O 0.04 Thiamine 0.01 Glucose 20.00 Ammonium thiosulfate 5.61 Vitamin B12 0.01 MOPS 20.00 IPTG 0.0048
(118) TABLE-US-00013 TABLE 13 Methionine yield (Ymet) in g methionine/% g of glucose produced in flask culture by the strains of interest carrying overexpressions of ygaZH homologues genes as well as metH, fldA and fpr genes. For the precise definition of methionine/glucose yield see below. n indicates the number of repeats. Strain Y.sub.met Strain 8 16.0 (n = 2) Strain 9 (E. coli) 16.2 (n = 10) Strain 10 (C. koseri) 18.4 (n = 4) Strain 11 (S. flexneri) 16.6 (n = 1) Strain 12 (R. ornithinolytica) 16.2 (n = 2) Strain 13 (Enterobacter sp.) 18.8 (n = 2) Strain 14 (Y. enterocolitica 16.3 subsp. Enterocolitica) (n = 2) Strain 15 (P. luminescens 16.1 subsp. Laumondii) (n = 2) Strain 16 (C. youngae) 18.1 (n = 2) Strain 17 (C. freundii) 18.4 (n = 2)
(119) As can be seen in table 13, overexpression of ygaZH homologous genes from various microorganisms in the L-methionine producer overexpressing metH, fldA, fpr genes, leads to equivalent or better performances than those obtained with strain 9 which overexpresses ygaZH from E. coli. The homologous L-methionine secretion systems from other microorganisms than E. coli can replace the endogenous proteins of the bacterium.
(120) The homologous proteins YgaZH from Citrobacter Koseri (strain 10, Ymet=19.6 g/g), Citrobacter youngae (strain 16, Ymet=19.6 g/g), Citrobacter freundii (strain 17, Ymet=19.6 g/g) and Enterobacter sp. (Strain 13, Ymet=19.4 g/g) showed the best L-methionine yields of production compared to strain 9 (Ymet=18.7 g/g).
The methionine yield was expressed as followed:
(121)
REFERENCES
(122) Anderson, 1946, Proc. Natl. Acad. Sci. USA 32:120-128. Banerjee R. V., Harder S. R., Ragsdale S. W., Matthews R. G., 1990, Biochemistry, 29:1129-1135 Carrier T., Keasling J. D., 1999, Biotechnology Progress, 15:58-64 Datsenko K. A., Wanner B. L., 2000, Proceedings of the National Academy of Sciences of the USA, 97:6640-6645 Drummond J. T., Jarrett J., Gonzalez J. C., Huang S., Matthews R. G., 1995, Analytical Biochemistry, 228(2):323-329. Eikmanns B. J., Kleinertz E., Liebl W., Sahm H., 1991, Gene, 102:93-98 Foster M. A., Jones K. M., Woods D. D., 1961, Biochemical Journal, 80:519-531 Fujii K. and Huennekens F. M., 1974, Journal of Biological Chemistry, 249 (21):6745-6753 Gonzalez J. C., Banerjee R. V., Huang S., Summer J. S., Matthews R. G., 1992, Biochemistry, 31:6045-6056 Lerner C. G. and Inouye M., 1990, Nucleic Acids Research, 18(15):4631 Liebl et al., 1989, Appl. Microbiol. Biotechnol. 32: 205-210. Matthews R. G., 2001, Accounts of Chemical Research, 34:681-689 Miller, 1992; A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. Riedel et al., 2001, J. Mol. Microbiol. Biotechnol. 3: 573-583. Saunderson C. L., 1985, British Journal of Nutrition, 54:621-633 Schaefer et al. 1999, Anal. Biochem. 270: 88-96. Trtschel C., Deutenberg D., Bathe B., Burkovski A., Kramer R., 2005, Journal of Bacteriology. 187(11):3786-3794 Wan J. T. and Jarrett J. T., 2002, Archives of Biochemistry and Biophysics, 406:116-126