Aspartic proteases

Abstract

The invention relates to aspartic proteases, and particularly to aspartic proteases for plants. Disclosed are modified plant aspartic proteases, and methods for their manufacture, and uses thereof. Particularly contemplated are the uses of aspartic proteases in clotting milk.

Claims

1. A method for producing a plant aspartic protease, wherein the plant aspartic protease is a modified cardosin, the method comprising expressing, in a yeast cell or a fungal cell, a nucleic acid encoding (i) a polypeptide of SEQ ID NO: 1, or SEQ ID NO: 2; or (ii) a polypeptide having at least 95% sequence identity to SEQ ID NO: 1, or SEQ ID NO: 2, wherein the polypeptide encoded lacks a functional plant specific insert (PSI) domain.

2. The method of claim 1, wherein modified cardosin is secreted from the cell, the method further comprising collecting modified cardosin secreted from the cell.

3. The method of claim 1 wherein the modified cardosin is expressed from a vector contained in the cell, or wherein the modified cardosin is expressed from the genome of the cell.

4. The method of claim 1 wherein the yeast is from the genus Kluyveromyces.

5. The method of claim 1 (ii) wherein the PSI domain is wholly or partially replaced by a linker peptide.

6. The method of claim 1 wherein the modified cardosin does not have sequence AEAA or AEAV at the C-terminus.

7. The method of claim 3 wherein the vector is a yeast expression vector.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures in which:

(2) FIG. 1. SDS-PAGE gel electrophoresis of enzyme purified from K. lactis (pCBPSI).

(3) FIG. 2. Sequences of Cardosins B and A with and without PSI sequence, PSI sequences, and sequences used in the examples.

(4) FIG. 3. Sheep, goat and cow cheeses produced using VRen as milk clotting agent.

(5) FIG. 4. RP-HPLC analysis of -casein digestion products. Digestion by native cardosin B (nCB) is shown in black whereas digestion by recombinant cardosin B is shown in grey.

(6) FIG. 6. Schematic representation of different constructs of cardosin A. A) Representation of primary structure of cardosin A. B) Schematic representation of cardosin A mutants.

(7) FIG. 6. SDS-PAGE analysis of K-casein hydrolysis by cardosin A mutants. The enzymatic activity towards K-casein was tested at 37 C. for 2 hours.

(8) FIG. 7. Alignment of partial amino acid sequences of cardosin B constructs. The sequences correspond to the PSI/linker regions of each construct.

(9) FIG. 8. Western-blot analysis of secreted cardosin B mutants. Activated samples (36 l) from ten randomly selected clones of each construct were examined using a specific antibody against cardosin B).

(10) FIG. 9. SDS-PAGE pattern of K-casein hydrolysed by different constructs of cardosin B. K-casein (6 g) was incubated at 37 C., for 20 minutes with a sample (1 l) of each cardosin B mutant. A negative control performed in a parallel experiment, by incubating K-casein with culture supernatant (1 l) of non transformed yeast cells (C).

(11) FIG. 10. Milk-clotting activity of cardosin B mutants. The milk-clotting activity was determined by mixing a skim milk solution (12%) prepared in 10 mM CaCl.sub.2 with the active recombinant enzymes. The same ten randomly selected clones analysed in western bot and k-casein cleavage were tested for milk-clotting activity. The incubations were performed at 37 C. and the milk-clotting time determined by visual observation. Clones of the same construct with similar milk-clotting times are represented only by one dot.

(12) FIG. 11. Summary of cardosin B construct studyone clone of each construct was selected and both k-casein and western-blot experiments were repeated in order to obtain a summarized figure of this study.

DETAILED DESCRIPTION OF THE INVENTION

(13) The details of one or more embodiments of the invention are set forth in the accompanying description below including specific details of the best mode contemplated by the inventors for carrying out the invention, by way of example. It will be apparent to one skilled in the art that the present invention may be practiced without limitation to these specific details.

(14) Milk Clotting and Cheese Making

(15) The use of aspartic proteases (Aps) in cheese manufacture is amongst the earliest applications of enzymes in food processing.sup.17.

(16) Enzymatic milk coagulation is a two-phase process. Stage one involves hydrolysation of Phe.sup.105-Met.sup.106 bond of bovine k-casein, splitting the protein molecule into two partspara-k-casein (hydrophobic) and the macropeptide (hydrophilic). In the second phase, the para-k-casein micelles (which were destabilised during proteolysis) are coagulated.

(17) As used herein, the term clotting is used interchangeably with coagulating.

(18) Chymosin, extracted from the abomasum of suckling calves, is specific for k-casein. However, Aps present in plant extracts cleave , and -caseins. This causes excessive acidity, bitterness and texture defects in cheese, but these characteristics are responsible for the special flavour, smell and consistency of the cheese varieties produced using these enzymes.

(19) Methods of making cheese may involve adding a coagulant enzyme such as a plant aspartic protease to induce coagulation, separating the milk into solid curds and liquid whey. A plurality of different enzymes may be used, for example Cardosin A and Cardosin B. The plurality of different enzymes may be obtained from different sources, for example a plant aspartic protease and an aspartic protease of animal origin. Alternatively, the enzymes may be obtained from the same source. The curds are separated from the whey. cutting may be used to enhance the separation of the curds from the whey, by increasing the surface area of the curds. Salt may be added. The curds are then pressed, often into a mold, to further promote the separation of the curds from the whey. The pressed curds are then optionally wrapped, and left to ripen to form the mature cheese.

(20) The plant aspartic proteases of the present invention are suited to the coagulation of milk and/or to cheese making because they may be readily produced in vitro, yet retain their specificity to -casein and ability to clot milk.

(21) Plant Aspartic Proteases

(22) In this specification a plant aspartic protease refers to and includes aspartic proteases that can be obtained from plant cells, or tissue, including whole plants. Plant aspartic proteases include cardosins, cyprosins, cenprosins, phytepsins and cynarases. In some cases, the plant aspartic protease according to the invention is not a phytepsin. As used herein the term plant aspartic protease includes mutants of such proteases, particularly mutants in which the PSI domain has been made non-functional. It is preferred that the mutation does not inactivate the aspartic protease function of the protein. In preferred embodiments the mutation is such that the resulting polypeptide retains at least 50%, more preferably one of at least 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity with the amino acid sequence of the wild type aspartic protease.

(23) The term modified plant aspartic protease as used herein describes a plant aspartic protease which contains one or more modifications as compared with a wild type plant aspartic protease. For example, it may contain one or more amino acid deletions, substitutions or additions as compared to the sequence of the plant aspartic protease as produced in a plant.

(24) Cardosins are examples of plant aspartic proteases, obtained from cardoon (Cynara cardunculus). The amino acid sequence of Cardosin A and Cardosin B is known (see SEQ ID NOs: 5 and 6).

(25) The inventors have developed a heterologous method of production for plant aspartic proteases in a GRAS yeast (K. lactis) that could be effectively transferred to scale-up production. They have used the K. lactis Protein Expression System from New England Biolabs and several optimization procedures were undertaken in order to enhance protein expression and secretion levels. Cardosin A and Cardosin B (a vacuolar and an extracellular aspartic protease from cardoon (Cynara cardunculus), respectively) were used as working models.

(26) Although some trafficking mechanisms in plants appear to be similar to those in yeasts there are several variations, particularly regarding the presence in plants of multiple vacuole types, that could result in the non-recognition of aspartic protease VSS's by yeast vacuolar sorting receptors. In fact, other plant VSS's of the CTPP type were previously shown not to be recognized in yeasts. Conversely, the results described herein indicate that some VSS's identified in plant aspartic proteases are recognized by yeast trafficking mechanisms and can be used to redirect protein sorting. These results show that the PSI domain is functional in plants and yeasts.

(27) Plant Specific Insert (PSI)

(28) When the inventors generated a construct of Cardosin B (which is normally localised extracellularly), lacking the PSI domain and expressed this in the K. lactis yeast, higher levels of expression and secretion were observed in the absence of the PSI, when compared to the full-length wild type construct. These results demonstrate that removal of the PSI domain from all plant aspartic proteases (either vacuolar or secreted) may have a positive impact on their secretion, in yeasts or in plants.

(29) The PSI is an insertion of approximately 100 amino acids located between the N-terminal domain and a C-terminal domain of the precursor preproenzymes of the majority of plant aspartic proteases so far identified. The PSI is only identified in plant aspartic proteases, and is highly similar to saposins and saposin-like proteins, whose biological function has not been completely established. Structurally, the PSI comprises five amphipathic -helices folded into a compact globular domain and linked with each other by three disulphide bridges (discussed in Simoes and Faro 2004.sup.3). The PSI sequence shows no homology with mammalian or microbial aspartic proteases but is highly similar to that of saposin-like proteins (SAPLIPs). A unique feature of the PSI is the swap of the N- and C-terminal portions of the saposin-like domain, where the C-terminal portion of one saposin is linked to the N-terminal portion of the other saposin. Hence the PSI is not a true saposin but a swaposin.

(30) The plant aspartic proteases described herein may lack a functional PSI domain. The PSI domain may be entirely or partially deleted, or mutated such that it is rendered non functional. Mutation may involve modification of an oligonucleotide sequence encoding the aspartic protease. For example, the modification may be an addition, deletion, insertion or substitution in the coding sequence.

(31) A PSI domain may have substantial identity to SEQ ID NO: 3, or SEQ ID NO: 4. A PSI domain may have at least 70% identity, at least 75% identity, at least 80% identity, at least 85% Identity, at least 90% identity, at least 95% identity, at least 98% identity, or 100% identity to SEQ ID NO: 3 or SEQ ID NO: 4.

(32) The PSI domain may have a length of any one of 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, or 150, amino acids. The PSI domain may have a length in the range 80, to 120 amino acids, or 90 to 110 amino acids, or 95 to 105 amino acids, or 98 to 108 amino acids. The PSI domain may have a minimum length of about 80 amino acids, more preferably one of 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103; 104, 105, or 106 amino acids. The PSI domain may have a maximum length of about 130 amino acids, more preferably one of 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, or 129 amino acids.

(33) The PSI domain of a plant aspartic protease functions to regulate trafficking of cardosins in the cell, for example targeting the protein to the vacuole. Thus, plant aspartic proteases according to the invention, which lack a functional PSI domain have altered trafficking, for example as compared to plant aspartic proteases that contain a complete PSI domain. For example, a modified aspartic protease that lacks a functional PSI domain may not be targeted to the vacuole, whereas the unmodified aspartic protease, such as the wild type protein, might be targeted to the vacuole.

(34) The skilled person may readily determine whether an aspartic protease lacks a functional PSI domain by any suitable method known in the art. For example agents known to affect protein trafficking (e.g. glycosidases) may be applied to a cell to determine whether trafficking of the modified aspartic protease is affected by the agent in the same or a similar way to the complete, or wild type, plant aspartic protease. Alternatively, or additionally, subcellular fractionation may be used to determine whether the modified and complete, or wild-type, aspartic proteases are present in a similar distribution within a cell. Alternatively, or additionally, immunocytochemistry may be used to determine whether the protein is secreted from the cell, or present in a different cellular compartment, to a complete, or wild type, plant aspartic protease.

(35) The lack of a functional PSI domain may be sufficient to stop the plant aspartic protease collecting in the vacuole and/or to increase secretion of the plant aspartic protease from the cell. In some cases, the lack of a functional PSI domain may entirely prevent the plant aspartic protease being localised to the vacuole such that substantially all of the plant aspartic protease produced by the cell is secreted from the cell.

(36) The plant aspartic acid which lacks a functional PSI domain may be any plant aspartic acid. Preferably, the plant aspartic acid is from the Cardosin family of plant aspartic proteases, i.e. a mutant or modified Cardosin that lacks a functional PSI domain. In some cases the plant aspartic protease may be further mutated.

(37) Modification of the PSI domain to render it non-functional may affect the kinetic properties of the plant aspartic protease. For example, the modified plant aspartic protease may be less caseinolytic as compared to the naturally occurring, or wild-type, plant aspartic protease. In some cases, modification of the PSI may increase the specificity of the plant aspartic protease for a substrate. For example, it may increase the specificity of the plant aspartic protease for -casein.

(38) Pro Segment

(39) The prosegment is located in the N-terminal of plant aspartic proteases. It is present in the precursor protein and is normally removed by proteolysis during production of the mature, active, enzyme from the Inactive zymogen. In some cases, the plant aspartic proteases according to the invention are expressed with a prosegment. The prosegment comprises approximately 44 amino acids.

(40) C-Terminal Sequence

(41) The C-terminal sequence Is a putative enzyme sorting signal. Certain plant aspartic proteases may lack 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acid residues, preferably 4 amino acids, from the C terminus, as compared to the naturally occurring form of the aspartic protease. For example, modified cardosin A according to the invention may lack AEAA from the C-terminus and cardosin B may lack AEAV.

(42) Linkers

(43) As used herein, the term linker denotes a series of amino acid resides which are introduced into a protein sequence to replace amino acid residues which have been removed. For example, the plant aspartic proteases of the present invention lack a functional PSI domain. Where the PSI domain is fully or partially deleted from the plant aspartic protease of the invention, the deleted amino acids may be replaced by a linker. The linker may allow two or more regions of the protein containing it to fold into the correct three dimensional configuration.

(44) The linker may comprise one or more amino acids. The amino acids may all be the same, for example a plurality of glycine residues. Alternatively, the amino acids may be different. The linker may comprise a sequence corresponding to a scrambled sequence of the PSI domain.

(45) The linker may comprise between 1 and 100, between 1 and 50, between 1 and 25 or between 1 and 10 amino acids. The linker may comprise 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids. In some cases, the linker consists of 1 to 7 amino acid residues.

(46) The presence of a linker may affect the kinetic properties of the plant aspartic protease. For example, the Introduction of a linker may render the plant aspartic protease less caseinolytic as compared to the naturally occurring, or wild-type, plant aspartic protease. In some cases, the linker may increase the specificity of the plant aspartic protease for a substrate. For example, the introduction of a linker may increase the specificity of the plant aspartic protease for -casein.

(47) Cardosins

(48) In this specification, a Cardosin nucleic acid may be any nucleic acid (DNA or RNA) having a nucleotide sequence which encodes a polypeptide having a specified degree of sequence identity to one of SEQ ID No.s 5 and 6 to an RNA transcript of any one of these sequences, to a fragment of any one of the preceding sequences or to the complementary sequence of any one of these sequences or fragments. Alternatively a Cardosin nucleic acid may be one that hybridises to one of these sequences under high or very high stringency conditions. The specified degree of sequence identity may be from at least 60% to 100% sequence identity. More preferably, the specified degree of sequence identity may be one of at least 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

(49) In this specification, a Cardosin polypeptide may be any peptide, polypeptide or protein having an amino acid sequence having a specified degree of sequence identity to one of SEQ ID NO.s 1, 2, 5 or 6 or to a fragment of one of these sequences. The cardosin may be, or have a specified degree of sequence identity to, cardosin A as deposited at GenBank under accession number Q9XFX3.1 (GI: 75267434). The cardosin may be, or have a specified degree of sequence identity to, cardosin B as deposited at GenBank under accession number Q9XFX4.1 (GI: 75338567).

(50) The specified degree of sequence identity may be from at least 60% to 100% sequence identity. More preferably, the specified degree of sequence identity may be one of at least 65%, 70%, 75%, 80%, 85%; 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

(51) Sequence Identity

(52) Percentage (%) sequence identity is defined as the percentage of amino acid residues in a candidate sequence that are identical with residues in the given listed sequence after aligning the sequences and Introducing gaps if necessary, to achieve the maximum sequence identity, and not considering any conservative substitutions as part of the sequence identity. Sequence identity is preferably calculated over the entire length of the respective sequences.

(53) Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways known to a person of skill in the art, for instance, using publicly available computer software such as ClustalW 1.82. T-coffee or Megalign (DNASTAR) software. When using such software, the default parameters, e.g. for gap penalty and extension penalty, are preferably used. The default parameters of ClustalW 1.82 are: Protein Gap Open Penalty=10.0, Protein Gap Extension Penalty=0.2, Protein matrix=Gonnet, Protein/DNA ENDGAP=1, Protein/DNA GAPDIST=4.

(54) In certain aspects the invention concerns compounds which are isolated peptides/polypeptides comprising an amino acid sequence having a sequence identity of at least 60% with a given sequence. Alternatively, this identity may be any of 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity.

(55) Identity of nucleic acid sequences may be determined in a similar manner involving aligning the sequences and introducing gaps if necessary, to achieve the maximum sequence identity, and calculating sequence identity over the entire length of the respective sequences.

(56) In certain aspects the invention concerns compounds which are isolated nucleic acids comprising a nucleotide sequence having a sequence identity of at least 60% with a given sequence. Alternatively, this identity may be any of 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity.

(57) Certain aspects of the invention relate to complete plant aspartic proteases (i.e. comprising substantially all domains present in the wild-type protein). For example, Cardosin A may have an amino acid sequence having a specified degree of sequence identity to SEQ ID NO: 3, or Cardosin B may have an amino acid sequence having a specified degree of sequence identity to SEQ ID NO: 4.

(58) Preferably, the plant aspartic proteases of the invention lack a functional PSI domain. For example, Cardosin B may have an amino acid sequence having a specified degree of sequence identity to SEQ ID NO: 1, and Cardosin A may have an amino acid sequence having a specified degree of sequence identity to SEQ ID NO: 2.

(59) A fragment may comprise a nucleotide or amino acid sequence encoding a portion of the corresponding full length sequence. In this specification the corresponding full length sequence may be one of SEQ ID No.s 1, 2, 5, or 6. Said portion may be of defined length, and may have a defined minimum and/or maximum length.

(60) Accordingly, the fragment may comprise at least, i.e. have a minimum length of, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98 or 99% of the corresponding full length sequence. The fragment may have a maximum length, i.e. be no longer than, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 85, 90, 95, 96, 97, 98 or 99% of the corresponding full length sequence. The fragment may have a length anywhere between the said minimum and maximum length.

(61) The fragment may comprise at least, i.e. have a minimum length of, at least 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 377, 380, 383, 400, 420, 440, 460, 480 or 500 amino acids. The fragment may have a maximum length, i.e. be no longer than, 220, 240, 260, 280, 300, 320, 340, 360, 377, 380, 383, 400, 420, 440, 460, 480 or 483 amino acids.

(62) In some embodiments the plant aspartic protease may be a mutant or modified plant aspartic protease, such as a mutant or modified Cardosin. The plant aspartic protease may be mutated relative to the wild-type or genomic plant aspartic protease, carrying one or more alterations to the nucleic acid encoding the plant aspartic protease and/or to the amino acid sequence of the plant aspartic protease. The alteration may take the form of an addition, insertion, substitution or deletion.

(63) In some embodiments of the Invention the plant aspartic protease is mutated such that it does not have a functional PSI domain. In some cases, the PSI domain is entirely or substantially absent. In others at least one mutation is included in the protein and/or nucleic acid sequence such that the PSI domain of the aspartic protease is not fully transcribed, is Incorrectly transcribed, or is otherwise non functional. Mutations may be point mutations or larger mutations, wherein one or more base pairs of the nucleic acid sequence encoding the aspartic protease are added, substituted, deleted or inserted. In some cases, the mutation is one that causes the subsequent nucleic acids to be transcribed out of frame, thereby producing a non-functional protein product. In other cases, mutation of a single base pair causes an alteration in the protein sequence such that the protein product is non functional. Where the mutation causes subsequent nucleic acids to be transcribed out of frame it may be necessary to include a further change downstream of the first mutation in order to restore transcription of a subsequent part of the protein, e.g. after some or all of the PSI domain, back into frame.

(64) Methods for introducing mutations are known in the art, and the skilled person will readily appreciate suitable methods for creating a modified or mutant plant aspartic protease according to the invention. Preferably, mutations are Introduced by site directed mutagenesis, for example through PCR mutagenesis. PCR mutagenesis is a method for generating point mutations on a double stranded plasmid and involves the use of two synthetic oligonucleotide primers containing the desired mutation, each complementary to the opposite strands of a vector containing the plant aspartic protease to be mutated.

(65) Methods of Producing a Plant Aspartic Protease

(66) Plant aspartic proteases may be produced according to any method known in the art, such as microbial fermentation, plant, insect or mammalian cell culture.

(67) Certain methods according to the invention involve expressing a plant aspartic protease that lacks a functional PSI domain in a cell. The method optionally further comprises the step of collecting plant aspartic protease that has been secreted from the cell.

(68) Molecular biology techniques suitable for the producing plant aspartic proteases according to the invention in cells are well known in the art, such as those set out in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989

(69) The plant aspartic protease may be expressed from a nucleotide sequence encoding the plant aspartic protease. The nucleotide sequence may be contained in a vector present in the cell, or may be incorporated into the genome of the cell.

(70) A vector as used herein is an oligonucleotide molecule (DNA or RNA) used as a vehicle to transfer foreign genetic material into a cell. The vector may be an expression vector for expression of the foreign genetic material in the cell. Such vectors may include a promoter sequence operably linked to the nucleotide sequence encoding the gene sequence to be expressed. A vector may also include a termination codon and expression enhancers. Any suitable vectors, promoters, enhancers and termination codons known in the art may be used to express plant aspartic proteases from a vector according to the invention. Suitable vectors include plasmids, binary vectors, viral vectors and artificial chromosomes (e.g. yeast artificial chromosomes).

(71) In this specification the term operably linked may include the situation where a selected nucleotide sequence and regulatory nucleotide sequence (e.g. promoter and/or enhancer) are covalently linked in such a way as to place the expression of the nucleotide sequence under the influence or control of the regulatory sequence (thereby forming an expression cassette). Thus a regulatory sequence is operably linked to the selected nucleotide sequence if the regulatory sequence is capable of effecting transcription of the nucleotide sequence. Where appropriate, the resulting transcript may then be translated into a desired protein or polypeptide.

(72) Any cell suitable for the expression of polypeptides may be used for producing plant aspartic proteases according to the invention. The cell may be a prokaryote or eukaryote. Preferably the cell is a eukaryotic cell such as a yeast cell, a plant cell, insect cell or a mammalian cell. In some cases the cell is not a prokaryotic cell because some prokaryotic cells do not allow for the same post-translational modifications as eukaryotes. In addition, very high expression levels are possible in eukaryotes and proteins can be easier to purify from eukaryotes using appropriate tags. Specific plasmids may also be utilised which enhance secretion of the protein into the media.

(73) In some embodiments the cell is not a plant cell, or a plant protoplast cell.

(74) In some preferred embodiments the cell is a fungi (including yeasts and molds) or microbial eukaryote, or single cell eukaryote, preferably a yeast of the genus Kluyveromyces, Rhizomucor, Endothia, Apergillus or Saccharomyces.

(75) Suitable yeast cells include Kluyveromyces lactis, Kluyveromyces marxianus, Rhizomucor meihei, Endothia parasitica, Rizomucor pusillus, Pichia pastoris, Aspergillus niger, Apsergillus oryzae and Saccharomyces cerevisae. The yeast may be a GRAS (Generally Regarded As Safe) yeast, i.e. a yeast that has GRAS status from the Food and Drug Administration (FDA).

(76) Methods of producing the plant aspartic protease may involve culture or fermentation of a eukaryotic cell modified to express the plant aspartic protease. The culture or fermentation may be performed in a bioreactor provided with an appropriate supply of nutrients, air/oxygen and/or growth factors. Secreted proteins can be collected by partitioning culture media/fermentation broth from the cells, extracting the protein content, and separating individual proteins to isolate secreted aspartic protease. Culture, fermentation and separation techniques are well known to those of skill in the art.

(77) Bioreactors include one or more vessels in which cells may be cultured. Culture in the bioreactor may occur continuously, with a continuous flow of reactants into, and a continuous flow of cultured cells from, the reactor. Alternatively, the culture may occur in batches. The bioreactor monitors and controls environmental conditions such as pH, oxygen, flow rates into and out of, and agitation within the vessel such that optimum conditions are provided for the cells being cultured.

(78) Following culture of cells that express a plant aspartic protease, the plant aspartic protease is preferably isolated. Any suitable method for separating proteins from cell culture known in the art may be used. In order to isolate a protein of interest from a culture, it may be necessary to first separate the cultured cells from media containing the protein of interest. If the protein of interest is secreted from the cells, the cells may be separated from the culture media that contains the secreted protein by centrifugation. If the protein of interest collects within the cell, for example in the vacuole of the cell, it will be necessary to disrupt the cells prior to centrifugation, for example using sonification, rapid freeze-thaw or osmotic lysis. Centrifugation will produce a pellet containing the cultured cells, or cell debris of the cultured cells, and a supernatant containing culture medium and the protein of interest.

(79) It may then be desirable to isolate the protein of interest from the supernatant or culture medium, which may contain other protein and non-protein components. A common approach to separating protein components from a supernatant or culture medium is by precipitation. Proteins of different solubilities are precipitated at different concentrations of precipitating agent such as ammonium sulfate. For example, at low concentrations of precipitating agent, water soluble proteins are extracted. Thus, by adding different increasing concentrations of precipitating agent, proteins of different solubilities may be distinguished. Dialysis may be subsequently used to remove ammonium sulfate from the separated proteins.

(80) Other methods for distinguishing different proteins are known in the art, for example ion exchange chromatography and size chromatography. These may be used as an alternative to precipitation, or may be performed subsequently to precipitation.

(81) Once the protein of interest has been isolated from culture it may be necessary to concentrate the protein. A number of methods for concentrating a protein of interest are known in the art, such as ultrafiltration or lyophilisation.

(82) A plant aspartic protease that has been isolated from a cell may be mixed with a carrier, adjuvant or diluent to form a product comprising a composition containing the plant aspartic protease. The product formed may be of any kind, e.g. liquid, solid, powder, cream and may be suitable for at least any of the following uses: as a detergent or washing powder, as a food modifier, as a meat tenderiser, as a milk coagulant, as a stain remover, as a leather softener, as a rennet substitute.

(83) Methods for Promoting Accumulation of a Polypeptide of Interest

(84) The invention also provides methods for promoting the accumulation of a polypeptide of interest in the vacuole of a cell, particularly a plant cell. Such methods involve expressing a polypeptide construct in the cell, the construct comprising the amino acid sequence of the polypeptide of interest and the amino acid sequence of a PSI domain. The amino acid sequences are preferably covalently linked to form a single contiguous amino acid sequence forming the polypeptide construct. As such, in some embodiments, the polypeptide construct may be a fusion protein.

(85) The PSI domain may be included in the amino acid sequence of the construct at any position. In some embodiments the PSI domain may be added at any one of the N-terminus, C-terminus or a position between the N- and C-termini.

(86) The polypeptide of interest can be any polypeptide, but is preferably not a polypeptide that normally (i.e. in the wild type sequence) encodes a PSI domain. For example, in some embodiments the polypeptide of Interest is not an aspartic protease, and in some embodiments the polypeptide of interest is not a plant aspartic protease.

(87) The polypeptide of interest Is preferably a polypeptide that forms a protein having a measurable activity, e.g. binding to another molecule, or enzyme activity. The polypeptide construct preferably retains such a measurable activity, although the level of activity may be reduced or increased compared to the wild type polypeptide of interest. As such, the polypeptide will typically have a minimum length of at least about 50 amino acids, and more preferably one of about 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 amino acids.

(88) In some other embodiments the polypeptide of interest may be a small peptide, and may have a length of less than about 50 amino acids.

(89) The polypeptide construct may be expressed from a nucleotide sequence encoding the polypeptide construct. The nucleotide sequence may be contained in a vector present in the cell, or may be incorporated into the genome of the cell.

(90) Molecular biology techniques suitable for the producing plant aspartic proteases according to the invention in cells are well known in the art, such as those set out in Sambrook et al., Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989

(91) The details of one or more embodiments of the invention are set forth in the accompanying description below including specific details of the best mode contemplated by the inventors for carrying out the invention, by way of example. It will be apparent to one skilled in the art that the present invention may be practiced without limitation to these specific details.

EXAMPLES

Example 1Synthesis of Cardosin B in K. lactis

(92) Strains and Growth Conditions

(93) All plasmid constructions and propagations were performed using the Escherichia coli strain Top10F (Invitrogen). The bacterial cells were grown at 37 C. in LB (Miller's FormulationInvitrogen) liquid and solid (1.5% agar) medium, supplemented with ampicillin at 100 g/ml (GE-Healthcare). The Kluyveromyces lactis GG799 strain was purchased from New England Biolabs and used as host strain to the recombinant protein expression studies. K. lactis cells were grown and maintained in YPD media (2% bactopeptone, 1% yeast extract, 2% glucose) whereas the expression experiments were performed in YPGal (2% bactopeptone, 1% yeast extract, 4% galactose) as culture media, both at 30 C. with shaking. The recombinant K. lactis cells were selected on solid Yeast Carbon Base (New England Biolabs) supplemented with 5 mM acetamide (New England Biolabs) plates.

(94) proCardosinBPSI pKLAC1 Sub Cloning

(95) The cloning and subcloning procedures were performed according to the manufacturers' instructions and using standard molecular biology cloning techniques. The construct proCardosinB lacking the PSI region (pCBPSI, also referred to herein as Bwo) was amplified by PCR, using the construct pCBPSI/TA as template, In order to introduce upstream and downstream of the cDNA the restriction sites XhoI and SalI, respectively. The pair of oligonucleotides used in the PCR reaction were:

(96) TABLE-US-00001 pCB-XhoI (CTCGAGAAAAGAATGGTCTCCAACGGCGGATTGCTTC [SEQIDNO:7]) and pCB-SaII (GTCGACTCAAACTGCTTCTGCAAATCCCACTCGTAAC [SEQIDNO:8]).

(97) After amplification the PCR product was cloned into pGEM (Promega) cloning vector and afterwards subcloned into the integrative expression pKLAC1 (NEB). The subcloning process was performed by cleavage/ligation at the XhoI/SalI restriction sites, resulting in pCBPSI cloning in frame with the -mating factor secretion leader sequence.

(98) K. lactis Recombinant Strains Construction

(99) The recombinant plasmid pCBPSI/pKLAC1 was linearized by SacII (NEB) digestion, in order to obtain the insertion cassette fragments that were afterwards used in K. lactis transformation step. A total of 2 g DNA was used in K. lactis GG799 transformation. This process was performed by electroporation with a Gene Pulser (BioRad) apparatus, using the following electroporation conditions: 1.5 KV, 25 mF and 200 Ohm. The positive transformants were selected based on their ability to growth on YCB acetamide media, and the multi-integrants clones selected by whole-cell PCR, following the instructions described on the K. lactis expression Kit protocols (NEB).

(100) Heterologous pCBPSI Mutants Expression and Purification

(101) An integrative recombinant K. lactis clone was selected for pCBPSI construct and was grown in YPD media, at 30 C. with shaking, for 16 h. The cultures were diluted to an OD600 nm of 0.3 in YPGal media and incubated at 30 C., with shaking for 4 days. Thereafter the cultures were centrifuged and the supernatants sequentially filtered through 0.8 m, 0.45 m and 0.2 m filters. The samples were concentrated and activated by dilution 1:10 with 0.5M sodium acetate buffer pH4.0, at 37 C. A size exclusion chromatography was the first purification step. The samples were applied to a S200 26/60 column (GE-Healthcare) and the proteins were eluted with buffer 20 mM Tris-HCl pH7.5, 0.1M NaCl at a flow rate of 1 ml/min.

(102) The fractions with milk clotting activity were pooled and applied to an ionic exchange on a Mono Q, using the buffer 20 mM Tris-HCl pH7.5. The proteins were then eluted with a linear gradient of 0-0.5M NaCl, at a flow rate of 0.75 ml/min. Both expression and purification procedures were followed by SDS-PAGE analysis (see FIG. 1).

(103) Milk Clotting Activity Assays

(104) The milk clotting activity was tested by using a skim milk solution at 12% in 10 mM CaCl.sub.2. The supernatants and the purified fractions were mixed with the milk solution and incubated at 37 C. The clotting time was determined by visual observation.

(105) This expression and purification method results in the production of a plant origin-based enzyme in considerable amounts (3 mg/L) and with a high purity level.

Example 2Milk Clotting Activity of Recombinant Cardosin

(106) VRen Preparation

(107) The recombinant strain described in Example 1 was grown in YPD medium and the enzyme expression was induced by changing the medium to YPGal. After enzyme production, the culture medium was isolated from the cellular material by centrifugation and filtration, and it was acidified to pH 5.0 in order to activate the enzyme (this processed supernatant is the rennet preparation and it is hereby named VRen). The VRen used in the milk clotting studies using raw and pasteurized milk, was additionally subjected to a concentration step.

(108) Study of the Milk Clotting Activity of VRen Using Skim Milk

(109) The milk clotting activity of VRen was initially tested using a skim milk solution, in test tubes, at 37 C. A sample of 100 l culture medium resultant from pCB construct expression in a yeast expression system, was added to 1 ml of 12% skim milk solution prepared in 10 mM CaCl.sub.2. The mixture was incubated at 37 C. and the milk clotting time was determined by visual observation. The milk coagulation occurred after an Incubation time of approximately 30 minutes.

(110) Study of Milk Clotting Activity of VRen Using Raw and Pasteurized Milk

(111) The cheese manufacture using VRen as milk clotting agent was tested using three types of milk: sheep, goat and cow and the cheesemaking procedure was similar for all types of cheeses. Each cheese was produced by using 3 L of milk, and depending on the milk type different quantities of VRen were used (table I) in order to obtain a clotting time of approximately 40 minutes. The process was initiated by the addition of both VRen and salt (15 g/L) to the milk sample and subsequently incubation of the mixture in a water-bath at 32 C., allowing the curd formation and syneresis initiation. Once formed, the curd was cut both wayshorizontally and verticallywith a spatula, accelerating the syneresis process. The release of the whey from the curd was allowed to occur for another 5 minutes, preceding the whey draining and curd pressing process. After a manual pressing in plastic moulds, the curd was compressed using a press resulting in the complete release of the whey. Finally, the cheese was incubated in a maturation chamber for three weeks (FIG. 3).

(112) TABLE-US-00002 TABLE I Amount of VRen used in the coagulation process of different types of milk Enzyme (mg)/Cheese Milk Enzyme (mg)/Milk (L) (kg) Goat (raw) 3.1 31.4 Sheep (raw) 1.5 10.2 Sheep (pasteurized) 1.4 8.4 Sheep (Bordaleira) 2.0 10.3 Cow (pasteurized) 6.6 56.4

Example 3Kinetic Properties of Modified Cardosin

(113) Using the fluorogenic peptide (MCA)Lys-Lys-Pro-Ala-Glu-Phe-Phe-Ala-Leu-Lys(DNP) the kinetic properties of the truncated cardosin produced in Example 2 were compared with native cardosin B. The observed differences suggest that this truncated construct is less efficient in cleaving this substrate, in comparison with native cardosin B.

(114) TABLE-US-00003 TABLE II Kinetic parameters of modified versus wild type cardosin B Km VMax kcat/Km (uM1 (uM) (umol/sec) kcat (sec1) sec1) nCB 1.4 6.36 106 24 17.1 pCBPSI 8.7 2.15 105 36.5 4.2

(115) Thus, the introduction of a 3 Gly linker in place of the PSI domain changes the kinetic parameters of cardosin B and thus the catalytic efficiency of the enzyme.

(116) Differences in specificity between recombinant single-chain cardosin B produced in this work and native cardosin B were observed when specificity profiles towards -casein were compared by RP-HPLC. See FIG. 4.

(117) Recombinant cardosin B (pCBPSI) displayed a more restricted specificity towards this milk protein which results in the formation of a reduced number of proteolytic fragments in comparison with native cardosin B (nCB, black line).

(118) Thus, the presence of the linker altered, but did not prevent, enzymatic activity.

Example 4Modified Cardosin A Constructs

(119) A strategy to enhance the secretion levels of recombinant cardosin A has been developed in order to improve the production yield. This strategy has comprised the manipulation of two regions of the enzyme: the PSI domain and the C-terminal region. Different mutants of cardosin A were constructed, by protein engineering, as shown in FIG. 5, and as set out in Table III.

(120) TABLE-US-00004 TABLE III Description of Cardosin A constructs Group Construct Description Manipulation of PSI pCAPSI Deletion of PSI region domain Manipulation of PSI pCA(PSIB) Swap of PSI domain of cardosin B domain to cardosin A Manipulation of pCAAEAA Deletion of C-terminal sequence C-terminal domain (AEAA) Manipulation of pCA(PSIB) Deletion of C-terminal sequence C-terminal domain AEAA (AEAA) of pCA(PSIB) construct Manipulation of pCA_FAEAV Mutation of C-terminal amino acid C-terminal domain to a valine, in order to mimic the C-terminal sequence of cardosin B
Production of Recombinant Mutants of Cardosin A

(121) The constructs were obtained by standard recombinant DNA methodologies and the cDNA of each construct was introduced into genomic DNA of K. lactis. The integration was performed by homologous recombination, confirmed by colony PCR and then several clones of each construct were randomly selected for protein production. After enzyme production in YPGal medium, the cultures were isolated from the cellular material by centrifugation and then acidified to pH 4.5, in order to activate the recombinant enzyme. These activated samples were used in -casein hydrolysis experiments. For milk-clotting studies the activated samples were additionally subjected to a concentration step.

(122) Milk-Clotting Activity of Cardosin A Constructs

(123) The milk-clotting activity of each construct was tested using a skim milk solution, in test tubes, at 37 C. An aliquot (100 l) of activated and concentrated sample was added to 1 ml of 12% skim milk solution prepared in 10 mM CaCl.sub.2. The mixture was incubated at 37 C. and the milk-clotting time was determined by visual observation.

(124) TABLE-US-00005 TABLE IV Milk-clotting activity of different cardosin A constructs Construct Concentration Milk clotting time pCAPSI 40x 60 min pCAAEAA 20x 50 min pCA_FAEAV 10x 90 min pCA(PSIB) 20x 30 min

(125) Some clones of the different constructs were able to clot skim milk, at an acceptable milk-clotting time (Table IV).

(126) Hydrolysis of -Casein by Cardosin A Constructs

(127) Proteolysis of -casein by recombinant enzymes was studied by SDS-PAGE. Commercial -casein was dissolved in water and then diluted in 0.1 M sodium phosphate buffer pH 6.8, to a final concentration of 0.3 mg/ml. Extract samples (0.25 l per l of reaction volume) were incubated with -casein and the digestion reaction was allowed to proceed at 37 C., for 2 hours. The reactions were stopped by heating the samples at 90 C., for 10 minutes, in the presence of denaturant solution. The digestions were analyzed by SDS-PAGE.

(128) The caseinolytic activity of cardosin A constructs was demonstrated by detection of a 15 kDa band after the incubation period. As shown in FIG. 6, the enzymatic activity towards -casein was slower for clone pCA_FAEAV.

(129) Conclusions:

(130) This study revealed that manipulation of PSI and/or C-terminal regions of cardosin A has improved enzyme production to detectable levels. The manipulation of these regions resulted in the production of cardosin A mutants with milk-clotting activity and enzymatic activity towards -casein.

(131) Our data support the prediction that PSI acts as a vacuolar sorting signal because it was possible to detect milk-clotting activity/-casein digestion with the constructs where the PSI domain of cardosin A was absent or swapped with the sequence of the PSI domain of cardosin B, which is consistent with increased cardosin A secretion. Because cardosin B is an extracellular enzyme we hypothesised that cardosin B PSI domain could be differentially recognized/processed during protein transport and our results with pCA(PSIB) and pCA(PSIB)AEAA further corroborate this initial assumption.

(132) TABLE-US-00006 TABLE V Summary of collected data. Milk-Clotting (sample Enzymatic Positive clone/ concentration, activity (- Construct total clones time) casein) pCAPSI 1/20 [40x], 60 pCAAEAA 1/21 [20x], 50 pCA_FAEAV 5/10 [10x], 90 pCA(PSIB) 19/20 [20x], 30 pCA(PSIB)AEAA 8/10

Example 6Modified Cardosin B Constructs

(133) The following cardosin B constructs were tested:

(134) Group I: deletion of the entire PSI domain+linkers of different sizes and sequences

(135) Group II: deletion of the entire PSI domain with no linker

(136) Group III: partial deletion of the PSI domain+/different linkers

(137) List of Constructs

(138) The pCBPSI clone (VRen) contains a linker of 3 Glycine residues between the heavy chain and light chain of enzyme. Based on this, different mutants were designed for each group of constructs as shown in Table VI below. An alignment of partial sequences of the construct corresponding to the PSI/linker region of each construct is shown in FIG. 7.

(139) TABLE-US-00007 TABLE VI Description of cardosin B constructs Group of constructs Clone Description I pCBPSI_4G Linker with different size (4 Glycine residues) I pCBPSI_6G Linker with different size (6 Glycine residues) I pCBPSI_NQG Linker with same size but different sequence (NQG) II pCBPSILK Deletion of the entire PSI domain (without linker) III pCBPSI_2C Partial removal of PSI: construct identical to the activated form of recombinant cardosin A, produced in E. coli expression system III pCBPSIloop Partial removal of PSI: the PSI domain is composed by 5 -helices and a loop region localized between the third and fourth -helices. This construct contains a PSI without the loop region.
Molecular Cloning of Cardosin B Constructs and Recombinant Enzyme Production.

(140) All mutants, excepting both pCBPSI_2C and pCBPSIloop, were obtained by site-directed mutagenesis using the clone pCBPSI as template and a pair of primers adequate for each construction. The constructs pCBPSI 2C and pCBPSIloop were obtained using the cross-over PCR technique, with an appropriate pair of primers and cDNA of cardosin B as template. The cDNA of each construct was introduced into genomic DNA of expression yeast, by homologous recombination. The integration was confirmed by colony PCR and ten clones of each construct were randomly selected for protein production in YPGal medium. After enzyme production, the culture medium was isolated from the cellular material by centrifugation and then acidified to pH 4.5, in order to activate the enzyme. These activated samples were used in the following experiments.

(141) Analysis of the Expression Levels by Western Blot

(142) The expression of cardosin B mutants was observed by Western blot. Samples were incubated with denaturant solution and loaded in 12.5% polyacrylamide gels for SDS-PAGE. Following electrophoretic separation, proteins were blotted into a PVDF membrane and immunodetected using an antibody specific for cardosin B (see FIG. 8). The results have shown that all constructs were expressed and secreted, however some differences in the secretion levels were observed. Both constructs pCBPSI_2C and pCBPSIloop (group III) displayed lower levels of secretion in comparison with the remaining constructs, suggesting an influence of the PSI region in the secretion levels of the enzyme. Moreover, the processing of these constructs is also different, with the detection of a band with lower molecular weight.

(143) Hydrolysis of -Casein by Cardosin B Constructs

(144) Proteolysis of -casein by recombinant enzymes was studied by SDS-PAGE. Commercial -casein was dissolved in water and then diluted in 0.1 M sodium phosphate buffer pH 6.8, to a final concentration of 0.3 mg/ml. Extract samples (0.05 l per l of reaction volume) were incubated with -casein and the digestion reaction was allowed to proceed at 37 C., for 15 minutes. The reactions were stopped by heating the samples at 90 C., for 10 minutes, in the presence of denaturant solution. The digestions were analyzed by SDS-PAGE.

(145) After the incubation period, a band of about 15 kDa was observed (para--casein) for all reactions. The proteolysis was slower for pCBPSI_2C and pCBPSIloop probably due to the reduced secretion levels of these constructs (as shown in FIG. 9).

(146) Milk-Clotting Activity of Cardosin B Constructs

(147) The milk-clotting activity of each construct was tested using a skim milk solution, in test tubes, at 37 C. A sample of 100 l culture medium resultant from pCB construct expression in a yeast expression system, was added to 1 ml of 12% skim milk solution, prepared in 10 mM CaCl.sub.2. The mixture was incubated at 37 C. and the milk-clotting time was determined by visual observation, and the results are shown in FIG. 10.

(148) Once again, all constructs excepting pCBPSI_2C and pCBPSIloop were able to clot skim milk (for these two constructs, milk-clotting activity was observed only after a 16 h incubation period), which likely reflects their low production efficiency.

(149) TABLE-US-00008 TABLE VII Milk-clotting activity of different cardosin B constructs Positive Milk Milk-Clotting clone/ Clotting (sample total time (lowest concentration, Construct clones time) time) pCBPSI 10/10 40 pCBPSI_4G 10/10 50 pCBPSI_6G 10/10 75 pCBPSI_NQG 9/10 40 pCBPSILinker 10/10 40 pCBPSI_2C 9/10 16 h pCBPSILoop 9/10 16 h
Conclusions

(150) A summary of the results of this study are shown in FIG. 11, in which one clone of each construct was selected and both k-casein and western lot experiments were repeated. This study revealed that different constructs of cardosin B exhibit significant expression and secretion yields and good milk-clotting and caseinolytic activity, conditions that are required for cheese manufacturing. Moreover, it was possible to verify that the partial removal of PSI domain influence protein production without impairing caseinolytic activity.

REFERENCES

(151) 1 Vitale A & Hinz G, 2005. Trends in Plant Sci, 10(7): 316-323 2 Trmkangas K et al, 2001. Plant Cell, 13: 2021-2032 3 Simes I & Faro C, 2004. Eur. J. Biochem. 271, 2067-2075 4 Trmkangas K et al, 2001. Plant Cell, 13: 2021-2032 5 Ramalho-Santos M et al, 1998. Eur J Biochem, 255: 133-138 6 Duarte A S, et al, 2005. Current Drug Disc Tech, 2: 37-44 7 PCT Patent publication No WO9507687 8 Patent publication No JP2000247907 9 US patent publication No US2003040047 10 Verissimo P et al (1996) Eur J Biochem. 235(3):762-8. 11 Verissimo P et al (1996) Eur J Biochem, 762-768 12 Chu T C, 1997. Medicine, 25:30-33 13 Smithard A et al, 2001. Br J Dermatol, 145:274-279 14 Pearl A et al, 1998. N Z Med J, 111:269-271 15 Cunliffe W J, 1998. J Cutan Med Surg, 2(suppl 3):7-13 16 Fowler J F et al, 2008. J Am Acad Dermatol, 59(5):772-80 17 Horn E J et al, 2007. J Am Acad Dermatol, 57(6):963-71 18 Egas C et al, 2000. J. Biol. Chem, 275, 38190-38196 19 Claverie-Martin et al, 2007. Industrial Enzymes 207-219