Peptide/?-1,3-glucan complex and production method thereof and pharmaceutical composition containing peptide/?-1,3-glucan complex
10195270 ยท 2019-02-05
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2740/16034
CHEMISTRY; METALLURGY
A61K47/643
HUMAN NECESSITIES
C12N15/117
CHEMISTRY; METALLURGY
C07K19/00
CHEMISTRY; METALLURGY
C12N2710/16634
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
C12N2770/32634
CHEMISTRY; METALLURGY
C12N2760/16134
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
A61K47/61
HUMAN NECESSITIES
C12N2730/10134
CHEMISTRY; METALLURGY
A61K39/39
HUMAN NECESSITIES
A61K39/292
HUMAN NECESSITIES
C12N2760/18034
CHEMISTRY; METALLURGY
A61K47/646
HUMAN NECESSITIES
A61K2039/55561
HUMAN NECESSITIES
A61K47/549
HUMAN NECESSITIES
A61K39/015
HUMAN NECESSITIES
International classification
C12N7/00
CHEMISTRY; METALLURGY
A61K39/39
HUMAN NECESSITIES
C12N15/117
CHEMISTRY; METALLURGY
C07K19/00
CHEMISTRY; METALLURGY
A61K31/7088
HUMAN NECESSITIES
A61K39/015
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
Abstract
This peptide/?-1,3-glucan complex includes ?-1,3-glucan and a peptide/polynucleotide conjugate in which an antigenic peptide is bonded covalently to a polynucleotide or a derivative thereof. The polynucleotide or derivative thereof of the peptide/polynucleotide conjugate bonds via a hydrogen bond with ?-1,3-glucan, forming a complex having a triple helix structure including a single molecular chain of the polynucleotide or derivative thereof and two molecular chains of the ?-1,3-glucan. Alternatively, the side chain of the ?-1,3-glucan and the antigenic peptide are bonded covalently formed by either a cycloaddition reaction between an alkyne and an azide derivative, or a reaction between a maleimide group or a vinyl sulfone group and a thiol group.
Claims
1. A peptide/?-1,3-glucan complex, comprising: a polysaccharide having a ?-1,3-glucan backbone; and a peptide/polynucleotide conjugate in which an antigenic peptide is bonded covalently to a polynucleotide or derivative thereof, wherein the polynucleotide or derivative thereof of the peptide/polynucleotide bonds through hydrogen bonding with the polysaccharide having the ?-1,3-glucan backbone, and forms a complex having a triple helix structure consisting of one molecular chain of the polynucleotide or derivative thereof and two molecular chains of the polysaccharide having the ?-1,3-glucan backbone.
2. The peptide/?-1,3-glucan complex according to claim 1, wherein the polysaccharide having the ?-1,3-glucan backbone is schizophyllan, lentinan, scleroglucan or curdlan.
3. The peptide/?-1,3-glucan complex according to claim 1, wherein the polynucleotide or derivative thereof is poly-deoxyadenosine.
4. The peptide/?-1,3-glucan complex according to claim 1, wherein the polynucleotide or derivative thereof is a polynucleotide derivative in which at least a portion of phosphodiester bonds of DNA or RNA is substituted with a phosphorothioate group.
5. The peptide/?-1,3-glucan complex according to claim 4, wherein in the polynucleotide derivative in which the at least the portion of phosphodiester bonds of DNA or RNA is substituted with a phosphorothioate group, at least 50% of the phosphodiester bonds are substituted with the phosphorothioate group.
6. The peptide/?-1,3-glucan complex according to claim 1, wherein the polynucleotide or derivative thereof and the antigenic peptide included in the peptide/polynucleotide conjugate are bonded through covalent bonding formed by: a cycloaddition reaction between an alkyne and an azide derivative, a reaction between a maleimide group and a thiol group, or a reaction between a thiol group of a thiol-modified nucleic acid and a thiol group of a peptide C-terminal cysteine residue.
7. The peptide/?-1,3-glucan complex according to claim 6, wherein the polysaccharide having the ?-1,3-glucan backbone is schizophyllan, lentinan, scleroglucan or curdlan.
8. The peptide/?-1,3-glucan complex according to claim 1, wherein the peptide/?-1,3-glucan complex further comprises a polynucleotide or derivative thereof having a partial base sequence having immunostimulatory activity; the polynucleotide or derivative thereof and the polysaccharide having the ?-1,3-glucan backbone are bonded by hydrogen bonding to form a complex having a triple helix structure consisting of one molecular chain of the polynucleotide or derivative thereof and two molecular chains of the polysaccharide having the ?-1,3-glucan backbone.
9. The peptide/?-1,3-glucan complex according to claim 8, wherein a portion of the polynucleotide or derivative thereof forming the complex having the triple helix structure is poly-deoxyadenosine.
10. The peptide/?-1,3-glucan complex according to claim 8, wherein the portion of the polynucleotide or derivative thereof forming the complex having the triple helix structure is a polynucleotide derivative in which at least a portion of phosphodiester bonds of DNA or RNA is substituted with a phosphorothioate group.
11. The peptide/?-1,3-glucan complex according to claim 10, wherein in the polynucleotide derivative in which the portion of phosphodiester bonds of DNA or RNA is substituted with a phosphorothioate group, at least 50% of the phosphodiester bonds are substituted with the phosphorothioate group.
12. A pharmaceutical composition comprising: a polynucleotide or derivative thereof having a partial base sequence having immunostimulatory activity, and the peptide/?-1,3-glucan complex of claim 1.
13. The pharmaceutical composition according to claim 12, wherein the polynucleotide or derivative thereof and the polysaccharide having the ?-1,3-glucan backbone are bonded by hydrogen bonding to form a complex having a triple helix structure consisting of one molecular chain of the polynucleotide or derivative thereof and two molecular chains of the polysaccharide having the ?-1,3-glucan backbone.
14. The pharmaceutical composition according to claim 13, wherein the polysaccharide having the ?-1,3-glucan backbone included in the polynucleotide/?-1,3-glucan complex having a triple helix structure is schizophyllan, lentinan, scleroglucan, or curdlan.
15. A pharmaceutical composition comprising the peptide/?-1,3-glucan complex according to claim 8.
16. The peptide/?-1,3-glucan complex according to claim 6, wherein the polysaccharide having the ?-1,3-glucan backbone is schizophyllan, lentinan, scleroglucan or curdlan.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DESCRIPTION OF EXAMPLES
(10) Specific embodiments of the present disclosure are described below to provide understanding of the present disclosure. The peptide/?-1,3-glucan complex in the first embodiment of the present disclosure includes a polysaccharide having the ?-1,3-glucan backbone (?-1,3-glucan), and a peptide/polynucleotide conjugate in which a peptide having antigenicity (antigenic peptide) is bonded covalently with a polynucleotide or derivative thereof. The polynucleotide or derivative thereof of the peptide/polynucleotide conjugate forms, through hydrogen bonding with the ?-1,3-glucan, a complex having a triple helix structure, and including one molecular chain of the polynucleotide or derivative thereof and two molecular chains of the ?-1,3-glucan.
(11) (1) ?-1,3-Glucan
(12) No particular limitation is placed on the type or molecular weight of the utilized ?-1,3-glucan, as long as a complex can be formed that includes one molecular chain of the polynucleotide or derivative thereof and two molecular chains of the ?-1,3-glucan. The polysaccharide having the ?-1,3-glucan backbone has helical parameters resembling those of nucleic acids such as poly(C) and the like (for example, see Prog. Polym. Phys. Jpn. 27, p. 767; and Conformation of Carbohydrates, Sharwood Academic Publisher, 1998), and also has hydroxyl groups that are capable of hydrogen-bonding with nucleic acid bases. Thus such polysaccharides and nucleic acids are known to interact with one another and to form a stable complex that has a helical structure. Specific examples that can be cited of ?-1,3-glucan include schizophyllan, curdlan, lentinan, pachyman, grifolan, scleroglucan and the like. These are glucans in which the main chain is formed by ?-bonding (?-D-bonding), and are natural polysaccharides having different frequencies of side chains. Although such ?-1,3-glucans may be used without undergoing treatment such as chemical decoration and the like, the normal periodate oxidation method can be used to reduce the number of side chains in order to control solubility.
(13) Molecular weight of ?-1,3-glucan is adjusted appropriately according to base sequence, base length and the like of the polynucleotide or derivative thereof included in the peptide/nucleotide conjugate. However, when the molecular weight is low, expression of the so-called cluster effect, a cooperative-emergent phenomenon in polymer systems, becomes difficult, and such low molecular weight is undesirable. Although single-chain weight average molecular weight of ?-1,3-glucan capable of forming a complex with the nucleic acid will vary according to the types of bases and higher-order structure of the nucleic acid, the weight average molecular weight is preferably greater than or equal to 2,000, further preferably is greater than or equal to 4,000, and most preferably is greater than or equal to 6,000. Moreover, the desired number of hydroxyl groups forming hydrogen bonds with the nucleic acid bases on the polynucleotide is normally at least 5 groups, is preferably at least 8 groups, and further preferably is at least 10 groups.
(14) Furthermore, the weight average molecular weight of ?-1,3-glucan can be determined by use of any widely-known method, such as optical scattering, settling rate (centrifugal method) and the like.
(15) Since ?-1,3-glucan can be generally produced by fungi and bacteria, ?-1,3-glucan can be obtained by culturing such microorganisms, homogenizing the fungus body, and then using ultracentrifugation and the like methods to isolate the ?-1,3-glucan from impurities such as cellular eluate, undissolved residue and the like. Generally the ?-1,3-glucan obtained in this manner assumes a triple helical structure with a high molecular weight, such as a weight average molecular weight of roughly several tens of thousands. As may be required, molecular weight reduction may be used. Molecular weight reduction is performed by selection of suitable conditions and a method, such as enzymatic decomposition, hydrolysis and the like, according to the type and desired molecular weight of the ?-1,3-glucan. For example, in the case of schizophyllan, by a method such as hydrolysis using 80% DMSO-sulfuric acid, single-chain schizophyllan can be obtained that has various molecular weight values.
(16) (2) Peptide/Polynucleotide Conjugate
(17) The peptide/polynucleotide conjugate is a complex formed through covalent bonding between the antigenic peptide and the polynucleotide or derivative thereof. The polynucleotide or derivative thereof bonded to the antigenic peptide, in the above-described manner, plays the role of bonding together the antigenic peptide and the ?-1,3-glucan by causing the formation of the complex having the triple helical structure with the ?-1,3-glucan.
(18) Any peptide having antigenicity can be used as the antigenic peptide, without particular limitation on the amino acid sequence or number of amino acid residues, as long as the antigenic peptide is recognized as foreign by the body's immune system, and causes the production of antibodies specific to the peptide. Among proteins derived from proteins causing allergies such as food allergies and the like, pathogens such as bacteria, viruses and the like, tumor cells and the like, proteins may be cited, as the antigenic peptide used for the production of the peptide/?-1,3-glucan complex according to the present example, that have partial amino acid sequences capable of use as epitopes. Although no particular limitation is placed on the number of amino acid bases forming the antigenic peptide capable of use as the epitope, the number of amino acid bases in many cases is within the range of 5 to 30 bases, and in most cases is in the range of about 8 to 17 bases.
(19) The antigenic peptide can be obtained by any know method, such as enzymatic decomposition of the source protein, peptide synthesis and the like. Moreover, the amino acid sequence of the antigenic peptide can be determined using any know method, such as epitope analysis using a peptide array and the like.
(20) No particular limitation is placed on the polynucleotide or derivative thereof, which may have any base sequence and number of bases, for bonding with the antigenic peptide, as long as the polynucleotide or derivative thereof forms a triple helical structure-type complex with ?-1,3-glucan in the above described manner. Specific examples of polynucleotides that can be cited include polyriboadenylic acid (polyA), polyribocytidylic acid (polyC), polydeoxyadenylic acid (poly(dA)) and polydeoxythymidylic acid (poly(dT)) capable of bonding with ?-1,3-glucan. Although no particular limitation is placed on the number of polynucleotide bases, as long as the polynucleotide is capable of forming the triple helical structure-type complex with ?-1,3-glucan in the above-described manner, in order to improve the ability to form the complex, the polynucleotide preferably has a repeating sequence capable of bonding with ?-1,3-glucan, such as that of polyriboadenylic acid (polyA), polyribocytidylic acid (polyC), polydeoxyadenylic acid (poly(dA)) or polydeoxythymidylic acid (poly(dT)). The bases forming the desired repeat base sequence and the types and base count of the nucleotide are selected appropriately according to length of the ribonucleotide part, type and molecular weight of the utilized ?-1,3-glucan and the like. For example, when schizophyllan is used as the ?-1,3-glucan, the polydeoxynucleotide part preferably has a poly(dA) sequence as the repeating sequence. Due to difficulty in the formation of the triple helical structure by hydrogen bonding with ?-1,3-glucan when the number of bases is low, length of the repeat sequence is required to be at least 10 bases, preferably is 20 to 80 bases, and further preferably is 30 to 80 bases.
(21) Since polynucleotides are readily decomposed by nucleases within the body, a polynucleotide derivative may be used instead of the polynucleotide in order to improve in vivo stability. Cited examples of the polynucleotide derivative include derivatives in which part or all of the 2 position hydroxyl groups of the ribonucleotide are replace by methoxy groups, derivatives in which part or all of the phosphodiester groups of polyribonucleotide (RNA) or polydeoxyribonucleotide (DNA) are replaced by the phosphorothioate group, and the like. When part of the phosphodiester groups of the polyribonucleotide or polydeoxyribonucleotide is replaced by the phosphorothioate group, at least 50% of the phosphodiester bonds are preferably replaced by the phosphorothioate group. No particular limitation is placed on the position of the phosphodiester group replaced by the phosphorothioate group, and replacement may be performed such that multiple adjacent phosphodiester groups are replaced, or such that the phosphorothioate groups are mutually non-adjacent.
(22) The polynucleotide or derivative thereof may bond to the N terminus, C terminus, or any side chain of the antigenic peptide. Bonding to either type of site may be performed by direct bonding by reaction between suitable reactive functional groups, and may be performed through a suitable spacer. The reactive functional group may be present on the unmodified antigenic peptide and the polynucleotide or derivative thereof, or the reactive functional group may be formed on the unmodified antigenic peptide and the polynucleotide or derivative thereof by activation by chemical decoration, or a suitable reactive functional group may be introduced. Moreover, the 5-terminus side or the 3-terminus side of the polynucleotide or derivative thereof may bond with the antigenic peptide.
(23) As shown in the Formula (A) below, one preferred example of the peptide/polynucleotide conjugate has a structure in which the 5-terminus side of phosphorothioated polydeoxyadenylic acid (polynucleotide derivative in which the phosphodiester group of polyA is replaced by the phosphorothioate group) is bonded to the C-terminus side of the peptide.
[antigenic peptide]-X-(dA(S)).sub.x(A)
(24) Furthermore, in Formula (A), dA(S) indicates phosphorothioated polydeoxyadenylic acid, and x is an integer greater than or equal to 20 and less than or equal to 80. X indicates a spacer or a functional group that is formed by reaction between reactive functional groups. One example of a spacer includes alkyl groups, polyethylene glycol (PEG) and the like. Cited examples of combinations of reactive functional groups include combinations of reactive functional groups used in fixing biomolecules to biochip surfaces, and more specific examples of such combinations are indicated below.
(25) (a) Alkynes and Azide Compounds
(26) The alkyne and azide compound form a 1,2,3-triazole ring by cycloaddition reaction, that is, Huisgen reaction, in the below indicated manner. Both reactants are stable functional groups capable of introduction to many organic compounds, including biomolecules. The reaction is rapid and nearly quantitative, even in a water-containing solvent. The reaction is nearly unaccompanied by the generation of byproducts, and almost no excess waste products are generated. Thus this reaction is widely used in the field of biochemistry as a central reaction of so-called click chemistry. The alkyne derivative and the azide group can be introduced to the antigenic peptide, or to the polynucleotide or polynucleotide derivative, by use of any known method. An alkyne derivative can be easily obtained that has a reactive functional group, such as propargyl alcohol, propargylamine and the like, and this alkyne derivative can be reacted directly with a reactive functional group such as the carboxyl group, hydroxyl group and the like, or alternatively, the alkyne derivative can be introduced through a urethane bond, ester bond, amide bond and the like generated by reaction with carbonyldiimidazole and the like. Any known method can be used for introduction of the azide group to the antigenic peptide or to the polynucleotide or derivative thereof. Furthermore, although the Husigen reaction is performed in the presence of a copper catalyst, activity of the copper catalyst may decrease due to the presence of copper ion-coordinating sulfur atoms in the antigenic peptide and in the polynucleotide derivative in which the phosphodiester group is substituted with a sulfur-containing functional group such as the phosphorothioate group and the like. An excess amount of copper is preferably added in order to improve the reaction rate.
(27) ##STR00001##
(28) (b) Thiol Group and Maleimide or Vinyl Sulfone
(29) At pH in the vicinity of neutral, a vinyl sulfone or maleimide having a double bond adjacent to an electron-accepting carbonyl group or sulfone group generates a stable thioester derivative by addition reaction with the thiol group (Michael addition reaction) as indicated below. Maleimide and vinyl sulfone derivatives having a suitable spacer are commercially marketed, and thus these reactive groups are easily introduced to the antigenic peptide or to the polynucleotide or derivative thereof. When a thiol group is introduced to the antigenic peptide, a thiol group of the cysteine residue side chain can be used when the antigenic peptide includes cysteine. However, cysteine is a low-abundance amino acid, and thus an antigenic peptide is used in which cysteine is introduced to the C-terminus side. Thiolated polynucleotides in which the thiol group replaces the 5-terminus hydroxyl group are used as the polynucleotide or derivative thereof that includes the thiol group.
(30) ##STR00002##
(31) (c) Cysteine Side-Chain Thiol Group and Thiolated Polynucleotide Thiol Group
(32) In the above manner, the thiol group of the cysteine residue side chain of the antigenic peptide having cysteine introduced to the C-terminus side and the thiol group of the thiolated polynucleotide are reacted to form a disulfide group. Since the disulfide bond is severed in the presence of a reducing agent, stability is inferior in comparison to both of the above combinations of reactive functional groups.
(33) (3) Preparation of the Peptide/?-1,3-Glucan Complex
(34) A ?-1,3-glucan such as schizophyllan and the like normally has a triple helical structure in water. Thus in order to form the complex with the polynucleotide or derivative thereof, the polynucleotide or derivative thereof is dissolved in a solvent such as DMSO to use intermolecular hydrogen bonding and hydrophobic interaction to unravel the associated state of the ?-1,3-glucan and to obtain a single chain. When an aqueous solution, or a solution of a polar solvent such as an alcohol and the like, containing polynucleotide is added, in accompaniment with the increase in polarity of the solvent, the ?-1,3-glucan and polynucleotide aggregate together due to hydrophobic interaction, and while incorporating the polynucleotide molecular chain, an aggregate is formed intra-molecularly and inter-molecularly between the polynucleotide and the polysaccharide. As a result, a complex is formed that has a triple helical structure that includes one molecule of the polynucleotide or derivative thereof and two molecules of the ?-1,3-glucan. Formation of the complex can be confirmed, for example, based on examination of conformational changes by measuring the circular dichroism (CD) spectrum.
(35) The peptide/?-1,3-glucan complex according to the second embodiment of the present disclosure includes an antigenic peptide bonded to a glucose residue on the main chain or side chain of the polysaccharide having the ?-1,3-glucan backbone via a covalent bond generated by reaction between the polysaccharide having the ?-1,3-glucan backbone, as the cycloaddition reaction between the alkyne and azide derivative, or the reaction between the maleimide group or vinyl sulfone group and thiol group.
(36) The ?-1,3-glucan and the antigenic peptide used in the preparation of the peptide/?-1,3-glucan complex according to the present example are similar to those used in the preparation of the peptide/?-1,3-glucan complex according to the first embodiment of the present disclosure, and thus detailed explanation of the ?-1,3-glucan and the antigenic peptide used in the preparation of the peptide/?-1,3-glucan complex according to the present embodiment is omitted. The ?-1,3-glucan and the antigenic peptide are bonded covalently formed by the cycloaddition reaction between the alkyne and azide derivative, or the reaction between the maleimide group or vinyl sulfone group and the thiol group. Although the antigenic peptide may be bound to either the main chain or a side chain of the ?-1,3-glucan molecule, in consideration of steric hindrance, the bonding is preferably with a glucose residue of a side chain. Moreover, although the antigenic peptide may bond to either the N-terminus side or the C-terminus side, or may bond with a side chain, in consideration of steric hindrance when contacting the antigen-presenting cell, bonding with the ?-1,3-glucan preferably occurs at the N-terminus side or C-terminus side. The introduction of the alkyne derivative and azide group to the ?-1,3-glucan and antigenic peptide can be performed using any known method, in the same manner as for the peptide/nucleotide conjugate in the preparation of the peptide/?-1,3-glucan complex according to the first embodiment of the present disclosure.
(37) In the peptide/?-1,3-glucan complex according to a third embodiment of the present disclosure, the aforementioned peptide/?-1,3-glucan complexes according to the first or second embodiments of the present disclosure further include a polynucleotide or derivative thereof having a partial base sequence having immunostimulatory activity, and the polynucleotide or derivative thereof is bonded to the ?-1,3-glucan through hydrogen bonding to form a complex (ternary complex including the antigenic peptide, ?-1,3-glucan, and the polynucleotide or derivative thereof) having the triple helical structure formed from one molecular chain of the polynucleotide or derivative thereof and two molecular chains of the ?-1,3-glucan.
(38) The site for bonding through hydrogen bonding with ?-1,3-glucan and within the antigenic peptide, ?-1,3-glucan, polynucleotide or derivative thereof used in the preparation of the peptide/?-1,3-glucan complex according to the present example is the same as that used in the production of the peptide/?-1,3-glucan complex according to first or second embodiments of the present disclosure, and thus detailed further description of this bonding site is omitted.
(39) Specific examples of partial base sequences having immunostimulatory activity, within the polynucleotide or derivative thereof, include: non-methylated CpG DNA derived from bacteria and viruses and activating immunity by bridging between innate immunity and acquired immunity through recognition by TLR9, double-stranded RNA derived from viruses for activating immunity by bridging between innate and acquired immunity by recognition by TLR3, virus genome RNA and artificial RNA for activating immunity by recognition by a RIG-I-like receptor (RLR), and the like.
(40) The hybrid between the RNA or DNA having the aforementioned partial base sequence having immunostimulatory activity and the polynucleotide or derivative thereof having the partial base sequence bonded to ?-1,3-glucan through hydrogen bonding can be obtained or synthesized using any known method. Furthermore, when the polynucleotide or derivative thereof is a chimeric nucleic acid having the RNA 5-terminus side bonded to the DNA 3-terminus side, due to the phosphodiester bond between the RNA and DNA readily undergoing decomposition, durability of the bond against hydrolysis is preferably improved by derivatizing, such as by using a methyl or fluoro group to replace the hydroxyl group of the 2 position in the 5-terminus side nucleotide of the RNA bonded to the DNA and/or using a phosphorothioate group to replace the phosphodiester group between the 3 position of the initial ribonucleotide bonded to the DNA and the 5 position of the RNA adjacent thereto.
(41) The peptide/?-1,3-glucan complex according to the present embodiment is prepared by any one of the below listed methods.
(42) (1) The aforementioned ?-1,3-glucan, peptide/nucleotide conjugate and the polynucleotide or derivative thereof are complexed using the same method as that of the preparation method of the peptide/?-1,3-glucan complex of the Example 1 of the present disclosure.
(43) (2) The peptide/?-1,3-glucan complex and the polynucleotide or derivative thereof according to the second embodiment of the present disclosure are complexed using the same method as that in the preparation method of the peptide/?-1,3-glucan complex according to the first embodiment of the present disclosure.
(44) The pharmaceutical composition according to fourth embodiment of the present disclosure (abbreviated below as the pharmaceutical composition) includes the peptide/?-1,3-glucan complex according to the first or second embodiments of the present disclosure, or the peptide/?-1,3-glucan complex according to the Example 3 of the present disclosure, and includes the polynucleotide/?-1,3-glucan complex having the triple helical structure including two molecular chains of the polysaccharide having the ?-1,3-glucan backbone and one molecular chain of the polynucleotide or derivative thereof, the polynucleotide/?-1,3-glucan complex being formed by hydrogen bonding between the ?-1,3-glucan backbone and the polynucleotide or derivative thereof having the partial base sequence having immunostimulatory activity.
(45) Except for using the peptide/nucleotide conjugate in place of the nucleotide or polynucleotide derivative, the polynucleotide/?-1,3-glucan complex is prepared using the same method as that of the peptide/?-1,3-glucan complex according to the first embodiment of the present disclosure.
(46) Any known components (such as any pharmacologically permissible carrier, excipient and additive) and preparation methods and be used in the preparation of the pharmaceutical composition, in addition to the polynucleotide/?-1,3-glucan complex and the peptide/?-1,3-glucan complex as the effective ingredient. For example, the pharmaceutical composition can assume the form of a tablet, suppository, capsule, syrup, nanogel and the like microcapsule, sterilized solution, suspension liquid and the like injection solution, aerosol, spray and the like.
(47) The pharmaceutical composition can be orally or parenterally administered to humans or warm blooded animals, such as mice, rats, rabbits, sheep, pigs, cattle, horses, chickens, cats, dogs, monkeys and the like. Examples of parenteral administration include subcutaneous injection, intradermal injection, intramuscular injection, intraperitoneal administration, intravenous administration, nasal mucous membrane spray administration, pharyngeal region spray administration and the like.
(48) The dose of the peptide/?-1,3-glucan complex and polynucleotide/?-1,3-glucan complex active ingredient will differ depending on activity, the disease undergoing medical treatment, and the type, body weight, sex, and age of the animal undergoing treatment, severity of the disease, treatment method and the like. In the case of oral administration to an adult weighing 60 kg, the daily dose is generally about 0.1 mg to about 100 mg, preferably is about 1.0 mg to about 50 mg, and more preferably is about 1.0 mg to about 20 mg. In the case of parenteral administration, the daily dose is generally about 0.01 mg to about 30 mg, preferably is about 0.1 mg to about 20 mg, and more preferably is about 0.1 mg to about 10 mg. In the case of administration to an animal (non-human), the used dose is calculated by converting the aforementioned dose to a dose per unit body weight and then multiplying by body weight of the animal undergoing treatment.
(49) By activation of immunity, the pharmaceutical composition can be used as a vaccine and the like for treatment or prevention of infective diseases caused by infection by pathogens such as bacteria, viruses and the like, and for treatment or prevention of tumors such as cancerous tumors and the like.
EXAMPLES
(50) Examples are provided below for confirmation of the effect of use of the present disclosure.
Example 1: Preparation of Antigenic Peptide/Polynucleotide Conjugate
(51) In the present example, preparation was investigated of an antigenic peptide/polynucleotide conjugate (referred to hereinafter as OVA peptide-dA40(S)) of a polynucleotide adduct (referred to hereinafter as dA40(S)(alkyne)) having an alkyne introduced at the 5 side of a polynucleotide derivative (referred to hereinafter as dA40(S)) having a structure in which phosphorothioate bonds replaced all phosphodiester bonds in deoxyadenine 40-mer and an antigenic peptide (referred to hereinafter as OVA(N3)) obtained by introduction of an azide group to the C terminus of ovalbumin ((OVA)-derived antigenic peptide, amino acid sequence: SIINFEKL (SEQ ID No. 1), obtained from Gene Design Inc.). Each chemical structure is shown in
(52) OVA(N3) (using water plus DMSO as solvent, 10 ?M to 800 ?M final concentration), dA40(S)(alkyne) (using water as solvent, 10 ?M final concentration), Cu(II) sulfate pentahydrate (using water as solvent, 1.5 mM final concentration), sodium ascorbate (using water as solvent, 3.0 mM final concentration), and (tris(1-benzyl-1H-1,2,3-driazo-4-yl)methyl)amine (using DMSO as solvent, 0.6 mM final concentration) were blended, and a click chemistry reaction was performed using copper catalyst for 1 hour at room temperature. After the reaction, a sample solution was diluted using a chelating agent solution of pH 7.4 ethylenediaminetetraacetate (EDTA) (final concentration of at least 20 mM), and then HPLC analysis was performed. Due to difficulty of elution due to strong mutual interaction between dA40(S) and the HPLC column, elution was made easier by addition of EDTA to weaken the mutual interaction.
(53) In the HPLC analysis, an Inertsil ODS-3 (GL Sciences Inc.) was used as the column, 0.1 M trimethylamine/acetate (TEAA) buffer (pH 7.0) and acetyl nitrile was used as the eluent, and a diode array was used as the detector. Change of UV absorption by dA40(S)(alkyne) was tracked at 260 nm. The results are shown in
Example 2: Complex Between Antigenic Peptide/Polynucleotide Conjugate and Polysaccharide Having ?-1,3-Glucan Backbone
(54) In the present example, schizophyllan (SPG) used as the polysaccharide having the ?-1,3-glucan backbone was obtained by the method described in the examples of Unexamined Japanese Patent Application Kokai Publication No. 2010-174107. This was purified using a certain method. GPC was used to determine molecular weight as 150,000 for the single strand and 450,000 for the triple strand. Testing was performed using the complex of this SPG and the OVA peptide-dA40(S) prepared in Example 1.
(55) Although a ?-1,3-glucan such as SPG and the like disassociates into single strands in an alkaline aqueous solution in the above-described manner, when the ?-1,3-glucan-including solution is neutralized by addition of phosphate buffer solution, three molecules of the ?-1,3-glucan become mutually associated through hydrogen bonding, and the triple helical structure is regenerated. The inventers discovered that, when the polynucleotide or derivative thereof, such as dA40(S) and the like, was present in the mixture, one molecule of the polynucleotide or derivative thereof and two molecules of the ?-1,3-glucan became mutually associated through hydrogen bonding and hydrophobic interaction to generate the complex having the triple helical structure. In the present example, investigation was performed to see whether a complex was generated that had the same type of triple helical structure, even when dA40(S), which is one example of the polynucleotide or derivative thereof, was combined with SPG and an antigenic peptide-dA40(S).
(56) SPG was dissolved (15 mg/mL) in 0.25N NaOH solution, and the mixture was allowed to sit for 2 days in order to allow complete disassociation into single strands. A 10% dimethyl sulfoxide (DMSO) aqueous solution (solution using as a solvent water including 10 volume percent DMSO, same hereinafter) of OVA peptide-dA40(S) and a phosphate buffer solution (330 mM NaH.sub.2PO.sub.4, pH 4.5) were mixed, the aforementioned SPG solution was added, and the mixture was stirred. Furthermore, concentrations of each of the solutions were adjusted so that molar mixing ratio of SPG to OVA peptide-dA40(S) became 3:1, and volume ratio of the SPG solution to phosphate buffer solution became 1:1. After the reaction mixture was allowed to sit overnight at 4? C., the reaction mixture was stirred, and then acrylamide gel electrophoresis was performed. Acrylamide gel electrophoresis of the antigenic peptide-dA40(S) was also performed for comparison.
(57)
Example 3: Effect of Complex Between Antigenic Peptide and SPG in Antigen-Specific Immune Response to Antigenic Peptide in Mouse Spleen Cells
(58) (1) One of the following was intradermally administered once to mice (C57BL/6 mouse, male, 7 weeks old): (1) antigenic peptide (OVA peptide, 5 ?g) having an ovalbumin (OVA)-derived amino acid sequence (SEQ ID No. 1), (2) ovalbumin (5 ?g) and CpG DNA (base sequence: ATCGACTCTCGAGCGTTCTC (SEQ ID No. 2), 30 ?g), (3) OVA peptide-dA40(S)/SPG complex (see Example 1, 5 ?g), (4) OVA peptide-dA40(S)/SPG complex (prepared as in Example 1, 5 ?g) and CpG DNA (30 ?g), and (5) OVA peptide-dA40(S)/SPG complex (5 ?g) and incomplete Freund's adjuvant (IFA). An investigation was performed to see whether antigen-specific interferon-? (IFN-?) was induced by, one week after administration, harvesting spleen cells from the mice, placing the cells in 96 wells (1.0?10.sup.6 cells/well), and then stimulating the cells using OVA peptide (10 ?g/mL).
(59) Then 24 hours after stimulating the spleen cells by OVA peptide, enzyme-linked immunosorbent assay (ELISA) was used to quantitatively measure IFN-? in the culture medium. Results are shown in
Example 4: Evaluation of Effect of Complexing Between Antigenic Peptide and SPG on Inducibility of Antigenic Peptide-Specific Cytolytic T-Lymphocytes
(60) Mouse spleen cells were harvested from mice to which had been intradermally administered in Example 3 the (1) OVA peptide, (2) OVA peptide and CpG DNA, (3) OVA peptide-dA40(S)/SPG complex, or (4) OVA peptide-dA40(S)/SPG complex and CpG DNA. The harvested cells were stimulated using OVA peptide-dA40(S)/SPG complex and were cultured for 6 days. Then after antibody staining, a flow cytometer was used to evaluate the fraction of T cells that had cytotoxic specificity (CD8 positive) for OVA peptide.
(61) The fraction of CD8-positive T cells specific for OVA peptide among the spleen cells is shown in
Example 5: Complexing Between Antigenic Peptide, Polynucleotide Derivative Having Partial Base Sequence Having Immunostimulatory Activity, and Polysaccharide Having the ?-1,3-Glucan Backbone
(62) An investigation was conducted concerning simultaneous complexing between SPG, OVA peptide-dA40(S) and CpG DNA-dA40(S).
(63) SPG was dissolved (15 mg/mL) in 0.25N NaOH solution, and the solution was allowed to sit for at least 2 days for complete disassociation into single strands. An aqueous solution of CpG DNA-dA40(S) (polynucleotide derivative having a structure in which dA40(S) was bonded to the 3-terminus side of CpG DNA), a 10% DMSO aqueous solution of OVA peptide-dA40(S), and a phosphate buffer solution (330 mM NaH.sub.2PO.sub.4, pH 4.5) were mixed together, the aforementioned SPG solution was added, and the mixture was stirred. The concentrations of each of the solutions were adjusted such that molar ratios of the SPG to OVA peptide-dA40(S) and the SPG to CpG DNA-dA40(S) were both 3:1, and the volume ratio of the SPG solution to the phosphate buffer solution became 1:1.
(64)
(65) Ternary complexes were prepared by the aforementioned method for antigenic peptide/nucleotide conjugates having the below-listed amino acid sequences as antigenic peptides other than the OVA peptide.
(66) TABLE-US-00001 TABLE1 OriginofPeptide AminoAcidSequence ovalbumin(OVA) SIINFEKL(SEQIDNo.1) mousemelanin-producingcellgp100 EGSRNQDWL(SEQIDNo.3) humanmelanin-producingcellgp100 KVPRNQDWL(SEQIDNo.4) CT26(largeintestinecarcinomastrain) SPSYVYHQF(SEQIDNo.5) influenzavirusHA IYSTVASSL(SEQIDNo.6) influenzavirusNP ASNENMDTM(SEQIDNo.7) influenzavirusPA SSLENFRAYV(SEQIDNo.8) ?-galactosidase DAPIYTNV(SEQIDNo.9) MuLV(mouseleukemiavirus)p15E KSPWFTTL(SEQIDNo.10) SeV(hemagglutinatingvirusofJapan) FAPGNYPAL(SEQIDNo.11) MCMV(mousecytomegalovirus)IE1 YPHFMPTNL(SEQIDNo.12) LCMV(lymphocyticchoriomeningitisvirus)gp33 KAVYNFATM(SEQIDNo.13) LCMVNP396 FQPQNGQFI(SEQIDNo.14) LCMVNP118 RPQASGVYM(SEQIDNo.15) malariaprotozoaPb9 SYIPSAEKI(SEQIDNo.16) HIVP18-I10 RGPGRAFVTI(SEQIDNo.17) BCGMPT51 GGPHAVYLL(SEQIDNo.18) humanCEA(humanembryoniccellcancerantigen) EAQNTTYL(SEQIDNo.19) P815(mouse-derivedantigen-presentingcell) LPYLGWLVF(SEQIDNo.20) HBsAg(B-typehepatitisvirusantigen) IPQSLDSWWTSL(SEQIDNo.21) HSV-1(mouseherpessimplexvirus)gB SSIEFARL(SEQIDNo.22) HY(malespecificantigen)Uty WMHHNMDLI(SEQIDNo.23) EGFP(enhancedgreenfluorescentprotein) HYLSTQSAL(SEQIDNo.24) HER2 TYLPTNASL(SEQIDNo.25) VSV(vesicularstomatitisvirus)NP RGYVYQGL(SEQIDNo.26) poliovirusMT RRLGRTLLL(SEQIDNo.27)
Example 6: Evaluation of Peptide-Specific Immune Response Due to Antigenic Peptide/CpG/SPG Ternary Complex
(67) One of the following was intradermally administered once to mice (C57BL/6 mouse, male, 7 weeks old): (1) the OVA peptide-dA40(S)/SPG complex (5 ?g) prepared in Example 2, (2) OVA peptide-dA40(S)/SPG complex (5 ?g) and CpG DNA (30 ?g), (3) OVA peptide-dA40(S)/SPG complex (5 ?g) and CpG DNA-dA40(S)/SPG complex (30 ?g, prepared in the same manner as in Example 5, except for the use of a 10% DMSO aqueous solution of OVA peptide-dA40A(S)), and (4) the OVA peptide-dA40(S)/CpG DNA-dA40(S)/SPG ternary complex (5 ?g) prepared in Example 5. An investigation was performed to see whether antigen-specific interferon-? (IFN-?) was induced by, one week after administration, harvesting spleen cells from the mice, placing the cells in 96 wells (1.0?10.sup.6 cells/well), and then stimulating the cells using OVA peptide (10 ?g/mL).
(68) Then 24 hours after stimulating the spleen cells by OVA peptide, enzyme-linked immunosorbent assay (ELISA) was used to quantitatively measure IFN-? in the culture medium. Results are shown in
Example 7: Evaluation of Inducibility of Peptide-Specific Cytolytic T-Lymphocytes by Antigenic Peptide/CpG/SPG Ternary Complex
(69) The (1) OVA peptide, (2) OVA peptide and CpG DNA, (3) OVA peptide and CpG DNA-dA40(S)/SPG complex, or (4) OVA peptide-dA40(S)/CpG DNA-dA40(S)/SPG ternary complex prepared in Example 5 of Example 6 was intradermally administered, mouse spleen cells were harvested and stimulated using OVA peptide-dA40(S)/SPG complex, and the stimulated cells were cultured for 6 days. Then after antibody staining, a flow cytometer was used to evaluate the fraction of T cells that had cytotoxic specificity (CD8 positive) for OVA peptide.
(70) The fraction of CD8-positive T cells specific for OVA peptide among the CD8-positive T cells is shown in
Example 8: Immune Response to Melanoma Cell-Specific Antigen Protein-Derived Peptide (Evaluation of Peptide-Specific Immune Response Due to Antigenic Peptide/CpG/SPG Ternary Complex)
(71) One of the following was intradermally administered once to mice (C57BL/6 mouse, male, 7 weeks old): (1) CpG DNA-dA40(S)/SPG complex (30 ?g) and gp100 peptide-dA40(S)/SPG complex (5 ?g) prepared in the same manner as in Examples 1 and 2, by using an antigenic peptide (gp100) having an amino acid sequence (EGSRNQDWL, SEQ ID No. 3) derived from mouse melanoma cell-specific antigen protein; and (2) gp100 peptide-dA40(S)/CpG DNA-dA40(S)/SPG ternary complex (5 ?g). An investigation was performed to see whether antigen-specific interferon-? (IFN-?) was induced by, one week after administration, harvesting spleen cells from the mice, placing the cells in 96 wells (1.0?10.sup.6 cells/well), and then stimulating the cells using gp100 peptide (10 ?g/mL).
(72) Then 24 hours after stimulating the spleen cells by gp100 peptide, enzyme-linked immunosorbent assay (ELISA) was used to quantitatively measure IFN-? in the culture medium. Results are shown in
Example 9: Immune Response Using Different Antigenic Peptides
(73) Using the method described in Example 5 and antigenic peptides other than OVA peptide, antigenic peptide-dA40(S)/CpG DNA-dA40(S)/SPG ternary complexes were prepared, and then peptide-specific immune responses were evaluated by the procedure described in Example 6. The amino acid sequences of the utilized antigenic peptides and experimental results (presence/absence of induction of antigenic peptide-specific IFN-?) are shown below in Table 2. Furthermore, the amino acid sequence (SEQ ID No. 28) shown for the no. 2 entry is a random sequence of the OVA peptide (no. 1). Although antigenic peptide including ternary complex was used to stimulate spleen cells placed in wells after harvesting from mice for case nos. 1, 3 and 4 in Table 2, for entry no. 2, OVA peptide was used that had the same amino acid composition, although having a different amino acid sequence. Moreover, among the examples of IFN response in Table 2, + indicates that production of IFN-? was observed, and ? indicates that production of IFN-? was not observed. An antigenic peptide-specific IFN response was observed in the cases (nos. 1, 3, 4 and 5) in which spleen cells were simulated by peptide having an amino acid sequence that was identical to the antigenic peptide used in the ternary complex administered to mice. In contrast, no IFN production whatsoever was observed in the case (no. 2) of stimulation of spleen cells by the peptide having a different amino acid sequence. Based on these results, the peptide-specific immune response is understood to have been induced by the ternary complex administered to the mice.
(74) TABLE-US-00002 TABLE2 No. PeptideSequence IFNResponse 1 SIINFEKL(SEQIDNo.1) + 2 FKILSENI(SEQIDNo.28) ? 3 EGSRNQDWL(SEQIDNo.3) + 4 KVPRNQDWL(SEQIDNo.4) + 5 SPSYVYHQF(SEQIDNo.5) +
Example 10: (1) Preparation of Peptide/?-1,3-Glucan Complex by Introduction of Antigenic Peptide to Glucose Residue on SPG Main Chain or Side Chain
(75) Introduction of antigenic peptide to a glucose residue on the main chain or side chain of SPG utilizing the quick reaction (Husigen reaction) between an alkyne and azide compound was investigated. The reaction scheme is indicated below. Carbonyldiimidazole (CDI) and propargylamine (PA) were reacted with the primary alcohol present at the 6 position of the glucose residue of the SPG, and through the generated carbamate bond, the alkyne was introduced in a site-specific manner to the main chain or side chain glucose residue of the SPG (SPG-PA). Since the ratio of the number of alkyne residues introduced to SPG to the number of glucose residues was 10 to 20%, the major portion of alkyne residues are thought to have been introduced to the glucose residue on the side chain due to steric hindrance in the vicinity of the glucose residue of the main chain. In the presence of copper catalyst, the SPG derivatives obtained in this manner were reacted with antigenic peptides (peptide (N3): obtained from Gene Science Inc., used as the azide-decorated OVA peptide in the present example) decorated by the azide group at the C terminus to prepare peptide/?-1,3-glucan complexes by the quick reaction.
(76) ##STR00003##
Example 11: (2) Preparation of Peptide/?-1,3-Glucan Complex by Introduction Through Covalent Bond of Antigenic Peptide to Glucose Residue on SPG Main Chain or Side Chain
(77) Introduction of antigenic peptide to a glucose residue on the main chain or side chain of SPG was investigated using the Michael addition reaction between an ?,?-unsaturated ketone and a thiol. The reaction scheme is indicated below. In the presence of N,N-diisopropylethylamine (DIPEA), carbonyldiimidazole (CDI) and 2-aminoethylmethaciylate (AEMA) were reacted with the primary alcohol present at the 6 position of the glucose residue of the SPG side chain, and a methaciyloyl group was introduced through the generated carbamate bond (SPG-AEMA). Thereafter, in the presence of tris(2-carboxyethyl)phosphine (TCEP), the antigenic peptide (peptide(SH): obtained from Gene Science Inc.) having cysteine introduced to the C terminus was reacted with SPG-AEMA to prepare the peptide/?-1,3-glucan complex.
(78) ##STR00004##
Example 12: Evaluation of Antigenic Peptide-Specific Immune Response Due to Antigenic Peptide/CpG/SPG Ternary Complex in which Antigenic Peptide is Covalently Bonded to Glucose Residue of Side Chain of Polysaccharide Having the ?-1,3-Glucan Backbone
(79) Using the same methods as those mentioned in Examples 2 and 5, the peptide/?-1,3-glucan complexes prepared in Examples 10 and 11 were complexed with CpG DNA-dA40(S) to prepare antigenic peptide/CpG/SPG ternary complexes. These complexes were intradermally administered once (amount equivalent to 30 ?g CpG DNA) to C57BL/6 mice (male, 7 weeks old). An investigation was performed to see whether antigen-specific interferon-? (IFN-?) was induced by, one week after administration, harvesting spleen cells from the mice, placing the cells in 96 wells (1.0?10.sup.6 cells/well), and then stimulating the cells using OVA peptide (10 ?g/mL). The utilized antigenic peptide amino acid sequences and experimental results (presence or absence of induction of antigenic peptide-specific IFN-?) are shown below in Table 3. Furthermore, in the same manner as in Example 9, the amino acid sequence (SEQ ID No. 28) indicated in case no. 2 was a random sequence of the OVA peptide (case no. 1). In case nos. 1, 3 and 4 of Table 3, antigenic peptide included in the ternary complex was used for stimulation of the spleen cells placed in the wells after harvesting from the mice. However, for case no. 2, although the amino acid composition was the same as that of OVA peptide, the amino acid sequence of the utilized antigenic peptide was different from that of OVA peptide. Moreover, in the IFN Response column of Table 3, + indicates that production of IFN-? was observed, and ? indicates that production of IFN-? was not observed. Similarly to the results of Example 9, in the cases (nos. 1, 3 and 4) of stimulation of spleen cells by peptides having the same amino acid sequence as that of the antigenic peptide used in the ternary complex administered to the mice, antigenic peptide-specific IFN responses were observed, and in contrast, IFN production was not observed whatsoever in the case (no. 2) of stimulation of the spleen cells by the peptide having a different amino acid sequence. Based on these results, induction of a peptide-specific immune response is understood to have occurred due to the ternary complex administered to the mice.
(80) TABLE-US-00003 TABLE3 No. PeptideSequence IFNResponse 1 SIINFEKL(SEQIDNo.1) + 2 FKILSENI(SEQIDNo.28) ? 3 EGSRNQDWL(SEQIDNo.3) + 4 SPSYVYHQF(SEQIDNo.5) +
(81) Furthermore, the present disclosure can be embodied in various ways and can undergo various modifications without departing from the broad spirit and scope of the disclosure. Moreover, the embodiments described above are for explaining the present disclosure, and do not limit the scope of the present disclosure. In other words, the scope of the present disclosure is as set forth in the Claims and not the embodiments. Various changes and modifications that are within the scope disclosed in the claims or that are within a scope that is equivalent to the claims of the disclosure are also included within the scope of the present disclosure.
(82) This application claims the benefit of Japanese Patent Application No. 2014-21333, filed on Feb. 6, 2014, including the Specification, Claims, Figures and Abstract of Japanese Patent Application No. 2014-21333. The entire disclosure of Japanese Patent Application No. 2014-21333 is incorporated by reference herein.