Enzymes and methods for dealkylation of substrates

10196656 ยท 2019-02-05

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed herein are enzymes and organisms useful for the dealkylation of products derived from lignin depolymerization, including the conversion of guaiacol or guaethol to catechol or the conversion of anisole to phenol. Methods of converting guaiacol or guaethol to catechol or anisole to phenol using enzymes or organisms expressing the same are also disclosed.

Claims

1. An isolated polynucleotide comprising a nucleic acid encoding a first polypeptide, a nucleic acid encoding a second polypeptide, and a promoter that is heterologous to the nucleic acid encoding said first or second polypeptide; wherein the promoter is operably linked to the nucleic acid encoding the first or second polypeptide, the first polypeptide has dealkylase activity and comprises the amino acid sequence of SEQ ID NO: 2, and the second polypeptide has reductase activity and comprises an amino acid sequence that has at least 99% sequence identity to the amino acid sequence of SEQ ID NO: 4.

2. An expression vector comprising the polynucleotide of claim 1.

3. An isolated host cell comprising the polynucleotide of claim 1.

4. The host cell of claim 3, wherein the host cell is a strain of Pseudomonas.

5. The isolated polynucleotide of claim 1, wherein the heterologous promoter is the lac promoter from Escherichia coli.

6. The host cell of claim 4, wherein the host cell is capable of growth on guaiacol and/or guaethol as a sole carbon source.

7. The host cell of claim 4, wherein the host cell is P. putida.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) Exemplary embodiments are illustrated in referenced figures of the drawings. It is intended that the embodiments and figures disclosed herein are to be considered illustrative rather than limiting.

(2) FIG. 1 shows exemplary dealkylation reactions catalyzed by the two component cytochrome P450 system.

(3) FIG. 2 shows the nucleic acid sequence (A) and amino acid sequence (B) of a cytochrome P450 O-dealkylase from Amycolatopsis sp. ATCC 39116.

(4) FIG. 3 shows the nucleic acid sequence (A) and amino acid sequence (B) of a reductase from Amycolatopsis sp. ATCC 39116.

(5) FIG. 4 shows growth by P. putida KT2440 engineered to express a cytochrome P450 O-dealkylase and a reductase (P. putida KT2440/pCJ021) on media containing guaiacol.

(6) FIG. 5 shows guaiacol and catechol levels for P. putida KT2440 and P. putida KT2440/pCJ021 after growth on media containing guaiacol.

(7) FIG. 6 shows guaiacol levels for P. putida KT2440 and P. putida KT2440/pCJ021 after growth on media containing guaiacol.

(8) FIG. 7 shows phenol levels for P. putida KT2440 and P. putida KT2440/pCJ021 after growth on media containing anisole.

(9) FIG. 8 shows guaethol levels for P. putida KT2440 and P. putida KT2440/pCJ021 after growth on media containing guaethol.

(10) FIG. 9 shows growth of P. putida KT2440 engineered to express a cytochrome P450 O-dealkylase and a reductase (P. putida KT2440/pCJ021) on media containing guaethol.

DETAILED DESCRIPTION

(11) Disclosed herein are enzymes, organisms expressing these enzymes, and methods useful for the dealkylation of aromatic substrates, including the conversion of guaiacol or guaethol to catechol and the conversion of anisole to phenol. Methods of converting aromatic substrates found in lignin-based feedstocks such as pyrolysis oil into catechol and phenol are also disclosed. FIGS. 2 and 3 present the nucleic acid sequences and amino acid sequences of two enzymes useful for the enzymatic conversion described herein.

(12) Guaiacol (2-methoxyphenol), anisole (methoxybenzene), and guaethol (2-ethoxyphenol) are common products of lignin depolymerization, and the conversion of guaiacol or guaethol to catechol (1,2-dihydroxybenzene) allows the more efficient use of products derived from lignin.

(13) Disclosed herein are cytochrome P450 O-dealkylases and reductases that catalyze reactions such as the O-demethylation of guaiacol to catechol, the O-demethylation of anisole to phenol, and the O-deethylation of guaethol to catechol. Generally, dealkylation is the removal of an alkyl group from a substrate, such as the removal of a methyl group to convert guaiacol to catechol and formaldehyde. These enzymes have activity not only on guaiacol, but also on anisole and guaethol. O-dealkylases may remove methyl, ethyl, propyl, butyl and other alkyl groups of the general formula C.sub.nH.sub.2n+1 from substrates. Another O-dealkylase activity may be to perform ether bond cleavage on aromatic compounds. In various embodiments, the enzymes may be from the CYP255 family of cytochrome P450 enzymes.

(14) Some bacterial cytochrome P450 enzymes cooperate with one or two partner proteins, usually a reductase and a ferredoxin, that transfer electrons from a cofactor such as NAD(P)H to the cytochrome, though there are variations on this throughout prokaryotes and eukaryotes. In certain embodiments, the reductase may comprise a 2Fe-2S ferredoxin domain, a flavin adenine dinucleotide (FAD) binding region, a nicotinamide adenine dinucleotide (NAD) binding region or combinations thereof. For example, the reductase represented by SEQ ID NO:4 comprises an N-terminal 2Fe-2S ferredoxin domain followed by a FAD and NAD binding region with homology to ferredoxin-NADPH reductase (FNR) type oxidoreductases. This domain architecture is novel for a cytochrome P450 reductase, and the presence of both ferredoxin and NAD binding domains may indicate the reductase and the cytochrome P450, whose genes are natively clustered and transcribed together, form a two-component cytochrome P450 system.

(15) The combination of both the cytochrome P450 and reductase polypeptides may be used as a two-component P450 system for dealkylating aromatic substrates, including demethylating guaiacol to produce catechol. For example, nucleic acid molecules encoding SEQ ID NOs: 2 and 4 encode a two-component cytochrome P450 system with guaiacol O-demethylase activity, as well as activity on other substrates including anisole (methoxybenzene), guaethol (2-ethoxyphenol), 2-propoxyphenol, and other substituted O-alkoxyphenols. Additional examples of two-component systems that exhibit these enzymatic activities include the cytochrome P450 (EHK82401; SEQ ID NO:6) and reductase (EHK82400; SEQ ID NO:8) polypeptides from Rhodococcus pyridinivorans AK37 and the cytochrome P450 (WP_011595125; SEQ ID NO:10) and reductase (WP_011595126; SEQ ID NO:12) polypeptides from Rhodococcus jostii.

(16) In addition to the enzymes described in FIGS. 2 and 3 and in the Sequence Listing, other suitable enzymes for aromatic substrate conversion include enzymes from Rhodococcus pyridinivorans strains SB3094 (e.g., YP_008987954.1) and AK37 (e.g., WP_006553158.1), Rhodococcus jostii RHA1 (e.g., YP_702345.1) and Amycolatopsis sp. ATCC 39116 (previously known as Streptomyces setonii or Streptomyces griseus strain 75iv2). In some embodiments, the cytochrome P450 or reductase polypeptide may be from a species of the genera Rhodococcus (e.g., R. pyridinivorans or R. jostii) or Amycolatopsis (e.g., Amycolatopsis sp. ATCC 39116). Additional exemplary cytochrome P450 and reductase polypeptides are provided in Table 1 below.

(17) In various embodiments, the cytochrome P450 and reductase polypeptides may be from microorganisms such as bacteria, yeast or fungi. Exemplary bacteria include species from the family Pseudonocardiaceae or species from the genera Rhodococcus, Amycolatopsis, Pimelobacter, Gordonia, Pseudonocardia, Saccharomonospora, Corynebacterium, Actinopolyspora, Nocardia, Saccharopolyspora, Nocardioides, or Granulicoccus. Though specific examples are provided herein, other examples of microbial cytochrome P450 and reductase polypeptides are within the scope of this disclosure.

(18) Cytochrome P450 polypeptides may be combined with reductase polypeptides to form a functional two-component complex capable of dealkylating an aromatic substrate. One of both of the polypeptides may be used in purified form. One of both of the polypeptides may be expressed by a microbial biocatalyst to carry out dealkylation. A biocatalyst host cell may express one or more of the polypeptides, or one or more of the polypeptides may be added exogenously to a biocatalyst culture. The cytochrome P450 and reductase polypeptides may be from the same organism or from different organisms, and various combinations may be created and tested for enzymatic activity.

(19) TABLE-US-00001 TABLE 1 Cytochrome P450s and Reductases Reductases Cytochrome P450s Organism Accession No. Organism Accession No. Rhodococcus pyridinivorans WP_006553157.1 Rhodococcus pyridinivorans WP_024102362.1 Rhodococcus pyridinivorans WP_041803486.1 Rhodococcus pyridinivorans WP_060652632.1 Rhodococcus rhodochrous WP_016691158.1 Rhodococcus rhodochrous WP_016691159.1 Rhodococcus rhodochrous WP_059382679.1 Rhodococcus ruber WP_003934526.1 Rhodococcus ruber WP_003934527.1 Gordonia rhizosphera WP_006338923.1 Rhodococcus aetherivorans WP_029546517.1 Gordonia bronchialis WP_012835331.1 Rhodococcus wratislaviensis WP_037225711.1 Gordonia namibiensis WP_006865278.1 Rhodococcus opacus WP_005261032.1 Gordonia alkanivorans WP_006358554.1 Rhodococcus imtechensis WP_007297192.1 Gordonia rubripertincta WP_005194215.1 Rhodococcus jostii WP_054246359.1 Gordonia terrae WP_004020850.1 Pimelobacter simplex WP_038682083.1 Rhodococcus wratislaviensis WP_037225709.1 Amycolatopsis methanolica WP_017982757.1 Rhodococcus jostii WP_011595125.1 Amycolatopsis orientalis WP_043838556.1 Rhodococcus imtechensis WP_007297193.1 Amycolatopsis sp. ATCC 39116 WP_020419854.1 Rhodococcus opacus WP_012689299.1 Pseudonocardia autotrophica WP_037048581.1 Amycolatopsis sp. ATCC39116 WP_020419855.1 Gordonia alkanivorans WP_006358553.1 Amycolatopsis methanolica WP_017982758.1 Gordonia sp. KTR9 WP_014924832.1 Gordonia polyisoprenivorans WP_006367698.1 Gordonia namibiensis WP_006865279.1 Gordonia polyisoprenivorans WP_014360659.1 Gordonia terrae WP_004020851.1 Saccharomonospora cyanea WP_005457512.1 Gordonia rubripertincta WP_039879854.1 Pseudonocardia autotrophica WP_037048579.1 Saccharomonospora cyanea WP_005457513.1 Gordonia desulfuricans WP_059037021.1 Gordonia polyisoprenivorans WP_014360660.1 Nocardia farcinica WP_011208761.1 Gordonia bronchialis WP_012835332.1 Saccharopolyspora rectivirgula WP_029722698.1 Gordonia rhizosphera WP_006338924.1 Nocardioides luteus WP_045548139.1 Gordonia rubripertincta GAB83512.1 Amycolatopsis orientalis WP_043838558.1 Corynebacterium halotolerans WP_015400585.1 Amycolatopsis orientalis WP_037363061.1 Actinopolyspora halophila WP_017975556.1 Pseudonocardia sp. AL041005-10 ALE78654.1 Gordonia sputi WP_039856233.1 Granulicoccus phenolivorans WP_035757215.1 Rhodococcus wratislaviensis IFP 2016 ELB87463.1 Pimelobacter simplex WP_038682080.1 Rhodococcus imtechensis WP_007296205.1 Gordonia amicalis WP_024500047.1 Gordonia desulfuricans WP_059037022.1

(20) Also presented are microorganisms engineered to express the enzymes disclosed herein and their use to biologically dealkylate aromatic substrates. Dealkylation may be carried out be culturing such microorganisms with a material containing aromatic substrates (e.g., guaiacol, guaethol or anisole) and allowing the microorganisms to enzymatically complete the conversion. Although the Examples presented herein exemplify the use of the bacterium P. putida, any microorganism capable of carrying out the dealkylation of the substrate through the addition of enzymes disclosed herein may be suitable. Exemplary microorganisms include bacteria, such as those from the genus Pseudomonas. Specific examples include strains of Pseudomonas putida, such as P. putida KT2440.

(21) Aromatic substrate-containing materials may be contacted with enzymes disclosed herein to dealkylate the substrate. As used herein, aromatic substrate-containing materials means any natural or processed materials comprising detectable amounts of compounds such as guaiacol, guaethol or anisole. These may be derived from many sources, including lignocellulose, lignin, or oils derived from the pyrolysis of biomass of other lignocellulose or cellulose sources.

(22) Suitable enzymes may be derived from microorganisms such as bacteria, fungi, yeast or the like via cell lysis and isolation techniques, or produced recombinantly. In some embodiments, a microorganism expressing the enzyme may be used directly as a biocatalyst to covert the aromatic substrate.

(23) Enzymes described herein may be used as purified recombinant enzyme or as culture broths from cells that naturally produce the enzyme or that have been engineered to produce the enzyme. Enzymes can be added exogenously, or may be expressed and secreted directly from a microbial biocatalyst, or used internally by the microbial biocatalyst. Suitable organisms for enzyme expression include aerobic microorganisms such as aerobic bacteria.

(24) Bio-oils and other aromatic substrate-containing materials may be contacted with enzymes at a concentration and a temperature for a time sufficient to achieve the desired amount of dealkylation. Suitable times for dealkylation range from a few hours to several days, and may be selected to achieve a desired amount of conversion. Exemplary reaction times include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 hours; and 0.5, 1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5 or 15 days. In some embodiments, reaction times may be one or more weeks.

(25) The resulting catechol, phenol, and the like may be further converted to products such as higher alcohols, hydrocarbons, or other advanced fuels via biological or chemical pathways, or combination thereof. Catechol, phenol and other products may be recovered or isolated from cells, cell cultures or reactions by standard separation techniques for further upgrading. Dealkylation products may also be further metabolized by biocatalyst cells in the culture to additional products metabolically derived from a dealkylation product. These additional products may in turn be isolated from cells, cell cultures or reactions by standard separation techniques and may be further upgraded to additional fuels and chemicals.

(26) Methods of fractionating, isolating or purifying dealkylation products (or further upgraded products) include a variety of biochemical engineering unit operations. For example, the reaction mixture or cell culture lysate may be filtered to separate solids from products present in a liquid portion. Dealkylation products may be further extracted from a solvent and/or purified using conventional methods. Exemplary methods for purification/isolation/separation of dealkylation products include at least one of affinity chromatography, ion exchange chromatography, solvent extraction, filtration, centrifugation, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, chromatofocusing, differential solubilization, preparative disc-gel electrophoresis, isoelectric focusing, HPLC, and/or or reversed-phase HPLC.

(27) Pyrolysis offers a straightforward approach for the deconstruction of plant cell wall polymers into pyrolysis oil or bio-oil, which may be fractionated and subsequently used in biological approaches to selectively upgrade some of the resulting fractions. Lignocellulose or lignin-containing materials may be subjected to pyrolysis processes to generate oils containing aromatic substrates. Exemplary lignocellulose-containing materials include bioenergy crops, agricultural residues, municipal solid waste, industrial solid waste, sludge from paper manufacture, yard waste, wood and forestry waste. Examples of biomass include, but are not limited to, corn grain, corn cobs, crop residues such as corn husks, corn stover, corn fiber, grasses, wheat, wheat straw, barley, barley straw, hay, rice straw, switchgrass, waste paper, sugar cane bagasse, sorghum, soy, components obtained from milling of grains, trees, branches, roots, leaves, wood (e.g., poplar) chips, sawdust, shrubs and bushes, vegetables, fruits, flowers and animal manure.

(28) SEQ ID NOS: 1, 3, 5, 7, 9 and 11 provide nucleic acid and amino acid sequences for exemplary enzymes for use in the disclosed methods. Nucleic acid or polynucleotide as used herein refers to purine- and pyrimidine-containing polymers of any length, either polyribonucleotides or polydeoxyribonucleotide or mixed polyribo-polydeoxyribonucleotides. This includes single- and double-stranded molecules (i.e., DNA-DNA, DNA-RNA and RNA-RNA hybrids) as well as protein nucleic acids (PNA) formed by conjugating bases to an amino acid backbone. This also includes nucleic acids containing modified bases.

(29) Nucleic acids referred to herein as isolated are nucleic acids that have been removed from their natural milieu or separated away from the nucleic acids of the genomic DNA or cellular RNA of their source of origin (e.g., as it exists in cells or in a mixture of nucleic acids such as a library), and may have undergone further processing. Isolated nucleic acids include nucleic acids obtained by methods described herein, similar methods or other suitable methods, including essentially pure nucleic acids, nucleic acids produced by chemical synthesis, by combinations of biological and chemical methods, and recombinant nucleic acids that are isolated.

(30) Nucleic acids referred to herein as recombinant are nucleic acids which have been produced by recombinant DNA methodology, including those nucleic acids that are generated by procedures that rely upon a method of artificial replication, such as the polymerase chain reaction (PCR) and/or cloning or assembling into a vector using restriction enzymes. Recombinant nucleic acids also include those that result from recombination events that occur through the natural mechanisms of cells, but are selected for after the introduction to the cells of nucleic acids designed to allow or make probable a desired recombination event. Portions of isolated nucleic acids that code for polypeptides having a certain function can be identified and isolated by, for example, the method disclosed in U.S. Pat. No. 4,952,501.

(31) An isolated nucleic acid molecule can be isolated from its natural source or produced using recombinant DNA technology (e.g., polymerase chain reaction (PCR) amplification, cloning or assembling) or chemical synthesis. Isolated nucleic acid molecules can include, for example, genes, natural allelic variants of genes, coding regions or portions thereof, and coding and/or regulatory regions modified by nucleotide insertions, deletions, substitutions, and/or inversions in a manner such that the modifications do not substantially interfere with the nucleic acid molecule's ability to encode a polypeptide or to form stable hybrids under stringent conditions with natural gene isolates. An isolated nucleic acid molecule can include degeneracies. As used herein, nucleotide degeneracy refers to the phenomenon that one amino acid can be encoded by different nucleotide codons. Thus, the nucleic acid sequence of a nucleic acid molecule that encodes a protein or polypeptide can vary due to degeneracies.

(32) Unless so specified, a nucleic acid molecule is not required to encode a protein having enzyme activity. A nucleic acid molecule can encode a truncated, mutated or inactive protein, for example. In addition, nucleic acid molecules may also be useful as probes and primers for the identification, isolation and/or purification of other nucleic acid molecules, independent of a protein-encoding function.

(33) Suitable nucleic acids include fragments or variants that encode a functional enzyme. For example, a fragment can comprise the minimum nucleotides required to encode a functional cytochrome P450 O-dealkylase or reductase. Nucleic acid variants include nucleic acids with one or more nucleotide additions, deletions, substitutions, including transitions and transversions, insertion, or modifications (e.g., via RNA or DNA analogs). Alterations may occur at the 5 or 3 terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.

(34) In certain embodiments, a nucleic acid may be identical to a sequence represented herein. In other embodiments, the nucleic acids may be at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence represented herein, or 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to a sequence represented herein. Sequence identity calculations can be performed using computer programs, hybridization methods, or calculations. Exemplary computer program methods to determine identity and similarity between two sequences include, but are not limited to, the GCG program package, BLASTN, BLASTX, TBLASTX, and FASTA. The BLAST programs are publicly available from NCBI and other sources. For example, nucleotide sequence identity can be determined by comparing query sequences to sequences in publicly available sequence databases (NCBI) using the BLASTN2 algorithm.

(35) Embodiments of the nucleic acids include those that encode the polypeptides that function as an O-dealkylase or a reductase or functional equivalents thereof. A functional equivalent includes fragments or variants of these that exhibit the ability to function as an O-dealkylase or a reductase. As a result of the degeneracy of the genetic code, many nucleic acid sequences can encode a given polypeptide with a particular enzymatic activity. Such functionally equivalent variants are contemplated herein.

(36) Nucleic acids may be derived from a variety of sources including DNA, cDNA, synthetic DNA, synthetic RNA, or combinations thereof. Such sequences may comprise genomic DNA, which may or may not include naturally occurring introns. Moreover, such genomic DNA may be obtained in association with promoter regions or poly (A) sequences. The sequences, genomic DNA, or cDNA may be obtained in any of several ways. Genomic DNA can be extracted and purified from suitable cells by means well known in the art. Alternatively, mRNA can be isolated from a cell and used to produce cDNA by reverse transcription or other means.

(37) Also disclosed herein are recombinant vectors, including expression vectors, containing nucleic acids encoding enzymes. A recombinant vector is a nucleic acid molecule that is used as a tool for manipulating a nucleic acid sequence of choice or for introducing such a nucleic acid sequence into a host cell. A recombinant vector may be suitable for use in cloning, assembling, sequencing, or otherwise manipulating the nucleic acid sequence of choice, such as by expressing or delivering the nucleic acid sequence of choice into a host cell to form a recombinant cell. Such a vector typically contains heterologous nucleic acid sequences not naturally found adjacent to a nucleic acid sequence of choice, although the vector can also contain regulatory nucleic acid sequences (e.g., promoters, untranslated regions) that are naturally found adjacent to the nucleic acid sequences of choice or that are useful for expression of the nucleic acid molecules.

(38) The nucleic acids described herein may be used in methods for production of enzymes and enzyme cocktails through incorporation into cells, tissues, or organisms. In some embodiments, a nucleic acid may be incorporated into a vector for expression in suitable host cells. The vector may then be introduced into one or more host cells by any method known in the art. One method to produce an encoded protein includes transforming a host cell with one or more recombinant nucleic acids (such as expression vectors) to form a recombinant cell. The term transformation is generally used herein to refer to any method by which an exogenous nucleic acid molecule (i.e., a recombinant nucleic acid molecule) can be inserted into a cell, but can be used interchangeably with the term transfection.

(39) Non-limiting examples of suitable host cells include cells from microorganisms such as bacteria, yeast, fungi, and filamentous fungi. Exemplary microorganisms include, but are not limited to, bacteria such as E. coli; bacteria from the genera Pseudomonas (e.g., P. putida or P. fluorescens), Bacillus (e.g., B. subtilis, B. megaterium or B. brevis), Caulobacter (e.g., C. crescentus), Lactoccocus (e.g., L. lactis), Streptomyces (e.g., S. coelicolor), Streptococcus (e.g., S. lividans), and Corynybacterium (e.g., C. glutamicum); fungi from the genera Trichoderma (e.g., T. reesei, T. viride, T. koningii, or T. harzianum), Penicillium (e.g., P. funiculosum), Humicola (e.g., H. insolens), Chrysosporium (e.g., C. lucknowense), Gliocladium, Aspergillus (e.g., A. niger, A. nidulans, A. awamori, or A. aculeatus), Fusarium, Neurospora, Hypocrea (e.g., H. jecorina), and Emericella; yeasts from the genera Saccharomyces (e.g., S. cerevisiae), Pichia (e.g., P. pastoris), or Kluyveromyces (e.g., K. lactis). Cells from plants such as Arabidopsis, barley, citrus, cotton, maize, poplar, rice, soybean, sugarcane, wheat, switch grass, alfalfa, miscanthus, and trees such as hardwoods and softwoods are also contemplated herein as host cells.

(40) Host cells can be transformed, transfected, or infected as appropriate by any suitable method including electroporation, calcium chloride-, lithium chloride-, lithium acetate/polyene glycol-, calcium phosphate-, DEAE-dextran-, liposome-mediated DNA uptake, spheroplasting, injection, microinjection, microprojectile bombardment, phage infection, viral infection, or other established methods. Alternatively, vectors containing the nucleic acids of interest can be transcribed in vitro, and the resulting RNA introduced into the host cell by well-known methods, for example, by injection. Exemplary embodiments include a host cell or population of cells expressing one or more nucleic acid molecules or expression vectors described herein (for example, a genetically modified microorganism). The cells into which nucleic acids have been introduced as described above also include the progeny of such cells.

(41) Vectors may be introduced into host cells such as those from bacteria or fungi by direct transformation, in which DNA is mixed with the cells and taken up without any additional manipulation, by conjugation, electroporation, or other means known in the art. Expression vectors may be expressed by bacteria or fungi or other host cells episomally or the gene of interest may be inserted into the chromosome of the host cell to produce cells that stably express the gene with or without the need for selective pressure. For example, expression cassettes may be targeted to neutral chromosomal sites by recombination.

(42) Host cells carrying an expression vector (i.e., transformants or clones) may be selected using markers depending on the mode of the vector construction. The marker may be on the same or a different DNA molecule. In prokaryotic hosts, the transformant may be selected, for example, by resistance to ampicillin, tetracycline or other antibiotics. Production of a particular product based on temperature sensitivity may also serve as an appropriate marker.

(43) Host cells may be cultured in an appropriate fermentation medium. An appropriate, or effective, fermentation medium refers to any medium in which a host cell, including a genetically modified microorganism, when cultured, is capable of growing or expressing the polypeptides described herein. Such a medium is typically an aqueous medium comprising assimilable carbon, nitrogen and phosphate sources, but can also include appropriate salts, minerals, metals and other nutrients. Microorganisms and other cells can be cultured in conventional fermentation bioreactors and by any fermentation process, including batch, fed-batch, cell recycle, and continuous fermentation. The pH of the fermentation medium is regulated to a pH suitable for growth of the particular organism. Culture media and conditions for various host cells are known in the art. A wide range of media for culturing bacteria or fungi, for example, are available from ATCC. Exemplary culture/fermentation conditions and reagents are provided in the Examples that follow. Media may be supplemented with aromatic substrates like guaiacol, guaethol or anisole for dealkylation reactions.

(44) The nucleic acid molecules described herein encode the enzymes with amino acid sequences such as those represented by SEQ ID NOS:2, 4, 6, 8, 10 and 12. As used herein, the terms protein and polypeptide are synonymous. Peptides are defined as fragments or portions of polypeptides, preferably fragments or portions having at least one functional activity as the complete polypeptide sequence. Isolated proteins or polypeptides are proteins or polypeptides purified to a state beyond that in which they exist in cells. In certain embodiments, they may be at least 10% pure; in others, they may be substantially purified to 80% or 90% purity or greater. Isolated proteins or polypeptides include essentially pure proteins or polypeptides, proteins or polypeptides produced by chemical synthesis or by combinations of biological and chemical methods, and recombinant proteins or polypeptides that are isolated. Proteins or polypeptides referred to herein as recombinant are proteins or polypeptides produced by the expression of recombinant nucleic acids.

(45) Proteins or polypeptides encoded by nucleic acids as well as functional portions or variants thereof are also described herein. Polypeptide sequences may be identical to the amino acid sequences presented in SEQ ID NOS:2, 4, 6, 8, 10 and 12, or may include up to a certain integer number of amino acid alterations. Such protein or polypeptide variants retain functionality as a cytochrome P450 O-dealkylase or a reductase, and include mutants differing by the addition, deletion or substitution of one or more amino acid residues, or modified polypeptides and mutants comprising one or more modified residues. The variant may have one or more conservative changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine). Alterations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence.

(46) In certain embodiments, the polypeptides may be at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequences set forth in SEQ ID NOS:2, 4, 6, 8, 10 and 12 and possess enzymatic function. Percent sequence identity can be calculated using computer programs (such as the BLASTP and TBLASTN programs publicly available from NCBI and other sources) or direct sequence comparison. Polypeptide variants can be produced using techniques known in the art including direct modifications to isolated polypeptides, direct synthesis, or modifications to the nucleic acid sequence encoding the polypeptide using, for example, recombinant DNA techniques.

(47) Polypeptides may be retrieved, obtained, or used in substantially pure form, a purity that allows for the effective use of the protein in any method described herein or known in the art. For a protein to be most useful in any of the methods described herein or in any method utilizing enzymes of the types described herein, it is most often substantially free of contaminants, other proteins and/or chemicals that might interfere or that would interfere with its use in the method (e.g., that might interfere with enzyme activity), or that at least would be undesirable for inclusion with a protein.

EXAMPLES

Example 1

(48) Enzyme Cloning

(49) The primers listed in Table 2 were used in the gene amplifications described below.

(50) TABLE-US-00002 TABLE2 NucleicAcidSequencesofPrimers Primer Sequence(5-3) SEQIDNO. oCJ160 GATATCATTCAGGACGAGCCTCAGACTCC SEQIDNO:13 oCJ161 CTCTAGAGTGTGAAATTGTTATCCGCTCA SEQIDNO:14 CAATTCC oCJ169 AACAATTTCACACTCTAGAGAGGAGGACA SEQIDNO:15 GCTATGACGACGACCGAACGGCC oCJ170 GGCTCGTCCTGAATGATATCTCACGAGGC SEQIDNO:16 CGGCGTG oCJ206 GGCTCGTCCTGAATGATATCTCACACCTC SEQIDNO:17 CCAGGTGACGTG

(51) The genes encoding the cytochrome P450 protein and the co-transcribed reductase were amplified from Amycolatopsis sp. ATCC 39116 DNA using primers oCJ169 and oCJ170 (see Table 2) and the product assembled using Gibson Assembly Master Mix (New England BioLabs) into the broad host-range vector pBTL-2, which was amplified using primers oCJ160 and oCJ161, resulting in pCJ021. pBTL-2 (a gift from Ryan Gill; Addgene plasmid #22806) is a broad host-range vector that drives expression of inserted genes using the lac promoter, which is constitutively expressed in Pseudomonas putida KT2440. The cytochrome P450 gene alone was also amplified using oCJ169 and oCJ206 and assembled it into the same vector (resulting in pCJ024). pCJ021 was then transformed into P. putida KT2440 to generate P. putida KT2440/pCJ021.

Example 2

(52) HPLC Analyses

(53) HPLC analysis was performed by injecting 6 L of 0.2 m filtered culture supernatant onto an Agilent 1100 series system equipped with a Phenomenex Rezex RFQ-Fast Acid H+ (8%) column and a cation H+ guard cartridge (Bio-Rad Laboratories) at 85 C. run using a mobile phase of 0.01 N sulfuric acid at a flow rate of 1.0 mL/min and a diode array detector to measure absorbance at 210 nm. Analytes were identified by comparing retention times and spectral profiles with pure standards. HPLC chromatograms show milli-absorbance units (mAU) on the Y axis and retention time (minutes) on the X axis.

Example 3

(54) Conversion of Guaiacol, Anisole and Guaethol

(55) P. putida KT2440 can readily metabolize catechol for growth, so a functional enzyme with O-dealkylase activity would convert guaiacol or guaethol to catechol and enable this organism to metabolize guaiacol or guaethol for growth, which it is not natively capable of P. putida KT2440 transformed with pCJ021 (KT2440/pCJ021) was capable of growth in M9 minimal medium containing 5 mM guaiacol as the sole source of carbon and energy, metabolizing the guaiacol completely and reaching an OD.sub.600 of just over 0.5 (FIG. 4). Native P. putida KT2440 and P. putida KT2440 transformed with pCJ024 were included in this experiment, but neither of these strains was able to metabolize guaiacol.

(56) HPLC analyses show the disappearance of guaiacol in a culture of P. putida KT2440/pCJ021 grown on M9 minimal medium containing guaiacol and the lack of guaiacol catabolism by native P. putida KT2440 (FIG. 6). When these strains are grown in LB medium containing guaiacol, HPLC analysis shows the conversion of guaiacol to catechol (an increase in catechol levels and a corresponding decrease in guaiacol levels), which temporarily accumulated during catabolism of guaiacol (FIG. 5). These results indicate that the amplified genes encode a two-component cytochrome P450 system with guaiacol O-demethylase activity.

(57) Conversion of anisole was demonstrated by growing P. putida KT2440/pCJ021 in LB medium containing anisole. The cultures were grown in LB, a rich medium, because P. putida KT2440 cannot metabolize phenol. HPLC analysis of cultures of P. putida KT2440/pCJ021 grown in LB medium containing anisole demonstrated this strain catalyzed the conversion of anisole to phenol, which accumulates because P. putida KT2440 cannot metabolize it further. Control cultures of P. putida KT2440 did not accumulate phenol (FIG. 7). A peak corresponding to anisole was not observed due to the HPLC column used. The production of phenol, however, demonstrates that anisole is being demethylated to generate phenol in P. putida KT2440/pCJ021 cultures.

(58) Dealkylation of guaethol was demonstrated by growing P. putida KT2440/pCJ021 in M9 minimal medium containing 5 mM guaethol (2-ethoxyphenol). After 72 hours of growth with guaethol as the sole source of carbon and energy, P. putida KT2440/pCJ021 was able to metabolize the guaethol in the culture while native P. putida KT2440 was unable to metabolize guaethol. HPLC analysis shows the disappearance of guaethol in a culture of P. putida KT2440/pCJ021 after 72 hours, but not in a culture of native P. putida KT2440 (FIG. 8). P. putida KT2440/pCJ021 was able to grow to an OD.sub.600 of 7 on the catechol produced in this reaction, as demonstrated in FIG. 9.

(59) Taken together, these data demonstrate that the two-component cytochrome P450 system catalyzes the O-demethylation of guaiacol (2-methoxyphenol) to catechol (1,2-dihydroxybenzene), the O-demethylation of anisole (methoxybenzene) to phenol, and the O-deethylation of guaethol (2-ethoxyphenol) to catechol (FIG. 1).

(60) The Examples discussed above are provided for purposes of illustration and are not intended to be limiting. Still other embodiments and modifications are also contemplated.

(61) While a number of exemplary aspects and embodiments have been discussed above, those of skill in the art will recognize certain modifications, permutations, additions and sub combinations thereof. It is therefore intended that the following appended claims and claims hereafter introduced are interpreted to include all such modifications, permutations, additions and sub-combinations as are within their true spirit and scope.