Method and Kit of Detecting the Absence of Micro-Organisms
20220372558 · 2022-11-24
Inventors
- Matthew A. Crow (Oxfordshire, GB)
- Helen V. Bennett (Buckinghamshire, GB)
- Daniel S. Wratting (Oxfordshire, GB)
- William H. Mullen (Berkshire, GB)
Cpc classification
C12Q1/6848
CHEMISTRY; METALLURGY
C12Q2525/101
CHEMISTRY; METALLURGY
International classification
C12Q1/04
CHEMISTRY; METALLURGY
Abstract
Methods of detecting the absence or presence of a micro-organism in a sample comprising: contacting the sample with a nucleic acid molecule which acts as a substrate for nucleic acid modifying activity of the micro-organism in the sample, incubating the thus contacted sample under conditions suitable for nucleic acid modifying activity; and specifically determining the absence or presence of a modified nucleic acid molecule resulting from the action of the nucleic acid modifying activity on the substrate nucleic acid molecule to indicate the absence or presence of the micro-organism. Corresponding kits are also provided.
Claims
1-59. (canceled).
60. A method of detecting the presence of a micro-organism in a sample, the method comprising: (a) contacting the sample with a nuclease resistant nucleic acid molecule comprising a plurality of nuclease resistant nucleotides which is either extended by polymerase activity or is ligated by ligase activity of the micro-organism in the sample, (b) incubating the thus contacted sample under conditions suitable for polymerase activity or ligase activity; and (c) detecting in the sample a nucleic acid molecule that has been extended by the polymerase activity or ligated by the ligase activity of the micro-organism as compared to a negative control, thereby indicating the presence of the micro-organism in the sample.
61. The method of claim 60 wherein the nuclease resistant nucleic acid molecule comprises methylated nucleotides, nucleotides protected at the 3′ and/or 5′ ends or synthetic nucleotides.
62. The method of claim 61 wherein the synthetic nucleotides comprise phosphorothioate nucleotides and/or locked nucleic acid nucleotides.
63. The method of claim 60 wherein the action of the polymerase activity or ligase activity on the nuclease resistant nucleic acid molecule produces an extended nucleic acid molecule.
64. The method of claim 60 wherein step (a) comprises contacting the sample with a nucleic acid molecule which is either extended by polymerase activity or is ligated by ligase activity of the micro-organism in the sample together with an internal positive control (IPC) nucleic acid molecule, wherein: (a) the IPC nucleic acid molecule is susceptible to nuclease activity and is used to identify contaminating nuclease activity in the sample; or (b) the IPC nucleic acid molecule is nuclease resistant and comprises a plurality of nucleotides that are resistant to nuclease activity.
65. The method of claim 63 wherein a nucleic acid probe is added in step (c) which binds to a target probe sequence within the nucleic acid molecule, optionally wherein the nucleic acid probe is labelled.
66. The method of claim 64 wherein a further nucleic acid probe is added in step (c) which binds to a target probe sequence within the IPC nucleic acid molecule, optionally wherein the further nucleic acid probe is labelled.
67. The method of claim 65 wherein: (a) the nucleic acid probe does not bind to the IPC nucleic acid molecule and the further nucleic acid probe does not bind to the nucleic acid molecule; or (b) the nucleic acid probe and further nucleic acid probe are differently labelled.
68. The method of claim 60 wherein the nucleic acid molecule is at least partially double stranded and comprises uracil residues in the complementary strand and step (c) comprises adding Uracil DNA Glycosylase (UDG) to the sample in order to degrade the uracil residues in the complementary strand.
69. The method of claim 68 wherein the complementary strand of the nucleic acid molecule comprises a modification at the 3′ end to prevent extension.
70. The method of claim 69 wherein the modification at the 3′ end comprises incorporation of a non-extendible nucleotide.
71. The method of claim 70 wherein the non-extendible nucleotide is a dideoxy nucleotide triphosphate (ddNTP), optionally wherein the ddNTP is dideoxyCytidine.
72. The method of claim 60 wherein step (c) comprises a nucleic acid amplification step.
73. A method of detecting the absence of a micro-organism in a sample, the method comprising: (a) contacting the sample with a nuclease resistant nucleic acid molecule comprising a plurality of nuclease resistant nucleotides which is either extended by polymerase activity or is ligated by ligase activity of the micro-organism in the sample, (b) incubating the thus contacted sample under conditions suitable for polymerase activity or ligase activity; and (c) detecting in the sample a lack of a nucleic acid molecule that has been extended by the polymerase activity or ligated by the ligase activity of the micro-organism as compared to a positive control, thereby indicating the absence of the micro-organism in the sample.
74. The method of claim 73 wherein the nuclease resistant nucleic acid molecule comprises methylated nucleotides, nucleotides protected at the 3′ and/or 5′ ends or synthetic nucleotides.
75. The method of claim 74 wherein the synthetic nucleotides comprise phosphorothioate nucleotides and/or locked nucleic acid nucleotides.
76. The method of claim 73 wherein the positive control is an internal positive control (IPC).
77. The method of claim 73 wherein the nucleic acid molecule is at least partially double stranded and comprises uracil residues in the complementary strand and step (c) comprises adding Uracil DNA Glycosylase (UDG) to the sample in order to degrade the uracil residues in the complementary strand.
78. The method of claim 77 wherein the complementary strand of the nucleic acid molecule comprises a modification at the 3′ end to prevent extension.
79. The method of claim 73 wherein step (c) comprises a nucleic acid amplification step.
80. A kit comprising at least one nuclease resistant nucleic acid molecule comprising a plurality of nuclease resistant nucleotides, wherein the at least one nuclease resistant nucleic acid molecule can be extended in the presence of polymerase activity or ligated in the presence of ligase activity of the micro-organism in the sample, wherein the at least one nuclease resistant nucleic acid molecule is at least partially double stranded and comprises uracil residues in the complementary strand.
81. The kit of claim 80 wherein the nuclease resistant nucleic acid molecule comprises synthetic nucleotides, methylated nucleotides or nucleotides protected of the 3′ and/or 5′ ends.
82. The kit of claim 81 wherein the synthetic nucleotides comprise phosphorothioate nucleotides and/or locked nucleic acid nucleotides.
83. The kit of claim 80 wherein the complementary strand of the nucleic acid molecule comprises a modification at the 3′ end to prevent extension.
84. The kit of claim 83 wherein the modification at the 3′ end comprises incorporation of a non-extendible nucleotide.
85. The kit of claim 84 wherein the non-extendible nucleotide is a dideoxy nucleotide triphosphate (ddNTP), optionally wherein the ddNTP is dideoxyCytidine.
86. The kit of claim 80 further comprising at least one internal positive control (IPC) nucleic acid molecule which comprises identical primer binding sites to the nuclease resistant nucleic acid molecule such that there is competition for primer binding in a nucleic acid amplification reaction containing both the nucleic acid molecule and the IPC.
87. The kit of claim 86 wherein the IPC nucleic acid molecule is modified so as to protect it from nuclease activity.
88. The kit of claim 87 wherein the modification of the IPC nucleic acid molecule is selected from incorporation of synthetic nucleotides, incorporation of methylation and protection of the 3′ and/or 5′ ends.
89. The kit of claim 88 wherein the synthetic nucleotides comprise phosphorothioate nucleotides and/or locked nucleic acid nucleotides.
Description
DESCRIPTION OF THE FIGURES
[0401]
[0402]
[0403]
[0404]
[0405]
[0406]
[0407]
[0408]
[0409]
[0410]
[0411]
[0412]
EXPERIMENTAL SECTION
[0413] The invention will be understood with respect to the following non-limiting examples:
Example 1—ETGA Test Modifications
Methods—General Protocol
[0414] For each sample, 1 mL of blood culture (with or without microorganisms added, with or without blood) was mixed with 0.333 mL Reagent A (5% w/v Saponin, 5% w/v Tween 20, 8.5 g/L sodium chloride) in a 1.5 mL microcentrifuge tube and incubated at room temperature for 15 min. Each sample was centrifuged for 3 min at 7300 g, then the supernatant was poured away and the rim of the tube was dabbed on clean laboratory tissue paper. Each pellet was then resupended in 0.75 mL of Reagent B (5 mM NaOH) and incubated for 5 min, then pH was lowered by adding 0.5 mL of Reagent C (1.32g/L ammonium sulphate, 0.49 g/L magnesium sulphate heptahydrate, 0.75 g/L potassium chloride, 20 mM Tris-HCl, pH8.0). After incubation, samples were centrifuged again and the supernatant removed by pouring away. The remaining pellet was resuspended in 0.5 mL of Reagent C and immediately transferred to a new tube containing a mixture of glass beads (0.1 mm and 0.5 mm glass beads; supplied by CamBio cat 13118-400, and 13116-400 respectively). A further centrifugation was carried out in order to pellet any suspended cells with the glass beads, and again, the supernatant was removed and discarded.
[0415] 50 μL of microbial Lysis Mixture containing the ETGA substrate (LM; containing reagents L1, L2, L3 at a ratio of 7:2:1, see Table 1) was added to the glass beads and placed in a Disruptor Genie (Scientific Industries, Inc.) cell disruptor for 6 min at 2800 rpm to lyse microbial cells. After disruption, samples were placed in a 37° C. heating block and incubated for 20 min, then transferred to another heating block at 95° C. and incubated for 5 min. After incubation, samples were cooled to room temperature whilst the PCR reagents were prepared.
[0416] After cooling, 3 μL of sample supernatant was added to 27 μL of PCR mastermix (MM; containing a general Taq polymerase PCR mastermix (Roche—cat 04902343001), primers for the ETGA substrate, internal positive control—IPC—DNA, FAM-labelled probe for the ETGA substrate, Texas Red labelled probe for the IPC, and (1.2 ul) UDG enzyme (Bioline—cat no BIO-27044)) in a SmartCycler PCR tube (Cepheid). Samples were placed in the SmartCycler PCR and subjected to the following reaction conditions; [0417] 1 cycle; 40° C. 10 min, 50° C. 10 min, 95° C. 5 min [0418] 40-50 cycles: 95° C. 5 sec, 61° C. 20 sec, 72° C. 20 sec.
[0419] Amplification was monitored throughout the reaction in real-time in the Texas Red and FAM excitation/detection channels of the SmartCycler.
TABLE-US-00004 TABLE 1 Lysis mixture components L1 Bovine serum albumin 1.5% w/v Triton X100 1.5% v/v Tween 20 1.5% v/v L2 Ammonium sulphate 2.64 g/L Magnesium sulphate heptahydrate 0.98 g/L Potassium chloride 1.5 g/L Tris-HCl, pH 8.0 40 mM dNTP (A, G, C, T) 500 μM L3 ETGA substrate 0.001 μM-0.01 μM Tris-HCl, pH 8.5 20 mM KCl 10 mM EDTA 10 μM
[0420] The sequences of the PCR reaction components are as follows;
[0421] Fam labelled probe (a molecular beacon):
TABLE-US-00005 (SEQ ID NO: 1) FAM-cgc tgc gac cga ccg ata agc tag aac agg cag cg-BHQ1
[0422] Texas red labelled probe (a molecular beacon):
TABLE-US-00006 (SEQ ID NO: 2) TxR-cgc gat cag cag gcc aca cgt taa aga cat cgc g-BHQ2
TABLE-US-00007 IPC (SEQ ID NO: 3) gcc gat atc gga caa cgg ccg aac tgg gaa ggc gag atc agc agg cca cac gtt aaa gac aga gag aca aca acg ctg gcc gtt tgt cac cga cgc cta Forward primer (SEQ ID NO: 4) ccg ata tcg gac aac ggc cga act gg Reverse primer (SEQ ID NO: 5) tag gcg tcg gtg aca aac ggc cag c
[0423] The substrate components are;
TABLE-US-00008 AS (SEQ ID NO: 6) uaggcgucggugacaaacggccagcguuguugucucu-DDC (3′ terminal is a dideoxy-C) S1 (SEQ ID NO: 7) gccgatatcggacaacggccgaactgggaaggcgagactgaccgaccga taagctagaacagagagacaacaac
Results and Discussion 1—Increasing Substrate Concentration
[0424] The general protocol was modified by increasing the amount of ETGA substrate in LM by 10-fold (from 0.001 μM to 0.01 μM) and increasing the amount of dNTP 2-fold (from 50 μM to 100 μM).
[0425] The increased quantity of substrate and dNTP enabled improved detection of C. albicans (
Results and Discussion 2—Improving ETGA Test Sensitivity and Lowering Background by Modifying Oligo Components
Evidence of Nuclease Activity
[0426] Adding the IPC molecule at the same time as the ETGA substrate molecule was thought to be an improvement on the original protocol. If IPC was added in LM, the IPC would be subject to exactly the same test conditions as the ETGA substrate and therefore provide a more accurate test control. For example, conditions that may negatively impact the substrate molecule such as nuclease activity that could digest the substrate, would also affect the IPC. If the IPC is added later (in MM for example) it would not be subject to the same conditions and may result in false interpretation of the data. If IPC is added at the same time as the ETGA substrate the magnitude of the effect of the test conditions on the nucleic acid templates could be measured.
[0427] To exemplify this,
[0428] Clearly, if the IPC molecule was lost during the test, the ETGA substrate molecule could also be lost.
[0429] Loss of the ETGA substrate molecule in a positive blood culture sample would obviously result in reduced detection sensitivity or potentially lead to a false negative result, but, by adding IPC to LM it would be possible to determine (and perhaps quantify) suspected nuclease activity and interpret results accordingly. Samples where a drop in IPC quantity was observed (as seen by a rise in ct value compared to a negative reagent control) could be reported as ‘unresolved’ rather than ‘negative’, thus indicating that the sample was subject to nuclease activity and may, in fact, be positive.
[0430] Adding an IPC molecule to LM could improve the ETGA test. However, depending on how common nuclease activity was found to be in clinical specimens, this could raise the overall number of unresolved results rendering the test less attractive to potential users due to the high perceived failure rate (and thus explaining why IPC was originally added to MM rather than LM).
[0431] Testing showed that the IPC molecule could be added to the test in the LM and still be detected in the presence of presumed nuclease activity by increasing the concentration 20-50 fold, but high levels of background were detected even in negative blood culture samples (
[0432] Whilst increasing the amount of IPC in LM may be considered a solution to the problem of loss of target DNA molecules due to nuclease activity, it may only mask the issue and as previously mentioned may contribute to higher background level. Increasing the amount of IPC molecule in samples where contaminating nuclease activity was low could also reduce test sensitivity by increasing competition for reaction components in the detection PCR thereby reducing the ability of the test to detect the target substrate. A better solution to the putative nuclease problem was required.
Protecting ETGA Substrate and IPC from Nuclease Activity
[0433] Based on the assumption that the IPC molecule should be included in LM, and that nuclease activity may be having a detrimental effect on the ETGA test, attempt was made to protect the DNA targets (IPC and ETGA substrate) from nuclease degradation. DNA can be protected from nuclease activity by various means, by modification (e.g. methylation, end modification) or using non-standard nucleotides during the synthesis of synthetic oligonucleotides (e.g. locked nucleic acids, phopsphorothioate nucleotides).
[0434] ETGA test has been found to be less sensitive to yeasts than bacteria. The reason for this not known but is likely to be due to a combination of reason such as, differences in in vitro activity or absolute quantity of the fungal enzymes in cells compared to the bacterial enzymes, or sensitivity to inhibitors.
Demonstration of the Use of PTO Oligos in the ETGA Test
[0435] Standard ETGA substrate and IPC oligos were replaced with phosphorothioate oligos (PTO) with the same nucleotide sequence in LM in the general protocol. PTO-modified ETGA substrate was added to LM at 0.01 μM and PTO-modified IPC was added at a sufficient quantity to achieve a ct value of 37-41 in a 50 cycle PCR reaction.
[0436] A dilution series of yeast cells (10.sup.5, 10.sup.4, 10.sup.3 and 0 cfu/ml) in blood culture was tested with the original ETGA test protocol with standard oligos and with PTO modified oligos. Both tests were run on exactly the same spiked blood cultures (
[0437] Data showed that the ETGA test with standard oligos yielded results that included high levels of background that may have occluded the detection of low levels of yeast cells, whereas results obtained with PTO modified oligos did not suffer from the same effect. In fact, results showed that PTO oligos reduced the overall background to undetectable levels on the same culture specimens, thus allowing the lowering of the threshold level in the qPCR reaction and potentially increasing the sensitivity of the ETGA test. Note that when using standard oligos, the threshold level was set at 50 units due to the amount of background fluorescence detected, but, when using the PTO oligos the threshold level could be lowered to 10 units, or lower if required. PTO oligos were detected later in the PCR reaction than when using standard oligos, but the PTO qPCR reaction could also be run for longer (50 cycles rather than 40) because the level of background was so low. The result of this reduction in background meant that lower levels of microbial load (as low as 10.sup.3 cfu/ml in this example) could be detected with PTO oligos that would have previously been undetectable when using the standard oligos.
[0438] In a further experiment, nuclease resistant PTO versions of the substrate molecules (MWG-Eurofins) were used in an ETGA test. A dilution series of yeast overnight culture was used to artificially spike a blood culture (a sample of the blood culture was then spread on SDA to confirm total viable counts). Each suspension was then tested with an ETGA test using standard oligos and an ETGA test using PTO oligos. Sensitivity of detection of the yeast was much improved by the use of PTO. Note that the PTO results are plotted on a different y-axis to the standard test, due to the differing number of PCR cycles. The dashed lines indicate the Ct value of the negative control (blood culture without any microorganisms). The data from this experiment show that the PTO substrate was shown to improve the detection of yeasts (
Example 2—Reducing False Negative Test Results in the ETGA Test
General Protocols
For 10 mL Specimens
[0439] For each sample, 10 mL of blood culture (with or without microorganisms added, with or without blood) was mixed with 3.33 mL Reagent A (5% w/v Saponin, 5% w/v Tween 20, 8.5 g/L sodium chloride) in a 15 mL Falcon tube and incubated at room temperature for 15 min. Each sample was centrifuged for 8 min at 3600 g, then the supernatant was poured away and the rim of the tube was dabbed on clean laboratory tissue paper. Each pellet was then resupended in 5 mL of Reagent B (5 mM NaOH) and incubated for 5 min. After incubation, samples were centrifuged again and the supernatant removed by pouring away. The remaining pellet was resuspended in 1 mL of Reagent C (1.32 g/L ammonium sulphate, 0.49 g/L magnesium sulphate heptahydrate, 0.75 g/L potassium chloride, 20 mM Tris-HCl, pH8.0) and immediately transferred to a 1.5 mL microcentrifuge tube containing a mixture of glass beads. A further centrifugation for 3 min at 7300×g was carried out in order to pellet any suspended cells with the glass beads, and again, the supernatant was removed and discarded.
[0440] 50 μL of microbial Lysis Mixture (LM; containing ETGA substrate see table 1 in Example 1 above) was added to the glass beads and placed in a Disruptor Genie cell disruptor for 6 min at 2800 rpm to lyse microbial cells. After disruption, samples were placed in a 37° C. heating block and incubated for 20 min, then transferred to another heating block at 95° C. and incubated for 5 min. After incubation, samples were cooled to room temperature whilst the PCR reagents were prepared.
[0441] After cooling, 3 μL of sample supernatant was added to 27 μL of PCR mastermix (MM; containing a general Taq polymerase PCR mastermix, primers for the ETGA substrate, internal positive control—IPC—DNA, FAM-labelled probe for the ETGA substrate, Texas Red labelled probe for the IPC, and UDG enzyme) in a SmartCycler PCR tube (Cepheid). Samples were placed in the SmartCycler PCR and subjected to the following reaction conditions; [0442] 1 cycle; 40° C. 10 min, 50° C. 10 min, 95° C. 5 min [0443] 40-50 cycles: 95° C. 5 sec, 61° C. 20 sec, 72° C. 20 sec.
[0444] Amplification was monitored throughout the reaction in real-time in the Texas Red and FAM excitation/detection channels of the SmartCycler.
For 1 mL Specimens
[0445] For each sample, 1 mL of blood culture was mixed with 0.333 mL Reagent A (5% w/v Saponin, 5% w/v Tween 20, 8.5 g/L sodium chloride) in a 1.5 mL microcentrifuge tube and incubated at room temperature for 15 min. Each sample was centrifuged for 3 min at 7300 g, then the supernatant was poured away and the rim of the tube was dabbed on clean laboratory tissue paper. Each pellet was then resupended in 1 mL of Reagent B (5 mM NaOH) and incubated for 5 min. After incubation, samples were centrifuged again and the supernatant removed by pouring away. The remaining pellet was resuspended in 0.5 mL of Reagent C (1.32 g/L ammonium sulphate, 0.49 g/L magnesium sulphate heptahydrate, 0.75 g/L potassium chloride, 20 mM Tris-HCl, pH8.0) and immediately transferred to a new tube containing a mixture of glass beads. A further centrifugation was carried out in order to pellet any suspended cells with the glass beads, and again, the supernatant was removed and discarded.
[0446] Microbial lysis and PCR detection was then carried out as previously described for the 10 mL protocol.
[0447] PCR reaction components and substrates are per Example 1 above.
Background
[0448] A single clinical microbial isolate, identified as Haemophilus influenzae gave a false negative result in the ETGA test during a clinical performance evaluation. The microorganism was detected by standard automated blood culture in Biomerieux Bact/ALERT blood culture media.
[0449] When a spike of cultured microbial cells was added to different stages of the ETGA test it was found that the H. influenzae strain was only detected when added after the NaOH wash step (Reagent B). Other, more robust bacterial species were found to be detectable when added to the test from the start (see
[0450] This result was not typical of all strains of H. influenzae and, to date, has only been associated with this strain. The isolate was used as a model ‘weak’ organism to develop a new ETGA procedure that was better at detecting less robust microorganisms.
[0451] Incubation in NaOH is an essential step in the ETGA protocol that must be carried out in order to inactivate free polymerases, reduce contaminants and reduce background. Attempts were therefore made to reduce the damaging effect of NaOH without detrimentally affecting the test results. The concentration of NaOH could not be lowered because it did not remove sufficient contaminating material, which leads to failure of the test.
Results—Reducing Sample Exposure to NaOH
[0452] In the general 10 mL protocol, note that the time taken to centrifuge the sample increases the total time that the sample is exposed to NaOH by 8 min. Shortening the length of time could be achieved and controlled by neutralisation of the alkali, or, at least lowering the pH of the sample after an optimal period of incubation time by adding 1 mL of 200 mM Tris-HCl buffer, pH 7.2 to the NaOH.
[0453] The general protocol for 10 mL specimens was carried out on a suspension of H. influenzae in culture media drawn from a BacT/ALERT SA bottle (no blood was added). Results demonstrate that neutralisation (or significant lowering the pH) of the NaOH lead to lower ct values (from identical samples) and therefore improved sensitivity of detection (see
[0454] Data also suggested that the shorter incubation time would be better, but again, short incubation times did not allow sufficient removal of contaminants to enable reliable PCR amplification, leading to reaction failure or high background levels and false positive results.
[0455] Lowering of the pH of the sample after NaOH treatment could potentially be achieved by adding any suitable buffer or acid. The preferred method of lowering the pH would be to use Reagent C (a Tris-HCl buffer, pH 8) because the reagent is already used in the test.
Results—Preferred Embodiment, 1 mL
[0456] Detection of both H. influenzae and S. aureus could be improved in the general protocol for 1 mL specimens by replacing the original NaOH step with the more complex steps consisting of resuspension in 0.75 mL NaOH, incubation at room temperature for 5 min then adding 0.5 mL Reagent C to lower the pH. Results, summarised in
Example 3— Analysis of the Importance of the 95° C. and the Use of a PTO Substrate Purpose
[0457] The purpose of the work outlined in this example was to assess the effect of the 95° C. step on the performance of the Cognitor Minus test. The Cognitor Minus test was carried out using bacteria-spiked blood broth samples with or without the 95° C. step to compare the following characteristics: [0458] The Ct values obtained [0459] The stability of ETGA template DNA as measured by QPCR at different time-points following completion of sample preparation [0460] The Ct values obtained and stability of ETGA template DNA when lysis mix (LM) contains unmodified oligonucleotide (UMO) ETGA substrate as opposed to the phosphorothioate modified oligonucleotide (PTO) ETGA substrate.
Introduction
[0461] The earlier steps in the Cognitor Minus test aim to lyse blood cells and wash away blood-derived proteins such as DNA polymerases, which will produce non-microorganism derived ETGA template DNA, and nuclease enzymes which may digest microorganism-derived ETGA template DNA. Any resulting intact microorganisms are then lysed by the addition of lysis mix (LM) and bead milling. Following microorganism lysis and the ETGA reaction, samples contain a mixture of microorganism proteins, LM components, newly synthesised ETGA template DNA and residual blood cell proteins. The 95° C. step is intended to denature all proteins in order to protect the ETGA template DNA and internal process control (IPC) DNA from nuclease digestion so that it can be successfully detected by QPCR.
[0462] To assess the importance of the 95° C. step, the Cognitor Minus test was carried out using bacteria-spiked blood cultures with or without the 95° C. step. The samples were analysed by QPCR at three time points: immediately after sample preparation; after 2 hours at room temperature; and after a further 18 hours at 4° C. The aim was to compare the Ct values obtained and the consistency of Ct values across the three time points as an indicator of ETGA template DNA stability. An additional experiment was performed using LM containing UMO ETGA substrate to test whether the stability of the resulting ETGA template DNA differs from that of LM containing PTO ETGA substrate.
Materials and Methods
Reagents Used
[0463] Reagent A—5% (w/v) Saponin, 5% (v/v) Tween 20 and 146 mM Sodium chloride
[0464] Reagent B—5 mM Sodium hydroxide.
[0465] Reagent C_13 10 mM Ammonium sulphate, 2 mM Magnesium sulphate heptahydrate, 10 mM Potassium chloride and 20 mM Tris-HCl [pH 8.0].
[0466] Lysis Mix (LM) comprised of L1, L2, L3, dNTPs, PTO-IPC stock: [0467] L1 (252 mL in 360 mL LM)—1.46% (w/v) BSA, 0.15% (v/v) Triton X100 and 0.15% (v/v) Tween 20; [0468] L2 (36 mL in 360 mL LM)—100 mM Ammonium sulphate, 20 mM Magnesium sulphate heptahydrate, 100 mM Potassium chloride and 200 mM Tris-HCl [pH 8.0]; [0469] L3 (36 mL in 360 mL LM)—0.1 μM PTO-AS oligo, 0.1 μM PTO-S1 oligo, 20 mM Tris-HCl [pH 8.5], 10 mM Potassium chloride and 10 μM EDTA; [0470] 10 mM dNTPs (3.6 mL in 360 mL LM) [0471] PTO-IPC stock (˜180 μL in 360 mL LM) *Note: variable concentration [0472] H.sub.2O (˜32.22 mL in 360 mL LM)
Method 1: The Cognitor Minus Test on E. coli Spiked Blood Broth With and Without the 95° C. Step
[0473] Escherichia coli (ATCC® 25922™) was grown in nutrient broth for 18 hours at 37° C. BacT/ALERT SA blood broth (sheep blood) was inoculated to approximately 1×0.sup.7 cfu/mL, 1×10.sup.6 cfu/mL, 1×10.sup.5 cfu/mL, 1×10.sup.4 cfu/mL, and ×10.sup.3 cfu/mL with E. coli. Two sets of 1 ml samples were prepared for testing with or without the 95° C. step. Total viable count (TVC) plates were prepared to confirm cfu/mL values. Two sets of blood broth only ‘no spike’ controls (NSCs), positive controls (broth only plus DNA polymerase) and negative controls (broth only) were also prepared giving a total of 16 samples (see Table 2).
[0474] To each 1 mL sample, 330 μL Reagent A was added and mixed by five tube inversions. Samples were incubated for 15 minutes at room temperature (approximately 19° C.) and then centrifuged for 3 minutes at 7300 RCF. Following centrifugation, supernatants were decanted into a clinical waste receptacle and the open tubes blotted on sterile tissue paper. Each pellet was resuspended in 750 μL Reagent B by tip mixing and incubated for 5 minutes at room temperature. Next, 500 μL Reagent C was added to each sample and mixed by three tube inversions. Samples were centrifuged for 3 minutes at 7300 RCF. The resulting supernatants were decanted into a clinical waste receptacle and the open tubes blotted on sterile tissue paper. Each pellet was resuspended in 500 μL Reagent C by tip mixing, transferred to a beadmill tube containing glass beads (0.1 mm and 0.5 mm glass beads), and centrifuged for 3 minutes at 7300 RCF. Following centrifugation, supernatants were transferred to waste by pipette. 50 μL LM was added to each sample and an additional 10 μL of DNA Polymerase solution was added to the positive control samples. Samples were then placed into a Disruptor Genie and run for 6 min at 2800 rpm. After bead milling, samples were transferred to a heat block set at 37° C. and incubated for 20 minutes.
[0475] Following the 37° C. microorganism lysis (ETGA) step, the 95° C. (−) samples (samples 9-16) were progressed immediately to QPCR setup, whilst the 95° C. (+) samples (samples 1-8) were incubated at 95° C. for 5 minutes prior to QPCR setup. Both sets of samples were analysed by QPCR immediately. The same samples were analysed by QPCR again after 2 hours at room temperature (approximately 19° C.), and again after a further 18 hours at 4° C. This experiment was replicated four times to allow statistical analysis of the results.
TABLE-US-00009 TABLE 2 Test Samples 95° C. (+) Samples 1. E. coli 1 × 10.sup.7 cfu/mL 2. E. coli 1 × 10.sup.6 cfu/mL 3. E. coli 1 × 10.sup.5 cfu/mL 4. E. coli 1 × 10.sup.4 cfu/mL 5. E. coli 1 × 10.sup.3 cfu/mL 6. Blood broth only (NSC) 7. Positive control (Pol + ve) 8. Negative control (Pol − ve) 95° C. (−) Samples 9. E. coli 1 × 10.sup.7 cfu/mL 10. E. coli 1 × 10.sup.6 cfu/mL 11. E. coli 1 × 10.sup.5 cfu/mL 12. E. coli 1 × 10.sup.4 cfu/mL 13. E. coli 1 × 10.sup.3 cfu/mL 14. Blood broth only (NSC) 15. Positive control (Pol + ve) 16. Broth only (Pol − ve) NSC: No spike control
Method 2: PTO ETGA Substrate vs UMO ETGA Substrate
[0476] BacT/ALERT blood broth SA was inoculated to approximately 1×10.sup.7 cfu/mL and 1×10.sup.4 cfu/mL with E. coli. Four sets of 1 ml samples were prepared to compare Cognitor Minus test results with and without the use of PTOs, with and without the 95° C. step. TVC plates were prepared to confirm cfu/mL values. NSCs and positive controls were also prepared (see Table 3). All samples were processed according to the general protocol described above in “Method 1”. Following the 37° C. microorganism lysis (ETGA) step, the 95° C. (−) samples (samples 9-16) were progressed immediately to QPCR setup, whilst the 95° C. (+) samples (samples 1-8) were incubated at 95° C. for 5 minutes before QPCR setup. Both sets of samples were analysed by QPCR immediately. The same samples were analysed by QPCR after 2 hours at room temperature, and again following a further 18 hours at 4° C.
TABLE-US-00010 TABLE 3 Test Samples 95° C. (+) Samples 1. E. coli 1 × 10.sup.7 cfu/mL: UMO LM 2. E. coli 1 × 10.sup.7 cfu/mL: PTO LM 3. E. coli 1 × 10.sup.4 cfu/mL: UMO LM 4. E. coli 1 × 10.sup.4 cfu/mL: PTO LM 5. Blood broth only (NSC): UMO LM 6. Blood broth only (NSC): PTO LM 7. Positive control (Pol + ve): UMO LM 8. Positive control (Pol + ve): PTO LM 95° C. (−) Samples 9. E. coli 1 × 10.sup.7 cfu/mL: UMO LM 10. E. coli 1 × 10.sup.7 cfu/mL: PTO LM 11. E. coli 1 × 10.sup.4 cfu/mL: UMO LM 12. E. coli 1 × 10.sup.4 cfu/mL: PTO LM 13. Blood broth only (NSC): UMO LM 14. Blood broth only (NSC): PTO LM 15. Positive control (Pol + ve): UMO LM 16. Positive control (Pol + ve): PTO LM NSC: no spike control, UMO: unmodified oligonucleotide, PTO: phosphorothioate oligonucleotide, LM: lysis mix
Results and Discussion
Results 1: Removal of the 95° C. Step Improves ETGA QPCR Signal Without a Reduction in Signal Over Time
[0477] The results for samples processed with or without the 95° C. step at time 0, 2 and 20 hours following sample preparation (n=3) are shown in
[0478] Linear modelling was performed (using R) to determine whether there are statistically significant differences between the Ct values obtained for the E. coli spiked blood broth dilution series with or without the 95° C. step and at different time points. Table 4 shows the p-values obtained for different comparisons. Comparison of Ct values for 95° C. (+) samples with 95° C. (−) samples using data from all four experiments produced highly significant p-values (p<0.001) regardless of whether data from individual time points or data from all time points were included in the analysis. Comparison of Ct values for different time points within 95° C. (+) or 95° C. (−) datasets using data from all four experiments produced non-significant p-values (p>0.05). Time point comparisons within the same experiment produced non-significant p-values (p>0.05) for all datasets apart from the 95° C. (−) dataset in experiment 3 (T3), which had a p-value of 0.016. This significant p-value is likely to be due to the more pronounced reduction in Ct value with time that was observed in this particular experiment.
TABLE-US-00011 TABLE 4 Linear Models (using R) to compare Ct value standard curves for the E. coli spiked blood culture dilution series at different time points and with or without the 95° C. step. Data analysed Comparison P-value Significance All data 95° C. (+) vs .sup. <2 × 10.sup.−16 *** 95° C. (−) Time 0 H: T1-T4 data 95° C. (+) vs 4.82 × 10.sup.−8 *** 95° C. (−) Time 2 H: T2-T4 data 95° C. (+) vs 1.31 × 10.sup.−8 *** 95° C. (−) Time 20 H: T2-T4 data 95° C. (+) vs .sup. 1.47 × 10.sup.−10 *** 95° C. (−) 95° C. (+): T1-T4 data Time 0.730 — 95° C. (−): T1-T4 data Time 0.094 — 95° C. (+): T2 data only Time 0.896 — 95° C. (−): T2 data only Time 0.657 — 95° C. (+): T3 data only Time 0.956 — 95° C. (−): T3 data only Time 0.016 * 95° C. (+): T4 data only Time 0.769 — 95° C. (−): T4 data only Time 0.061 — Significance codes: * p < 0.05, ** p < 0.01, *** p < 0.001. —: not significant. T: experiment.
Results 2: Cognitor Minus Results are More Consistent Across Different Time Points When Using PTO LM Rather Than UMO LM
[0479]
Summary
[0480] The data shown here demonstrate that ETGA template DNA detection is improved when the 95° C. step is removed. Furthermore, ETGA QPCR signal does not deteriorate with increased sample storage time in the absence of the 95° C. step. Comparison of PTO LM with UMO LM indicates that the high stability of ETGA template DNA is dependant of the use of PTO ETGA substrate DNA. All of the data shown here support removal of the 95° C. step from the Cognitor Minus test. It is worth noting that the increased sensitivity of the test may increase the chance of detecting background signal (blood-derived ETGA signal), however, optimisation of other factors such as blood lysis/wash performance and interpretation of QPCR results should eliminate the impact of this.
Example 4—Analysis of the Importance of the 95° C. and the Use of a PTO Substrate: Primary Panel Microorganisms
Purpose
[0481] The purpose of the work presented in this report was to: [0482] 1. Compare Cognitor Minus results with and without the 95° C. step for all primary panel microorganisms (E. coli; S. aureus; and C. albicans) [0483] 2. Confirm the findings of Example 3 with regard to comparison between phosphorothioate modified oligonucleotide (PTO) LM and unmodified oligonucleotide (UMO) LM [0484] 3. Test the effect of extended sample storage duration (up to 72 hours) on QPCR results for each primary panel microorganism using PTO LM and UMO LM
Introduction
[0485] The earlier steps in the Cognitor Minus test aim to lyse blood cells and wash away blood-derived proteins such as DNA polymerases, which will produce non-microorganism derived ETGA template DNA, and nuclease enzymes which may digest microorganism-derived ETGA template DNA. This process should not harm any microorganisms that are present in the blood sample. Isolated intact microorganisms are then lysed by the addition of lysis mix (LM) and bead milling. After microorganism lysis and the ETGA reaction, samples contain a mixture of microorganism proteins, LM components, newly synthesised ETGA template DNA and residual blood cell proteins. In the current Cognitor Minus test protocol, the 95° C. step is intended to denature all proteins in order to protect ETGA template DNA and internal process control (IPC) DNA from nuclease digestion so that it can be successfully detected by QPCR. The 95° C. step also inactivates DNA polymerases, thereby quenching the ETGA reaction. However, since incorporating the 95° C. step into the protocol, the UMOs used to form the ETGA substrate (and IPC) in the LM have been replaced with PTOs which are nuclease resistant. Whilst the ETGA extension strand that forms the ETGA template is constructed from standard dNTPs, the PTO substrate DNA that it is annealed to may confer protection against nuclease digestion. Due to the benefits of removing the 95° C. step, such as protocol simplification and a reduction in the time required to run the test, it was deemed important to re-evaluate the necessity of the 95° C. step.
[0486] To assess the importance of the 95° C. step, the Cognitor Minus test was carried out using microorganism-spiked blood broth with or without the 95° C. step. Samples were analysed by QPCR at five time points: immediately after sample preparation; after 2 hours stored at room temperature (approximately 19° C.); and after 24 hours, 48 hours and 72 hours stored at 4° C. The Ct values obtained and consistency of Ct values across the five time points were used to assess the effect of the 95° C. step on Cognitor Minus test performance and sample stability for each of the primary panel microorganisms using either PTO LM or UMO LM.
Materials and Methods
[0487] For details of reagents, see Example 3.
[0488] Escherichia coli (ATCC® 25922™), Staphylococcus aureus (ATCC® 25923™) and Candida albicans (ATCC® 10231™) were grown in liquid media (E. coli and S. aureus in nutrient broth; and C. albicans in Sabouraud media) for approximately 18 hours at 37° C. BacT/ALERT SA blood broth (sheep blood; see Table 6) was inoculated with E. coli, S. aureus and C. albicans to approximately 1×10.sup.4 cfu/mL, 1×10.sup.4 cfu/mL and 1×10.sup.5 cfu/mL respectively. Four sets of 1 ml samples were prepared for testing with or without the 95° C. step for PTO LM and UMO LM. Blood broth only ‘no spike’ controls (NSCs) and positive controls (broth only plus DNA polymerase (PC)) were also prepared giving a total of 20 samples (see Table 5). Total viable count (TVC) plates were prepared to confirm cfu/mL values (see Table 7) and negative blood broth.
[0489] To each 1 mL sample, 330 μL Reagent A was added and mixed by five tube inversions. Samples were incubated for 15 minutes at room temperature (approximately 19° C.) and then centrifuged for 3 minutes at 7300 RCF. Following centrifugation, supernatants were decanted into a clinical waste receptacle and the open tubes blotted on sterile tissue paper. Each pellet was resuspended in 750 μL Reagent B by tip mixing and incubated for 5 minutes at room temperature. Next, 500 μL Reagent C was added to each sample and mixed by three tube inversions. Samples were centrifuged for 3 minutes at 7300 RCF. The resulting supernatants were decanted into a clinical waste receptacle and the open tubes blotted on sterile tissue paper. Each pellet was resuspended in 500 μL Reagent C by tip mixing, transferred to a beadmill tube containing glass beads (0.1 mm and 0.5 mm glass beads), and centrifuged for 3 minutes at 7300 RCF. Following centrifugation, supernatants were transferred to waste by pipette. 50 μL LM was added to each sample and an additional 10 μL of DNA Polymerase solution was added to the positive control samples. Samples were then placed into a Disruptor Genie and run for 6 min at 2800 rpm. After bead milling, samples were transferred to a heat block set at 37° C. and incubated for 20 minutes.
[0490] Following the 37° C. microorganism lysis (ETGA) step, the 95° C. (−) samples (samples 11-20) were progressed immediately to QPCR setup, whilst the 95° C. (+) samples (samples 1-10) were incubated at 95° C. for 5 minutes prior to QPCR setup. Both sets of samples were analysed by QPCR immediately. The same samples were analysed by QPCR again after 2 hours at room temperature, and again after 24 hours, 48 hours and 72 hours at stored at 4° C. This experiment was replicated three times to allow for statistical analysis of the results.
TABLE-US-00012 TABLE 5 Test Samples 95° C. (+) Samples 1. E. coli 1 × 10.sup.4 cfu/mL: PTO LM 2. S. aureus 1 × 10.sup.4 cfu/mL: PTO LM 3. C. albicans 1 × 10.sup.5 cfu/mL: PTO LM 4. PC: PTO LM 5. NSC: PTO LM 6. E. coli 1 × 10.sup.4 cfu/mL: UMO LM 7. S. aureus 1 × 10.sup.4 cfu/mL: UMO LM 8. C. albicans 1 × 10.sup.5 cfu/mL: UMO LM 9. PC: UMO LM 10. NSC: UMO LM 95° C. (−) Samples 11. E. coli 1 × 10.sup.4 cfu/mL: PTO LM 12. S. aureus 1 × 10.sup.4 cfu/mL: PTO LM 13. C. albicans 1 × 10.sup.5 cfu/mL: PTO LM 14. PC: PTO LM 15. NSC: PTO LM 16. E. coli 1 × 10.sup.4 cfu/mL: UMO LM 17. S. aureus 1 × 10.sup.4 cfu/mL: UMO LM 18. C. albicans 1 × 10.sup.5 cfu/mL: UMO LM 19. PC: UMO LM 20. NSC: UMO LM PC: positive control, NSC: no spike control, UMO: unmodified oligonucleotide, PTO: phosphorothioate oligonucleotide, LM: lysis mix
TABLE-US-00013 TABLE 6 Materials Batch/Lot Reagent Supplier number Expiry date Sheep Blood TCS Bioscience 30112000 27 Apr. 2015 (Replicate 1) Sheep Blood TCS Bioscience 30210900 25 May 2015 (Replicate 2) Sheep Blood TCS Bioscience 30255300 8 Jun. 2015 (Replicate 3)
TABLE-US-00014 TABLE 7 Microorganism TVCs Exp. 1 TVC Exp. 2 TVC Exp. 3 TVC Microorganism (cfu total) (cfu total) (cfu total) E. coli 7,200 10,200 28,200 S. aureus 4,200 23,000 23,200 C. albicans 271,000 191,000 246,000
Results and Discussion
[0491] The results for samples processed using either PTO LM or UMO LM with or without the 95° C. step at time 0, 2, 24, 48 and 72 hours (n=3) are shown in
Removal of the 95° C. Step Improves ETGA QPCR Signal
[0492] All microorganism-spiked blood broth samples and positive control samples processed without the 95° C. step produced lower Ct values (stronger ETGA signal) than corresponding samples processed with the 95° C. step, for both PTO LM and UMO LM. The average ΔCt values (95° C. (+) subtract 95° C. (−)) for PTO LM samples at ‘0 hours’ were 0.98 Ct units, 1.41 Ct units, 0.12 Ct units and 1.21 Ct units forE. coli, S. aureus and C. albicans and positive control respectively. The average ΔCt values (95° C. (+) subtract 95° C. (−)) for UMO LM samples at ‘0 hours’ were 3.91 Ct units, 4.10 Ct units, 5.36 Ct units and 1.20 Ct units for E. coli, S. aureus and C. albicans and positive control respectively. The majority of NSC samples processed with PTO LM did not produce Ct values due to low QPCR amplification, and therefore this data is not shown in
Cognitor Minus Results are More Consistent Across Different Time Points When Using PTO LM Rather than UMO LM
[0493] Within the PTO LM dataset, all microorganism-spiked blood broth samples and positive control samples produced highly consistent Ct values across the 72 hour storage period, regardless of whether samples were processed with the 95° C. step. Within the UMO LM 95° C. (+) dataset, E. coli, S. aureus and positive control samples produced fairly consistent Ct values across the 72-hour storage period, whereas C. albicans and NSC samples showed an increase in Ct values over time (reduction in ETGA signal). This increase in Ct values for C. albicans and NSC samples may be due to a greater impact of nuclease activity on ETGA template DNA concentration when the starting concentration is lower, as indicated by higher Ct values for these samples at ‘0 hours’. UMO LM 95° C. (−) samples generally showed a decrease in Ct value (increase in ETGA QPCR signal) over time, except for C. albicans and NSC samples were Ct values were highly consistent across the 72-hour period. This indicates that for E. coli, S. aureus and positive control samples processed without the 95° C. step (protein denaturation), continuation of the ETGA reaction results in increased QPCR signal, out competing any nuclease activity. Whereas, in C. albicans and NSC samples, where the effect of nuclease degradation seems to be more pronounced, the continued ETGA reaction may be counteracting this degradation to provide more stable QPCR signal over time.
Statistical Analysis of Results
[0494] Linear modelling was performed (using R) to determine whether there are statistically significant differences between the Ct values obtained for PTO LM and UMO LM samples processed with or without the 95° C. step at different time points. For each dataset (e.g. E. coli with PTO LM dataset), ‘Ct’ was modelled against the following explanatory variables and their interactions: log10 cfu', ‘Time’, and ‘95° C. step’. Non-significant (p>0.05) interactions and variables were removed from the model in a stepwise manner, resulting in model simplification. However, non-significant variables were not removed from the model if any of their interactions were significant (p<0.05). Therefore, the final model for each dataset contained only significant interactions, significant variables, and non-significant variables that form significant interactions. Significance codes for each variable and interaction are shown in Table 8 (significance codes are based on p-values for each interaction or variable at the point of model simplification, if removed from the model, or from the final model).
TABLE-US-00015 TABLE 8 Significance codes for p-values of each explanatory variable and their interactions using linear modelling in R Log10 Log10 Log10 Time: Log10 cfu: Dataset cfu Time 95° C. cfu: Time cfu: 95° C. 95° C. Time: 95° C. E. coli PTO LM *** NS *** NS ~ NS NS E. coli UMO LM *** ** *** NS NS * NS S. aureus PTO LM *** NS * NS ** NS NS S. aureus UMO LM *** *** *** NS *** ** NS C. albicans PTO LM * NS *** NS *** NS NS C. albicans UMO LM ~ NS ** NS ** NS NS PC PTO LM ~ *** NS PC UMO LM ~ *** ~ NSC UMO LM NS NS *** Significance codes: ***p < 0.001, **p < 0.01, *p < 0.05, ~p < 0.1, NS—not significant.
[0495] The 95° C. step has a significant effect on Ct value for all microorganisms and positive controls with PTO LM and UMO LM. Sample storage duration (Time' and ‘Time’ interactions) has no significant effect on Ct value for any microorganism or positive control with PTO LM; and is also non-significant for C. albicans and the positive control with UMO LM. However, sample storage duration is a significant variable for E. coli and S. aureus with UMO LM: most likely due to the observed reduction in Ct value over time for samples processed without the 95° C. step in these sample sets. There is no significant effect of the 95° C. step for the NSC UMO LM dataset; but there is a significant interaction between sample storage duration and the 95° C. step (Time:95° C.). Statistical analysis could not be performed on the NSC PTO LM dataset due to missing Ct values as a result of low QPCR amplification.
Summary
[0496] The data shown here demonstrate that ETGA template DNA detection is improved when the 95° C. step is removed. Furthermore, ETGA QPCR signal does not deteriorate with increased sample storage duration in the absence of the 95° C. step when samples are processed using PTO ETGA substrate DNA. ETGA signal is not as stable when samples are processed using UMO ETGA substrate DNA: in the absence of the 95° C. step ETGA QPCR signal continues to increase with sample storage duration; and with the 95° C. step ETGA QPCR signal is more likely to deteriorate as a result of nuclease degradation without continued production of ETGA template DNA. These results are consistent with the results presented in Example 3.
[0497] All of the data shown here support removal of the 95° C. step from the Cognitor Minus test, and confirm the importance of using PTO ETGA substrate DNA in the LM. These results also verify that samples processed using PTO LM can be stored for up to 72 hours at 4° C., without being detrimental to test results. It is worth noting that the increased sensitivity of the test upon removal of the 95° C. step may increase the chance of detecting background signal (blood-derived ETGA QPCR signal). However, whilst NSC PTO LM samples did not provide a complete set of Ct values for comparison (due to low amplification), the NSC UMO LM dataset demonstrates that the increase in ETGA QPCR signal associated with removal of the 95° C. is lower for NSCs than it is for positive samples. Furthermore, optimisation of other factors such as blood lysis/wash performance and interpretation of QPCR results should eliminate the impact of this.
[0498] The present invention is not to be limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims. Moreover, all embodiments described herein are considered to be broadly applicable and combinable with any and all other consistent embodiments, as appropriate.
[0499] Various publications are cited herein, the disclosures of which are incorporated by reference in their entireties.