BIOLOGICAL MICROBIAL TREATING AGENT FOR RADIOACTIVE MATERIAL REMOVAL

Abstract

The present invention provides a biological microbial treating agent, for radioactive material removal, comprising at least one type of microorganism selected from Bacillus amyloliquefaciens KS-R01, Bacillus siamensis KS-R02, Bacillus velezensis KS-R03 and Bacillus tequilensis KS-R04.

Claims

1. A biological microbial treating agent for radioactive material removal, comprising at least one type of microorganismselected from Bacillus amyloliquefaciens KS-R01, Bacillus siamensis KS-R02, Bacillus lezensis KS-R03 and Bacillus tequilensis KS-R04.

2. The biological microbial treating agent of claim comprising Bacillus amyloliquefaciens KS-R01, Bacillus siamensis KS-R02, Bacillus velezensis KS-R03 and Bacillus tequilensis KS-R04.

3. A method for removing radioactive materials by treating water or soil contaminated with radioactive materials with the microbial treating agent of claim 1.

Description

DESCRIPTION OF DRAWINGS

[0015] FIG. 1 is a view showing the results of showing a degree of colony formation of four selected strains according to the present invention by radioactive irradiation.

[0016] FIG. 2 is a survival curve of four selected strains according to the present invention by radioactive irradiation.

MODE FOR INVENTION

[0017] Hereinafter, the content, of the present invention will be described in more detail as follows.

[0018] As described. above, the present invention may provide a biological microbial treating agent for radioactive material removal, which. contains at least type of microorganism selected from Bacillus amylcliquefaciens KS-R01, Bacillus siamensis KS-R02, Bacillus velezensis KS-R03, and Bacillus tequilensis KS-R04.

[0019] For the microorganisms used above in the present invention, the present invention may provide a biological microbial treating agent for radioactive material removal, which includes at least one type of microorganism selected from Bacillus amylcliquefaciens KS-R01 (KCTC 13558BP) , Bacillus siamensis KS-R02 (KCTC 13559BP), Bacillus velezensis KS-R03 (KCTC 13560BP), and Bacillus tequilensis KS-R04 (KCTC 13561BP).

[0020] The biological microbial treating agent according to the present invention is not particularly limited, but may be mixed with each microbial strain at a ratio of 1 to 30 wt %. The biological microbial treating agent according to the present invention may have the four types of microorganisms mixed to exert a synergistic effect and environmentally remove radioactive materials as the agent is directly put into places contaminated with radioactive materials, such as ocean, river, lake or soil, other articles contaminated with radiation, or the like.

[0021] Bacillus amyloliquefaciens KS-R01 (KCTC 13558BP), Bacillus siamensis KS-R02 (KCTC 13559BP), Bacillus velezensis KS-R03 (KCTC 13560BP) and Bacillus tequilensis KS-R04 (KCTC 13561BP), which form the biological microbial treating agent according to the present invention, were deposited to the Gene Bank in the Korea Research Institute of Bioscience and Biotechnology on Jun. 21, 2018.

[0022] The biological microbial treating agent according to the present invention, containing the above-described microorganisms, may be prepared by the following method.

[0023] The 0.001 to 0.02 wt % of microbial starters consisting of the above microbial strains (at least one of the four species), 2 to 5 wt % of rice bran, 2 to 4 wt % of molasses, and 2 to 4 wt % of brown sugar may be mixed with the rest of water to make it 100 wt %, and cultured for 15 to 21 days by repeating a process of performing an aeration at 100 to 500 L/h for 1 to 3 hours at intervals of 2 to 6 hours 2 to 6 times a day while maintaining a temperature of 20 to 25° C., thereby preparing a liquid microbial agent. The above conditions such as the aeration, etc., may be those optimized as a result of the inventor's research, and those skilled in the art will appreciate that some modifications may be made to the above conditions, but such modifications do not depart from the scope of the present invention.

[0024] After preparing the liquid microbial agent as above, a mixed raw material including 20 to 30 wt % of one or more raw materials for cultivation selected from the group consisting of dried powder of rice bran, agricultural by-products, and agricultural and forest products, and 70 to 80 wt % of the liquid microbial agent may be prepared, and the inoculation step of inoculating 0.01 to 0.1 wt % of the microbial starters according to the present invention may be performed.

[0025] The biological microbial treating agent of the present invention may use rice bran, agricultural by-products, agricultural and forest products, or the like, which are relatively easy to obtain and have a low cost burden, as a raw material for cultivation of microorganisms. For the raw material for cultivation, the rice bran, agricultural by-products or agricultural and forest products may be used alone or in combination, but may be preferably formed at a composition ratio of 35 to 45 wt % of rice bran, 25 to 35 wt % of agricultural by-products, and 20 to 30 wt % of agricultural and forest products. It is preferable that the raw material for cultivation is pulverized with 100 mesh in advance and used in a powder form. The mixed and pulverized raw materials for cultivation may be put into a direct warmed incubator, after which moisture may be adjusted with a liquid fermenting agent to maintain an environment suitable for microbial fermentation, and then inoculated with the mixed microbial starters.

[0026] After performing the inoculation step, the inoculated mixed raw materials may be subjected to a high-temperature cultivation step of culturing at 80 to 85° C. for 2 to 8 hours. As described above, the method for preparing a biological microbial treating agent of the present invention may have a feature of being cultured at an ultra-high temperature of 80° C. or higher. Considering that normal microbial cultivation is performed in the range of 20 to 40° C., it can be understood that the biological microbial treating agent of the present invention is performed under ultra-high temperature conditions. In particular, in one embodiment of the present invention, the raw materials for cultivation, inoculated with the mixed starters, may be cultured at an ultra--high temperature of 80 to 85° C. for 2 to 8 hours while stirring at a speed of 30 to 80 rpm/min. In this case, the cultivation may be performed at a temperature of 80° C. or higher so as to suppress the proliferation of unnecessary microorganisms, but may be preferably performed at 85° C. or lower to maintain the activity of the polymicrobes according to the present invention.

[0027] The method of inputting the biological microbial treating agent that may be prepared as described above is to directly spray from a culture tank containing the biological microbial treating agent according to the present invention onto a radioactive contaminated area by using a sprayer, etc., or to directly input to the contaminated area simply by installing a fixed injection tank. The biological microbial treating agent to be inputted may vary depending on a radioactive contaminant, but in general may be made into a 10 to 30-fold dilution of the microbial preparation stock solution to make an activating solution, and then inputted in an appropriate amount several times at an interval of 1 to 3 days.

[0028] The stock solution of the microbial preparation may be prepared by adding 0.1 to 1.0 parts by weight of the microbial preparation, preferably 0.2 to 0.7 parts by weight, and most preferably 0.5 parts by weight, based on 100 parts by weight of the water, mixing with 0.5 to 2.0 parts by weight of molasses, preferably 0.8 to 1.2 parts by weight, and most preferably 1 part by weight, and culturing with an aeration for about 72 hours while maintaining at 18 to 25° C. The activating solution may be formed, for example, by adding water 10 times the amount of the microbial preparation stock solution at a weight ratio so as to make a composition containing 0.2 wt % of molasses when preparing a 10-fold activating solution. After that, the activating solution may be obtained by culturing with an aeration. for about 48 hours while maintaining at 18 to 25° C.

[0029] Hereinafter, the content of the present invention will be described through the following examples and experimental examples. However, these examples are provided only for the purpose of illustrating the present invention in more detail, and thus the scope of the present invention is not limited thereto.

Experimental Example 1 Isolation Of Radiation-Resistant Strains

[0030] 1. Radioactive resistance of KS50 complex microbial agent

[0031] KS50 starters, powder products, liquid products and liquid products, which are complex microbial agents developed by Keonnong Co., Ltd., were subjected to irradiation with different Co-60 gamma rays of 0, 4, 6, 8, 10 kGy, so as to isolate surviving microorganisms.

[0032] As shown in Tables 1 and 2, for KS50 starters (F2), powder products (F3), and liquid products (F4), which were not irradiated with radioactivity, a total of 3.3×10.sup.7, 5.8×10.sup.6, and 4.2×10.sup.6 CFU were present TSA medium, respectively, and 1.0×10.sup.6, 4.8×10.sup.6, and 6.3×10.sup.6 CFU were present in YM medium.

[0033] The maximum irradiation dose viable in the TSA medium was 10 kGy for F2, 4 kGy for F3, and 10 kGy for F4, in which 5.0×10.sup.1, 1.9×10.sup.3 and 5 colonies were detected, respectively. In the YM medium, the maximum irradiation dose was confirmed to be 4 kGy for F2 with 5.0×10.sup.1 CFU, 6 kGy for F3 with 5.0×10.sup.2 CFU, and 6 kGy for F4 with 1.0×10.sup.2 CFU.

[0034] From these results, it was confirmed that the KS50 complex microbial starters and products contain a number of microorganisms that are resistant to radioactivity.

[0035] There was a difference in the number of viable cells depending on the irradiation dose according to the composition of the medium, but the number of viable cells decreased as the irradiation dose increased. In particular, when the irradiation dose was increased to 4 kGy, the number of viable cells was rapidly decreased. Accordingly, the irradiation dose for screening efficient radiation-resistant microorganisms was selected to be 4 kGy or more.

TABLE-US-00001 TABLE 1 Measurement of viable cell counts in TSA medium (CFU/mL) Irradiation dose (kGy) TSA(BD) 0 0.5 1 2 4 6 8 10 F2 3.3 × 10.sup.7 1.0 × 10.sup.6 2.5 × 10.sup.6 6.3 × 10.sup.6 1.2 × 10.sup.4 1.0 × 10.sup.2 10 × 10.sup.2 5.0 × 10.sup.1 F3 5.8 × 10.sup.6 1.5 × 10.sup.6 3.8 × 10.sup.5 6.3 × 10.sup.4 1.9 × 10.sup.3 ND ND ND F4 4.2 × 10.sup.6 6.8 × 10.sup.5 2.9 × 10.sup.5 4.5 × 10.sup.4 3.5 × 10.sup.2 5.0 × 10.sup.1 5.0 5.0 * ND: not detected

TABLE-US-00002 TABLE 2 Measurement of viable cell counts in YM medium (CFU/mL) Irradiation dose (kGy) YM(BD) 0 0.5 1 2 4 6 8 10 F2 1.0 × 10.sup.6 2.5 × 10.sup.6 1.5 × 10.sup.6 1.5 × 10.sup.5 5.0 × 10.sup.1 ND ND ND F3 4.8 × 10.sup.6 8.0 × 10.sup.6 8.5 × 10.sup.6 2.5 × 10.sup.6 4.5 × 10.sup.3 5.0 × 10.sup.2 ND ND F4 6.3 × 10.sup.6 1.2 × 10.sup.6 6.0 × 10.sup.5 2.8 × 10.sup.4 1.5 × 10.sup.2 1.0 × 10.sup.2 ND ND *ND: not detected

[0036] 2. Isolation of radiation--resistant strains from TSA complex microbial agent

[0037] The surviving strains were isolated from the first Co-60 (Cobalt 60) radioactive irradiation, and then re-irradiated at an irradiation dose of 4-15 kGy so as to isolate and identify the surviving strains. A total of 22 types of microorganisms were isolated on the TSA medium and a total of 14 types of microorganisms were isolated on the YM medium, and their survival was confirmed by irradiation with gamma rays at an irradiation dose of 4, 6, 8, 10, 11, 12, 13, and 15 kGy. As shown in Tables 3 and 4, it appears that the survival was achieved even at an irradiation of 8 kGy for T11-6k, 11 kGy for T12-11k, 4 kGy for T14-4k, 4 kGy for T15-4k, 11 kGy for T16-11k, 6 kGy for T17-6k, 6 kGy for T18-6k, and 8 kGy for T19-8k, while the survival was achieved even at an irradiation of 6 kGy for Y6-6k, 8 kGy for Y7-8k, and 6 kGy for Y11-6k. As described above, 9 types of microorganisms that survived at an irradiation dose of 6 kGy were isolated, 5 types of microorganisms that survived at 8 kGy were isolated, and 2 types of microorganisms that survived at 11 kGy were isolated.

[0038] The microorganisms that survived at an irradiation dose of 4 kGy or higher were found to be microorganisms which were detected in liquid products cultured in liquid medium using the starters of KS50complex microbial agent.

TABLE-US-00003 TABLE 3 Radioactive resistance of strains isolated from TSA medium (CFU/mL) First radioactive irradiation Second radioactive Viable cell irradiation (kGy) Name Information count 4 6 8 10 11 12 13 15 Id T1 F2-10 kGy 5.0 × 10.sup.1 — — — — — — — — T2 F2-6 kGy 5.0 × 10.sup.2 — — — — — — — — T3 F2-6 kGy 5.0 × 10.sup.2 — — — — — — — — T4 F2-6 kGy 5.0 × 10.sup.2 — — — — — — — — T5 F2-4 kGy 4.5 × 10.sup.3 — — — — — — — — T6 F2-4 kGy 4.5 × 10.sup.3 — — — — — — — — T7 F2-4 kGy 4.5 × 10.sup.3 — — — — — — — — T8 F2-4 kGy 2.0 × 10.sup.4 — — — — — — — — T9 F2-4 kGy 2.0 × 10.sup.4 — — — — — — — — T10 F2-4 kGy 2.0 × 10.sup.4 — — — — — — — — T11 F4-8 kGy 2.5 × 10.sup.1 ◯ ◯ ◯ — — — — — T11-6k T12 F4-8 kGy 2.5 × 10.sup.1 ◯ ◯ ◯ ◯ ◯ — — — T12-11k T13 F4-8 kGy 2.5 × 10.sup.1 ◯ — — — — — — — T14 F4-8 kGy 2.5 × 10.sup.1 ◯ — — — — — — — T14-4k T15 F4-6 kGy 5.0 × 10.sup.1 ◯ — — — — — — — T15-4k T16 F4-6 kGy 5.0 × 10.sup.1 ◯ ◯ ◯ ◯ ◯ — — — T16-11k T17 F4-6 kGy 2.0 × 10.sup.2 ◯ ◯ — — — — — — T17-6k T18 F4-6 kGy 2.0 × 10.sup.2 ◯ ◯ — — — — — — T18-6k T19 F4-6 kGy 2.0 × 10.sup.2 ◯ ◯ ◯ — — — — — T19-8k T20 F3-8 kGy 2 — — — — — — — — T21 F3-8 kGy 2 — — — — — — — — T22 F2-8 kGy 2.5 × 10.sup.2 — — — — — — — —

TABLE-US-00004 TABLE 4 Radioactive resistance of microorganisms isolated from YM medium (CFU/mL) First radioactive irradiation Second radioactive Viable cell irradiation Name Information count 4 6 8 10 11 12 13 15 Id Y1 F4-8 kGy <9 — — — — — — — — Y2 F4-8 kGy <9 — — — — — — — — Y3 F4-8 kGy <9 — — — — — — — — Y4 F4-8 kGy <9 — — — — — — — — Y5 F4-6 kGy .sup. 1 × 10.sup.2 — — — — — — — — Y6 F4-6 kGy .sup. 1 × 10.sup.2 ◯ ◯ — — — — — Y6-6k Y7 F4-4 kGy 1.5 × 10.sup.2 ◯ ◯ ◯ ◯ ◯ — — — Y7-8k Y8 F4-4 kGy 1.5 × 10.sup.2 — — — — — — — — — Y9 F4-4 kGy 1.5 × 10.sup.2 — — — — — — — — — Y10 F4-4 kGy 1.5 × 10.sup.2 — — — — — — — — — Y11 F4-4 kGy 1.5 × 10.sup.2 ◯ ◯ — — — — — — Y11-6k Y12 F4-4 kGy 1.5 × 10.sup.2 — — — — — — — — — Y13 F3-2 kGy 2.5 × 10.sup.6 — — — — — — — — — Y14 F2-2 kGy 1.5 × 10.sup.5 — — — — — — — — — * Information marked: Sample type-irradiation dose* TSA medium: Tryptic soy agar, cultured at 35° C. for 24 hours * YM medium: Yeast and mold media, cultured at 30° C. for 48 hours * Colony production marked - “◯” * A final ID mark for strain identification was written based on the second radioactive irradiation.

[0039] 3. Identification of radiation-resistant microorganisms

[0040] A total of 36 types of strains were isolated from samples that survived the first radioactive irradiation (Tables 3 and 4), and the radioactive irradiation was performed at an irradiation dose ranging from 4 to 15 kGy, so as to identify microorganisms based on 16S rRNA gene sequence for 28 types of surviving microorganisms.

[0041] As a result of analyzing a total of 28 types of microorganisms (Table 5), it was composed of 4 types of microorganisms. Finally, as shown in. Table 6, it was identified that the microorganisms surviving at an irradiation dose of 11 kGy are Bacillus amyloliquefaciens (T16-11k) and Bacillus siamensis (T12-11k), the microorganism surviving at 8 kGy is Bacillus velezensis (T19-8k), and the microorganism surviving at 6 kGy is Bacillus tequilensis (Y11-6k). Radiation-resistant microorganisms appeared all as Bacillus bacteria, and Bacillus is known to have resistance to extreme environments by forming resistant spores in extreme environments such as ultraviolet rays, high temperatures, low temperatures, high pressures, etc. Microorganisms that survived at an irradiation dose of 4 kGy or more are considered to have resistance by resistant spores. The analyzed 16S nucleotide sequence is as shown in Tables 7 and 10.

TABLE-US-00005 TABLE 5 Results of 16S identification for a total of 28 strains Diff/ No. ID Stain name Similarity Total  1 T16-11k Bacillus amyloliquefaciens 99.86 2/1472  2 T12-11k Bacillus siamensis 99.86 2/1472  3 T19-8k Bacillus velezensis 99.86 2/1403  4-1 T16-8k-b-1 Bacillus velezensis 99.86 2/1403  4-2 T16-8k-b-2 Bacillus amyloliquefaciens 99.8 3/1472  4-3 T16-8k-b-3 Bacillus amyloliquefaciens 99.86 2/1471  4-4 T16-8k-b-4-a Bacillus amyloliquefaciens 99.86 2/1471  4-5 T16-8k-b-4-b Bacillus amyloliquefaciens 99.86 2/1471  5-1 T12-8k-b-1 Bacillus velezensis 99.86 2/1403  5-2 T12-8k-b-2 Bacillus velezensis 99.86 2/1403  5-3 T12-8k-b-3 Bacillus velezensis 99.86 2/1403  6 T19-6k Bacillus velezensis 99.86 2/1403  7 T18-6k Bacillus velezensis 99.86 2/1403  8 T17-6k Bacillus siamensis 99.93 1/1472  9 T11-6k Bacillus amyloliquefaciens 99.8 3/1472 10-1 T15-4k-a-1 Bacillus tequilensis 99.93 1/1472 10-2 T15-4k-a-2 Bacillus tequilensis 99.93 1/1472 10-3 T15-4k-b Bacillus tequilensis 99.93 1/1472 10-4 T15-4k-c-1 Bacillus tequilensis 99.93 1/1472 10-5 T15-4k-c-2 Bacillus tequilensis 99.93 1/1472 10-6 T15-4k-d Bacillus tequilensis 99.93 1/1472 10-7 T15-4k-e Bacillus tequilensis 99.93 1/1472 10-8 T15-4k-f Bacillus tequilensis 99.93 1/1472 11 T14-4k Bacillus amyloliquefaciens 99.8 3/1472 12 Y7-8k Bacillus amyloliquefaciens 99.8 3/1472 13 Y11-6k Bacillus tequilensis 99.93 1/1472 14 Y6-6k Bacillus amyloliquefaciens 99.8 3/1472 15 Y7-4k Bacillus amyloliquefaciens 99.8 3/1472

TABLE-US-00006 TABLE 6 Four types of non-overlapping strains with high radioactive resistance among 28 strains No. ID Strain name Similarity Diff/Total 1 T16-11k Bacillus amyloliquefaciens 99.86 2/1472 2 T12-11k Bacillus siamensis 99.86 2/1472 3 T19-8k Bacillus velezensis 99.86 2/1403 4 Y11-6k Bacillus tequilensis 99.93 1/1472

[0042] 4. Radioactive resistance of selected strains

[0043] As a result of smearing four types of strains irradiated with radioactivity at an irradiation dose of 0.5 to 4 kGy and examining a growth pattern (FIG. 1), it was observed that T16 and T19 strains do not for a colony at an irradiation dose of or more, whereas Y11 and T12 strains have a colony surviving even at a dose of 2 kGy. Y11 strain showed a survival rate about 0.001% at 2 kGy, and T12 strain showed a survival rate of 2% at 2 kGy and about 0.7% at 4 kGy. In addition, as a result of confirming a survival trend according to the irradiation dose (FIG. 2), it was shown that T16 strain is −1.1, Y11 strain is −1.9, and T19 strain is −2.5, but T12 strain is −0.48, showing a definitely higher survival curve depending on doses than other strains.

[0044] In order to confirm the quantitative radioactive resistance, it was attempted to calculate the D10 value of the strain (Table 7). Based on the survival rate, a trend line value of a growth curve for each strain could be calculated as follows.

TABLE-US-00007 TABLE 7 Radioactive resistance of isolated microorganisms Sample b a D10 value (kGy) T16 0.078 −1.13 0.95 T19 0.053 −2.00 0.53 Y11 0.135 −1.94 0.58 T12 −0.46 −0.48 1.13

[0045] As a result of calculating a D10 value (an irradiation dose at which 90% of strains die) based on the survival curve of each. strain, the T12 strain. showed the D10 value=1.13, which was a higher value than that of other strains. In conclusion, it means that the T12 strain has higher radioactive resistance than other strains. The radioactive susceptibility of microorganisms may vary depending on the microorganism's various species, growth states, environments, or the like. Gram-positive bacteria and resistant spores of the genus Clostridium or Basillus, and some radiation-resistant microorganisms may exhibit high radioactive resistance with a D10 value of 1 kGy or more. In contrast, food poisoning bacteria that do not form spores (Salmonella, Staphylococcus, Listeria, Escherichia, etc.) may have low radioactive resistance and thus show a D10 value of around 0.5 kGy. It has been reported that there is a sterilization effect of about 10.sup.−6 level by radioactive irradiation of 3 kGy, which is an irradiation dose of radioactive sterilization for general food.

Example 1

[0046] The 0.01 kg of Bacillus amyloliquefaciens KS-R01 (KCTC 13558BP) starter, 4 kg of rice bran, 2 kg of molasses, and 4 kg of brown sugar were mixed with water suitable for drinking water to make it a weight of 100 kg, and then cultured for 21 days by repeating a process of performing an aeration at 100 L/h for 2 hours at intervals of 4 hours 4 times a day while maintaining a temperature of 20 to 25° C., thereby preparing a liquid microbial agent. The liquid fermenting agent had a total number of bacteria of 4.3=10.sup.7 cfu/g.

[0047] Apart from the above, 65 kg of rice bran and 35 kg of agricultural by-products which were pulverized in advance were added to an incubator with a mixing function and mixed for 30 minutes. The 30 kg of the liquid fermenting agent was added to the mixed raw materials to adjust a moisture concentration to 70%, and then the microbial mixed starters according to the present invention were inoculated at 0.01% of the total weight the raw materials for cultivation. The inoculated raw materials for cultivation were cultured for four hours in an incubator at a ultra-high internal temperature of 80 to 85° C. while stirring at 30 to 80 rpm/min, so as to prepare a complex microbial preparation of the present invention.

[0048] The 1 ton of water was added to 5 kg of the complex microbial preparation, and 10 kg of molasses was added thereto and cultured at 25° C. for 72 hours along with aeration so as to obtain a stock solution. Water was added 20 times the amount of the stock. solution at a weight ratio, and 0.2 wt % of molasses was added to obtain a 20-fold dilution of the stock solution for an activating solution.

Example 2

[0049] A microbial preparation was prepared by the same process as shown in Example 1 with an exception of using Bacillus siamensis KS-R02 (KCTC 13559BP) as a microbial starter.

Example 3

[0050] A microbial preparation was prepared by the same process as shown in Example 1 with an exception of using Bacillus velezensis KS-R03 (KCTC 13560BP) as a microbial starter.

Example 4

[0051] A microbial preparation was prepared by the same process as shown in Example 1 with an exception of using Bacillus tequilensis KS-R04 (KCTC 13561BP) as a microbial starter.

Example 5

[0052] A microbial preparation was prepared by the same process as shown. in Example 1 with an exception of using a mixed strain obtained by mixing Bacillus amyloliquefaciens KS-R01 (KCTC 13558BP), Bacillus siamensis KS-R02 (KCTC 13559BP), Bacillus velezensis KS-R03 (KCTC 13560BP) and Bacillus tequllensis KS-R04 (KCTC 13561BP) as a microbial starter in the same amount.

Experimental Example 2

Experimental Method

[0053] As for the conditions for injecting the microbial preparation, an activating solution, which was the 20-fold dilution of the stock solution of the complex microbial preparation, was injected 1/50 compared to the volume of the soil, so as to exert an optimal performance.

[0054] A soil sample was collected from the soil of the Danyang area, which a granite base with the amount of radon generated exceeding a reference value, and an average value of naturally occurring radon in the soil collected from the area is about 180 becquerels (Bq/m.sup.3) as measured by a radon meter.

Experimental Results

[0055]

TABLE-US-00008 TABLE 8 Radon value measurement results (First) Radon value (Bq/m.sup.3) Classification 0 60 min 120 min 180 min Example 1 182 166 125 86 Example 2 179 165 122 82 Example 3 183 164 123 80 Example 4 184 166 120 79 Example 5 183 142 108 58 Comparative Example 182 179 172 168

[0056] Table 8 shows the results of continuously investigating a radon value generated from the soil sample at an interval of 60 minutes during an experiment using a radon meter. From the above experimental results, it can be confirmed that the microbial preparation according to the present invention significantly decreases the amount of radon generated, and thus it is expected to be very effective in preventing the environmental pollution of radioactively contaminated areas and restoring the environment.

[0057] As described above, the present invention has been described with reference to preferred exemplary embodiments herein, but it will be understood by those skilled in the art that the present invention may be variously changed and modified without departing from the spirit and field of the present invention, as described in the following scope of patent claims.

TABLE-US-00009 SEQ ID NO: 1: 16S sequence of T16-11k (Bacillus amyloliquefaciens) [96]GTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGT TGGGgTTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCA TTCAGTTGGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGAAGGT GGGGATGACGTCAAATCATCATGCCCCTTATGACCTGGGCTACACACGT GCTACAATGGGCAGAACAAAGGGCAGCGAAACCGCGAGGTTAAGCCAAT CCCACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGT GAAGCTGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACG TTCCCGGGCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACA CCCGAAGTCGGTGAGGTAACCTTTTTGGAGCCAGCCGCCGAAGGTGGGA CAGATGATTGGGGTG SEQ ID NO: 2: 16S sequence of T12-11k (Bacillus siamensis) GTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGGG TTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAG TTGGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGAAGGTGGGGA TGACGTCAAATCATCATGCCCCTTATGACCTGGGCTACACACGTGCTAC AATGGACAGAACAAAGGGCAGCGAAACCGCGAGGTTAAGCCAATCCCAC AAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGTGAAGC tGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCC GGGCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGA AGTCGGTGAGGTAACCTTTATGGAGCCAGCCGCCGAAGGTGGGACAGAT GATTGGGGTG SEQ ID NO: 3: 16S sequence of T19-8k (Bacillus velezensis) GTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATGTTGGG TTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCATTCAG TTGGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGAAGGTGGGGA TGACGTCAAATCATCATGCCCCTTATGACCTGGGCTACACACGTGCTAC AATGGACAGAACAAAGGGCAGCGAAACCGCGAGGTTAAGCCAATCCCAC AAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGTGAAGC TGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACGTTCCC GGGCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACACCCGA AGTCGGTGAGGTAACCTTTTAGGAGCCAGCCGCCGAAGGTGGGACAGAT GATTGGGGTG SEQ ID NO: 4: 16S sequence of Y11-6k (Bacillus tequilensis) [105]GTGACAGGTGGTGCATGGTTGTCGTCAGCTCGTGTCGTGAGATG TTGGGTTAAGTCCCGCAACGAGCGCAACCCTTGATCTTAGTTGCCAGCA TTCAGTTGGGCACTCTAAGGTGACTGCCGGTGACAAACCGGAGGAAGGT GGGGATGACGTCAAATCATCATGCCCCTTATGACCTGGGCTACACACGT GCTACAATGGACAGAACAAAGGGCAGCGAAACCGCGAGGTTAAGCCAAT CCCACAAATCTGTTCTCAGTTCGGATCGCAGTCTGCAACTCGACTGCGT GAAGCTGGAATCGCTAGTAATCGCGGATCAGCATGCCGCGGTGAATACG TTCCCGGGCCTTGTACACACCGCCCGTCACACCACGAGAGTTTGTAACA CCCGAAGTCGGTGAGGTAACCTTTTAGGAGCCAGCCGCCGAAGGTGGGA CAGATGATTGGGGTG