PREPARATION METHOD FOR DNA LIBRARY, AND ANALYSIS METHOD FOR DNA LIBRARY
20220372469 · 2022-11-24
Inventors
- Zhihong ZHANG (Guangzhou, CN)
- Xiaotian WANG (Guangzhou, CN)
- Zhen ZHANG (Guangzhou, CN)
- Yunzhao GU (Guangzhou, CN)
- Yusheng HAN (Guangzhou, CN)
- Haibo ZHANG (Guangzhou, CN)
Cpc classification
C12N15/1065
CHEMISTRY; METALLURGY
C12N15/1093
CHEMISTRY; METALLURGY
C12Q2525/173
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
C12Q2525/173
CHEMISTRY; METALLURGY
C12N15/1093
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
Abstract
Provided is a preparation method for a DNA library, comprising a pre-library preparation process, the pre-library preparation process comprising DNA preparation, end repair and 3′ A-tailing, linker connection using an anti-contamination linker, linker connected product purification, pre-library amplification, and amplified pre-library purification. Also provided are a use of the anti-contamination linker in preparing a test kit for DNA library capture, and a method for performing bioinformatic analysis on the DNA library prepared by means of the preparation method of the present invention. The preparation method of the present invention reduces the risk of cross-contamination between samples.
Claims
1. A method for preparing a DNA library, comprising a pre-library preparation process, wherein the pre-library preparation process comprising DNA preparation, end repairing and 3′A tailing, adapter ligation using contamination-resistant adapters, purification of adapter ligation products, amplification of pre-library, and purification of the amplified pre-library, wherein the contamination-resistant adapters are additionally added with 2-3 bps at the 3′-end or 5′-end compared with original adapters used to prepare the DNA library, thus forming multiple pairs of contamination-resistant adapters, the multiple pairs of contamination-resistant adapters are preferably 4, 5, 6, 7 or 8 pairs.
2. Method for preparing a DNA library according to claim 1, wherein the contamination-resistant adapters are designed to meet following criteria: (1) adding bases from the 3′-end of the original adapter, and ensuring that the last base added is a T; (2) adding A, T, G and C to the first position from the 3′-end of the original adapter to ensure signal equilibrium during sequencing and no effect on the judgment about detected bases; (3) on each position added at the 3′-end of the original adapter, the proportion of the same bases does not exceed 50%; following (1)-(3) above, multiple first contamination-resistant adapters are obtained; and (4) at the 5′-end of the original adapter adding the bases that are reversely complementary to the extra bases except terminal T in the first contamination-resistant adapters, and the first base at the 5′-end is phosphorylated, thus multiple second contamination-resistant adapters are obtained.
3. Method of preparation according to claim 1 or 2, wherein on the position of the first proximal base added at the 3′-end of the original adapter, there are 4 types of bases, each accounting for 25%; on the position of the second proximal base added, there are 3 types of bases, with T bases accounting for 50%, and the remaining 2 types of bases each accounting for 25%; at the position of the third proximal base added at the 3′-end or 5′-end of the original adapter, there is no base for two adapters, and a fixed base T for the other two adapters, accounting for 50%.
4. Method of preparation according to any one of the precedent claims, wherein the original adapters are: TABLE-US-00034 ADM-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ADM-A7: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC; *represents phosphorothioate-modification; /5Phos/ represents phosphorylation modification.
5. Method of preparation according to any one of the precedent claims, wherein for multiple first contamination-resistant adapters, the extra base sequences are A*T, G*T, TC*T and CA*T; and for multiple second contamination-resistant adapters, the additional bases are TA, CA, GAA and TGA, * represents phosphorothioate-modification; /5Phos/ represents phosphorylation modification.
6. Method of preparation according to any one of the precedent claims, wherein the contamination-resistant adapters are: TABLE-US-00035 ACA1-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATCTA*T ACA1-A7: /5Phos/TAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ACA2-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATCTG*T ACA2-A7: /5Phos/CAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ACA3-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATCTTC*T ACA3-A7: /5Phos/GAAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ACA4-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATCTCA*T ACA4-A7: /5Phos/TGAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC *represents phosphorothioate-modification; /5Phos/ represents phosphorylation modification, wherein the bases that are underlined and bolded are extra bases.
7. Method of preparation according to any one of the precedent claims, wherein test samples are arranged such that each of the contamination-resistant adapter is different from those at adjacent or surrounding locations.
8. Method of preparation according to any one of the precedent claims, wherein the following primers are used for pre-library amplification: TABLE-US-00036 Oligo PPS 1.1: ACACTCTTTCCCTACACGACGCTC; Oligo PPS 2.1: GTGACTGGAGTTCAGACGTGTGC
9. Method of preparation according to claim 6, wherein the test samples are arranged such that basic arrangement units of the contamination-resistant adapter are: TABLE-US-00037 ACA1 ACA3 ACA2 ACA4 ACA3 ACA1 ACA4 ACA2; wherein ACA1 means by using ACA1-A5 and ACA1-A7, ACA2 means by using ACA2-A5 and ACA2-A7, ACA3 means by using ACA3-A5 and ACA3-A7, and ACA4 means by using ACA4-A5 and ACA4-A7.
10. Use of contamination-resistant adapter according to any one of the precedent claims in preparation of a DNA library capture kit.
11. Use according to claim 10, wherein the DNA library is a cfDNA library, a leukocyte gDNA library or a tissue-derived DNA library.
12. Method for performing bioinformative analysis of DNA library prepared by preparation methods according to any one of the claims 1-9, comprising sequencing and analyzing sequencing data; if Condition 1 but not Condition 2 of the following two conditions is met, it is deemed that a pair of reads possesses a contamination-resistant adapter at the 5′-end, and no contamination-resistant adapter at the 3′-end; if the following two conditions are both met, it is deemed that a pair of reads possesses contamination-resistant adapters at both the 5′-end and the 3′-end; Condition 1: calculating Hamming distance between the primary 2-3 bps of the 5′-end of a pair of reads with same sequence ID, i.e., the read 1 sequence and the read 2 sequence respectively and the 2-3 bps of the 5′-end of the contamination-resistant adapter, and the sum of numerical values is less than or equal to 1; Condition 2: in the case that condition 1 is met, and a pair of reads are of equal length, the reverse complementary sequence of one read is approximately the same as the forward sequence of the other read, that is, Hamming distance calculated with the sequence characters of the two reads is less than or equal to the default value 4 set by the software.
13. Method according to claim 12, wherein in the subsequent analysis process, for a pair of reads with contamination-resistant adapter-specific sequences merely at the 5′-end, only the 2-3 bps at the 5′-end of the read are subtracted; and for a pair of reads with contamination-resistant adapter-specific sequences at both the 5′-end and the 3′-end, the 2-3 bps at both the 5′-end and 3′-end of the read are subtracted.
14. Method according to claim 13, wherein a pair of reads after the two deduction of contamination-resistant adapters are put respectively in the fastq files of the retained read 1 and read 2; and for a pair of reads that do not meet condition 1, the pair of reads are put in the fastq files of abandoned read 1 and read 2 for subsequent inspection and analysis.
15. Method according to any one of claims 12-14, comprising judging the type of the contamination-resistant adapters, and giving the proportion of the judged adapters and the type of dominant adapters during the analysis; if the proportion of the dominant adapter type is less than 90%, it is deemed that the sample has been contaminated with other samples, and the subsequent analysis procedures are stopped; if the dominant adapter type accounts for more than 90% but less than 98%, it is deemed that the sample has been slightly contaminated with other samples, and the subsequent analysis procedures can be performed after removing the reads containing the contaminated adapter; if the dominant adapter type accounts for more than 98%, it is deemed that the sample are not contaminated, and the subsequent analysis procedures are directly carried out.
16. Method according to any one of claims 12-15, wherein the total number of read pairs of the original data file, the number of read pairs whose adapter are cleaved, the number of read pairs eventually retained and the number of abandoned read pairs are counted in the final analysis results.
Description
DESCRIPTION OF DRAWINGS
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
EMBODIMENTS
[0043] The present disclosure will be further illustrated below in conjunction with specific embodiments. It should be understood that the following examples are solely used to illustrate the present disclosure and not to limit its scope of protection.
EXAMPLES
Methods and Materials
[0044] The experiment is carried out by using the HS library construction kit from Guangzhou Burning Rock Biotech and capture probes for detection of human multi-gene mutation (Langke). The specific operation steps are as follows.
[0045] 1. Ends-Repair and 3′A-Tailing
[0046] 1.1 Preparation of reagent: Open the HS library construction kit, take ERA buffer and thaw it on ice.
[0047] 1.2 Setting of program: Set the PCR thermal cycler (BioRad S1000 or ABI Veriti), name the program as “ERA”, with the following conditions
[0048] Set 85° C. for lid heating, reaction volume 60 μL: [0049] 20° C., 30 minutes (note: lidded) [0050] 65° C., 30 minutes (note: lidded) [0051] hold at 4° C.
[0052] 1.3 Procedure for operation [0053] Add nuclease-free water to a 1.5 mL tube to dilute 30 ng of sample to 50 μL. Vortex the tube and centrifuge for 3 seconds. [0054] Transfer 50 μL sample in the 1.5 mL tube to bottoms of the wells of a 48-well plate with a single-channel pipette P100, and record and mark the order of the samples (the 48-well plate is placed on the PCR tube rack for use). [0055] Prepare mixed solution for end repair and A-tailing reaction systems (table 1, preparing on ice) at a ratio of 1:1.1 in a new 1.5 mL Eppendorf LoBind tube. [0056] Flick the 1.5 mL tube 3-5 times, invertit 2-3 times, centrifuge for 3 seconds. [0057] Divide the mixed solution in aliquot between the tubes of an eight-tube strip (dispose according to the volume of sample) by using a single-channel pipette P200, avoiding formation of bubbles, and centrifuge for 3 seconds. [0058] Take 10 μL of the mixed solution from eight-tube strip by using an eight-channel pipette P10 into a 48-well plate (50 μL sample already included), pipette 10 times, stick a film (micro seal B) on and make it fit tightly with the plate by using a scrape. Make sure that there is no bubble in the tube. Centrifuge at 1000 rpm for 3 seconds.
TABLE-US-00005 TABLE 1 End repair and 3′A-tailing Volume per Reagents reaction End Repair and A-Tailing buffer 7 μL Enzyme mixture solution for End Repair and A-Tailing 3 μL Fragmented DNA 50 μL Total 60 μL [0059] Put the 48-well plate in the PCR thermal cycler Bio-Rad S1000 or ABI Veriti, using the program “ERA” (lid heating at 85° C., 30 minutes at 20° C., 30 minutes at 65° C., hold at 4° C.). Go to the next step within 2 hours.
[0060] 2. Adapter Ligation
[0061] 2.1 Preparation of reagent: prepare the reagents in Table 2.
TABLE-US-00006 TABLE 2 Adapter ligation and reagent purification Reagents Preparation ligation buffer Thaw on ice DNA ligase On ice ACA adapter Thaw on ice SPB Equilibrate at RT (RT) for 30 minutes Ethanol RT (for purification)
[0062] 2.2 Setting of program: Set BioRad S1000 or ABI Veriti, name the program as “LIG”.
[0063] Set 85° C. for lid heating, reaction volume 50/100 μl: [0064] 20° C., 15 minutes (note: not lidded) [0065] 70° C., 10 minutes (note: lidded) [0066] hold at 4° C.
[0067] 2.3 Operation procedure [0068] Take out the 48-well plate that has completed the reaction program “ERA” from the PCR thermal cycler, place it on PCR tube rack, centrifuge at 1000 rpm for 3 seconds. Tear off the sealing film (micro seal B) carefully and keep it on ice for use. [0069] Prepare mixed solution for adapter ligation reaction system (Table 3) at a ratio of 1:1.1 in a 1.5 mL Eppendorf LoBind tube on ice. [0070] Flick the 1.5 mL tube 3-5 times, invert it 2-3 times, and centrifuge for 3 seconds. [0071] Take the corresponding mixed solution into an eight-tube strip by using a single-channel pipette P200, and centrifuge for 3 seconds. [0072] Take 50 μL of the mixed solution from the eight-tube strip into the above 48-well plate by using an eight-channel pipette P200, whose volume scale is adjusted to 80 μL, pipette the solution gently 10 times, stick a film (micro seal B) on and make it fit tightly with the plate by using a scrape. Make sure that there is no bubble in the tube. Centrifuge at 1000 rpm for 3 seconds.
TABLE-US-00007 TABLE 3 Set of ligation reaction Reagents Volume per reaction Ligation buffer 30 μL DNA ligase 10 μL ACA adapter 10 μL End repair mixture solution 60 μL Total volume 110 μL [0073] Put the 48-well plate in the PCR thermal cycler (S1000 or ABI Veriti), run the program “LIG” [0074] 20° C., 15 minutes (85° C. for lid heating, not lidded) [0075] 70° C., 10 minutes, hold at 4° C. (85° C. for lid heating, lidded)
[0076] 3. Purification of the Adapter Ligation Products (Ligation Purification)
[0077] 3.1 Preparation [0078] Leave the SPB magnetic beads at room temperature (“RT”) for at least 30 minutes. [0079] Prepare fresh 75% ethanol, 400 μL for each library.
[0080] 3.2 Operation procedure [0081] Invert the tubes with SPB magnetic beads 2-3 times, vortex for 5-10 s at the maximum speed of VORTEX to homogenize. [0082] Transfer the corresponding SPB magnetic beads into sample-loading slots by using a single-channel pipette P1000. Each sample requires 88 μL SPB magnetic beads (sample: magnetic beads=1:0.8). [0083] Take out the 48-well plate from PCR thermal cycler, place it on the PCR tube rack, centrifuge at 1000 rpm for 3 seconds, and tear off the film carefully. Transfer 88 μL SPB magnetic beads (sample: magnetic beads=1:0.8) from sample-loading slot by using a eight-channel pipette P200 into the 48-well plate. The volume scale of the eight-channel pipette P200 is adjusted to 180 μL, and pipette the mixture 10 times. [0084] Stick a film (micro seal B) on the 48-well plate, centrifuge at 1000 rpm for 3 s. Leave it at RT for 10 minutes. [0085] Centrifuge at 1000 rpm for 1 min, discard the film. [0086] Place the 48-well plate on a magnetic stand (Thermo Scientific, AM10027) and let the solution clarify (about 3-5 min). [0087] Discard the supernatant carefully by using an eight-channel pipette P200, with the volume scale adjusted to the maximum. Note: Do not touch the magnetic beads. [0088] With the 48-well plate still on the magnetic stand, add 200 μL of freshly prepared 75% ethanol into the sample well (in the sample-loading slot) by using an eight-channel pipette P200. [0089] Move horizontally the 48-well plate back and forth on the magnetic stand to fully soak the magnetic beads, leave it for 1 min and discard the ethanol. [0090] Repeat the above two steps once. [0091] Allow the 48-well plate to sit on the magnetic stand for 1 min, and remove residual ethanol by using an eight-channel pipette P20. [0092] Remove the 48-well plate from the magnetic stand and place it on the PCR plate rack at RT for 2 minutes to dry the magnetic beads, until that the surface of the magnetic beads is not reflective and free of cracks. [0093] Add an appropriate amount of EB eluant into sample-loading slot. [0094] Add 28 μL of EB solution to the 48-well plate by using an eight-channel pipette P200, cap the eight-tube strip, vortex for about 5 seconds, and centrifuge at 1000 rpm for 3 seconds. [0095] Incubate the 48-well plate at RT for 2 minutes. [0096] Centrifuge the plate at 1000 rpm for 1 min. [0097] Take off the cap of eight-tube strip carefully, and place the 48-well plate on the magnetic stand for 2 minutes until the solution is clear. [0098] Transfer 27.5 μL of the supernatant to a new 48-well plate by using an eight-channel pipette P20, aspirate all the supernatant as much as possible.
[0099] 4. Amplification of Pre-Library
[0100] 4.1 Preparation of reagents: See table 4.
TABLE-US-00008 TABLE 4 Preparation of PCR and PCR product purification Reagents Preparation 5x HiFi buffer thaw on ice 10 mM dNTP mixture thaw on ice PPS primers thaw on ice HiFi HotStart on ice SPB equilibrate at RT for 30 minutes Ethanol RT (for purification)
[0101] 4.2 Setting of program:
[0102] “PRE” is as in table 5:
TABLE-US-00009 TABLE 5 Set of pre-enrichment PCR Step Cycle Temperature Time 1 1 98° C. 45 s 2 9 98° C. 15 s 60° C. 30 s 72° C. 30 s 3 1 72° C. 2 min 4 1 4° C. hold
[0103] 4.3 Operation procedure [0104] Prepare the mixed solution of reaction system (preparing on ice) according to table 6, flick 3-5 times, invert 2-3 times, centrifuge for 3 seconds, and divide in aliquot between the tubes of an eight-tube strip. [0105] Add 22.5 μL of the mixed solution to each well (containing 27.5 μL of purified product) of the 48-well plate used in the step of “ligation product purification” by using an eight-channel pipette P200, and adjust the volume scale of the eight-channel pipette P200 to 40 μL and pipette gently 10 times. [0106] Stick a film (micro seal B) with a scraper until it fits tightly, without bubble forming in the tube, and centrifuge at 1000 rpm for 3 s. [0107] Place the plate in the PCR thermal cycler and run program “PRE”
TABLE-US-00010 TABLE 6 Pre-Enrichment PCR system Reagents Volume per reation HiFi Fidelity buffer (5X) 10 μL 10 mM dNTP Mix 1.5 μL PPS primer 10 μL 1 U/μL HiFi HotStart (100 U) 1 μL Cleared Ligation Mix 27.5 μL Total volume 50 μL
[0108] 5. Purification of Amplified Pre-Library
[0109] 5.1 Preparation of reagents [0110] Keep the magnetic beads at RT for at least 30 minutes. [0111] Prepare fresh 75% ethanol, 400 μL for each library.
[0112] 5.2 Operation procedure [0113] Invert the tube of SPB magnetic beads 2-3 times, and mix them for 5-10 s at the maximum speed of VORTEX to homogenize them. [0114] Transfer the corresponding SPB magnetic beads into the sample-loading slots by using the single-channel pipette P1000. 60 μL of SPB magnetic beads is added to each sample (sample: magnetic beads=1:1.2). [0115] Take out the 48-well plate from the PCR thermal cycler, centrifuge at 1000 rpm for 3 seconds, and tear off the film carefully. transfer 60 μL of SPB magnetic beads (sample: magnetic beads=1:1.2) from the sample-loading slot and add them into the 48-well plate by using an eight-channel pipette P200. Adjust the volume scale of the eight-channel pipette P200 to 80 μL, and pipette the mixture gently 10 times. [0116] Stick a film on the 48-well plate. Leave it at RT for 10 min. [0117] Centrifuge at 1000 rpm for 1 min. [0118] Discard the film, place the 48-well plate on the magnetic stand, and let the solution clarify (about 3-5 min). [0119] Discard the supernatant carefully by using an eight-channel pipette P200 adjusted to its maximum volume scale of. Do not touch the magnetic beads. [0120] With the 48-well plate still placed on the magnetic stand, add 200 μL of freshly prepared 75% ethanol to the sample-loading slot by using an eight-channel pipette P200. [0121] Move horizontally the 48-well plate back and forth on the magnetic stand to fully soak the magnetic beads. Leave it for 1 min and discard the ethanol. [0122] Repeat the above two steps once. [0123] Allow the 48-well plate to sit on the magnetic stand for 1 min, and remove residual ethanol by using an eight-channel pipette P20. [0124] Take off the 48-well plate from the magnetic rack and place it on the PCR plate rack at RT for 2 minutes to dry the magnetic beads, until that the surface of the magnetic beads is not reflective and free of cracks. [0125] Add an appropriate amount of nuclease-free water to the sample-loading slot (EB cannot be used in this step). [0126] Add 16 μL of nuclease-free water to the 48-well plate by using an eight-channel pipette P200, cap the eight-tube strip, vortex for about 5 seconds, and centrifuge at 1000 rpm for 3 seconds. [0127] Incubate the 48-well plate at RT for 2 minutes. [0128] Centrifuge at 1000 rpm for 1 min. [0129] Discard the film and place the 48-well plate on the magnetic stand for 2 minutes until the solution is clear. [0130] Transfer 15.5 μL of the supernatant to a new 48-well plate by using an eight-channel pipette P10. Do not aspirate magnetic beads.
[0131] 6. Quality Control for the Purified Pre-Library (Pre-Library QC) [0132] Dilution of pre-library
[0133] Take 1 μL of the purified pre-library into a new 48-well plate, add 11 μL ddH.sub.2O, pipette using a P20 pipette 10 times to homogenize (1 μL is used for Qubit quantification, 10 μL for the next Labchip or 2100 QC)
[0134] 7. Hybridization of Pre-Library (Pre-Library Hybridization)
[0135] 7.1 Preparation of reagents:
[0136] Prepare the reagents in table 7.
[0137] 7.2 Setting of program:
[0138] Set BioRad S1000, name the program as “HYB” [0139] 95° C. 5 min (lid heating at 105° C.) [0140] Hold at 65° C.
TABLE-US-00011 TABLE 7 Preparation of hybridization reagents Reagent Preparation HYB buffer thaw at RT BLM blocking agent thaw on ice RIB blocking agent thaw on ice Langke probes thaw on ice
[0141] 7.3 Operation procedure [0142] Take 15 μL of the pre-library library, place it in a 48-well plate according to the maker, add 4 μl of BLM blocking agent (marked as component A) to each well, mix by pipetting 8-10 times, and cap the eight-tube strip. [0143] Prepare component B on ice according to table 8, and then dispense it into a new eight-tube strip and cap the eight-tube strip.
Table 8: Proportion of Component B System
[0144]
TABLE-US-00012 Component B Volume per reaction HYB blocking agent 10 μL RIB blocking agent 0.5 μL Langke probe 0.5 μL Total volume 11 μL
component A in the PCR thermal cycler, and run the program “HYB” (95° C., 5 min; 65° C., hold). [0145] Let the temperature of the PCR thermal cycler drop to 65° C., then place component B in the PCR thermal cycler and incubate, and close the heated lid. [0146] After 2 minutes, open the heated lid of the PCR thermal cycler and the cap of the eight-tube strip, transfer component B to component A quickly using a pipette, replace the pipette tip each time, pipette 5 times to homogenize (keep the 48-well plate in the PCR thermal cycler), cap the eight-tube strip tightly and stick a film to prevent evaporation, close the lid of thermal cycler, and incubate at 65° C. for 16-24 h (lid heating at 105° C.).
[0147] 8. Capture and Elution (Binding and Wash)
[0148] 8.1 Preparation of reagents
TABLE-US-00013 TABLE 9 Preparation of reagents for capturing SCB magnetic beads Reagent Preparation BWS binding buffer RT Washing buffer 1 RT Washing buffer 2 RT SCB (T1 magnetic beads) equilibrate at RT for 30 min [0149] Prepare the reagents in table 9. [0150] Set temperature of thermostatic metal bath to 65° C. [0151] Equilibrate the SCB magnetic beads at RT for more than 30 minutes.
[0152] 8.2 Setting of program:
[0153] Set BioRad S1000 or ABI, and name the program as “WASH 2”: [0154] Hold at 65° C. (Lid heating at 70° C.)
[0155] 8.3 Operation procedure [0156] Place 600 μL of WB solution 2 per sample in a 15 mL conical tube, incubate on a metal heater at 65° C. [0157] Take out SCB/T1 magnetic beads, invert the tube 5 times to homogenize, vortex for 10 seconds, allow it to sit at RT for more than half an hour, vortex for 10 seconds, put into 1.5 ml LoBind tube according to numbers of samples, each sample requires 25 μL, with 150 μL at maximum per Lobind tube. Allow the tubes to sit on a 16-well magnetic stand for 3 minutes, and discard the supernatant. [0158] Add 150 μL of BWS binding buffer to each 25 μL of original magnetic beads, vortex for 3 seconds, centrifuge briefly, allow the mixture to sit on the magnetic stand for 3 minutes, and discard the supernatant. [0159] Repeat the above steps 2 times, for a total of 3 times. [0160] Resuspend SCB (add 150 μL BWS binding buffer to each 25 μL original magnetic beads), add it to the sample-loading slot, dispense 150 μL/tube into a 48-well plate (containing 28 μL hybridization buffer) with multi-channel pipette, pipette gently 10 times, then stick a film and centrifuge at 1000 rpm for 3 seconds. [0161] Place the plate on a thermomixer and incubate at RT 300 rpm for 30 min. [0162] Centrifuge at 1000 rpm for 1 min, discard the film, then place the plate on a magnetic stand for 5 min, and discard the supernatant. [0163] Add an appropriate amount of WB solution 1 into the sample-loading slot, add 150 μL of WB solution 1 to each sample well by using a P200 pipette, and adjust the volume scale of pipette to 140 μL and pipette 10 times. Stick a film. Place on a super thermomixer and incubate at RT 300 rpm for 15 min. [0164] During the incubation process, transfer manually 2 μL of the positive controls in wells adjacent to the negative ones in wells G1, H2 and G3 to the negative controls, so as to mimic cross-contamination of samples in the experiment. [0165] Centrifuge at 1000 rpm for 1 min, discard the film, allow the plate to sit on a magnetic stand for 5 minutes, aspirate and discard the supernatant with an eight-channel pipette P200, and then aspirate the remaining liquid with an eight-channel pipette P20. [0166] Add an appropriate amount of WB solution 2 that has been preheated to 65° C. into the sample-loading slot. Add 150 μL of WB solution 2 to each sample well by using a P200 pipette, adjust the volume scale of the pipette to 130 μL and pipette gently 10 times to homogenize. Stick a film and place the plate in the PCR thermal cycler and incubate at 65° C. for 10 min (note: 70° C., lidded). [0167] Centrifuge at 1000 rpm for 1 min, tear off the film, place the plate on a magnetic stand, aspirate and discard the supernatant with an eight-channel pipette P200, and then aspirate the remaining liquid with an eight-channel pipette P20. [0168] Repeat the operation with WB solution 2 three times, for a total of four times. [0169] Centrifuge at 1000 rpm for 1 min, place the plate on a magnetic stand, and aspirate the remaining liquid by using a P20 pipette. [0170] Add an appropriate amount of EB into the sample-loading slot. [0171] Add 20 μL of EB to the sample well, cap the eight-strip tube, vortex for 3 seconds, resuspend the SCB magnetic beads, and centrifuge at 1000 rpm for 3 seconds.
[0172] 9. Preparation of the Post Library (Post Capture Library Amplification)
[0173] 9.1 Preparation of reagents: prepare the reagents in table 10.
TABLE-US-00014 TABLE 10 Amplification and purification of capture library Reagent Preparation 2X HiFI ready mix thaw on ice SetA/SetB/SetC/SetD series thaw on ice SPB equilibrate at RM for 30 min Ethanol RT (for purification)
[0174] 9.2 Setting of program: set PCR thermal cycler (BioRad 51000) program as “POST” according to table 11.
TABLE-US-00015 TABLE 11 Post PCR setting Step Cycle Temperature Time 1 1 98° C. 45 s 98° C. 15 s 2 14 60° C. 30 s 72° C. 30 s 3 1 72° C. .sup. 10 min 4 1 4° C. hold
[0175] 9.3 Operation procedure [0176] Take a new 48-well plate and add HiFi ready mix and Index according to the PostPCR system shown in Table 12. The concrete operations are as follows:
[0177] a. Put the HIFI ready mix and Index on the ice to thaw, prepare a new 48-well plate and sort the thawed Index.
[0178] b. Add 5 μl Index to the wall of tube of the corresponding well by using a single-channel pipette P2.5, cap the eight-tube strip, and after confirming that all of them have been added, centrifuge the plate at 1000 rpm for 3 seconds.
[0179] c. Prepare a new eight-tube strip and add an appropriate amount of HIFI readymix.
[0180] d. Aspirate 25 μl of HIFI readymix from the eight-tube strip by using a P200 pipette and add it to the 48-well plate. [0181] Aspirate carefully 20 μl of SCB-bound magnetic beads in the 48-well plate resulted from the end of step 7.3 into the 48-well plate with Index and Mix added by using the eight-channel pipette P200, and pipette gently 10 times to homogenize. Stick a film. [0182] Run the “POST” program on the PCR thermal cycler.
TABLE-US-00016 TABLE 12 Post library system Reagent Volume per reaction Captured Library with SCB 20 μL HiFi HotStart readyMix (2X) 25 μL Index 5 μL Total volume 50 μl
[0183] 10. Purification of Post Library (Post PCR Library Purification)
[0184] 10.1 preparation of the experiment [0185] Leave the SPB magnetic beads at RT for at least 30 minutes. [0186] Prepare fresh 75% ethanol, 400 μL for each library.
[0187] 10.2 Operation procedure [0188] Invert the tube containing the SPB magnetic beads 2-3 times, and mix them for 5-10 s at the maximum speed of VORTEX to homogenize. [0189] Take out the PCR products (including SCB magnetic beads) from the PCR thermal cycler and centrifuge at 1000 rpm for 1 min, and allow them to sit on the magnetic stand for 5 min. Aspirate 50 μL of the supernatant and add it to a new 48-well plate by using an eight-channel pipette P20. [0190] Aspirate corresponding SPB magnetic beads and add into the sample-loading slot using a single-channel pipette P1000. Add 50 μL SPB magnetic beads to each sample (sample: magnetic beads=1:1). [0191] Aspirate 50 μL of SPB magnetic beads (sample: magnetic beads=1:1) from the sample-loading slot and add them to a 48-well plate (containing 50 μL of PCR product with SCB beads removed) by using an eight-channel pipette P200. Adjust the volume scale of the eight-channel pipette P200 to 80 μL, and pipette the beads gently 10 times. [0192] stick a film on the 48-well plate. Leave it at RT for 10 minutes. [0193] Centrifuge at 1000 rpm for 1 min. [0194] Discard the film, place the 48-well plate on the magnetic stand, and let the solution clarify (about 3-5 min). [0195] Adjust the volume scale of the eight-channel pipette P200 to the maximum, and discard the supernatant. Do not touch the magnetic beads. [0196] The 48-well plate is still on the magnetic stand. Add 200 μL of freshly prepared 75% ethanol to the sample-loading slot by using an eight-channel pipette P200. [0197] Move horizontally the 48-well plate back and forth on the magnetic stand to fully soak the magnetic beads. Wait for 1 min and discard the ethanol. [0198] Repeat the above two steps once. [0199] Allow the 48-well plate to sit on the magnetic stand for 1 min, remove residual ethanol by using an eight-channel pipette P20. [0200] Remove the 48-well plate from the magnetic rack and place it on the PCR plate rack at RT for 2 minutes to dry the magnetic beads, until that the surface of the magnetic beads is not reflective and free of cracks. [0201] Add an appropriate amount of EB into the sample-loading slot. [0202] Add 20 μL of EB to the 48-well plate by using an eight-channel pipette P20, cap the eight-tube strip, vortex for about 5 seconds, and centrifuge at 1000 rpm for 3 seconds. [0203] Incubate the 48-well plate at RT for 2 minutes. [0204] Centrifuge at 1000 rpm for 1 minute. [0205] Discard carefully the cover of the eight-tube strip, and place the 48-well plate on the magnetic stand for 2 minutes until the solution is clear. [0206] Transfer 19.5 μL of the supernatant to a new 48-well plate using an eight-channel pipette P10. Do not aspirate magnetic beads.
[0207] 11. Detection of Concentration of the Purified Library (Library QC) [0208] Take 2 μL of the purified library in a new 1.5 mL EP tube, add 10 μL ddH.sub.2O (1 μL is used for Qubit quantification, and the remaining 11 μL is used for the next step for Labchip or 2100 QC)
[0209] 12. Detection of Fragment Size of Purified Library (Library QC)
[0210] 12.1 Preparation of reagent [0211] Allow Labchip HS or Agilent 2100 HS reagents and chips to sit at RT for more than 30 minutes.
[0212] 12.2 Experimental procedure [0213] Detection reagent: Labchip HS Kit [0214] Detection method: Use the 10 μL library in step 3.14.3 for the detection in the present step (refer to “Standard Operation Procedure for Labchip Detection” or “Standard Operation Procedure for Agilent 2100 HS DNA Kit”).
Procedure of Bioinformative Analysis:
[0215] In the course of the library construction of samples according to the present disclosure, new contamination-resistant adapters and special arrangement pattern are introduced in order to ensure that each sample carries a specific tag in the early stage of the experiment. Even if cross-contamination occurs in the later stage of the experiment, it can be detected in the bioinformative analysis procedure and the information from external contamination can be rejected, reduced, and the risk of pollution can even be eliminated.
[0216] Check each pair of reads of off-line fastq file, and output the result of cross-contamination statistics at the same time, thus ensuring the accuracy of the data used in subsequent analysis steps; and in the course of analysis of the contamination-resistant adapters, the reads with contamination-resistant adapters will be cleaved, and the reads with contamination-resistant adapters are re-input into a new file. In this way it is easy for subsequent search and verification.
[0217] The innovation of the present disclosure reside in that the software will judge automatically the type of contamination-resistant adapters in off-line fastq file, and then execute the subsequent analysis procedure or judge the contamination sources of the sample from the type of adapters contaminated, which simplifies the operation procedure during the running of software.
The Realization Principle of the Present Disclosure Includes Design, Experimental Method and Algorithm.
[0218] A file in bcl format is generated after the sequencing data is offlined, and then the file in bcl format is converted into a file in fastq format by bcl2fastq software, however, the bcl2fastq software will execute forced pruning of the sequencing reads, that is, as long as the preset adapter appears at the 3′-end of the read sequence, the bases present at the 5′-end will be pruned, so the reads off-lined are not of equal length, and their lengths are less than or equal to the number of cycles that the sequencer run; but if some of insert sequences are too short while the library is constructed, and their lengths are less than that of the read being sequenced, adapter sequences will be detected at the 3′-end after the reads sequence is generated. Therefore, the method for removing the contamination-resistant adapters has been designed in the light of above characteristics.
[0219] The contamination-resistant adapters designed by the present kit are all modified adapters (ADM) from original kit, that is, add 2-3 bps to the 5′-end of ADM (A7), and add to the 3′-end of ADM (A5) the bases of the same length that are reversely complementary to the 5′-end. Therefore, after the sequencing data is off-lined, if the first but not the second of the following two conditions is met, it is considered that this pair of reads possesses a contamination-resistant adapter at the 5′-end but not at the 3′-end. If the following two conditions are both met, it is considered that this pair of reads possesses contamination-resistant adapter at both the 5′-end and the 3′-end. [0220] Condition 1: calculating Hamming distance between the primary 2-3 bps of the 5′-end of a pair of reads with same sequence ID, i.e., the read 1 sequence and the read 2 sequence respectively and the 2-3 bps of the 5′-end of the contamination-resistant adapter (A7), and the sum the numerical values is less than or equal to 1; [0221] Condition 2: In the case that condition 1 is met, and a pair of reads are of equal length, the reverse complementary sequence of one read is approximately the same as the forward sequence of the other read (It is considered as approximately the same if Hamming distance calculated with the sequence characters of the two reads is less than or equal to the default value 4 set by the software).
[0222] In the process of subsequent analysis, for a pair of reads with contamination-resistant adapter-specific sequences merely at the 5′-end, only the 2-3 bps at the 5′-end of the read are subtracted; and for a pair of reads with contamination-resistant adapter-specific sequences at both the 5′- and the 3′-end, the 2-3 bps at both ends are subtracted. Put a pair of reads after the above two types of subtraction of contamination-resistant adapter specific sequences in the fastq files of retained read 1 and read 2; and for a pair of reads that do not meet condition 1, they are put in the fastq files of abandoned read 1 and read 2, for subsequent inspection and analysis.
[0223] The software will judge the type of contamination-resistant adapter of off-line raw fastq file, and giving the proportion of the judged adapter sequences and the type of dominant adapter during the analysis; if the proportion of type of the dominant adapter is less than 90%, it is considered that the sample has been contaminated with other samples, and the subsequent analysis procedures are stopped. If the dominant adapter type accounts for more than 90% but less than 98%, it is considered that the sample has been slightly contaminated with other samples, and the subsequent analysis procedures can be performed after removing the reads containing the contaminated adapter; If the dominant adapter type accounts for more than 98%, it is considered that the sample are not contaminated, and the subsequent analysis procedures are carried out directly. The total number of read pairs of the original data file, the number of read pairs whose adapter are cleaved, the number of read pairs eventually retained and the number of abandoned read pairs are counted in the final results of analysis.
[0224] Adapters and Primers
[0225] ADM adapters are as follow:
TABLE-US-00017 ADM-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T ADM-A7: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC;
[0226] ACA1 ACA2
ACA3 and ACA4 adapters are as follow:
TABLE-US-00018 ACA1-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATCTA*T ACA1-A7: /5Phos/TAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ACA2-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATCTG*T ACA2-A7: /5Phos/CAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ACA3-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATCTTC*T ACA3-A7: /5Phos/GAAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ACA4-A5: ACACTCTTTCCCTACACGACGCTCTTCCGATCTCA*T ACA4-A7: /5Phos/TGAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
[0227] Optimized PPS primers (PPO Plus primers) according to the present application:
TABLE-US-00019 Oligo PPS 1.1: ACACTCTTTCCCTACACGACGCTC; Oligo PPS 2.1: GTGACTGGAGTTCAGACGTGTGC.
[0228] Blocking Primers:
TABLE-US-00020 PCR1B1 ACACTCTTTCCCTACACGACGCTCTTCCGATCT PCR1B2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT PCR2B1 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC PCR2B2 GATCGGAAGAGCACACGTCTGAACTCCAGTCAC.
Example 1: Verification of the Efficiency of Library Construction of Contamination-Resistant ACA Adapter and PPO Plus Primers in the Experiment
[0229] NA12878 genomic DNA (Coriell Institute, catalog number NA12878) (negative control) was taken as the experimental sample, and 30 ng input amount after 195 s interruption by Covaris M220 interrupter was used to hybridization capture for library construction. The newly designed ACA adapter and PPS primers were employed in the process of library construction, and ADM adapter and PPO primers (sequence (5′.fwdarw.3′): ACACTCTTTCCCTACACGACG; GTGACTGGAGTTCAGACGTG) were used as experimental controls to verify the efficiency of newly designed adapter primer for library construction. The arrangement of ACA and ADM adapters is shown in table 13 below. The process of DNA library preparation is as described above.
TABLE-US-00021 TABLE 13 Schematic diagram of arrangement patterns of experimental adapters 1 2 A ACA1 ACA1 B ACA2 ACA2 C ACA3 ACA3 D ACA4 ACA4 E ADM ADM
Experimental Results
[0230] 1) QC of Library Construction
[0231] The QC index of library construction in this example focuses on yield of pre-library, yield of post library, and average fragment size of the post library. For the detailed experimental QC results and statistics, see table 14 below, and the statistical information is shown in
TABLE-US-00022 TABLE 14 QC of library construction Fragment Well Yield of pre- Yield of final- size of final- Sample name position library(ng) library(ng) library(bp) NA12878-ACA1 A1 4893.7 103.9 459 NA12878-ACA1 A2 4972.8 114.5 461 NA12878-ACA2 B1 3949.2 76.2 449 NA12878-ACA2 B2 4006.1 81.2 440 NA12878-ACA3 C1 3889.0 79.0 448 NA12878-ACA3 C2 4041.8 83.4 454 NA12878-ACA4 D1 4707.9 99.5 450 NA12878-ACA4 D2 4491.4 83.0 446 NA12878-ADM E1 3907.2 91.4 456 NA12878-ADM E2 3751.9 88.4 457
[0232] The results show that the newly designed ACA adapter primers and PPO Plus primers both meet or exceed the criteria for library construction in terms of pre-library yield compared with original ADM adapter and PPO primers. With the corresponding 1 μg of pre-library input for hybridization capture, yield of post library and average fragment size obtained in the experimental group are similar to those in the control group.
[0233] This demonstrates that the newly designed ACA adapter and PPS primers can meet QC index of normal library construction, and to a certain extent, is better in terms of efficiency of library construction than with original ADM adapter and PPO primers.
[0234] 2) Bioinformative QC of Sequencing
[0235] The QC index of targeted capture experiment in this example mainly focuses on size of inserted fragment, capture efficiency, complexity of library construction and uniformity of coverage (0.2× mean). For the detailed QC results, see table below. The statistical information is shown in
TABLE-US-00023 TABLE 15 Bioinformative QC of sequencing Sizes of complexity Unifor- inserted of library mity of Sample Well fragments construction Capture coverage name position (bp) (ng) efficiency (0.2X mean) NA12878- A1 225 0.902 0.815 0.991 ACA1 NA12878- A2 222 0.905 0.817 0.99 ACA1 NA12878- B1 229 0.886 0.817 0.991 ACA2 NA12878- B2 219 0.893 0.826 0.99 ACA2 NA12878- C1 223 0.885 0.823 0.991 ACA3 NA12878- C2 223 0.886 0.821 0.991 ACA3 NA12878- D1 223 0.902 0.824 0.991 ACA4 NA12878- D2 218 0.905 0.828 0.991 ACA4 NA12878- E1 226 0.903 0.819 0.991 ADM NA12878- E2 226 0.901 0.822 0.991 ADM
[0236] The results showed that the newly designed ACA adapter and PPO Plus primers had no significant difference in terms of sizes of inserted fragments, capture efficiency, complexity of library construction and uniformity of coverage (0.2× mean) compared with the original ADM adapter and PPO primers.
[0237] This demonstrates that the newly designed ACA adapter and PPO Plus primers can meet the requirements for QC analysis of normal sequencing and has the same effect of analysis as with the original ADM adapter and PPO primers.
Example 2: Verification of the Ability of Adapters of Present Disclosure to Resist Contamination During Experiment
Experimental Design
[0238] NA12878 genomic DNA served as negative control, and DNA from HCC827 cell line (HCC827 cell line was purchased from ATCC, and DNA was extracted with an extraction kit from Tiangen, Item No. DP304) was used as positive control for the experiment (information about HCC827 cell line mutation: EGFR E746-A750 del, AF=83.4%, EGFR CNV=37), both samples were used in hybridization capture of library construction in a 30 ng input amount after 195 s interruption by Covaris M220 interrupter. The samples were arranged according to the checkerboard method, and the specific arrangement is shown in Table 16.
TABLE-US-00024 TABLE 16 Schematic diagram of arrangement pattern of experimental samples 1 2 3 4 A N H N H B H N H N C N H N H D H N H N E N H N H F H N H N G N H N H H H N H N Notes: N represents NA12878 (negative control); H represents HCC827 (positive control)
[0239] The newly designed ACA adapter was employed in the process of library construction, and the original ADM adapter was used as an experimental control (see table 17 for the specific arrangement of the adapters). After the pre-library was completed, 1 μg input amount of the pre-library was taken respectively for hybridization capture, and the positive controls in wells adjacent to the negative controls were introduced manually to the negative controls in wells G1, H2 and G3 to mimic cross-contamination of samples, thus verifying the ability of newly designed ACA adapter to resist contamination.
TABLE-US-00025 TABLE 17 Schematic diagram of arrangement pattern of experimental adapters 1 2 3 4 A ACA1 ACA3 ACA1 ADM B ADA2 ACA4 ACA2 ADM C ACA3 ACA1 ACA3 ADM D ACA4 ACA2 ACA4 ADM E ACA1 ACA3 ACA1 ADM F ACA2 ACA4 ACA2 ADM G ACA3 ACA1 ACA3 ADM H ACA4 ACA2 ACA4 ADM
[0240] Experimental Results:
[0241] 1) QC Results of Library Construction
[0242] The QC index of library construction in the present disclosure focuses on pre-library yield, post library yield, and average fragment size of the post library. For detailed QC results and statistics, see table 18 below, and for statistical information, see
TABLE-US-00026 TABLE 18 QC results of library construction Fragment Well Yield of pre- Yield of final- size of final- Sample name position library(ng) library(ng) library(bp) NA12878-ACA1 A1 2412 91.2 425 HCC827-ACA2 B1 2001.6 220.2 430 NA12878-ACA3 C1 1742.4 46.02 416 HCC827-ACA4 D1 2390.4 198 420 NA12878-ACA1 E1 2800.8 81 429 HCC827-ACA2 F1 1756.8 138.6 418 NA12878-ACA3 G1 2203.2 71.4 423 HCC827-ACA4 H1 2545.2 248.4 431 HCC827-ACA3 A2 1530 172.8 431 NA12878-ACA4 B2 2124 68.4 415 HCC827-ACA1 C2 2260.8 211.2 426 NA12878-ACA2 D2 2174.4 70.2 416 HCC827-ACA3 E2 2095.2 187.2 424 NA12878-ACA4 F2 1598.4 55.8 427 HCC827-ACA1 G2 2422.8 250.8 426 NA12878-ACA2 H2 2088 84 425 NA12878-ACA1 A3 2221.2 104.4 430 HCC827-ACA2 B3 1947.6 159 421 NA12878-ACA3 C3 1598.4 43.32 410 HCC827-ACA4 D3 2199.6 199.2 416 NA12878-ACA1 E3 1728 90 418 HCC827-ACA2 F3 2926.8 117 423 NA12878-ACA3 G3 2397.6 79.2 419 HCC827-ACA4 H3 2520 241.2 432 HCC827-ADM A4 2754 278.4 426 NA12878-ADM B4 2930.4 79.8 394 HCC827-ADM C4 2685.6 229.8 400 NA12878-ADM D4 2671.2 86.4 402 HCC827-ADM E4 2980.8 235.2 420 NA12878-ADM F4 2563.2 76.2 406 HCC827-ADM G4 2750.4 217.8 403 NA12878-ADM H4 2145.6 68.4 412
[0243] The results show that the criteria for library construction of the contamination-resistant ACA adapter are lower than that of original ADM adapter in terms of pre-library yield. With the corresponding pre-library put to hybridization capture, the post library yields obtained from different types of samples in both experimental and control groups are similar, but the average fragment size of the post library is slightly larger than that of the control group.
[0244] This demonstrates that contamination-resistant ACA adapter can meet the QC index for normal library construction, but the effect in library construction is slightly lower than that of the original ADM adapter.
Bioinformative QC Results of Sequencing
[0245] The QC index of targeted capture experiment in this example mainly focuses on insert size, capture efficiency, complexity of library construction and uniformity of coverage (0.2× mean). For detailed QC results, see table 19 below, and the statistical information is shown in
TABLE-US-00027 TABLE 19 Bioinformative QC of Sequencing Fragment Uniformity size of Complexity of coverage Well final-library of library Capture (0.2 X Sample name position (bp) construction efficiency mean) NA12878-ACA1 A1 165 0.394 0.731 0.992 HCC827-ACA2 B1 160 0.396 0.844 0.992 NA12878-ACA3 C1 162 0.33 0.749 0.992 HCC827-ACA4 D1 159 0.407 0.851 0.991 NA12878-ACA1 E1 177 0.384 0.749 0.991 HCC827-ACA2 F1 161 0.382 0.856 0.992 NA12878-ACA3 G1 180 0.374 0.77 0.99 HCC827-ACA4 H1 167 0.424 0.845 0.99 HCC827-ACA3 A2 161 0.385 0.85 0.992 NA12878-ACA4 B2 163 0.391 0.759 0.991 HCC827-ACA1 C2 161 0.388 0.856 0.991 NA12878-ACA2 D2 165 0.369 0.77 0.991 HCC827-ACA3 E2 166 0.462 0.854 0.989 NA12878-ACA4 F2 165 0.369 0.77 0.991 HCC827-ACA1 G2 163 0.428 0.858 0.991 NA12878-ACA2 H2 166 0.41 0.793 0.991 NA12878-ACA1 A3 163 0.388 0.749 0.992 HCC827-ACA2 B3 160 0.413 0.87 0.99 NA12878-ACA3 C3 162 0.293 0.774 0.99 HCC827-ACA4 D3 160 0.464 0.866 0.99 NA12878-ACA1 E3 164 0.389 0.783 0.992 HCC827-ACA2 F3 161 0.338 0.865 0.991 NA12878-ACA3 G3 165 0.35 0.804 0.989 HCC827-ACA4 H3 163 0.453 0.853 0.99 HCC827-ADM A4 163 0.429 0.843 0.992 NA12878-ADM B4 167 0.393 0.758 0.989 HCC827-ADM C4 166 0.397 0.874 0.987 NA12878-ADM D4 185 0.357 0.768 0.991 HCC827-ADM E4 173 0.402 0.861 0.988 NA12878-ADM F4 162 0.358 0.774 0.991 HCC827-ADM G4 162 0.459 0.866 0.99 NA12878-ADM H4 168 0.376 0.774 0.99
[0246] The results show that contamination-resistant ACA adapters have no significant difference compared with the original ADM adapter and PPO primer in terms of insert size, capture efficiency, Complexity of library construction and uniformity of coverage (0.2× mean). This demonstrates that contamination-resistant ACA adapters can meet the requirement for bioinformative QC analysis of normal sequencing and has the same effect of analysis as that of the original ADM adapter.
Mutation Detection Results
[0247] Processing the data using conventional data analysis procedure, mutation sites of positive samples that are manually introduced into the negative sample in adjacent wells in capture process are detected. The results are shown in detail in table 20, in which the EGFR A750del mutation site in the NA12878-ACA3 sample are as showed in
[0248] In
TABLE-US-00028 TABLE 20 Mutation Detection Results of processing of conventional analysis procedure Well Sample name position EGFR: cn_amp EGFR.p.E746_A750del HCC827-ACA2 B1 30.58 80.10% HCC827-ACA4 D1 29.97 80.42% HCC827-ACA2 F1 32.70 80.47% NA12878-ACA3 G1 5.82 31.60% HCC827-ACA4 H1 30.59 80.77% HCC827-ACA3 A2 34.30 81.31% HCC827-ACA1 C2 30.70 79.83% HCC827-ACA3 E2 32.14 81.01% HCC827-ACA1 G2 29.02 80.50% NA12878-ACA2 H2 6.98 41.54% HCC827-ACA B3 31.15 80.06% NA12878-ACA3 C3 0.34% HCC827-ACA4 D3 31.92 81.00% HCC827-ACA2 F3 32.83 80.44% NA12878-ACA3 G3 7.54 39.52% HCC827-ACA H3 30.26 80.70% HCC827-ACA A4 37.13 82.65% HCC827-ACA C4 37.12 82.30% HCC827-ACA E4 36.28 83.44% HCC827-ACA G4 37.50 82.35%
[0249] When mutation detection is re-performed on the data using the newly designed analysis procedure, mutations in positive sample manually introduced and really occurring in negative samples are successfully removed. The results are as in table 21, in which the detection results of the EGFR A750del site in NA12878-ACA3 sample are shown in
TABLE-US-00029 TABLE 21 Mutation Detection Results of newly designed analysis procedure Well Sample name position EGFR: can_amp EGFR.p.E746_A750del HCC827-ACA2 B1 37.17 81.87% HCC827-ACA4 D1 36.16 82.32% HCC827-ACA2 F1 38.83 82.18% HCC827-ACA4 H1 36.92 82.48% HCC827-ACA3 A2 39.52 82.56% HCC827-ACA1 C2 37.79 81.42% HCC827-ACA3 E2 38.48 82.26% HCC827-ACA1 G2 36.41 82.07% HCC827-ACA2 B3 37.71 81.85% HCC827-ACA4 D3 37.71 81.85% HCC827-ACA2 F3 38.74 82.29% HCC827-ACA4 H3 36.54 82.51% HCC827-ADM A4 37.13 82.65% HCC827-ADM C4 37.12 82.30% HCC827-ADM E4 36.28 83.44% HCC827-ADM G4 37.5 82.35%
[0250] Statistical analysis performed on the processed data shows that the use contamination-resistant ACA adapter combined with the newly designed bioinformative analysis procedure, effectively avoids interference of the manually introduced and really occurring mutation in positive samples on the detection. The detailed statistical results are as in table 22 below.
TABLE-US-00030 TABLE 22 Statistics of mutation sites after processing of newly designed analysis procedure EGFR. A750del EGFR: cn_amp Sequencing Total depth Copy Sequencing depth Well Depth of site of site mutation number of of deduplication Sample name position mutation sequencing abundance mutation of sample HCC827-1 B1 21,732 24,796 81.87% 37.17 1,798 HCC827-2 D1 24,568 28,072 82.32% 36.16 2,099 HCC827-3 F1 17,168 19,584 82.18% 38.83 1,399 HCC827-4 H1 24,259 27,666 82.48% 36.92 2,032 HCC827-5 A2 16,990 19,413 82.56% 39.52 1,333 HCC827-6 C2 21,013 24,024 81.42% 37.79 1,723 HCC827-7 E2 20,363 23,242 82.26% 38.48 1,646 HCC827-8 G2 24,002 27,323 82.07% 36.41 2,035 HCC827-9 B3 20,205 23,071 81.85% 37.71 1,654 HCC827-10 D3 21,362 24,270 82.77% 38.09 1,772 HCC827-11 F3 16,394 18,704 82.29% 38.74 1,347 HCC827-12 H3 24,249 27,684 82.51% 36.54 2,112 HCC827-13 A4 23,286 26,511 82.65% 37.13 1,896 HCC827-14 C4 24,663 28,202 82.30% 37.12 2,008 HCC827-15 E4 25,290 28,794 83.44% 36.28 2,083 HCC827-16 G4 22,454 25,591 82.35% 37.50 1,888 NA12878-1 A1 0 2,361 NA NA 2,540 NA12878-2 C1 0 1,655 NA NA 1,728 NA12878-3 E1 0 2,579 NA NA 2,669 NA12878-4 G1 0 2,024 NA NA 2,225 NA12878-5 B2 0 2,420 NA NA 2,587 NA12878-6 D2 0 2,468 NA NA 2,628 NA12878-7 F2 0 1,716 NA NA 1,810 NA12878-8 H2 0 2,771 NA NA 2,884 NA12878-9 A3 0 2,475 NA NA 2,618 NA12878-10 C3 0 1,447 NA NA 1,563 NA12878-11 E3 0 2,923 NA NA 3,048 NA12878-12 G3 0 2,365 NA NA 2,476 NA12878-13 B4 0 2,611 NA NA 2,755 NA12878-14 D4 0 2,845 NA NA 2,903 NA12878-15 F4 0 2,300 NA NA 2,467 NA12878-16 H4 0 2,255 NA NA 2,313
[0251] It demonstrates that the newly designed contamination-resistant ACA adapters combined with corresponding bioinformative analysis procedure can effectively avoid the generation of erroneous experimental data resulted from cross-contamination of samples caused by external factors in the experiment, thereby further improving the accuracy of the experiment.
Illustrations of Bioinformative Analysis
[0252] After the sequencing data is off-lined, if the first but not the second of the following two conditions is met, it is considered that a pair of reads possesses a contamination-resistant adapter at the 5′-end, and no contamination-resistant adapter at the 3′-end; if the following two conditions are both met, it is considered that a pair of reads possesses contamination-resistant adapters at both the 5′- and the 3′-ends. [0253] Condition 1: Calculating Hamming distance between the primary 2-3 bps of the 5′-end of a pair of reads with same sequence ID, i.e., the read 1 sequence and the read 2 sequence respectively and the primary 2-3 bps of the 5′-end of the contamination-resistant adapter (A7), and the sum of numerical values is less than or equal to 1; [0254] Condition 2: In the case that condition 1 is met and a pair of reads are of equal length, the reverse complementary sequence of one read is approximately the same as the forward sequence of the other read, that is, Hamming distance calculated with the characters of sequence of the two reads is less than or equal to the default value 4 set by the software.
[0255] In the process of subsequent analysis, for a pair of reads with contamination-resistant adapter-specific sequences merely at the 5′-end, only the 2-3 bps at the 5′-end of the read are subtracted; and for the 5′ a pair of reads with contamination-resistant adapter-specific sequences at both the 5′- and the 3′-end, the 2-3 bps at both the 5′-end and 3′-end of the read are subtracted. Put a pair of reads after the above two types of subtraction of contamination-resistant adapter specific sequences in the fastq files of retained read 1 and read 2; and for a pair of reads that do not meet condition 1, it is put in the fastq files of abandoned read 1 and read 2, for subsequent inspection and analysis.
[0256] The software will judge the type of contamination-resistant adapter of off-line raw fastq file, and giving the proportion of the judged adapter sequences and the type of dominant adapter during the analysis; if the proportion of type of the dominant adapter is less than 90%, it is considered that the sample has been contaminated with other samples, and the subsequent analysis procedures are stopped. If the dominant adapter type accounts for more than 90% but less than 98%, it is considered that the sample has been slightly contaminated with other samples, and the subsequent analysis procedures can be performed after removing the reads containing the contaminated adapter; If the dominant adapter type accounts for more than 98%, it is considered that the sample are not contaminated, and the subsequent analysis procedures are carried out directly. The total number of read pairs of the original data file, the number of read pairs whose adapter are cleaved, the number of read pairs eventually retained and the number of abandoned read pairs are counted in the final results of analysis.
TABLE-US-00031 TABLE 23 A pair of contamination-resistant adapters that are removed of 5′- and the 3′-ends respectively Type of contamination- resistant adapters Sequence 5′-end contamination- AT resistant adapter 3′-end contamination- AT resistant adapter (reversely complemented sequence of 5′-end contamination- resistant adapter) Read 1 sequence ATGTAAATGCACAACAGTGAGACGCAG AATGCCTCTGGAGCACACAGAAGGGAC GCCTCATCCAGAGCTGGGGGATTAGAGA AGGCTCCCAGAAGTGAAATTAGCTGAT Read 2 sequence ATCAGCTAATTTCACTTCTGGGAGCCTT CTCTAATCCCCCAGCTCTGGATGAGGCG TCCCTTCTGTGTGCTCCAGAGGCATTCT GCGTCTCACTGTTGTGCATTTACAT Reversely complemented ATGTAAATGCACAACAGTGAGACGCAG sequence of read 2 AATGCCTCTGGAGCACACAGAAGGGAC GCCTCATCCAGAGCTGGGGGATTAGAGA AGGCTCCCAGAAGTGAAATTAGCTGAT Read 1 sequence removed of ATGTAAATGCACAACAGTGAGACGCAG “AT” at the 3′-end AATGCCTCTGGAGCACACAGAAGGGAC GCCTCATCCAGAGCTGGGGGATTAGAGA AGGCTCCCAGAAGTGAAATTAGCTG Read 2 sequence removed of ATCAGCTAATTTCACTTCTGGGAGCCTT “AT” at the 3′-end CTCTAATCCCCCAGCTCTGGATGAGGCG TCCCTTCTGTGTGCTCCAGAGGCATTCT GCGTCTCACTGTTGTGCATTTAC Read 1 sequence removed of GTAAATGCACAACAGTGAGACGCAGAA “ATs” at both the 3′-end and TGCCTCTGGAGCACACAGAAGGGACGC the 5′-end CTCATCCAGAGCTGGGGGATTAGAGAA GGCTCCCAGAAGTGAAATTAGCTG Read 2 sequence removed of CAGCTAATTTCACTTCTGGGAGCCTTCT “ATs” at both the 3′-end and CTAATCCCCCAGCTCTGGATGAGGCGTC 5′-end CCTTCTGTGTGCTCCAGAGGCATTCTGC GTCTCACTGTTGTGCATTTAC Notes: In table 23, both the 5′-end and the 3′-end of contamination-resistant adapters are “AT”, the lengths of read 1 and 2 are the same, read 1 and 2 are reversely complementary to each other, so the contamination-resistant adapters “AT” at the 5′-end and 3′-end of this pair of reads are subtracted during the analysis.
TABLE-US-00032 TABLE 24 A pair of contamination-resistant adapters that are removed of 5′-end respectively Type of contamination- resistant adapters Sequence 5′-end contamination- TCT resistant adapter 3′-end contamination- AGA resistant adapter (reversely complemented sequence of 5′-end contamination-resistant adapter) Read 1 sequence TCTAATGGACAAATAAAAGTTGTATATATTTA CTGTATACAACACGATGTTTTGGAATATGTAT ACGTTGTGGAATGGCTAAATCAAGCTAATTA AAATATGCATTACTTCACTTTTTTTTTTTTTA AGAGACAGCGTTTTGCTCTCGTT Read 2 sequence TCTTGATGCAGTGAGCCGAGATCATGCCACT TCTGTCTCTTAAAAAAAAAAAAAGTGTAGT AATGCATATTTTAATTATCTTGATTTATCATTT CTACAATGTAGTCCTATTCCAAAGTAT Reversely complemented ATACTTTGGAATAGGACTACATTGTAGAAAT sequence of read GATAAATCAAGATAATTAAAATATGCATTACT ACACTTTTTTTTTTTTTAAGAGACAGAGTTT TGCTCTCGTTACCCAGGCTGGAGTACAGTG GCATGATCTCGGCTCACTGCATCAAGA Read 1 sequence removed AATGGACAAATAAAAGTTGTATATATTTACTG of “TCT” at the 5′-end TATACAACACGATGTTTTGGAATATGTATACG TTGTGGAATGGCTAAATCAAGCTAATTAAAA TATGCATTACTTCACTTTTTTTTTTTTTAAGA GACAGCGTTTTGCTCTCGTT Read 2 sequence removed TGATGCAGTGAGCCGAGATCATGCCACTGTA of “TCT” at the 5′-end CTCCAGCCTGGGTAACGAGAGCAAAACTCT GTCTCTTAAAAAAAAAAAAAGTGTAGTAAT GCATATTTTAATTATCTTGATTTATCATTTCTA CAATGTAGTCCTATTCCAAAGTAT Notes: In table 24, the 5′-end of contamination-resistant adapters is “TCT”, and the 3′-end of contamination-resistant adapters is “AGA”, the lengths of read 1 and 2 are not the same, reversely complementary sequence of read 2 is different from that of read 1, so the contamination-resistant adapters “TCT” at the 5′-end of this pair of reads are subtracted during the analysis.
TABLE-US-00033 TABLE 25 A pair of reads that are not removed of 5′-end and abandoned Type of contamination- resistant adapters Sequence 5′-end contamination- GT resistant adapter Read 1 sequence GGATAGAGGGGCACCACGTTCTTGCACTTC ATGCTGTACAGATGCTCCATTCCTTTGTTACT GTAGGTGGGAAGACACAGAAAGGACTACTT TAGAGCCAACCCGAGCCCCAGGAGTGCTGA AATCCCTAGAAGGGGAAGGAACAGGAACG Read 2 sequence GAGTGTCTTTGGAGTTCCTCTTCCTACCCCT TCTAGGGATTTCAGCACTCCTGGGGCTCGGG TTGGCACTAAAGTATTCCTTACTGTGACTTC CCACCTACACTAACAAAGGCAACGAGCATC TTTACCGCATGAAGTGCAAGAACGAGGG Notes: In table 25, the 5′-end of the contamination-resistant adapters is “GT”, and the first two bases at 5′-end of read 1 and 2 are “GG” and “GA”; the sequences are different from the contamination-resistant adapters by one base, the sum of numerical values of Hamming distance calculated between “GG” and “GA” respectively and “GT” is 2, which is bigger than 1, so this pair of reads is abandoned.