Use of Herbicide-tolerant Protein
20190029252 · 2019-01-31
Inventors
- Xiangting Xie (Beijing, CN)
- Qing TAO (Beijing, CN)
- Jie Pang (Beijing, CN)
- Derong Ding (Beijing, CN)
- Xiaoming BAO (Beijing, CN)
Cpc classification
C12N15/82
CHEMISTRY; METALLURGY
A01N25/32
HUMAN NECESSITIES
A01N47/36
HUMAN NECESSITIES
A01G22/00
HUMAN NECESSITIES
International classification
A01N25/32
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
A01G22/00
HUMAN NECESSITIES
A01N47/36
HUMAN NECESSITIES
Abstract
The present invention relates to the use of a herbicide-tolerant protein, wherein the method for controlling weeds comprises applying a herbicide containing an effective dose of tribenuron-methyl to a plant growth environment where at least one transgenic plant is present, wherein the transgenic plant comprises a nucleotide sequence encoding a thifensulfuron hydrolase in its genome, and compared to other plants without the nucleotide sequence encoding the hydrolase, the transgenic plant has reduced plant damage and/or an increased plant yield. The present invention discloses for the first time that a thifensulfuron hydrolase can show a high tolerance to a tribenuron-methyl herbicide, plants containing a nucleotide sequence encoding the thifensulfuron hydrolase are strongly tolerant to the tribenuron-methyl herbicide and can at least tolerate 1-fold field concentration, and thus the hydrolase has broad application prospects in plants.
Claims
1. A method for controlling weeds, characterized in that the method comprises applying a herbicide containing an effective dose of tribenuron-methyl to a plant growth environment where at least one transgenic plant is present, wherein the transgenic plant comprises a nucleotide sequence encoding a thifensulfuron hydrolase in its genome, and compared to other plants without the nucleotide sequence encoding the thifensulfuron hydrolase, the transgenic plant has reduced plant damage and/or an increased plant yield.
2. (canceled)
3. (canceled)
4. The method for controlling weeds according to claim 1, characterized in that the transgenic plant is maize, soybean, Arabidopsis thaliana, cotton, rape, rice, sorghum, wheat, barley, millet, sugar cane or oat.
5. The method for controlling weeds according to claim 1, characterized in that the amino acid sequence of the thifensulfuron hydrolase comprises an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 7.
6. The method for controlling weeds according to claim 5, characterized in that the nucleotide sequence of the thifensulfuron hydrolase comprises: (a) a nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 7; or (b) a nucleotide sequence as shown in SEQ ID NO: 2 or SEQ ID NO: 3; or (c) a nucleotide sequence as shown in SEQ ID NO: 5 or SEQ ID NO: 6; or (d) a nucleotide sequence as shown in SEQ ID NO: 8 or SEQ ID NO: 9.
7. The method for controlling weeds according to claim 1, characterized in that the transgenic plant may also comprise at least one second nucleotide different from the nucleotide sequence encoding the thifensulfuron hydrolase.
8. The method for controlling weeds according to claim 7, characterized in that the second nucleotide encodes a selectable marker protein, a protein with a synthetic activity, a protein with a decomposing activity, an anti-biostress protein, an anti-nonbiostress protein, a male sterile protein, a protein affecting a plant yield and/or a protein affecting plant quality.
9. The method for controlling weeds according to claim 8, characterized in that the second nucleotide encodes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, -ketoglutarate-dependent dioxygenase, dicamba monooxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, cytochrome-like proteins and/or protoporphyrinogen oxidase.
10. The method for controlling weeds according to claim 1, characterized in that the herbicide containing an effective dose of tribenuron-methyl also includes glyphosate herbicides, glufosinate herbicides, auxin herbicides, graminicides, pre-emergence selective herbicides and/or post-emergence selective herbicides.
11. The method for controlling weeds according to claim 1, the weeds are glyphosate-tolerant weeds, characterized in that the method comprises applying effective doses of a tribenuron-methyl herbicide and a glyphosate herbicide to a field where at least one transgenic plant is planted, wherein the field includes glyphosate-tolerant weeds or seeds thereof, the transgenic plant comprises a nucleotide sequence encoding a thifensulfuron hydrolase and a nucleotide sequence encoding a glyphosate-tolerant protein in its genome, and compared to other plants without the nucleotide sequence encoding the thifensulfuron hydrolase and/or the nucleotide sequence encoding the glyphosate-tolerant protein, the transgenic plant has reduced plant damage and/or an increased plant yield.
12. (canceled)
13. (canceled)
14. (canceled)
15. (canceled)
16. (canceled)
17. (canceled)
18. The method for controlling weeds according to claim 11, characterized in that the glyphosate-tolerant protein includes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase or glyphosate decarboxylase.
19. The method for controlling weeds according to claim 18, characterized in that the amino acid sequence of the glyphosate-tolerant protein comprises an amino acid sequence as shown in SEQ ID NO: 10.
20. The method for controlling weeds according to claim 19, characterized in that the nucleotide sequence of the glyphosate-tolerant protein comprises: (a) a nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 10; or (b) a nucleotide sequence as shown in SEQ ID NO: 11.
21. A planting system for controlling weeds growth, characterized in that the planting system comprises a tribenuron-methyl herbicide and a plant growth environment where at least one transgenic plant is present, and a herbicide containing an effective dose of tribenuron-methyl is applied to the plant growth environment where at least one transgenic plant is present, wherein the transgenic plant comprises a nucleotide sequence encoding a thifensulfuron hydrolase in its genome, and compared to other plants without the nucleotide sequence encoding the thifensulfuron hydrolase, the transgenic plant has reduced plant damage and/or an increased plant yield.
22. (canceled)
23. (canceled)
24. The planting system for controlling weeds growth according to claim 21, characterized in that the transgenic plant is maize, soybean, Arabidopsis thaliana, cotton, rape, rice, sorghum, wheat, barley, millet, sugar cane or oat.
25. The planting system for controlling weeds growth according to claim 21, characterized in that the amino acid sequence of the thifensulfuron hydrolase comprises an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 7.
26. The planting system for controlling weeds growth according to claim 25, characterized in that the nucleotide sequence of the thifensulfuron hydrolase comprises: (a) a nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 7; or (b) a nucleotide sequence as shown in SEQ ID NO: 2 or SEQ ID NO: 3; or (c) a nucleotide sequence as shown in SEQ ID NO: 5 or SEQ ID NO: 6; or (d) a nucleotide sequence as shown in SEQ ID NO: 8 or SEQ ID NO: 9.
27. The planting system for controlling weeds growth according to claim 21, characterized in that the transgenic plant may also comprise at least one second nucleotide different from the nucleotide sequence encoding the thifensulfuron hydrolase.
28. The planting system for controlling weeds growth according to claim 27, characterized in that the second nucleotide encodes a selectable marker protein, a protein with a synthetic activity, a protein with a decomposing activity, an anti-biostress protein, an anti-nonbiostress protein, a male sterile protein, a protein affecting a plant yield and/or a protein affecting plant quality.
29. The planting system for controlling weeds growth according to claim 28, characterized in that the second nucleotide encodes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, -ketoglutarate-dependent dioxygenase, 4-hydroxyphenylpyruvate dioxygenase, acetolactate synthase, cytochrome-like proteins and/or protoporphyrinogen oxidase.
30. The planting system for controlling weeds growth according to claim 21, characterized in that the herbicide containing a herbicidally effective dose of tribenuron-methyl also includes glyphosate herbicides, glufosinate herbicides, auxin herbicides, graminicides, pre-emergence selective herbicides and/or post-emergence selective herbicides.
31. The planting system for controlling weeds growth according to claim 21, the weeds are glyphosate-tolerant weeds, characterized in that the planting system comprises a tribenuron-methyl herbicide, a glyphosate herbicide and a field where at least one transgenic plant is planted, and effective doses of the tribenuron-methyl herbicide and the glyphosate herbicide are applied to the field where at least one transgenic plant is planted, wherein the field includes glyphosate-tolerant weeds or seeds thereof, the transgenic plant comprises a nucleotide sequence encoding a thifensulfuron hydrolase and a nucleotide sequence encoding a glyphosate-tolerant protein in its genome, and compared to other plants without the nucleotide sequence encoding the thifensulfuron hydrolase and/or the nucleotide sequence encoding the glyphosate-tolerant protein, the transgenic plant has reduced plant damage and/or an increased plant yield.
32. (canceled)
33. (canceled)
34. (canceled)
35. (canceled)
36. (canceled)
37. (canceled)
38. The planting system for controlling weeds growth according to claim 31, characterized in that the glyphosate-tolerant protein includes 5-enolpyruvylshikimate-3-phosphate synthase, glyphosate oxidoreductase, glyphosate-N-acetyltransferase or glyphosate decarboxylase.
39. The planting system for controlling weeds growth according to claim 38, characterized in that the amino acid sequence of the glyphosate-tolerant protein comprises an amino acid sequence as shown in SEQ ID NO: 10.
40. The planting system for controlling weeds growth according to claim 39, characterized in that the nucleotide sequence of the glyphosate-tolerant protein comprises: (a) a nucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 10; or (b) a nucleotide sequence as shown in SEQ ID NO: 11.
41. (canceled)
42. (canceled)
43. (canceled)
44. A method for degrading a tribenuron-methyl herbicide with a thifensulfuron hydrolase, characterized in that the method comprises applying a herbicide containing an effective dose of tribenuron-methyl to a plant growth environment where at least one transgenic plant is present, wherein the transgenic plant comprises a nucleotide sequence encoding the thifensulfuron hydrolase in its genome, and compared to other plants without the nucleotide sequence encoding the thifensulfuron hydrolase, the transgenic plant has reduced plant damage and/or an increased plant yield.
45. (canceled)
46. (canceled)
47. (canceled)
48. (canceled)
Description
DESCRIPTION OF THE DRAWINGS
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149] and
PARTICULAR EMBODIMENTS
[0150] The technical solution of the use of the herbicide-tolerant protein of the present invention is further described through specific examples below.
Example 1. Acquisition and Synthesis of an ALT Gene Sequence
[0151] 1. Acquisition of an ALT Gene Sequence
[0152] The amino acid sequence (398 amino acids) of thifensulfuron hydrolase-1 (ALT-1) is shown as SEQ ID NO: 1 in the sequence listing; the ALT-1-01 nucleotide sequence (1197 nucleotides) encoding the corresponding ALT-1 amino acid sequence is shown as SEQ ID NO: 2 in the sequence listing; and the ALT-1-02 nucleotide sequence (1197 nucleotides) encoding the corresponding ALT-1 amino acid sequence is shown as SEQ ID NO: 3 in the sequence listing.
[0153] The amino acid sequence (369 amino acids) of thifensulfuron hydrolase-2 (ALT-2) is shown as SEQ ID NO: 4 in the sequence listing; the ALT-2-01 nucleotide sequence (1110 nucleotides) encoding the corresponding ALT-2 amino acid sequence is shown as SEQ ID NO: 5 in the sequence listing; and the ALT-2-02 nucleotide sequence (1110 nucleotides) encoding the corresponding ALT-2 amino acid sequence is shown as SEQ ID NO: 6 in the sequence listing.
[0154] The amino acid sequence (362 amino acids) of thifensulfuron hydrolase-3 (ALT-3) is shown as SEQ ID NO: 7 in the sequence listing; the ALT-3-01 nucleotide sequence (1089 nucleotides) encoding the corresponding ALT-3 amino acid sequence is shown as SEQ ID NO: 8 in the sequence listing; and the ALT-3-02 nucleotide sequence (1089 nucleotides) encoding the corresponding ALT-3 amino acid sequence is shown as SEQ ID NO: 9 in the sequence listing.
[0155] 2. Acquisition of an EPSPS Gene Sequence
[0156] The amino acid sequence (455 amino acids) of a glyphosate-tolerant protein is shown as SEQ ID NO: 10 in the sequence listing; and the EPSPS nucleotide sequence (1368 nucleotides) encoding the amino acid sequence of the corresponding glyphosate-tolerant protein is shown as SEQ ID NO: 11 in the sequence listing.
[0157] 3. Synthesis of the Above-Mentioned Nucleotide Sequences
[0158] The ALT-1-01 nucleotide sequence (shown as SEQ ID NO: 2 in the sequence listing), the ALT-1-02 nucleotide sequence (shown as SEQ ID NO: 3 in the sequence listing), the ALT-2-01 nucleotide sequence (shown as SEQ ID NO: 5 in the sequence listing), the ALT-2-02 nucleotide sequence (shown as SEQ ID NO: 6 in the sequence listing), the ALT-3-01 nucleotide sequence (shown as SEQ ID NO: 8 in the sequence listing), the ALT-3-02 nucleotide sequence (shown as SEQ ID NO: 9 in the sequence listing) and the EPSPS nucleotide sequence (shown as SEQ ID NO: 11 in the sequence listing) were synthesized by Nanjing Genscript Biotechnology Co., Ltd.; the synthetic ALT-1-01 nucleotide sequence (SEQ ID NO: 2) is further connected with a SpeI restriction site at the 5 end, and the ALT-1-01 nucleotide sequence (SEQ ID NO: 2) is further connected with a KasI restriction site at the 3 end; the synthetic ALT-1-02 nucleotide sequence (SEQ ID NO: 3) is further connected with a SpeI restriction site at the 5 end, and the ALT-1-02 nucleotide sequence (SEQ ID NO: 3) is further connected with a KasI restriction site at the 3 end; the synthetic ALT-2-01 nucleotide sequence (SEQ ID NO: 5) is further connected with a SpeI restriction site at the 5 end, and the ALT-2-01 nucleotide sequence (SEQ ID NO: 5) is further connected with a KasI restriction site at the 3 end; the synthetic ALT-2-02 nucleotide sequence (SEQ ID NO: 6) is further connected with a SpeI restriction site at the 5 end, and the ALT-2-02 nucleotide sequence (SEQ ID NO: 6) is further connected with a KasI restriction site at the 3 end; the synthetic ALT-3-01 nucleotide sequence (SEQ ID NO: 8) is further connected with a SpeI restriction site at the 5 end, and the ALT-3-01 nucleotide sequence (SEQ ID NO: 8) is further connected with a KasI restriction site at the 3 end; the synthetic ALT-3-02 nucleotide sequence (SEQ ID NO: 9) is further connected with a SpeI restriction site at the 5 end, and the ALT-3-02 nucleotide sequence (SEQ ID NO: 9) is further connected with a KasI restriction site at the 3 end; and the synthetic EPSPS nucleotide sequence (SEQ ID NO: 11) is further connected with a NcoI restriction site at the 5 end, and the EPSPS nucleotide sequence (SEQ ID NO: 11) is further connected with a FspI restriction site at the 3 end.
Example 2. Construction of Arabidopsis thaliana Recombinant Expression Vectors
[0159] 1. Construction of Arabidopsis thaliana and Soybean Recombinant Cloning Vectors Containing ALT Nucleotide Sequences
[0160] The synthetic ALT-1-01 nucleotide sequence was ligated into cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and the operational procedure was carried out according to Promega's pGEM-T vector product instructions, obtaining a recombinant cloning vector DBN01-T, the construction process of which is as shown in
[0161] Then, Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) were transformed with the recombinant cloning vector DBN01-T using the heat shock method with the following heat shock conditions: water bathing 50 L Escherichia coli T1 competent cells and 10 L plasmid DNA (recombinant cloning vector DBN01-T) at 42 C. for 30 seconds; shake culturing at 37 C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking); and growing on an LB plate (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, adjusting the pH to 7.5 with NaOH) of ampicillin (100 mg/L) having its surface coated with IPTG (isopropylthio--D-galactoside) and X-gal (5-bromo-4-chloro-3-indole--D-galactoside) overnight. White colonies were picked out and cultured in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 100 mg/L of ampicillin, adjusting the pH to 7.5 with NaOH) at a temperature of 37 C. overnight. The plasmids in the cells were extracted through an alkaline method: centrifuging the bacteria solution at a rotation speed of 12000 rpm for 1 min, removing the supernatant, and suspending the precipitated thalli with 100 L ice pre-cooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), and 50 mM glucose, pH 8.0); adding 200 L newly formulated solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)), inverting the tube 4 times, mixing and placing on ice for 3-5 min; adding 150 L ice-cold solution III (3 M potassium acetate, 5 M acetic acid), mixing uniformly immediately and placing on ice for 5-10 min; centrifuging under the conditions of a temperature of 4 C. and a rotation speed of 12000 rpm for 5 min, adding 2 volumes of anhydrous ethanol to the supernatant and placing at room temperature for 5 min after mixing uniformly; centrifuging under the conditions of a temperature of 4 C. and a rotation speed of 12000 rpm for 5 min, discarding the supernatant, and air drying the precipitate after washing with ethanol with a concentration of 70% (V/V); adding 30 L TE (10 mM Tris-HCl, and 1 mM EDTA, pH 8.0) containing RNase (20 g/mL) to dissolve the precipitate; water bathing at a temperature of 37 C. for 30 min to digest RNA; and storing at a temperature of 20 C. for use.
[0162] After identifying the extracted plasmid by SpeI and KasI digestion, positive clones were verified by sequencing. The results showed that the inserted ALT-1-01 nucleotide sequence in the recombinant cloning vector DBN01-T was the nucleotide sequence shown as SEQ ID NO: 2 in the sequence listing, that is, the ALT-1-01 nucleotide sequence was inserted correctly.
[0163] According to the above-mentioned method for constructing the recombinant cloning vector DBN01-T, the synthetic ALT-2-01 nucleotide sequence was ligated into a cloning vector pGEM-T, obtaining a recombinant cloning vector DBN02-T, wherein ALT-2-01 is the ALT-2-01 nucleotide sequence (SEQ ID NO: 5). Enzyme digestion and sequencing verified that the ALT-2-01 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN02-T.
[0164] According to the above-mentioned method for constructing the recombinant cloning vector DBN01-T, the synthetic ALT-3-01 nucleotide sequence was ligated into a cloning vector pGEM-T, obtaining a recombinant cloning vector DBN03-T, wherein ALT-3-01 is the ALT-3-01 nucleotide sequence (SEQ ID NO: 8). Enzyme digestion and sequencing verified that the ALT-3-01 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN03-T.
[0165] At the same time, according to the above-mentioned method for constructing the recombinant cloning vector DBN01-T, the synthetic EPSPS nucleotide sequence was ligated into a cloning vector pGEM-T, obtaining a recombinant cloning vector DBN04-T, wherein EPSPS is the EPSPS nucleotide sequence (SEQ ID NO: 11). Enzyme digestion and sequencing verified that the EPSPS nucleotide sequence was correctly inserted into the recombinant cloning vector DBN04-T.
[0166] 2. Construction of Arabidopsis thaliana Recombinant Expression Vectors Containing ALT Nucleotide Sequences
[0167] The recombinant cloning vector DBN01-T and an expression vector DBNBC-01 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were digested with restriction enzymes SpeI and KasI, respectively; the excised ALT-1-01 nucleotide sequence fragment was inserted between the SpeI and KasI sites in the expression vector DBNBC-01; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, a recombinant expression vector DBN100632 was constructed (located in the cytoplasm), and the construction process of which was shown as
[0168] Escherichia coli T1 competent cells were transformed with the recombinant expression vector DBN100632 by a heat shock method with the following heat shock conditions: water bathing 50 L Escherichia coli T1 competent cells and 10 L plasmid DNA (recombinant expression vector DBN100632) at 42 C. for 30 seconds; shake culturing at 37 C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking); then culturing under the condition of a temperature of 37 C. on an LB solid plate containing 50 mg/L of spectinomycin (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 15 g/L of agar, adjusted to a pH of 7.5 with NaOH) for 12 hours, picking white colonies, and culturing under the condition of a temperature of 37 C. overnight in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 50 mg/L of spectinomycin, adjusted to a pH of 7.5 with NaOH). The plasmids in the cells were extracted through an alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant expression vector DBN100632 was the nucleotide sequence shown as SEQ ID NO: 2 in the sequence listing, i.e., the ALT-1-01 nucleotide sequence.
[0169] According to the above-mentioned method for constructing the recombinant expression vector DBN100632, a recombinant expression vector DBN100631 (located in the chloroplast) containing the ALT-1-01 nucleotide sequence was constructed, the vector structure of which was shown as
[0170] According to the above-mentioned method for constructing the recombinant expression vector DBN100632, the ALT-2-01 nucleotide sequence excised by SpeI and KasI digested recombinant cloning vector DBN02-T was inserted into the expression vector DBNBC-01, obtaining a recombinant expression vector DBN100634. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100634 contained the nucleotide sequence shown as SEQ ID NO: 5 in the sequence listing, that is, the ALT-2-01 nucleotide sequence was inserted correctly.
[0171] According to the above-mentioned method for constructing the recombinant expression vector DBN100631, the ALT-2-01 nucleotide sequence excised by SpeI and KasI digested recombinant cloning vector DBN02-T was inserted into the expression vector DBNBC-01, obtaining a recombinant expression vector DBN100633 (containing spAtCTP2, located in the chloroplast). Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100633 contained the nucleotide sequence shown as SEQ ID NO: 5 in the sequence listing, that is, the ALT-2-01 nucleotide sequence was inserted correctly.
[0172] According to the above-mentioned method for constructing the recombinant expression vector DBN100632, the ALT-3-01 nucleotide sequence excised by SpeI and KasI digested recombinant cloning vector DBN03-T was inserted into the expression vector DBNBC-01, obtaining a recombinant expression vector DBN100636. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100636 contained the nucleotide sequence shown as SEQ ID NO: 8 in the sequence listing, that is, the ALT-3-01 nucleotide sequence was inserted correctly.
[0173] According to the above-mentioned method for constructing the recombinant expression vector DBN100631, the ALT-3-01 nucleotide sequence excised by SpeI and KasI digested recombinant cloning vector DBN03-T was inserted into the expression vector DBNBC-01, obtaining a recombinant expression vector DBN100635 (containing spAtCTP2, located in the chloroplast). Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100635 contained the nucleotide sequence shown as SEQ ID NO: 8 in the sequence listing, that is, the ALT-3-01 nucleotide sequence was inserted correctly.
Example 3. Acquisition of Arabidopsis thaliana Plants Having an ALT Nucleotide Sequence Introduced
[0174] 1. Transformation of Agrobacterium with the Recombinant Expression Vectors
[0175] The Agrobacterium GV3101 was transformed with the recombinant expression vectors DBN100632, DBN100631, DBN100634, DBN100633, DBN100636 and DBN100635 which had been correctly constructed using the liquid nitrogen method with the following transformation conditions: placing 100 L of Agrobacterium GV3101, and 3 L of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, warm water bathing at 37 C. for 10 minutes; inoculating the transformed Agrobacterium GV3101 into an LB tube, culturing under the conditions of a temperature of 28 C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification using restriction enzymes. The results showed that the structures of the recombinant expression vectors DBN100632, DBN100631, DBN100634, DBN100633, DBN100636 and DBN100635 were completely correct.
[0176] 2. Acquisition of Transgenic Arabidopsis thaliana Plants
[0177] Seeds of wild-type Arabidopsis thaliana were suspended in a 0.1% (w/v) agarose solution. The suspended seeds were stored at 4 C. for 2 days to complete the need for dormancy, in order to ensure synchronous seed germination. Vermiculite was mixed with horse manure soil, the mixture was sub-irrigated with water to wet, and the soil mixture was allowed to drain the water away for 24 hours. The pretreated seeds were sowed in the soil mixture and covered with a moisturizing cover for 7 days. The seeds were germinated and the plants were cultivated in a greenhouse under long day conditions (16 hours of light/8 hours of dark) of a constant temperature (22 C.) and a constant humidity (40-50%) with a light intensity of 120-150 mol/(m.sup.2.Math.sec). The plants were initially irrigated with the Hoagland's nutrient solution, followed by deionized water, keeping the soil moist but not wet through.
[0178] Arabidopsis thaliana was transformed using the flower soaking method. One or more 15-30 mL of precultures of YEP culture solution (containing spectinomycin (50 mg/L) and rifampicin (10 mg/L)) were inoculated with the selected Agrobacterium colonies. The cultures were incubated at 28 C. and 220 rpm with shaking at a constant speed overnight. Each preculture was used to inoculate two 500 mL of cultures of YEP culture solution (containing spectinomycin (50 mg/L) and rifampicin (10 mg/L)), and the cultures were incubated at 28 C. with continuous shaking overnight. Cells were precipitated by centrifuging at about 8700g at room temperature for 10 minutes, and the resulting supernatant was discarded. The cell precipitate was gently re-suspended in 500 mL osmotic medium which contained MS salt/B5 vitamin, 10% (w/v) sucrose, 0.044 M benzylaminopurine (10 L/L (1 mg/mL, a stock solution in DMSO)) and 300 L/L of Silvet L-77. About 1-month-old plants were soaked in a culture medium for 15 seconds to ensure immersion of the latest inflorescence. Then, the plants were reclined laterally and covered (transparently or opaquely) for 24 hours, then washed with water, and placed vertically. The plants were cultivated with a photoperiod of 16 hours of light/8 hours of dark at 22 C. Seeds were harvested after soaking for about 4 weeks.
[0179] The newly harvested (ALT nucleotide sequence) T.sub.1 seeds were dried at room temperature for 7 days. The seeds were sowed in 26.551 cm germination disks, and 200 mg T.sub.1 seeds (about 10000 seeds) were accepted per disk, wherein the seeds had been previously suspended in 40 mL of 0.1% (w/v) agarose solution and stored at 4 C. for 2 days to complete the need for dormancy, in order to ensure synchronous seed germination.
[0180] Vermiculite was mixed with horse manure soil, the mixture was sub-irrigated with water to wet, and water was drained through gravity. The pretreated seeds (each 40 mL) were sowed evenly in the soil mixture using a pipette, and covered with a moisturizing cover for 4-5 days. The cover was removed 1 day before performing initial transformant selection by spraying glufosinate (used to select the co-transformed PAT gene) post emergence.
[0181] The T.sub.1 plants were sprayed with a 0.2% solution of a Liberty herbicide (200 g ai/L of glufosinate) reusing a DeVilbiss compressed air nozzle at a spray volume of 10 mL/disc (703 L/ha) 7 days after planting (DAP) and 11 DAP (the cotyledon stage and 2-4 leaf stage, respectively), to provide an effective amount of glufosinate of 280 g ai/ha per application. Surviving plants (actively growing plants) were identified 4-7 days after the final spraying, and transplanted to 7 cm7 cm square pots prepared with horse manure soil and vermiculite (3-5 plants/disc), respectively. The transplanted plants were covered with a moisturizing cover for 3-4 days, and placed in a 22 C. culture chamber or directly transferred into a greenhouse as previously. Then, the cover was removed, and at least 1 day before testing the ability of the ALT gene to provide tribenuron-methyl herbicide resistance, the plants were planted into a greenhouse (225 C., 5030% RH, 14 hours of light: 10 hours of dark, a minimum of 500 E/m.sup.2s.sup.1 natural+supplemental light).
Example 4. Detection of Herbicide Tolerance Effects of the Transgenic Arabidopsis thaliana Plants
[0182] T.sub.1 transformants were initially selected from the background of untransformed seeds using a glufosinate selection scheme. About 40000 T.sub.1 seeds were screened, and 380 T.sub.1 positive transformants (PAT gene) were identified with a transformation efficiency of about 0.95%. The plants that were transformed with the recombinant expression vector DBN100632 were Arabidopsis thaliana plants having an ALT-1-01 nucleotide sequence located in the cytoplasm introduced (At cytoplasmic ALT-1-01), and the plants that were transformed with the recombinant expression vector DBN100631 were Arabidopsis thaliana plants having an ALT-1-01 nucleotide sequence located in the chloroplast introduced (At chloroplastic ALT-1-01); the plants that were transformed with the recombinant expression vector DBN100634 were Arabidopsis thaliana plants having an ALT-2-01 nucleotide sequence located in the cytoplasm introduced (At cytoplasmic ALT-2-01), and the plants that were transformed with the recombinant expression vector DBN100633 were Arabidopsis thaliana plants having an ALT-2-01 nucleotide sequence located in the chloroplast introduced (At chloroplastic ALT-2-01); and the plants that were transformed with the recombinant expression vector DBN100636 were Arabidopsis thaliana plants having an ALT-3-01 nucleotide sequence located in the cytoplasm introduced (At cytoplasmic ALT-3-01), and the plants that were transformed with the recombinant expression vector DBN100635 were Arabidopsis thaliana plants having an ALT-3-01 nucleotide sequence located in the chloroplast introduced (At chloroplastic ALT-3-01). The herbicide tolerance effects of At cytoplasmic ALT-1-01 T.sub.1 plants, At chloroplastic ALT-1-01 T.sub.1 plants, At cytoplasmic ALT-2-01 T.sub.1 plants, At chloroplastic ALT-2-01 T.sub.1 plants, At cytoplasmic ALT-3-01 T.sub.1 plants, At chloroplastic ALT-3-01 T.sub.1 plants and wild-type Arabidopsis thaliana plants on tribenuron-methyl were detected (14 days after sowing), respectively.
[0183] At cytoplasmic ALT-1-01 T.sub.1 plants, At chloroplastic ALT-1-01 T.sub.1 plants, At cytoplasmic ALT-2-01 T.sub.1 plants, At chloroplastic ALT-2-01 T.sub.1 plants, At cytoplasmic ALT-3-01 T.sub.1 plants, At chloroplastic ALT-3-01 T.sub.1 plants and wild-type Arabidopsis thaliana plants were sprayed with tribenuron-methyl (18 g ai/ha, 1-fold field concentration) and a blank solvent (water), respectively. Plants were counted for the resistance situations 14 days after spraying: those having a consistent growth status with the blank solvent (water) group after 14 days were classified as highly resistant plants, those having a bolting height less than of that of the blank solvent (water) group after 14 days were classified as moderately resistant plants, those still not capable of bolting after 14 days were classified as poorly resistant plants, and those dead after 14 days were classified as non-resistant plants. Since each Arabidopsis thaliana T.sub.1 plant was an independent transformation event, a significant difference in individual T1 responses could be expected at a given dose. The results are as shown in Table 1 and
TABLE-US-00001 TABLE 1 Experimental results of the tolerance of transgenic Arabidopsis thaliana T.sub.1 plants to a tribenuron-methyl herbicide Arabidopsis Mod- thaliana Highly erately Poorly Non- Treatment genotypes resistant resistant resistant resistant Total Blank At 30 0 0 0 30 solvent cytoplasmic (water) ALT-1-01 At 28 0 0 0 28 chloroplastic ALT-1-01 At 31 0 0 0 31 cytoplasmic ALT-2-01 At 25 0 0 0 25 chloroplastic ALT-2-01 At 27 0 0 0 27 cytoplasmic ALT-3-01 At 27 0 0 0 27 chloroplastic ALT-3-01 wild-type 30 0 0 0 30 18 g ai/ha At 24 2 1 1 28 tribenuron- cytoplasmic methyl ALT-1-01 (1x Tri.) At 28 0 0 2 30 chloroplastic ALT-1-01 At 25 1 1 3 30 cytoplasmic ALT-2-01 At 29 0 1 1 31 chloroplastic ALT-2-01 At 22 1 1 3 27 cytoplasmic ALT-3-01 At 27 0 0 2 29 chloroplastic ALT-3-01 wild-type 0 0 0 32 32
[0184] For Arabidopsis thaliana, 18 g ai/ha tribenuron-methyl herbicide is an effective dose distinguishing sensitive plants from plants having an average level of resistance. The results of Table 1 and
Example 5. Having an Unexpected Technical Effect on Different Sulfonylurea Herbicides
[0185] The thifensulfuron hydrolase, which can also be known as sulfonylurea herbicide de-esterase, degrades ester bond-containing sulfonylurea herbicides (e.g., thifensulfuron, etc.) into herbicidally inactive mother acids by hydrolyzing the ester bond, and therefore it cannot degrade ester bond-free sulfonylurea herbicides (e.g., nicosulfuron, chlorsulfuron, etc.). In the prior art, there are many sulfonylurea herbicides containing ester bonds and having similar structures, such as tribenuron-methyl, iodosulfuron-methyl, oxasulfuron, mesosulfuron (mesosulfuron-methyl), pyrazosulfuron-ethyl, sulfometuron-methyl, and halo sulfuron-methyl.
[0186] At cytoplasmic ALT-1-01 T.sub.1 plants, At chloroplastic ALT-1-01 T.sub.1 plants, At cytoplasmic ALT-2-01 T.sub.1 plants, At chloroplastic ALT-2-01 T.sub.1 plants, At cytoplasmic ALT-3-01 T.sub.1 plants, At chloroplastic ALT-3-01 T.sub.1 plants and wild-type Arabidopsis thaliana plants in Example 4 were sprayed with iodosulfuron-methyl (10 g ai/ha, 1-fold field concentration), mesosulfuron (14 g ai/ha, 1-fold field concentration) and oxasulfuron (60 g ai/ha, 1-fold field concentration), respectively, in addition to tribenuron-methyl (18 g ai/ha, 1-fold field concentration) and the blank solvent (water). Plants were counted for the resistance situation 14 days after spraying: those having a consistent growth status with the blank solvent (water) group after 14 days were classified as highly resistant plants, those having a bolting height less than of that of the blank solvent (water) group after 14 days were classified as moderately resistant plants, those still not capable of bolting after 14 days were classified as poorly resistant plants, and those dead after 14 days were classified as non-resistant plants. Since each Arabidopsis thaliana T.sub.1 plant was an independent transformation event, a significant difference in individual T.sub.1 responses could be expected at a given dose. The results are as shown in Table 2 and
TABLE-US-00002 TABLE 2 Experimental results of the tolerance of transgenic Arabidopsis thaliana T.sub.1 plants to sulfonylurea herbicides Arabidopsis thaliana Highly Moderately Poorly Treatment genotypes resistant resistant resistant Non-resistant Total Blank At cytoplasmic 30 0 0 0 30 solvent ALT-1-01 (water) At 28 0 0 0 28 chloroplastic ALT-1-01 At cytoplasmic 31 0 0 0 31 ALT-2-01 At 25 0 0 0 25 chloroplastic ALT-2-01 At cytoplasmic 27 0 0 0 27 ALT-3-01 At 27 0 0 0 27 chloroplastic ALT-3-01 wild-type 30 0 0 0 30 10 g ai/ha At cytoplasmic 0 0 0 29 29 iodosulfuron- ALT-1-01 methyl At 0 0 0 30 30 (1x Iod.) chloroplastic ALT-1-01 At cytoplasmic 0 0 0 30 30 ALT-2-01 At 0 0 0 31 31 chloroplastic ALT-2-01 At cytoplasmic 0 0 0 30 30 ALT-3-01 At 0 0 0 32 32 chloroplastic ALT-3-01 wild-type 0 0 0 29 29 14 g ai/ha At cytoplasmic 0 0 0 29 29 mesosulfuron ALT-1-01 (1x Mes.) At 0 0 0 32 32 chloroplastic ALT-1-01 At cytoplasmic 0 0 0 32 32 ALT-2-01 At 0 0 0 30 30 chloroplastic ALT-2-01 At cytoplasmic 0 0 0 30 30 ALT-3-01 At 0 0 0 32 32 chloroplastic ALT-3-01 wild-type 0 0 0 28 28 60 g ai/ha At cytoplasmic 0 0 0 28 28 oxasulfuron ALT-1-01 (1x Oxa.) At 0 0 0 30 30 chloroplastic ALT-1-01 At cytoplasmic 0 0 0 30 30 ALT-2-01 At 0 0 0 30 30 chloroplastic ALT-2-01 At cytoplasmic 0 0 0 30 30 ALT-3-01 At 0 0 0 31 31 chloroplastic ALT-3-01 wild-type 0 0 0 28 28
[0187] The responses of inputting the thifensulfuron hydrolase activity to Arabidopsis thaliana T.sub.1 plants by ALT-1, ALT-2 and ALT-3 were compared in Table 2. The thifensulfuron hydrolase activity was conferred to all the transformed Arabidopsis thaliana T.sub.1 plants; however, in the given treatments (iodosulfuron-methyl, mesosulfuron and oxasulfuron), all the transformed Arabidopsis thaliana T.sub.1 plants did not exhibit the ability to degrade the above-mentioned sulfonylurea herbicides, and there was no difference between all the transformed Arabidopsis thaliana T.sub.1 plants (ALT-1, ALT-2 and ALT-3) and the wild-type Arabidopsis thaliana plants in the degree of damage.
[0188] Table 2 fully illustrated that the results of Table 1 were unexpected. Although tribenuron-methyl as well as thifensulfuron, iodosulfuron-methyl, mesosulfuron and oxasulfuron are all sulfonylurea herbicides containing ester bonds and having similar chemical structures, the given treatments were also comparable (1-fold field concentration) and at the same time, the thifensulfuron hydrolase (ALT-1, ALT-2 and ALT-3) had been input and expressed at an expected level in the plant individuals, plants expressing the thifensulfuron hydrolase neither had the ability to degrade iodosulfuron-methyl, mesosulfuron and oxasulfuron, nor could protect themselves from damage from the above-mentioned sulfonylurea herbicides, and showed no difference from the wild-type plants in performance, wherein these data are sufficient to confirm that the tribenuron-methyl herbicide tolerance conferred by the thifensulfuron hydrolase (ALT-1, ALT-2 and ALT-3) on the plants was difficult to predict.
Example 6. Construction of Soybean Recombinant Expression Vectors and Transformation of Agrobacterium with the Recombinant Expression Vectors
[0189] 1. Construction of Soybean Recombinant Expression Vectors Containing ALT Nucleotide Sequences
[0190] The recombinant cloning vectors DBN01-T and DBN04-T as well as an expression vector DBNBC-02 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were digested with restriction enzymes SpeI and KasI as well as NcoI and FspI, respectively; the excised ALT-1-01 nucleotide sequence and EPSPS nucleotide sequence fragments were inserted between the SpeI and KasI as well as NcoI and FspI sites in the expression vector DBNBC-02, respectively; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, a recombinant expression vector DBN100828 was constructed (located in the cytoplasm), the construction process of which is as shown in
[0191] According to the method in point 2 of Example 2, Escherichia coli T.sub.1 competent cells were transformed with the recombinant expression vector DBN100828 using the heat shock method, and the plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant expression vector DBN100828 was the nucleotide sequence shown as SEQ ID NO: 2 in the sequence listing, i.e., the ALT-1-01 nucleotide sequence.
[0192] According to the above-mentioned method for constructing the recombinant expression vector DBN100828, a recombinant expression vector DBN100827 (located in the chloroplast) containing the ALT-1-01 nucleotide sequence was constructed, the vector structure of which was shown as
[0193] According to the above-mentioned method for constructing the recombinant expression vector DBN100828, the ALT-2-01 nucleotide sequence and the EPSPS nucleotide sequence excised by SpeI and KasI as well as NcoI and FspI from digested recombinant cloning vectors DBN02-T and DBN04-T were inserted into the expression vector DBNBC-02, obtaining a recombinant expression vector DBN100826. Enzyme digestion and sequencing verified that the nucleotide sequences in the recombinant expression vector DBN100826 contained the nucleotide sequences shown as SEQ ID NO: 5 and SEQ ID NO: 11 in the sequence listing, that is, the ALT-2-01 nucleotide sequence and the EPSPS nucleotide sequence were inserted correctly.
[0194] According to the above-mentioned method for constructing the recombinant expression vector DBN100827, the ALT-2-01 nucleotide sequence and the EPSPS nucleotide sequence excised by SpeI and KasI as well as NcoI and FspI from digested recombinant cloning vectors DBN02-T and DBN04-T were inserted into the expression vector DBNBC-02, obtaining a recombinant expression vector DBN100825 (containing spAtCTP2, located in the chloroplast). Enzyme digestion and sequencing verified that the nucleotide sequences in the recombinant expression vector DBN100825 contained the nucleotide sequences shown as SEQ ID NO: 5 and SEQ ID NO: 11 in the sequence listing, that is, the ALT-2-01 nucleotide sequence and the EPSPS nucleotide sequence were inserted correctly.
[0195] According to the above-mentioned method for constructing the recombinant expression vector DBN100828, the ALT-3-01 nucleotide sequence and the EPSPS nucleotide sequence excised by SpeI and KasI as well as NcoI and FspI from digested recombinant cloning vectors DBN03-T and DBN04-T were inserted into the expression vector DBNBC-02, obtaining a recombinant expression vector DBN100824. Enzyme digestion and sequencing verified that the nucleotide sequences in the recombinant expression vector DBN100824 contained the nucleotide sequences shown as SEQ ID NO: 8 and SEQ ID NO: 11 in the sequence listing, that is, the ALT-3-01 nucleotide sequence and the EPSPS nucleotide sequence were inserted correctly.
[0196] According to the above-mentioned method for constructing the recombinant expression vector DBN100827, the ALT-3-01 nucleotide sequence and the EPSPS nucleotide sequence excised by SpeI and KasI as well as NcoI and FspI from digested recombinant cloning vectors DBN03-T and DBN04-T were inserted into the expression vector DBNBC-02, obtaining a recombinant expression vector DBN100823 (containing spAtCTP2, located in the chloroplast). Enzyme digestion and sequencing verified that the nucleotide sequences in the recombinant expression vector DBN100823 contained the nucleotide sequences shown as SEQ ID NO: 8 and SEQ ID NO: 11 in the sequence listing, that is, the ALT-3-01 nucleotide sequence and the EPSPS nucleotide sequence were inserted correctly.
[0197] 2. Transformation of Agrobacterium with the Recombinant Expression Vectors
[0198] Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) was transformed with the recombinant expression vectors DBN100828, DBN100827, DBN100826, DBN100825, DBN100824 and DBN100823 which had been correctly constructed using a liquid nitrogen method, with the following transformation conditions: placing 100 L of Agrobacterium LBA4404, and 3 L of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, warm water bathing at 37 C. for 10 minutes; inoculating the transformed Agrobacterium LBA4404 into an LB tube, culturing under the conditions of a temperature of 28 C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification using restriction enzymes. The results showed that the structures of the recombinant expression vectors DBN100828, DBN100827, DBN100826, DBN100825, DBN100824 and DBN100823 were completely correct.
Example 7. Acquisition and Verification of Transgenic Soybean Plants
[0199] 1. Acquisition of Transgenic Soybean Plants
[0200] According to the Agrobacterium infection method conventionally used, the cotyledonary node tissue of a sterile culture of soybean variety Zhonghuang13 was co-cultured with the Agrobacterium in point 2 of Example 6, so as to introduce T-DNA (comprising the Arabidopsis thaliana Ubiquitin10 gene promoter sequence, an ALT-1-01 nucleotide sequence, an ALT-2-01 nucleotide sequence, an ALT-3-01 nucleotide sequence, the tNos terminator, the rape eukaryotic elongation factor gene 1a promoter, the Arabidopsis thaliana chloroplast transit peptide, 5-enolpyruvylshikimate-3-phosphate synthase gene and the pea RbcS gene terminator) in the recombinant expression vectors DBN100828, DBN100827, DBN100826, DBN100825, DBN100824 and DBN100823 constructed in Example 6.1 into the soybean chromosomes, obtaining soybean plants that were transformed with the recombinant expression vector DBN100828 and had an ALT-1-01 nucleotide sequence located in the cytoplasm introduced (Gm cytoplasmic ALT-1-01) and soybean plants that were transformed with the recombinant expression vector DBN100827 and had an ALT-1-01 nucleotide sequence located in the chloroplast introduced (Gm chloroplastic ALT-1-01); soybean plants that were transformed with the recombinant expression vector DBN100826 and had an ALT-2-01 nucleotide sequence located in the cytoplasm introduced (Gm cytoplasmic ALT-2-01) and soybean plants that were transformed with the recombinant expression vector DBN100825 and had an ALT-2-01 nucleotide sequence located in the chloroplast introduced (Gm chloroplastic ALT-2-01); and soybean plants that were transformed with the recombinant expression vector DBN100824 and had an ALT-3-01 nucleotide sequence located in the cytoplasm introduced (Gm cytoplasmic ALT-3-01) and soybean plants that were transformed with the recombinant expression vector DBN100823 and had an ALT-3-01 nucleotide sequence located in the chloroplast introduced (Gm chloroplastic ALT-3-01); meanwhile, wild type soybean plants were used as the control.
[0201] As regards the Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in a soybean germination culture medium (3.1 g/L of B5 salt, B5 vitamin, 20 g/L of sucrose, and 8 g/L of agar, pH 5.6), and the seeds were inoculated in a germination culture medium and cultured under the conditions of a temperature of 251 C.; and a photoperiod (light/dark) of 16 h/8 h. After 4-6 days of germination, soybean sterile seedlings swelled at bright green cotyledonary nodes were taken, hypocotyledonary axes were cut off 3-4 millimeters below the cotyledonary nodes, the cotyledons were cut longitudinally, and apical buds, lateral bud and seminal roots were removed. A wound was made at a cotyledonary node using the knife back of a scalpel, and the wounded cotyledonary node tissue was contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the ALT-1-01 nucleotide sequence, the ALT-2-01 nucleotide sequence and the ALT-3-01 nucleotide sequence to the wounded cotyledonary node tissue (step 1: infection step). In this step, the cotyledonary node tissues were preferably immersed in the Agrobacterium suspension (OD660=0.5-0.8, an infection culture medium (2.15 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 40 mg/L of acetosyringone (AS), 4 g/L of 2-morpholine ethanesulfonic acid (MES), and 2 mg/L of zeatin (ZT), pH 5.3) to initiate the inoculation. The cotyledonary node tissues were co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culturing step). Preferably, the cotyledonary node tissues were cultured in a solid culture medium (4.3 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 4 g/L of 2-morpholine ethanesulfonic acid (MES), 2 mg/L of zeatin, and 8 g/L of agar, pH 5.6) after the infection step. After this co-culturing stage, there can be an optional recovery step. In the recovery step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in a recovery culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 2 mg/L of zeatin (ZT), 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, and 100 mg/L of aspartic acid, pH 5.6), without the addition of a selective agent for a plant transformant (step 3: recovery step). Preferably, tissue blocks regenerated from the cotyledonary nodes were cultured in a solid culture medium with an antibiotic but without a selective agent, to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the tissue blocks regenerated from the cotyledonary nodes were cultured in a culture medium containing a selective agent (glyphosate), and growing transformed calli were selected (step 4: selection step). Preferably, the tissue blocks regenerated from the cotyledonary nodes were cultured in a screening solid culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 1 mg/L of 6-benzyladenine (6-BAP), 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, 100 mg/L of aspartic acid, and 0.25 mol/L of N-(phosphonomethyl)glycine, pH 5.6) containing a selective agent, resulting in selective growth of the transformed cells. Then, plants were regenerated from the transformed cells (step 5: regeneration step). Preferably, the tissue blocks regenerated from the cotyledonary nodes grown in a culture medium containing a selective agent were cultured in solid culture media (B5 differentiation culture medium and B5 rooting culture medium) to regenerate plants.
[0202] The screened out resistant tissues were transferred onto the B5 differentiation culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 1 mg/L of zeatin (ZT), 8 g/L of agar, 150 mg/L of cephalosporin, 50 mg/L of glutamic acid, 50 mg/L of aspartic acid, 1 mg/L of gibberellin, 1 mg/L of auxin, and 0.25 mol/L of N-(phosphonomethyl)glycine, pH 5.6), and cultured at 25 C. for differentiation. The differentiated seedlings were transferred onto the B5 rooting culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of 2-morpholine ethanesulfonic acid (MES), 30 g/L of sucrose, 8 g/L of agar, 150 mg/L of cephalosporin, and 1 mg/L of indole-3-butyric acid (IBA)), cultured in the rooting culture medium to be a height of about 10 cm at 25 C., and transferred to a glasshouse for culturing until fruiting. In the greenhouse, the plants were cultured at 26 C. for 16 hours, and then cultured at 20 C. for 8 hours every day.
[0203] 2. Verification of the Transgenic Soybean Plants Using TaqMan
[0204] Leaves of about 100 mg from Gm cytoplasmic ALT-1-01 soybean plants, Gm chloroplastic ALT-1-01 soybean plants, Gm cytoplasmic ALT-2-01 soybean plants, Gm chloroplastic ALT-2-01 soybean plants, Gm cytoplasmic ALT-3-01 soybean plants and Gm chloroplastic ALT-3-01 soybean plants were respectively taken as samples, genomic DNAs thereof were extracted with a DNeasy Plant Maxi Kit (Qiagen), and the copy number of the EPSPS gene was detected by the Taqman probe fluorescence quantitative PCR method so as to determine the copy number of the ALT gene. At the same time, wild type soybean plants were used as controls, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and averaged.
[0205] The specific method for detecting the copy number of the EPSPS gene was as follows:
[0206] Step 11. Leaves of 100 mg from Gm cytoplasmic ALT-1-01 soybean plants, Gm chloroplastic ALT-1-01 soybean plants, Gm cytoplasmic ALT-2-01 soybean plants, Gm chloroplastic ALT-2-01 soybean plants, Gm cytoplasmic ALT-3-01 soybean plants, Gm chloroplastic ALT-3-01 soybean plants and wild-type soybean plants were respectively taken each, respectively ground into a homogenate in a mortar with liquid nitrogen, and 3 replicates were taken for each sample;
[0207] Step 12. Genomic DNAs of the above-mentioned samples were extracted using a DNeasy Plant Mini Kit of Qiagen, and the particular method can refer to the product manual thereof;
[0208] Step 13. The concentrations of the genomic DNAs of the above-mentioned samples were detected using NanoDrop 2000 (Thermo Scientific);
[0209] Step 14. The concentrations of the genomic DNAs of the above-mentioned samples were adjusted to a consistent concentration value which ranges from 80 to 100 ng/L;
[0210] Step 15. The copy numbers of the samples were identified using the Taqman probe fluorescence quantitative PCR method, wherein samples for which the copy numbers had been identified and known were taken as standards, the samples of the wild type soybean plants were taken as the control, and triple repeats were taken for each sample and averaged; the sequences of fluorescence quantitative PCR primers and a probe were as follows, respectively:
[0211] the following primers and probe were used to detect the EPSPS gene sequence:
TABLE-US-00003 primer1: CTGGAAGGCGAGGACGTCATCAATA,shownasSEQIDNO:20 inthesequencelisting; primer2: TGGCGGCATTGCCGAAATCGAG,shownasSEQIDNO:21in thesequencelisting; probe1: ATGCAGGCGATGGGCGCCCGCATCCGTA,shownasSEQID NO:22inthesequencelisting;
[0212] PCR Reaction System:
TABLE-US-00004 Jump Start Taq ReadyMix (Sigma) 10 L 50 primer/probe mixture 1 L genomic DNA 3 L water (ddH.sub.2O) 6 L
[0213] The 50 primer/probe mixture comprises 45 L of each primer at a concentration of 1 mM, 50 L of the probe at a concentration of 100 M, and 860 L of 1TE buffer, and was stored at 4 C. in an amber tube.
[0214] PCR Reaction Conditions:
TABLE-US-00005 Step Temperature Time 21 95 C. 5 minutes 22 95 C. 30 seconds 23 60 C. 1 minute 24 back to step 22, repeated 40 times
[0215] Data were analyzed using software SDS2. 3 (Applied Biosystems).
[0216] It was further confirmed by analyzing the experimental results of the copy number of the EPSPS gene that the ALT-1-01 nucleotide sequence, the ALT-2-01 nucleotide sequence and the ALT-3-01 nucleotide sequence had all been incorporated into the chromosomes of the detected soybean plants, and Gm cytoplasmic ALT-1-01 soybean plants, Gm chloroplastic ALT-1-01 soybean plants, Gm cytoplasmic ALT-2-01 soybean plants, Gm chloroplastic ALT-2-01 soybean plants, Gm cytoplasmic ALT-3-01 soybean plants and Gm chloroplastic ALT-3-01 soybean plants all resulted in single copy transgenic soybean plants.
Example 8. Detection of Herbicide Tolerance Effects of the Transgenic Soybean Plants
[0217] 1. Tribenuron-Methyl Tolerance
[0218] The herbicide tolerance effects of Gm cytoplasmic ALT-1-01 soybean plants, Gm chloroplastic ALT-1-01 soybean plants, Gm cytoplasmic ALT-2-01 soybean plants, Gm chloroplastic ALT-2-01 soybean plants, Gm cytoplasmic ALT-3-01 soybean plants, Gm chloroplastic ALT-3-01 soybean plants and wild-type soybean plants on tribenuron-methyl were detected (at seedling stage), respectively.
[0219] Gm cytoplasmic ALT-1-01 soybean plants, Gm chloroplastic ALT-1-01 soybean plants, Gm cytoplasmic ALT-2-01 soybean plants, Gm chloroplastic ALT-2-01 soybean plants, Gm cytoplasmic ALT-3-01 soybean plants, Gm chloroplastic ALT-3-01 soybean plants and wild-type soybean plants were respectively taken and sprayed with tribenuron-methyl (72 g ai/ha, 4-fold field concentration) and a blank solvent (water). The damage degree caused by the herbicide was measured for each plant according to the leaf curl degree and the growth point damage degree 3 days after spraying (3 DAT), 7 days after spraying (7 DAT), 14 days after spraying (14 DAT) and 21 days after spraying (21 DAT), respectively: considering conditions of leaves being flat as the untreated plants and growth points being intact as having a damage degree of 0%; considering conditions of veins being locally browned, new leaves being malformed and plant growth being slow as having a damage degree of 50%; and considering conditions of veins being purple to whole plant being dead and growth points being browned and dry as having a damage degree of 100%. There were 2 strains in Gm cytoplasmic ALT-1-01 soybean plants in total (S1 and S2), 2 strains in Gm chloroplastic ALT-1-01 soybean plants in total (S3 and S4), 2 strains in Gm cytoplasmic ALT-2-01 soybean plants in total (S5 and S6), 2 strains in Gm chloroplastic ALT-2-01 soybean plants in total (S7 and S8), 2 strains in Gm cytoplasmic ALT-3-01 soybean plants in total (S9 and S10), 2 strains in Gm chloroplastic ALT-3-01 soybean plants in total (S11 and S12), and 1 strain in wild-type soybean plants (CK1) in total; and 10-15 plants were selected from each strain and tested. The results are as shown in Table 3 and
TABLE-US-00006 TABLE 3 Experimental results of the herbicide tolerance of transgenic soybean T.sub.1 plants Average Average Average Average Soybean damage % damage % damage % damage % Treatment genotypes 3DAT 7DAT 14DAT 21DAT Blank S1 0 0 0 0 solvent S2 0 0 0 0 (water) S3 0 0 0 0 S4 0 0 0 0 S5 0 0 0 0 S6 0 0 0 0 S7 0 0 0 0 S8 0 0 0 0 S9 0 0 0 0 S10 0 0 0 0 S11 0 0 0 0 S12 0 0 0 0 CK1 0 0 0 0 72 g ai/ha S1 5 0 0 0 tribenuron- S2 4 0 0 0 methyl S3 0 0 0 0 (4x Tri.) S4 0 0 0 0 S5 6 0 0 0 S6 5 0 0 0 S7 0 0 0 0 S8 0 0 0 0 S9 5 0 0 0 S10 7 0 0 0 S11 0 0 0 0 S12 0 0 0 0 CK1 46 87 100 100
[0220] For soybean, 72 g ai/ha tribenuron-methyl herbicide is an effective dose distinguishing sensitive plants from plants having an average level of resistance. The results of Table 3 and
[0221] 2. Glyphosate Tolerance
[0222] The herbicide tolerance effects of Gm cytoplasmic ALT-1-01 soybean plants, Gm chloroplastic ALT-1-01 soybean plants, Gm cytoplasmic ALT-2-01 soybean plants, Gm chloroplastic ALT-2-01 soybean plants, Gm cytoplasmic ALT-3-01 soybean plants, Gm chloroplastic ALT-3-01 soybean plants and wild-type soybean plants on glyphosate were detected (at seedling stage), respectively.
[0223] 2 strains from Gm cytoplasmic ALT-1-01 soybean plants, Gm chloroplastic ALT-1-01 soybean plants, Gm cytoplasmic ALT-2-01 soybean plants, Gm chloroplastic ALT-2-01 soybean plants, Gm cytoplasmic ALT-3-01 soybean plants, Gm chloroplastic ALT-3-01 soybean plants and wild-type soybean plants were respectively taken each, and 10-15 plants were selected from each strain and tested. The plants above were sprayed with glyphosate (840 g ae/ha, 1-fold field concentration) and a blank solvent (water). The herbicide damage rate was measured for each plant according to the phytotoxicity symptoms 14 days after spraying (14 DAT): herbicide damage rate (%)=(number of damaged plants at the same level level number)/(total number of plantshighest level). Grading of the phytotoxicity symptoms is as shown in Table 5.
TABLE-US-00007 TABLE 5 Grading standards of the phytotoxicity degree caused by the glyphosate herbicide to soybeans Phytotoxicity level Symptom description 1 growing normally, without any damage symptoms 2 mild phytotoxicity, less than 10% of phytotoxicity 3 moderate phytotoxicity, able to recover later 4 relatively severe phytotoxicity, difficult to recover 5 severe phytotoxicity, unable to recover
[0224] The results suggested that the glyphosate herbicide damage rates of Gm cytoplasmic ALT-1-01 soybean plants, Gm chloroplastic ALT-1-01 soybean plants, Gm cytoplasmic ALT-2-01 soybean plants, Gm chloroplastic ALT-2-01 soybean plants, Gm cytoplasmic ALT-3-01 soybean plants and Gm chloroplastic ALT-3-01 soybean plants were substantially 0%, whereas the glyphosate herbicide damage rate of wild-type soybean plants (CK1) was up to not less than 90%; thereby, Gm cytoplasmic ALT-1-01 soybean plants, Gm chloroplastic ALT-1-01 soybean plants, Gm cytoplasmic ALT-2-01 soybean plants, Gm chloroplastic ALT-2-01 soybean plants, Gm cytoplasmic ALT-3-01 soybean plants and Gm chloroplastic ALT-3-01 soybean plants were very tolerant to the glyphosate herbicide.
Example 9. Construction of Maize Recombinant Expression Vectors
[0225] 1. Construction of Maize Recombinant Cloning Vectors Containing ALT Nucleotide Sequences
[0226] The synthetic ALT-1-02 nucleotide sequence was ligated into cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and the operational procedure was carried out according to Promega's pGEM-T vector product instructions, obtaining a recombinant cloning vector DBN05-T, the construction process of which is as shown in
[0227] According to the method in point 1 of Example 2, Escherichia coli T1 competent cells were transformed with the recombinant cloning vector DBN05-T using the heat shock method, and the plasmids in the cells were extracted through the alkaline method. After identifying the extracted plasmid by SpeI and KasI digestion, positive clones were verified by sequencing. The results showed that the inserted ALT-1-02 nucleotide sequence in the recombinant cloning vector DBN05-T was the nucleotide sequence shown as SEQ ID NO: 3 in the sequence listing, that is, the ALT-1-02 nucleotide sequence was inserted correctly.
[0228] According to the above-mentioned method for constructing the recombinant cloning vector DBN05-T, the synthetic ALT-2-02 nucleotide sequence was ligated into a cloning vector pGEM-T, obtaining a recombinant cloning vector DBN06-T, wherein ALT-2-02 was the ALT-2-02 nucleotide sequence (SEQ ID NO: 6). Enzyme digestion and sequencing verified that the ALT-2-02 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN06-T.
[0229] According to the above-mentioned method for constructing the recombinant cloning vector DBN05-T, the synthetic ALT-3-02 nucleotide sequence was ligated into a cloning vector pGEM-T, obtaining a recombinant cloning vector DBN07-T, wherein ALT-3-02 was the ALT-3-02 nucleotide sequence (SEQ ID NO: 9). Enzyme digestion and sequencing verified that the ALT-3-02 nucleotide sequence was correctly inserted into the recombinant cloning vector DBN07-T.
[0230] 2. Construction of Maize Recombinant Expression Vectors Containing ALT Nucleotide Sequences
[0231] The recombinant cloning vector DBN05-T and an expression vector DBNBC-03 (vector backbone: pCAMBIA2301 (which can be provided by the CAMBIA institution)) were digested with restriction enzymes SpeI and KasI, respectively; the excised ALT-1-02 nucleotide sequence fragment was inserted between the SpeI and KasI sites in the expression vector DBNBC-03; and it is well known to a person skilled in the art to construct a vector using conventional enzyme digestion methods, constructing a recombinant expression vector DBN100830 (located in the cytoplasm), the construction process of which is as shown
[0232] According to the method in point 2 of Example 2, Escherichia coli T1 competent cells were transformed with the recombinant expression vector DBN100830 using the heat shock method, and the plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified after digesting with restriction enzymes SpeI and KasI, and positive clones were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and KasI sites in the recombinant expression vector DBN100830 was the nucleotide sequence shown as SEQ ID NO: 3 in the sequence listing, i.e., the ALT-1-02 nucleotide sequence.
[0233] According to the above-mentioned method for constructing the recombinant expression vector DBN100830, a recombinant expression vector DBN100829 (located in the chloroplast) containing the ALT-1-02 nucleotide sequence was constructed, the vector structure of which is as shown in
[0234] According to the above-mentioned method for constructing the recombinant expression vector DBN100830, the ALT-2-02 nucleotide sequence excised by SpeI and KasI from digested recombinant cloning vector DBN06-T was inserted into the expression vector DBNBC-03, obtaining a recombinant expression vector DBN100832. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100832 contained the nucleotide sequence shown as SEQ ID NO: 6 in the sequence listing, that is, the ALT-2-02 nucleotide sequence was inserted correctly.
[0235] According to the above-mentioned method for constructing the recombinant expression vector DBN100829, the ALT-2-02 nucleotide sequence excised by SpeI and KasI from digested recombinant cloning vector DBN06-T was inserted into the expression vector DBNBC-03, obtaining a recombinant expression vector DBN100831 (containing spAtCTP2, located in the chloroplast). Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100831 contained the nucleotide sequence shown as SEQ ID NO: 6 in the sequence listing, that is, the ALT-2-02 nucleotide sequence was inserted correctly.
[0236] According to the above-mentioned method for constructing the recombinant expression vector DBN100830, the ALT-3-02 nucleotide sequence excised by SpeI and KasI from digested recombinant cloning vector DBN07-T was inserted into the expression vector DBNBC-03, obtaining a recombinant expression vector DBN100834. Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100834 contained the nucleotide sequence shown as SEQ ID NO: 9 in the sequence listing, that is, the ALT-3-02 nucleotide sequence was inserted correctly.
[0237] According to the above-mentioned method for constructing the recombinant expression vector DBN100829, the ALT-3-02 nucleotide sequence excised by SpeI and KasI from digested recombinant cloning vector DBN07-T was inserted into the expression vector DBNBC-03, obtaining a recombinant expression vector DBN100833 (containing spAtCTP2, located in the chloroplast). Enzyme digestion and sequencing verified that the nucleotide sequence in the recombinant expression vector DBN100833 contained the nucleotide sequence shown as SEQ ID NO: 9 in the sequence listing, that is, the ALT-3-02 nucleotide sequence was inserted correctly.
[0238] 3. Transformation of Agrobacterium with the Maize Recombinant Expression Vectors
[0239] Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) was transformed with the recombinant expression vectors DBN100830, DBN100829, DBN100832, DBN100831, DBN100834 and DBN100833 which had been correctly constructed using a liquid nitrogen method, with the following transformation conditions: placing 100 L of Agrobacterium LBA4404, and 3 L of plasmid DNA (recombinant expression vector) in liquid nitrogen for 10 minutes, warm water bathing at 37 C. for 10 minutes; inoculating the transformed Agrobacterium LBA4404 into an LB tube, culturing under the conditions of a temperature of 28 C. and a rotation speed of 200 rpm for 2 hours, spreading on an LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, picking out single clones for culturing and extracting the plasmids thereof, and performing enzyme digestion verification using restriction enzymes. The results showed that the structures of the recombinant expression vectors DBN100830, DBN100829, DBN100832, DBN100831, DBN100834 and DBN100833 were completely correct.
Example 10. Acquisition and Verification of Transgenic Maize Plants
[0240] According to the Agrobacterium infection method conventionally used, young embryos of a sterile culture of maize variety Zong31 (Z31) were co-cultured with the Agrobacterium in point 3 of Example 9, so as to introduce T-DNA (comprising the maize Ubiquitin1 gene promoter sequence, an ALT-1-02 nucleotide sequence, an ALT-2-02 nucleotide sequence, an ALT-3-02 nucleotide sequence, the Arabidopsis thaliana chloroplast transit peptide, the PMI gene and the tNos terminator sequence) in the recombinant expression vectors DBN100830, DBN100829, DBN100832, DBN100831, DBN100834 and DBN100833 constructed in point 2 of Example 9 into the maize chromosomes, obtaining maize plants that were transformed with the recombinant expression vector DBN100830 and had an ALT-1-02 nucleotide sequence located in the cytoplasm introduced (Zm cytoplasmic ALT-1-02) and maize plants that were transformed with the recombinant expression vector DBN100829 and had an ALT-1-02 nucleotide sequence located in the chloroplast introduced (Zm chloroplastic ALT-1-02); maize plants that were transformed with the recombinant expression vector DBN100832 and had an ALT-2-02 nucleotide sequence located in the cytoplasm introduced (Zm cytoplasmic ALT-2-02) and maize plants that were transformed with the recombinant expression vector DBN100831 and had an ALT-2-02 nucleotide sequence located in the chloroplast introduced (Zm chloroplastic ALT-2-02); maize plants that were transformed with the recombinant expression vector DBN100834 and had an ALT-3-02 nucleotide sequence located in the cytoplasm introduced (Zm cytoplasmic ALT-3-02) and maize plants that were transformed with the recombinant expression vector DBN100833 and had an ALT-3-02 nucleotide sequence located in the chloroplast introduced (Zm chloroplastic ALT-3-02); meanwhile, wild type maize plants were used as the control.
[0241] For the Agrobacterium-mediated maize transformation, briefly, immature young embryos were separated from maize, and contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the ALT-1-02 nucleotide sequence, the ALT-2-02 nucleotide sequence and the ALT-3-02 nucleotide sequence to at least one cell of one of young embryos (step 1: infection step). In this step, the young embryos were preferably immersed in an Agrobacterium suspension (OD660=0.4-0.6, an infection culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 68.5 g/L of sucrose, 36 g/L of glucose, 40 mg/L of acetosyringone (AS), and 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), pH 5.3) to initiate the inoculation. The young embryos were co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-culturing step). Preferably, the young embryos were cultured in a solid culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 20 g/L of sucrose, 10 g/L of glucose, 100 mg/L of acetosyringone (AS), 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 8 g/L of agar, pH 5.8) after the infection step. After this co-culturing stage, there can be an optional recovery step. In the recovery step, there may be at least one antibiotic (cephalosporin) known to inhibit the growth of Agrobacterium in a recovery culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 3 g/L of phytagel, pH 5.8), without the addition of a selective agent for a plant transformant (step 3: recovery step). Preferably, the young embryos were cultured in a solid culture medium with an antibiotic but without a selective agent, to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the inoculated young embryos were cultured in a culture medium containing a selective agent (mannose), and growing transformed calli were selected (step 4: selection step). Preferably, the young embryos were cultured in a screening solid culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 12.5 g/L of mannose, 1 mg/L of 2,4-dichlorphenoxyacetic acid (2,4-D), and 3 g/L of phytagel, pH 5.8) with a selective agent, resulting in selective growth of transformed cells. Then, plants were regenerated from the calli (step 5: regeneration step). Preferably, the calli grown in a culture medium containing a selective agent were cultured in solid culture media (MS differentiation culture medium and MS rooting culture medium) to regenerate plants.
[0242] Resistant calli screened out were transferred onto the MS differentiation culture medium (4.3 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 2 mg/L of 6-benzyladenine, 5 g/L of mannose, and 3 g/L of phytagel, pH 5.8), and cultured at 25 C. for differentiation. The differentiated seedlings were transferred onto the MS rooting culture medium (2.15 g/L of MS salt, MS vitamin, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of indole-3-acetic acid, and 3 g/L of phytagel, pH 5.8), cultured at 25 C. to a height of about 10 cm, and transferred to a glasshouse for culturing until fruiting. In the greenhouse, the plants were cultured at 28 C. for 16 hours, and then cultured at 20 C. for 8 hours every day.
[0243] 2. Verification of the Transgenic Maize Plants Using TaqMan
[0244] According to the method in point 2 of Example 7 for verifying the transgenic soybean plants using TaqMan, Zm cytoplasmic ALT-1-02 maize plants, Zm chloroplastic ALT-1-02 maize plants, Zm cytoplasmic ALT-2-02 maize plants, Zm chloroplastic ALT-2-02 maize plants, Zm cytoplasmic ALT-3-02 maize plants and Zm chloroplastic ALT-3-02 maize plants were detected and analyzed. The copy number of the PMI gene was detected by the Taqman probe fluorescence quantitative PCR method so as to determine the copy number of the ALT gene. Meanwhile, wild type maize plants were used as the control, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and averaged.
[0245] The following primers and probe were used to detect the PMI gene sequence:
TABLE-US-00008 primer3: GCTGTAAGAGCTTACTGAAAAAATTAACA,shownasSEQID NO:25inthesequencelisting; primer4: CGATCTGCAGGTCGACGG,shownasSEQIDNO:26inthe sequencelisting; probe2: TCTCTTGCTAAGCTGGGAGCTCGATCC,shownasSEQID NO:27inthesequencelisting.
[0246] It was further confirmed by analyzing the experimental results of the copy number of the PMI gene that the ALT-1-02 nucleotide sequence, the ALT-2-02 nucleotide sequence and the ALT-3-02 nucleotide sequence had all been incorporated into the chromosomes of the detected maize plants, and Zm cytoplasmic ALT-1-02 maize plants, Zm chloroplastic ALT-1-02 maize plants, Zm cytoplasmic ALT-2-02 maize plants, Zm chloroplastic ALT-2-02 maize plants, Zm cytoplasmic ALT-3-02 maize plants and Zm chloroplastic ALT-3-02 maize plants all resulted in single copy transgenic maize plants.
Example 11. Detection of Herbicide Tolerance Effects of the Transgenic Maize Plants
[0247] The herbicide tolerance effects of Zm cytoplasmic ALT-1-02 maize plants, Zm chloroplastic ALT-1-02 maize plants, Zm cytoplasmic ALT-2-02 maize plants, Zm chloroplastic ALT-2-02 maize plants, Zm cytoplasmic ALT-3-02 maize plants, Zm chloroplastic ALT-3-02 maize plants and wild-type maize plants on tribenuron-methyl were detected (at V3-V4 stage), respectively.
[0248] Zm cytoplasmic ALT-1-02 maize plants, Zm chloroplastic ALT-1-02 maize plants, Zm cytoplasmic ALT-2-02 maize plants, Zm chloroplastic ALT-2-02 maize plants, Zm cytoplasmic ALT-3-02 maize plants, Zm chloroplastic ALT-3-02 maize plants and wild-type maize plants were respectively taken and sprayed with tribenuron-methyl (72 g ai/ha, 4-fold field concentration) and a blank solvent (water). The damage degree caused by the herbicide was measured for each plant according to the plant growth status 3 days after spraying (3 DAT), 7 days after spraying (7 DAT), 14 days after spraying (14 DAT) and 21 days after spraying (21 DAT), respectively: considering a growth status equivalent to that of the untreated plants as having a damage degree of 0%; considering conditions of leaves being partially chlorotic and yellow but substantially not affecting the plant normal growth as having a damage degree of 50%; and considering the whole plant being purple and dying as having a damage degree of 100%. There were 2 strains in Zm cytoplasmic ALT-1-02 maize plants in total (S13 and S14), 2 strains in Zm chloroplastic ALT-1-02 maize plants in total (S15 and S16), 2 strains in Zm cytoplasmic ALT-2-02 maize plants in total (S17 and S18), 2 strains in Zm chloroplastic ALT-2-02 maize plants in total (S19 and S20), 2 strains in Zm cytoplasmic ALT-3-02 maize plants in total (S21 and S22), 2 strains in Zm chloroplastic ALT-3-02 maize plants in total (S23 and S24), and 1 strain in wild-type maize plants (CK2) in total; and 10-15 plants were selected from each strain and tested. The results are as shown in Table 4 and
TABLE-US-00009 TABLE 4 Experimental results of the herbicide tolerance of transgenic maize T.sub.1 plants Average Average Average Average Maize damage % damage % damage % damage % Treatment genotypes 3DAT 7DAT 14DAT 21DAT Blank S13 0 0 0 0 solvent S14 0 0 0 0 (water) S15 0 0 0 0 S16 0 0 0 0 S17 0 0 0 0 S18 0 0 0 0 S19 0 0 0 0 S20 0 0 0 0 S21 0 0 0 0 S22 0 0 0 0 S23 0 0 0 0 S24 0 0 0 0 CK2 0 0 0 0 72 g ai/ha S13 4 0 0 0 tribenuron- S14 5 0 0 0 methyl S15 0 0 0 0 (4x Tri.) S16 0 0 0 0 S17 6 0 0 0 S18 5 0 0 0 S19 0 0 0 0 S20 0 0 0 0 S21 3 0 0 0 S22 5 0 0 0 S23 0 0 0 0 S24 0 0 0 0 CK2 46 86 100 100
[0249] For maize, 72 g ai/ha tribenuron-methyl herbicide is an effective dose distinguishing sensitive plants from plants having an average level of resistance. The results of Table 4 and
[0250] In summary, the present invention discloses for the first time that a thifensulfuron hydrolase (ALT-1, ALT-2 and ALT-3) can show a high tolerance to a tribenuron-methyl herbicide, Arabidopsis thaliana plants, soybean plants and maize plants containing nucleotide sequences encoding the thifensulfuron hydrolase are strongly tolerant to the tribenuron-methyl herbicide and can at least tolerate 1-fold field concentration, and thus the hydrolase has broad application prospects in plants.
[0251] Finally, it should be stated that the above embodiments are merely used for illustrating rather than limiting the technical solution of the present invention; and although the present invention has been described in detail with reference to the preferred embodiments, a person skilled in the art should understand that modifications or equivalent substitutions may be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.