G PROTEINS

20190032033 ยท 2019-01-31

    Inventors

    Cpc classification

    International classification

    Abstract

    The invention provides a mutant of a parent heterotrimeric G protein alpha (G?) subunit, which mutant (i) lacks at least one helix of the helical domain of the parent G? subunit; (ii) is capable of binding to a GPCR in the absence of a heterotrimeric G protein beta (G?) subunit and a heterotrimeric G protein gamma (G?) subunit; and (iii) has an amino acid sequence that contains one or more mutations compared to the amino acid sequence of the parent heterotrimeric G? subunit, which mutations are selected from a deletion, a substitution and an insertion.

    Claims

    1. A mutant of a parent heterotrimeric G protein alpha (G?) subunit, which mutant: lacks at least one helix of the helical domain of the parent G? subunit; is capable of binding to a GPCR in the absence of a heterotrimeric G protein beta (G?) subunit and a heterotrimeric G protein gamma (G?) subunit; and has an amino acid sequence that contains one or more mutations compared to the amino acid sequence of the parent heterotrimeric G? subunit, which mutations are selected from a deletion, a substitution and an insertion; wherein binding of the mutant G? subunit to a GPCR increases the affinity of the GPCR for an agonist.

    2. The mutant G? subunit according to claim 1, wherein the mutant lacks any one or more of helices A, B, C, D, E or F of the helical domain of the parent G? subunit.

    3. The mutant G? subunit according to claim 1, wherein the mutant lacks a region of the helical domain of the parent heterotrimeric G? subunit corresponding to amino acid residues 70-193, 71-193, 85-193, or 85-199 according to the numbering of the long isoform of human G?-s subunit as set out in FIG. 1.

    4. (canceled)

    5. The mutant G? subunit according to claim 1, wherein binding of the mutant G? subunit to a GPCR activates the G? subunit.

    6. The mutant G? subunit according to claim 5, wherein activation of the G? subunit generates a G? protein signal in a cell.

    7. The mutant G? subunit according to claim 1, wherein the mutant G? subunit has increased stability under denaturing conditions compared to its parent G? subunit and/or is expressed at a higher level than its parent G? subunit, when expressed in a cell.

    8. The mutant G? subunit according to claim 1, wherein the mutant G? subunit is able to stabilize a particular conformation of the GPCR upon binding to the GPCR.

    9. The mutant G? subunit according to claim 1, wherein the mutant G? subunit is capable of binding to a nucleotide, such as a guanine nucleotide, and/or wherein the mutant G? subunit is capable of binding to a G? and/or G? subunit of a heterotrimeric G protein.

    10-117. (canceled)

    118. The mutant G? subunit according to claim 1, wherein the G? subunit is any one of a G?.sub.s, G?.sub.i/o, G?.sub.q/11, or G?.sub.12/13 subunit.

    119. The mutant G? subunit according to claim 1, wherein the switch I region of the parent heterotrimeric G protein alpha subunit is not deleted.

    120. The mutant G? subunit according to claim 1, wherein the switch I region of the parent heterotrimeric G protein alpha subunit is deleted.

    121. The mutant G? subunit according to claim 120, wherein the switch I region of the parent heterotrimeric G protein alpha subunit is replaced by a switch I region of a small GTPase.

    122. The mutant G? subunit according to claim 1, wherein the switch I region of the parent heterotrimeric G protein alpha subunit corresponds to amino acid residues 194-207 according to the numbering of the long isoform of human G?-s subunit as set out in FIG. 1.

    123. The mutant G? subunit according to claim 1, wherein the helical domain or part thereof and/or the switch I region or part thereof, of the parent heterotrimeric G protein alpha subunit is replaced by a linker sequence.

    124. The mutant G? subunit according to claim 1, wherein the region of the parent heterotrimeric G? subunit that corresponds to amino acid residues 65 to 203 according to the numbering of the long isoform of human G?-s subunit as set out in FIG. 1, is deleted.

    125. The mutant G? subunit according to claim 124, wherein the region of the parent heterotrimeric G? subunit is replaced by a linker sequence.

    126. The mutant G? subunit according to claim 1, which, when compared to the parent G? subunit, has an N-terminally truncated amino acid sequence.

    127. The mutant G? subunit according to claim 1 which, when compared to the parent G? subunit, contains one or more mutations in the switch I region.

    128. The mutant G? subunit according to claim 1, wherein the switch III region of the parent heterotrimeric G protein alpha subunit is deleted.

    129. The mutant G? subunit according to claim 128, wherein the switch III region of the parent heterotrimeric G? subunit corresponds to amino acid residues 254-263 according to the numbering of the long isoform of human G?-s subunit as set out in FIG. 1.

    130. The mutant G? subunit according to claim 1, wherein the switch II region, or part thereof, of the parent heterotrimeric G? subunit, is replaced by a linker sequence.

    131. The mutant G? subunit according to claim 1, which, when compared to the parent G? subunit, has a different amino acid at a position which corresponds to any one or more of the following positions according to the numbering of the long isoform of human G?-s subunit as set out in FIG. 1: Val 36, His 41, Ala 48, Gly 49, Glu 50, Met 60, Leu 63, Leu 197, Cys 200, Arg 201 , Phe 208, Asn 218, Gly 226, Glu 230, Ala 249, Ser 252, Leu 272, Ile 372, Val 375.

    132. The mutant G? subunit according to claim 1, wherein the mutant G? subunit has at least 20% sequence identity to the amino acid sequence of the long isoform of human G?-s subunit as set out in FIG. 1 (SEQ ID NO: 91).

    133. The mutant G? subunit according to claim 1, wherein the mutant G? subunit has at least 20% sequence identity to any of the amino acid sequences as set out in any of FIGS. 26, 29, 35, 36, 37, 38 and 40.

    134. The mutant G? subunit according to claim 1, which, when compared to the parent G? subunit, comprises one or more dominant negative mutations.

    135. The mutant G? subunit according to claim 134, which, when compared to the parent G? subunit, has one or more different amino acids within the NKXD motif.

    136. The mutant G? subunit according to claim 1, wherein the mutant lacks helices A to E or lacks helices A to F of the helical domain of the parent G? subunit.

    Description

    [0320] The invention will now be described by reference to the following figures and examples.

    [0321] FIG. 1. Alignment of the mini-Gs amino acid sequence with the human G alpha sequence. Amino acid deletions and substitutions highlighted in grey were critical for the development of a minimal GTPase domain that could function in the absence of beta and gamma subunits. The N-terminal deletion was required for crystallisation as was the deletion of the helical domain. For clarity, all numbering uses the numbers for the complete human GNASL sequence (1-394), although the mini-Gs contains only 229 amino acid residues.

    [0322] FIG. 2. Saturation binding data for ?.sub.1AR constructs. (a) The dissociation constant (K.sub.d) of .sup.3H-dihydroalprenolol (.sup.3H-DHA) binding to ?.sub.1AR-WT was 5.0?0.6 nM. (b) The Kd of .sup.3H-DHA binding to ?.sub.1AR-84 was 20?3 nM. Data represent mean?SEM of three independent experiments. Curves shown are from a representative experiment performed in duplicate.

    [0323] FIG. 3. Measuring G protein coupling to membrane-embedded ?.sub.1AR using a competitive binding assay.

    [0324] (a) For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-WT+Nb80 (Ki 5.8?0.8 nM, n=2); (ii) ?.sub.1AR-WT+Gs-Nb35 (Ki 6.8?0.6 nM, n=2); (iii) ?.sub.1AR-WT+Gs (Ki 17?2 nM, n=2); (iv) ?.sub.1AR-WT (40?0 nM, n=2).

    [0325] (b) For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-84+Gs-Nb35 (Ki 16?4 nM, n=3); (ii) ?.sub.1AR-84+Nb80 (Ki 28?1 nM, n=2); (iii) ?.sub.1AR-84+Gs -Ki 271?54 nM, n=2); (iv) ?.sub.1AR-84 (2.6?0.3 ?M, n=2).

    [0326] (c) Experiments performed at 20? C. For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-84+Mini Gs.sub.77????Nb35 (Ki 3.6?0.8 nM, n=2); (ii) ?.sub.1AR-84+Mini Gs.sub.77 (Ki 1.9?0.2 ?M, n=3); (iii) ?.sub.1AR-84 (Ki 2.6?0.3 ?M, n=15).

    [0327] (d) Experiments performed at 4? C. For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-84+Mini Gs.sub.77????Nb35 (Ki 10 nM, n=2); (ii) ?.sub.1AR-84+Mini Gs.sub.77 (Ki 117 nM, n=2); (iii) ?.sub.1AR-84 (Ki 2.1?0.2 ?M, n=12).

    [0328] FIG. 4. Crystal structure of the ?.sub.2AR-WT?Gs complex.sup.10. (a) Heterotrimeric Gs is composed of ?, ? and ? subunits and is stabilised in the GPCR-bound conformation by Nb35. (b) Only the 25 KDa G?GTPase domain from Gs forms significant interactions with ?.sub.1AR-WT.

    [0329] FIG. 5. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of mini Gs.sub.77 purification. (1) molecular weight marker, (2) mini Gs.sub.77, (3) 25 ng BSA, (4) 50 ng BSA, (5) 100 ng BSA, (6) 250 ng BSA, (7) 500 ng BSA, (8) 1 ?g BSA, (9) 2.5 ?g BSA. Mini Gs.sub.77 (indicate by the arrow) could be partially purified with a yield of approximately 200 ?g per litre of E. coli culture, and purity of approximately 10-20 percent.

    [0330] FIG. 6. Design of mutations to stabilise mini Gs. (a) Structural alignment of G?s.sup.81 (dark grey) and Arl-2.sup.98 (light grey). The G?s GTPase domain aligns to Arl-2 with an RMSD of 1.9 ?, despite sharing sequence identity of only 25 percent (determined using the Dali server.sup.19). (b) Alignment between the nucleotide-binding pocket of G?s (dark grey) and Arl-2 (light grey). Mini Gs residues that were mutated to match the corresponding residue in Arl-2 (G49D, E50N, A249D, and S252D) are shown as sticks and underlined. Residues with which the mutations potentially interact are shown as sticks. (c) Mutation of Leu-272, which is located within the ?3 helix, to aspartic acid allows potential interactions with a cluster of charged and polar residues (227-233) in the N-terminal region of switch II. (d) Alignment of G?s in its GTP-bound (dark grey) and GPCR-bound (light grey) conformations. In the GPCR-bound conformation Ile-372 (?5 helix) sterically clashes with Met-60 and His-64 (?1 helix), preventing close packing of the ?1 helix against the core of the G?GTPase domain. (e) The V375I mutation (modelled using the mutate function of PyMol) was designed to increase hydrophobic contacts between the core of the G?GTPase domain and the ?5 helix in its GPCR-bound conformation. Residues that interact with Val-375 are shown as sticks, additional contacts (less than 4.2 ?) that are predicted to be formed by the ?-carbon (*) of the isoleucine mutation are displayed as dashed lines. Figures were prepared using PyMOL (The PyMOL Molecular Graphics System, Version 1.7.4 Schr?dinger, LLC).

    [0331] FIG. 7. ?.sub.1AR-WT competitive binding assay using the agonist norepinephrine. The assay was performed under identical buffer conditions used for the thermostability assay. For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-WT+Gs-Nb35 (Ki 0.36?0.02 nM, n=2); (ii) ?.sub.1AR-WT+Nb80 (Ki 0.70?0.11 nM, n=2); (iii) ?.sub.1AR-WT (Ki 158?6 nM, n=2).

    [0332] FIG. 8. Sequence of mini Gs.sub.393. The histidine tag (HHHHHH encoded by CACCACCATCATCACCAT) is highlighted in dark grey, the TEV protease cleavage site is highlighted in light grey (ENLYFQG encoded by GAAAATCTTTATTTCCAGGGT), and the linker used to replace the G?AH domain is highlighted in grey (GGSGGSGG encoded by GGTGGGAGTGGCGGGAGCGGAGGT). Mutations are shown in bold type and underlined. This construct was cloned into the pET15b vector using Ncol (CCATGG) and Xhol (CTCGAG) restriction sites for E. coli expression. Stop codons are also highlighted (TAATAG).

    [0333] FIG. 9. Validation of mini Gs: ?.sub.1AR pharmacology and mini Gs complexes. (a-c) Measuring G protein binding to ?.sub.1AR using a competitive binding assay. (a) Receptor in membranes. For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-WT+mini Gs.sub.393 (Ki 4.1?1.1 nM, n=2); (ii) ?.sub.1AR-WT+Gs?Nb35 (Ki 6.8?0.6 nM, n=2); (iii) ?.sub.1AR-WT (Ki 40?0 nM, n=2).

    [0334] (b) Receptor in membranes. For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-84+mini Gs.sub.393 (Ki 3.6?0.0 nM, n=2); (ii) ?.sub.1AR-84 +Gs?Nb35 (Ki 16?4 nM, n=2); (iii) ?.sub.1AR-84 (Ki 2.6?0.3 ?M, n=15).

    [0335] (c) Receptor solubilised in DDM. For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-84+mini Gs.sub.393 (Ki 4.7?0.4 nM, n=2); (ii) ?.sub.1AR-84 +Gs?Nb35 (Ki 23?7 nM, n=2); (iii) ?.sub.1AR-84 (Ki 2.8?0.2 ?M, n=2). (d-f) Analytical gel filtration analysis of mini Gs complexes. (d) Mini Gs.sub.393 was purified with a yield of 100 mg per litre E. coli culture (inset), and resolved as a single peak with a retention volume of 17.2 ml by gel filtration. (e) Mini Gs.sub.399, a construct in which N-terminal residues 6-25 were replaced and the L272D mutation reversed retained its ability to bind G?.sub.1?.sub.2. An equimolar mixture of mini Gs.sub.399 and G?.sub.1?.sub.2 resolved as a single peak with a retention volume of 14.6 ml, compared with retention volumes of 15.8 ml or 16.4 ml for G?.sub.1?.sub.2 or mini Gs.sub.399, respectively. (f) Mini Gs.sub.393 was able to bind purified ?.sub.1AR-WT in LMNG detergent. An equimolar mixture of mini Gs.sub.393 and ?.sub.1AR-WT resolved as a predominant peak with a retention volume of 13.2 ml, compared with retention volumes of 13.6 ml or 17.1 ml for ?.sub.1AR-WT or mini Gs.sub.393, respectively.

    [0336] FIG. 10. Validation of mini Gs: thermostability and GTP responsiveness (a-b) Thermostability of ?.sub.1AR-WT complexes. (a) Thermostability in dodecylmaltoside. For clarity, thermostability curves are described in order from the left hand side of the graph to the right hand side of the graph (apparent Tm is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-WT (Tm 25.9?0.0? C., n=3); (ii) ?.sub.1AR-WT+Nb80 (Tm 32.0?0.0? C., n=3); (iii) ?.sub.1AR-WT+mini Gs.sub.393 (Tm 34.1?0.5? C., n=3); (iv) ?.sub.1AR-WT+Gs?Nb35 (Tm 35.8?0.1? C., n=3).

    [0337] (b) Thermostability in octylglucoside; uncoupled ?.sub.1AR-WT did not survive solubilisation in OG detergent. For clarity, thermostability curves are described in order from the left hand side of the graph to the right hand side of the graph (apparent Tm is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-WT+Gs?Nb35 (Tm 13.6?0.2? C., n=3); (ii) ?.sub.1AR-WT+Nb80 (Tm 14.3?0.2? C., n=3); (iii) ?.sub.1AR-WT+mini Gs.sub.393 (Tm 19.7?0.5? C., n=3).

    [0338] (c-d) GTP-mediated dissociation of ?.sub.1AR-84 complexes, measured by competitive binding assay in membranes. Mini Gs.sub.404, is an identical construct to mini Gs.sub.393, except the I372A and V375I mutations were reversed.

    [0339] (c) No GTP?S present in the assay. For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-84+mini Gs.sub.393 (Ki 3.6?0.0 nM, n=3); (ii) ?.sub.1AR-84+mini Gs.sub.404. (Ki 18?2 nM, n=2); (iii) ?.sub.1AR-84+Gs (Ki 271?54 nM, n=2); (iv) ?.sub.1AR-84 (Ki 2.6?0.3 ?M; n=15).

    [0340] (d) In the presence of 0.25 mM GTP?S in the assay. For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-84+mini Gs.sub.393 (Ki 5.2?0.7 nM, n=2); (ii) ?.sub.1AR-84+mini Gs.sub.404 (Ki 700?60 nM, n=2); (iii) ?.sub.1AR-84+Gs (Ki 2.7?0.1 ?M, n=2); (iv) ?.sub.1AR-84 (Ki 3.0?0.1 ?M; n=2).

    [0341] There was no statistical difference in the isoprenaline affinity of the ?.sub.1AR-WT?mini Gs.sub.393 in the presence or absence of GTP?S. Curves shown are from a representative experiment performed in duplicate.

    [0342] FIG. 11. Thermostability (apparent Tm) of ?.sub.1AR-WT complexes in DM or NG detergents. (a) Thermostability in decylmaltoside. For clarity, thermostability curves are described in order from the left hand side of the graph to the right hand side of the graph (apparent Tm is shown in parentheses, with number of independent experiments (n) also indicated): (i)?.sub.1AR-WT (Tm 20.4?0.4? C., n=3); (ii) ?.sub.1AR-WT+Nb80 (Tm 28.6?0.3? C., n=3); (iii) ?.sub.1AR-WT+mini Gs.sub.393 (Tm 30.5?0.4? C., n=3); (iv) ?.sub.1AR-WT+Gs?Nb35 (Tm 31.1?0.4? C., n=3).

    [0343] (b) Thermostability in nonylglucoside; uncoupled ?.sub.1AR-WT did not survive solubilisation in NG detergent. For clarity, thermostability curves are described in order from the left hand side of the graph to the right hand side of the graph (apparent Tm is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-WT+Nb80 (Tm 16.7?0.7? C., n=2); (ii) ?.sub.1AR-WT+Gs?Nb35 (Tm 19.0?0.2? C., n=2); (iii) ?.sub.1AR-WT+mini GS.sub.393 (Tm 24.7?0.4? C., n=2). Data represent mean?SEM of the number of independent experiments (n) indicated in the legend. Curves shown are from a representative experiment performed in duplicate.

    [0344] FIG. 12. GTP-mediated dissociation of the ?.sub.1AR-84?mini Gs.sub.391 complex in the membrane, measured by competitive binding assay. Mini Gs.sub.391 is an identical construct to mini Gs.sub.393, except the V375I mutation was reversed.

    [0345] (a) Absence of GTP?S. For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-84+mini Gs.sub.391 (Ki 3.0?0.4 nM, n=2); (ii) ?.sub.1AR-84 (Ki 2.6?0.3 ?M, n=15).

    [0346] (b) In the presence of GTP?S (0.25 mM). For clarity, curves representing the binding reactions are described in order from the left hand side of the graph to the right hand side of the graph (Ki for isoprenaline binding is shown in parentheses, with number of independent experiments (n) also indicated): (i) ?.sub.1AR-84+mini Gs.sub.391 (Ki 4.7?0.1 nM, n=2); (ii) ?.sub.1AR-84 (Ki 3.0?0.1 ?M, n=2).

    [0347] There was no statistical difference in the isoprenaline affinity of the ?.sub.1AR-WT?mini Gs.sub.391 in the presence or absence of GTP?S. Curves shown are from a representative experiment performed in duplicate.

    [0348] FIG. 13. ?.sub.1AR competitive binding curves in the presence of Nb80 or Gs. The affinity (IC50) of isoprenaline binding to different ?.sub.1AR constructs was measured in the presence of Nb80 and Gs. (A) A near wild type ?.sub.1AR construct (?6) displayed a high isoprenaline affinity (180 nM) in the absence of an intracellular binding partner (right hand curve). In the presence of Nb80 (left hand curve) the isoprenaline affinity only increased to 51 nM. (B) A minimally thermostabilised receptor construct ((384) displayed a lower isoprenaline affinity (7.1 ?M) in the absence of an intracellular binding partner (right hand curve). In the presence of Nb80 (left hand curve) the isoprenaline affinity shifted dramatically to 16 nM. (C) In the presence of non-lipidated Gs the isoprenaline affinity of f384 only increased from 6.9 ?M (right hand curve) to 1.4 ?M (left hand curve). (D) In the presence of non-lipidated Gs and Nb35 the isoprenaline affinity of ?84 shifted dramatically from 6.9 ?M (right hand curve) to 68 nM (left hand curve). Data shown are from a single representative experiment, and error bars represent the standard error between duplicate measurements.

    [0349] FIG. 14. ?.sub.1AR competitive binding curves in the presence of the GTPase domain. The affinity (IC50) of isoprenaline binding to the ?.sub.1AR was measured in the presence of the G?s GTPase domain. (A), At 20? C. the isoprenaline affinity of ?84 (middle curve) was 3.3 ?M, and did not increase (3.4 ?M) in the presence of the GTPase domain (right hand upper curve). However, a combination of the GTPase domain, ??-dimer and Nb35 induced a shift in isoprenaline affinity to 206 nM (left hand curve). (B), At 4? C. the isoprenaline affinity of ?84 (right hand curve) was 3.9 ?M, in presence of the GTPase domain (green) the affinity increased to 253 nM (left hand curve). Data shown are from a single representative experiment, and error bars represent the standard error between duplicate measurements.

    [0350] FIG. 15. Ligand binding and overall structure of mini-Gs-bound A.sub.2AR. a, Mini-G.sub.s increases the affinity of agonist binding to A.sub.2AR similar to that observed by a heterotrimeric G protein. Competition binding curves were performed by measuring the displacement of the inverse agonist .sup.3H-ZM241385 with increasing concentrations of the agonist NECA in triplicate (K.sub.i values in parentheses, see FIG. 16 for full data). For clarity, curves are described from the left hand side of the graph to the right hand side of the graph: (i) A.sub.2AR and heterotrimeric G protein with nanobody Nb35 (K.sub.i 340?70 nM);(ii) A.sub.2AR and mini-G.sub.s (K.sub.i 430?80 nM); (iii), A.sub.2AR (K.sub.i 4.6?0.3 ?M). G proteins were all added to membranes containing A.sub.2AR to give a final concentration of 25 ?M and the final concentration of NaCl was 100 mM. b, The structure of A.sub.2AR is depicted as a cartoon in light grey with mini-G.sub.s in dark grey. The agonist NECA bound to A.sub.2AR and GDP bound to mini-G.sub.s are depicted as space-filling models. Relevant secondary structural features are labelled.

    [0351] FIG. 16. Competition assays were performed on A.sub.2AR expressed in HEK293 cell membranes with the agonist NECA competing for the binding of radiolabelled inverse agonist .sup.3H-ZM241385. Experiments performed in the presence of either 100 mM KCl (a,b), 100 mM NaCl (c, d) or 500 mM NaCl (e, f) to confirm the similar behaviour of mini-Gs with heterotrimeric Gs with nanobody Nb35 for stabilisation of the complex. Results are summarised in the Table (g). Data from at least 3 independent experiments were analysed with an unpaired t-test for statistical significance.

    [0352] FIG. 17. Thermostability of detergent solubilised 3H-NECA-bound A2AR in the presence or absence of mini-Gs414. Unpurified A2AR was solubilised in detergent at the following concentrations: (a) DDM, 0.1%; (b) DM, 0.13%; (c) OG, 0.8%. Samples were heated for 30 minutes, quenched on ice and the amount of 3H-NECA bound determined. In each panel, A2AR alone is the left hand curve, whereas A2AR bound to mini Gs414 is the right hand curve. Data were analysed by non-linear and apparent Tms determined from analysis of the sigmoidal dose-response curves fitted (d).

    [0353] FIG. 18. Orthogonal views of omit map difference density for NECA in A.sub.2AR chain A (a and b), NECA in A.sub.2AR chain B (c and d) and GDP in mini-Gs chain C (e and f). The contour level is 2.5 sigma in panels a-d and 3.0 sigma in panels e and f.

    [0354] FIG. 19. Alignment of mini-Gs (chains C & D) against bovine GNAS2 (P04896) used in the ?.sub.2AR-Gs structure, with the CGN system for reference. Residues that are within 3.9 ? of either ?2AR in the Gs-?2AR complex or A2AR in the mini-Gs-A2AR complex are highlighted in grey.

    [0355] FIG. 20. Packing interactions between A.sub.2AR and mini-G.sub.s. a, Diagram of A.sub.2AR depicting its secondary structure in the A.sub.2AR-mini-G.sub.s structure. Residues shaded in light grey are disordered in either chain A and/or chain B. Disulphide bonds are depicted as black dashed lines. b, cartoon of the mini-G.sub.s topology. c, Diagram of contacts between mini-G.sub.s and A.sub.2AR, with line thickness representing the relative number of interactions between amino acid residues.

    [0356] FIG. 21. Alignment of the human ?2-adrenergic receptor (adrb2_human), human adenosine A2A receptor (AA.sub.2AR_human) with Chain A and Chain B of the crystallised A2AR-mini-Gs structure. Key Ballesteros-Weinstein numbers are shown above the sequences and mutations in the crystallised A2AR to facilitate purification and crystallization are underlined. Light grey bars indicate the positions of alpha-helices in the ?2AR-Gs structure, whereas dark grey bars represent these regions in the A2AR-miniGs structure.

    [0357] FIG. 22. Comparison of mini-G.sub.s-bound A.sub.2AR and heterotrimeric G.sub.s-bound ?.sub.2AR. a, Structural alignment of ?.sub.2AR-G.sub.s (PDB ID: 3SN6).sup.10 and A.sub.2AR-mini-G.sub.s was performed by aligning the receptors alone; A.sub.2AR, dark grey; ?.sub.2AR, light grey. The resultant relative dispositions of G?.sub.s (light grey) bound to ?.sub.2AR and mini-G.sub.s bound to A.sub.2AR (dark grey) are depicted. NECA and GDP are depicted as space-filling models. The ?-helical domain of G?.sub.s has been omitted for clarity, along with G?.sub.s-bound Nb35 and G??. b-e, detailed comparisons of hydrogen bonds (dashed lines) between the respective G proteins and receptors; receptors are in the upper parts of the panels with helices labelled H3, H5, H6, H7 and H8, with mini-G.sub.s and G?.sub.s in the bottom part of the panels with residues labelled using the CGN system. Labelling of amino acid residues shows the Ballesteros-Weinstein (B-W) numbers for the receptors and the CGN notation for G proteins. f and g, Views of the cytoplasmic surface of A.sub.2AR and ?.sub.2AR, respectively, as space-filling models with atoms making contacts with their respective G proteins in dark grey. h, Comparison of residues making contacts to G proteins in the mini-G.sub.s-A.sub.2AR complex and the G.sub.s-?.sub.2AR complex. Amino acid residues in the receptors that make contacts are in dark grey. Residues in white are those that do not make contact to the respective G protein, but the equivalent residue in the other receptor does. B-W numbers are given for residues in transmembrane a-helices, with a dash for residues in loops or H8. Amino acid residues 5.71-5.77 are disordered in the mini-G.sub.s-A.sub.2AR structure.

    [0358] FIG. 23. Alignment of mini-Gs (chain c, dark grey) bound to A2AR with the GTPase domain of G?s (light grey) bound to ?2AR. GDP bound to mini-Gs is depicted as a space filling model. The ?5 helix that interacts with the receptors is labelled.

    [0359] FIG. 24. Conformational changes in A.sub.2AR upon G protein binding. A.sub.2AR (dark grey) bound to mini-G.sub.s was aligned with A.sub.2AR in the active-intermediate conformation (light grey) bound to either NECA (PDB code 2YDV).sup.1 or UK432097 (PDB code 3QAK).sup.4 to highlight structural changes upon G protein binding. Neither structure was used for both comparisons because the large extensions of the ligand UK432097 compared to NECA distorts the extracellular surface in comparison to the NECA-bound structure and the NECA-bound structure contains a thermostabilising mutation in the intracellular half of the receptor. a, Alignment with 2YDV and the extracellular half of the receptor is viewed parallel to the membrane plane. b, Alignment with 3QAK and viewed from the cytoplasmic surface with mini-G.sub.s removed for clarity. c, Alignment with 3QAK viewed parallel to the membrane. Transmembrane ?-helices in A.sub.2AR are labelled H3, H5, H6, H7 and the mini-Gs is labelled. Residues are labelled with their Ballesteros-Weinstein numbers and arrows depict the direction of movement upon mini-G.sub.s binding. Conversion of B-W and CGN numbers to amino acid residues in A.sub.2AR and mini-G.sub.s, respectively, are as follows: R.sup.3.50, Arg102; Y.sup.5.58, Tyr197; K.sup.6.29, Lys227; A.sup.3.33, Ala231 carbonyl; L.sup.6.37, Leu235; Y.sup.7.53, Tyr288; Y.sup.H5.23, Tyr391; L.sup.H5.25, Leu393; C-term.sup.5.24, C-terminus of mini-G.sub.s (Leu394).

    [0360] FIG. 25. Human paralogue reference alignment for common G? numbering system.sup.103. a, Reference alignment of all canonical human G? paralogues. The domain (D), consensus secondary structure (S) and position in the SSE of the human reference alignment (P) are shown on top of the alignment. b, Reference table of the definitions of SSEs used in the CGN nomenclature.

    [0361] FIG. 26. Mini Gs amino acid and nucleotide sequences. Amino acid sequences are listed as SEQ ID Nos: 1-45, and nucleotide sequences are listed as SEQ ID Nos: 46-90.

    [0362] FIG. 27. Amino acid sequence of Galphat subunit (Chimera 6). This is a chimeric protein where residues 216-294 of bovine G?.sub.t1 have been replaced with residues 220-298 of rat G?.sub.i1. It has been crystallised in complex with ?? subunits (1GOT).

    [0363] FIG. 28. Phylogenetic relationship of human G? subunits. All the G? subunits that have been highlighted in the family-specific colours were attempted to be converted into mini-G proteins. The phylogenetic relationships were determined using TreeDyn.

    [0364] FIG. 29. Alignment of G? GTPase domain protein sequences. The amino acid sequences aligned are of the wild type GTPase domains of the G? subunits used in this study to create the initial mini-G proteins. The G?AH domain (not shown) was deleted and replaced by a linker (GGGGGGGG or GGSGGSGG in italics). To construct mini-G proteins, the residues highlighted in grey were deleted and residues in bold were mutated to the following (G?.sub.s residue number and the CGN in superscript: D49.sup.S1H1.3, N50.sup.S1H1.4, D249.sup.S4.7, D252.sup.S4H3.3, D272.sup.H3.8, A372.sup.H5.4, I375.sup.H5.7. The glycine mutation (G217D; underlined) was incorporated into G.sub.i1 only, to improve expression (see Results and Discussion). Numbering above the sequences is for G?.sub.s and the CGN system below the sequence is used for reference.

    [0365] FIG. 30. The ?.sub.1AR-mini-G.sub.s and A.sub.2AR-mini-G.sub.s complexes. (a) FSEC traces of GFP-mini-Gs with ?.sub.1AR (retention volumes are given in parentheses): GFP-mini-G.sub.s (15.1 ml); GFP-mini-G.sub.s with ?.sub.1AR bound to the inverse agonist ICI118551 (15.1 ml); GFP-mini-G.sub.s with ?.sub.1AR bond to the agonist isoprenaline (8 ml, 12.1 ml and 15.1 ml). Representative chromatograms from at least two independent experiments are shown. (b) Measurement of GFP-mini-G.sub.s affinity to DDM-solubilized ?.sub.1AR using a fluorescent saturation binding assay (FSBA); circles, ?.sub.1AR bound to the agonist isoprenaline (total binding); squares, ?.sub.1AR bound to the inverse agonist ICI118551 (non-specific binding); triangles, specific binding, with an apparent K.sub.D of 201?1 nM (mean?SEM, n=2). Curves shown are from a representative experiment. (c) FSEC traces of GFP-mini-G.sub.s with DDM-solubilised A.sub.2AR (retention volumes are given in parentheses): GFP-mini-G.sub.s (15.1 ml); GFP-mini-G.sub.s with A.sub.2AR bound to the inverse agonist ZM241385 (15.1 ml); GFP-mini-G.sub.s with A.sub.2AR bound to the agonist NECA (12.5 ml and 15.1 ml). Representative chromatograms from at least two independent experiments are shown. (d) Measurement of mini-G.sub.s affinity to DDM-solubilized A.sub.2AR using FSBA: circles, A.sub.2AR bound to the agonist NECA (total binding); squares, A.sub.2AR bound to the inverse agonist ZM241385 (non-specific binding); triangles, specific binding, with an apparent K.sub.D of 428?24 nM (mean?SEM, n=2). (e) Analytical size exclusion chromatography (SEC) of mini-G.sub.s bound to purified A.sub.2AR (retention volumes are given in parentheses): A.sub.2AR-mini-G.sub.s complex, 153 kDa (13 ml); A.sub.2AR, 133 kDa (13.3 ml); mini-G.sub.s, 22 kDa (17.2 ml). Three panels to the right of the SEC traces are coomassie blue-stained SDS-PAGE gels of fractions from 3 separate SEC experiments: top panel, mini-G.sub.s; middle panel, A.sub.2AR; bottom panel, mini-G.sub.s mixed with NECA-bound A.sub.2AR (1.2:1 molar ratio).

    [0366] FIG. 31. The A.sub.2AR-mini-Golf complex. (a) Analytical SEC of mini-G.sub.olf bound to purified A.sub.2AR (retention volumes are given in parentheses): A.sub.2AR-mini-G.sub.olf complex, 153 kDa (13 ml); A.sub.2AR, 133 kDa (13.3 ml); mini-G.sub.olf, 23 kDa (17.1 ml). Three panels to the right of the SEC traces are coomassie blue-stained SDS-PAGE gels of fractions from 3 separate SEC experiments: top panel, mini-G.sub.olf; middle panel, A.sub.2AR; bottom panel, mini-G.sub.olf mixed with NECA-bound A.sub.2AR (1.2:1 molar ratio). (b) Thermostability of unpurified DM-solubilized, .sup.3H-NECA-bound A.sub.2AR. Data were analysed by nonlinear regression and apparent T.sub.m values were determined from analysis of the sigmoidal dose-response curves fitted. T.sub.m values represent mean?SEM of two independent experiments, each performed in duplicate: circles, no mini-G.sub.olf (26.9?0.3? C.); squares, mini-G.sub.olf (32.5?1? C.). Curves shown are from a representative experiment.

    [0367] FIG. 32. Thermostability assays of various complexes between mini-G.sub.s/q chimeras and GPCRs. (a) Thermostability of unpurified digitonin-solubilized, .sup.125I-AngII-bound AT.sub.1R (T.sub.m values in parentheses): circles, no mini-G.sub.s/q (22.6?0.4? C.); squares, mini-G.sub.s/q57; inverted triangles, mini-G.sub.s/q70 (30.7?1? C.); triangles, mini-G.sub.s/q71 (30.2?0.8? C.). (b) Thermostability of unpurified DDM-solubilized, .sup.3H-NTS-bound NTSR1: circles, no mini-G.sub.s/q (24.9?0.4? C.); squares, mini-G.sub.s/q57 (26.7?0.7? C.); hexagons, mini-G.sub.s/q58 (25.1?0.4? C.); inverted triangles, mini-G.sub.s/q70 (32.5?0.3? C.); diamonds, mini-G.sub.s/q71 (28.6?1.1? C.). (c) Thermostability of unpurified DM-solubilized, .sup.3H-NECA-bound A.sub.2AR: circles, no mini-G.sub.s/q (26.9?0.3? C.); squares, mini-G.sub.s/q57 (30.6?0.3? C.); hexagons, mini-Gs/q58 (26.9?0.5? C.); inverted triangles, mini-G.sub.s/q70 (27.5?0.2? C.). In all panels, data (n=3) were analysed by nonlinear regression and apparent T.sub.m values were determined from analysis of the sigmoidal dose-response curves fitted with values shown as mean?SEM. Curves shown are from a representative experiment.

    [0368] FIG. 33. The 5HT.sub.1BR-mini-G.sub.i1 complexes. (a) Mini-G.sub.i1 coupling increases agonist affinity to 5HT.sub.1BR. Competition binding curves were performed in duplicate (n=2) by measuring the displacement of the antagonist .sup.3H-GR125743 with increasing concentration of the agonist sumatriptan (K.sub.i values representing mean?SEM in parentheses): circles, 5HT.sub.1BR (K.sub.i 276?10 nM); hexagons, 5HT.sub.1BR and mini-G.sub.i1 (K.sub.i 80?13 nM); squares, 5HT.sub.1BR and mini-G.sub.s/i1 (K.sub.i 36?2 nM); triangles, 5HT.sub.1BR and mini-G.sub.i1?.sub.1?.sub.2 (K.sub.i 15?1 nM); diamonds, 5HT.sub.1BR and mini-G.sub.s/i1?.sub.1?.sub.2 (K.sub.i 7.2?0.8 nM). Error bars represent the SEM. (b) Measurement of mini-G.sub.s/i1 chimera affinity to the DDM-solubilized, donitriptan-bound 5HT.sub.1BR using FSBA: circles, 5HT.sub.1BR and GFP-mini-G.sub.s/i1 (total binding); squares, 5HT.sub.1BR and GFP-mini-G.sub.s (non-specific binding); triangles, specific binding. The apparent K.sub.D of 386?47 nM represents the mean?SEM of two independent experiments. Curves shown are from a representative experiment. (c) FSEC traces of GFP-mini-G.sub.i1 with 5HT.sub.1BR in DDM: GFP-mini-G.sub.i1 and donitriptan-bound 5HT.sub.1BR purified in DDM (13.5 ml); GFP-mini-G.sub.i1 (13.5 ml). (d) FSEC traces of GFP-mini-G.sub.i1 with 5HT.sub.1BR in LMNG: GFP-mini-G.sub.i1 and donitriptan-bound 5HT.sub.1BR purified in LMNG (12.2 ml and 14.3 ml); GFP-mini-G.sub.i1 (14.3 ml). (e) FSEC traces of GFP-mini-G.sub.s/i1 with 5HT.sub.1BR: GFP-mini-G.sub.s/il and donitriptan-bound 5HT.sub.1BR purified in DDM (13.2 ml); GFP-mini-G.sub.s/i1 (15.1 ml). (f) FSEC traces of GFP-mini-G.sub.i1?.sub.1?.sub.2 with 5HT.sub.1BR: GFP-mini-G.sub.i1?.sub.1?.sub.2 and donitriptan-bound 5HT.sub.1BR purified in LMNG (11.8 ml); GFP-mini-G.sub.i1?.sub.1?.sub.2 (14.3 ml). In panels c-f, retention volumes are given in parentheses.

    [0369] FIG. 34. The 5HT.sub.1BR?mini-G.sub.o1 complex. (a) Competition binding curves were performed on membranes in duplicate (n=2) by measuring the displacement of the antagonist .sup.3H-GR125743 with increasing concentration of the agonist sumatriptan is (apparent K.sub.i values representing mean?SEM are in parentheses): circles, 5HT.sub.1BR (K.sub.i 276?10 nM); squares, 5HT.sub.1BR and mini-G.sub.o1 (K.sub.i 32?3 nM). Error bars represent SEM. (b) Measurement of GFP-mini-G.sub.o1 affinity to DDM-solubilized, donitriptan-bound 5HT.sub.1BR using the FSBA: circles, 5HT.sub.1BR and GFP-mini-G.sub.o1 (total binding); squares, 5HT.sub.1BR and GFP-mini-G.sub.s (non-specific binding); triangles, specific binding. The apparent K.sub.D value (184?24 nM) represents mean?SEM of two independent experiments. Curves shown are from a representative experiment. (c) FSEC traces of GFP-mini-G.sub.o1 with DDM-solubilized unpurified 5HT.sub.1BR bound to the following (retention volumes are shown in parentheses): the antagonist SB224289 (14.9 ml); the agonist donitriptan (11.3 ml and 14.9 ml). Free GFP-mini-G.sub.o1 resolved as a predominant peak with a retention volume of 14.9 ml. (d) Mini-G.sub.o1 forms a complex with purified 5HT.sub.1BR. The three panels are coomassie blue-stained SDS-PAGE gels of fractions from 3 separate SEC experiments: top panel, mini-G.sub.o1; middle panel, 5HT.sub.1BR; bottom panel, mini-G.sub.o1 mixed with donitriptan-bound 5HT.sub.1BR (1:1 molar ratio). (e) FSEC traces of GFP-mini-G.sub.o1 with purified 5HT.sub.1BR: GFP-mini-G.sub.o1 with 5HT.sub.1BR purified in DDM (13 ml); GFP-mini-G.sub.o1 (14.8 ml). (f) FSEC traces of GFP-mini-G.sub.s with purified 5HT.sub.1BR: GFP-mini-G.sub.s with 5HT.sub.1BR purified in DDM (negative control; 15.1 ml); GFP-mini-G.sub.s (15.1 ml). Retention volumes are shown in parentheses.

    [0370] FIG. 35. Sequence of mini-G proteins used in this study. The poly-histidine tag is underlined with a dotted line, the TEV protease cleavage site is highlighted in grey, and the linker used to replace the G?AH domain is in italics. Mutations are shown in bold type and underlined.

    [0371] FIG. 36. Sequence of mini-G proteins that were not successfully expressed in E. coli. The poly-histidine tag is underlined with dotted line, the TEV site is highlighted in grey and the linker used to replace the G?AH domain is in italics. Mutations are shown in bold type and underlined. The constructs were cloned into plasmid pET15b for E. coli expression using Ncol and Xhol restriction sites.

    [0372] FIG. 37. Sequence of GFP-mini-G proteins used in this study: GFP (double underlined) was fused to the N-terminus of the mini-G proteins with a GGGGS linker (italics). The poly-histidine tag is underlined with a dotted line, the TEV cleavage site highlighted in grey and the linker used to replace the G?AH domain is in italics (GGSGGSGG or GGGGGGGG).

    [0373] FIG. 38. Sequence alignment of selected mini-G.sub.s/q chimeras used in this study. Residues in bold are the signature mutations of a mini-G protein. Residues in grey are those found in G.sub.q. Diamonds above the sequences identify the amino acid residues in G?.sub.s where the side chains that make atomic contacts to residues in either ?.sub.2AR ((?2 con) or A.sub.2AR (2A con). Ovals above the sequences identify the amino acid residues in G?.sub.s where only the main chain atoms make contacts to the receptor.

    [0374] FIG. 39. Analytical SEC and SDS-PAGE analyses of purified A.sub.2AR with mini-Gs/q chimeras. Analytical SEC of mini-G.sub.s/q57 (a), mini-G.sub.s/q58 (b) and mini-G.sub.s/q70 (c) bound to purified A.sub.2AR: A.sub.2AR-mini-G.sub.s/q complex; A.sub.2AR; mini-G.sub.s/q. Three panels below the SEC traces are coomassie blue-stained SDS-PAGE gels of fractions from 3 separate SEC experiments: top panel, mini-G.sub.s/q; middle panel, A.sub.2AR; bottom panel, NECA-bound A.sub.2AR mixed with mini-G.sub.s/q (1:1.2 molar ratio).

    [0375] FIG. 40. Sequence alignment of the different mini-G.sub.81 and mini-G.sub.o1 proteins used in this study. Residues in bold are the signature mutations of a mini-G protein. Note the additional G217D mutation (bold; residue 114 in the mini-G protein) in mini-G.sub.i1 to improve expression. Residues in mini-G.sub.s were mutated to their equivalent in mini-G.sub.s/i1 or mini-G.sub.o1 (single underline or double underline, respectively) to make the mini-G.sub.s/i1 or mini-G.sub.s/o1 chimeras. Note the re-insertion of the N-terminus (highlighted in grey) in the constructs that were used to form a heterotrimer with ?.sub.1?.sub.2 (i.e. mini-G.sub.i1.sub._46; mini-G.sub.s/i1 .sub._43 and mini-G.sub.s/o1.sub._16).

    [0376] FIG. 41. Stability of GLP1R in agonist conformation in the presence of mini-Gs. Mini-Gs increase the stability of GLP1R in the presence of mini-Gs. GLP1R Tm is 14.7? C., GLP1R plus mini-Gs Tm is 19.3? C.

    EXAMPLE 1

    Engineering a Minimal G Protein to Facilitate Crystallisation of G Protein Coupled Receptors in their Active Conformation

    [0377] Introduction

    [0378] G protein coupled receptors (GPCRs) modulate cytoplasmic signalling pathways in response to stimuli such as hormones and neurotransmitters. Structure determination of GPCRs in all activation states is vital to elucidate the precise mechanism of signal transduction. However, due to their inherent instability, crystallisation of GPCRG protein complexes has proved particularly challenging. Here, we describe the design of a minimal G protein, which is composed solely of the GTPase domain from the adenylate cyclase stimulating G protein (Gs). Mini Gs is a small, soluble protein, which efficiently couples GPCRs in the absence of G?? subunits. We engineered mini Gs to form a stable complex with the ?1 adrenergic receptor (? 1AR), even when solubilised in short chain detergents. Mini G proteins induce similar pharmacological and structural changes in GPCRs as heterotrimeric G proteins. They are therefore novel tools, which will facilitate high throughput structure determination of GPCRs in their active conformation.

    [0379] Results

    [0380] Developing a Sensitive Assay to Detect Gs Coupling to ?1AR

    [0381] We developed a sensitive competitive binding assay, which could detect the interaction of different binding partners with ?.sub.1AR, by measuring the response in agonist binding affinity. The binding partners used during this work were: Nb80.sup.38, a Nanobody that binds ?.sub.2AR and induces a comparable shift in agonist affinity to lipidated Gs; Nb35.sup.40, a Nanobody that stabilises Gs in its GPCR-bound conformation; non-lipidated Gs (G?s?.sub.1?.sub.2); and non-lipidated G?? (G?.sub.1?.sub.2). The concentration of binding proteins used in the assays was standardised to 25 ?M, which is approximately 30-fold above the equilibrium dissociation constant (K.sub.D) for Nb80 binding to ?.sub.1AR.sup.96. No affinity data was available for Gs, however we anticipated this concentration to be at least 10-fold above K.sub.D.

    [0382] A heterologous competitive binding assay was used to measure competition between the antagonist .sup.3H-dihydroalprenolol (.sup.3H-DHA) and the agonist isoprenaline. Inhibition constant (K.sub.i) values were calculated using the dissociation constant (K.sub.d) of .sup.3H-DHA derived from saturation binding experiments (see FIG. 2). First, a wild type-like turkey ?.sub.1AR construct.sup.97 (?.sub.1AR-WT) was assayed (see Table 1). This construct had an isoprenaline K.sub.i of 40?0 nM in the absence of binding partner. The K.sub.i shifted to: 5.8?0.8 nM (6.9-fold), 17?2 nM (2.4-fold), or 6.8?0.6 nM (5.9-fold) in response to Nb80, Gs, or Gs?Nb35, respectively (FIG. 3a). The shift in agonist affinity was relatively small for ?.sub.1AR-WT, therefore, we next tested a minimally thermostabilised construct (?.sub.1AR-84), which contained some of the previously described mutations.sup.3,96 (see Table 1). This construct had a significantly lower isoprenaline K.sub.i in its uncoupled state (2.6?0.3 ?M), but produced a larger shift than ?.sub.1AR-WT in response to binding partners. Coupling to Nb80, Gs, or Gs?Nb35 shifted the K.sub.i to 28?1 nM (93-fold), 271?54 nM (9.6-fold), or 16?4 nM (163-fold), respectively (FIG. 3b). The competitive binding curves fitted best to single-site binding parameters. Therefore, the partial shift in agonist affinity observed for some binding partners (such as Gs) most likely reflects incomplete stabilisation of the high-affinity agonist-bound state, rather than indicating partial coupling or mixed receptor populations. These results demonstrated that non-lipidated Gs was able to couple ?.sub.1AR, but that Nb35 was required to stabilise the complex and elucidate an equal response in agonist binding affinity to Nb80. The competitive binding assay using ?.sub.1AR-84 was more sensitive than ?.sub.1AR-WT, and thus useful to distinguish small differences in the ability of different binding partners to stabilise the high-affinity agonist-bound state.

    [0383] Isolation of the G?s G?GTPase Domain and Measuring Binding to ?.sub.1AR-84

    [0384] The structure of the ?.sub.2AR?Gs complex.sup.10 revealed that only the G?GTPase domain from Gs forms significant interactions with the receptor (see FIG. 4). We isolated the GTPase domain at the genetic level by replacing the sequence corresponding to G?AH with a short glycine linker (see Table 2). This construct, which we named mini Gs.sub.77, was poorly expressed in E. coli and could not be purified to homogeneity, indicating that it was very unstable. Nonetheless, a small amount of protein (approximately 200 ?g/L culture) could be prepared at approximately 10-20 percent purity (see FIG. 5). The G?GTPase and G?AH domains from G?s have previously been expressed as independent proteins in order to determine their role in guanine nucleotide binding and hydrolysis.sup.41, but their ability to couple GPCRs has never been investigated. We tested the ability of mini Gs.sub.77 to couple ?.sub.1AR-84 in our competitive binding assay at 20? C., in either the presence or absence of G???Nb35. No significant shift in the agonist binding affinity of ?.sub.1AR-84 (2.6?0.3 ?M) was observed in the presence of mini Gs.sub.77 (1.9?0.2 ?M), but mini Gs.sub.77?G???Nb35 induced a shift to 3.6?0.8 nM (718-fold) (FIG. 3c). This demonstrated that the partially purified G?GTPase domain was functional, but also suggested that it was unable to couple ?.sub.1AR-84 in the absence of G?? subunits. However, when we repeated the assay at 4? C., we observed a significant shift in agonist K.sub.i from 2.1?0.2 ?M for the uncoupled receptor (at 4? C.) to 99?12 nM (21-fold) in response to mini Gs.sub.77 (FIG. 3d). This was a critical result because it demonstrated that the isolated G?GTPase domain could bind ?.sub.1AR-84 in the absence of G?? subunits. It also suggested that thermostability was the limiting factor in its ability to stabilise the high-affinity agonist-bound state of the receptor.

    [0385] Thermostabilisation of the ?.sub.1AR?Mini Gs Complex

    [0386] We thermostabilised mini Gs in complex with ?.sub.1AR. Mutants were screened using our competitive binding assay at both 4? C. and 20? C. Due to the low, and variable expression level of the mutants, it was impossible to standardize the concentration used in the assays. Instead, the total mini Gs purified from 1 L of E. coil culture was used per competition curve (Table 3). Approximately 100 mutants were tested during the initial screen. Mutations that shifted the agonist affinity of ?.sub.1AR-84 more than 2-fold compared to the parental mini Gs construct (mini Gs.sub.77) at either temperature were classed as positive. A total of 14 positive mutations, covering 11 unique positions were identified (Table 3).

    [0387] A new parental construct (mini Gs.sub.161), which contained a modified N-terminus and linker region (see Table 2), was used to combine mutations. Positive mutations were combined with one of the best mutations from the first round of screening (A249D), and their stability in complex with ?.sub.1AR-WT was tested using a thermostability assay in n-dodecyl-?-D-maltopyranoside (DDM) detergent. The agonist .sup.3H-norepinephrine (.sup.3H-NE) was used in the Tm assay, however due to the high background signal associated with this ligand, a maximum concentration of 200 nM could be used in the assay. This was approximately equal to the K.sub.i of uncoupled ?.sub.1AR-WT, but approximately 250-fold above K.sub.i of ?.sub.1AR-WT complexed with Nb80 or Gs?Nb35 (see FIG. 7). Therefore, Tm values quoted for uncoupled ?.sub.1AR-WT are under non-saturating agonist conditions, but ?.sub.1AR-WT complexes, which have higher agonist affinity, are under agonist saturating conditions.

    [0388] The A249D mutant (mini Gs.sub.162) had an apparent Tm of 25.1? C. (Table 4), which was lower than that of uncoupled of ?.sub.1AR-WT (25.9? C.). A double mutant (mini Gs.sub.164), containing the A249D mutation and switch III deletion, increased the apparent Tm of the complex to 28.6? C. Addition of G49D, E50N, S252D and L272D mutations produced similar apparent Tm values (within 0.2? C. of the double mutant). These six mutations were utilised in the final construct, because of their positive individual effect on the agonist affinity of membrane-embedded ?AR-84 (Table 3). None of the other positive mutations from the first round of screening further increased the Tm of the complex and so were rejected. All of the combinations, except L272D, also increased the Tm of the basal GDP-bound state (Table 4), as assessed by differential scanning fluorimetry (DSF).

    [0389] Five of the six mutations, which were successfully combined, were clustered around the nucleotide-binding pocket and phosphate-binding loop (P-loop) (FIG. 6b). The A249D mutation was designed to interact with Lys-293 and S251, in order to stabilise the base of the nucleotide-binding pocket. Deletion of switch III, which is disordered in the GPCR-bound conformation, was intended to stabilise mini Gs by replacing this flexible loop with the defined secondary structure elements (? helix, 3.sub.10 helix and beta turn) found in Arl-2.sup.98. The S252D mutation was also designed to stabilise the region around switch III, through potential interactions with Arg-265. The G49D and E50N mutations, which are located in the P-loop, were designed to reduce flexibility and conformationally constrain this region, through potentially interactions with Arg-265 and Lys-293, respectively. The sixth mutation (L272D) was designed to conformationally constrain switch II, through potential interactions with a cluster of charged and polar residues (227-233) within its N-terminal region (FIG. 6c).

    [0390] Screening Mutations that Stabilise the ?.sub.1AR-WT?Mini Gs Complex in Detergent

    [0391] Mini Gs.sub.183, which contained the six stabilising mutations from the first round of screening, was unable to fully stabilise detergent-solubilised ?.sub.1AR-WT. Complexes of Nb80 or Gs?Nb35 had apparent Tm values 3.3? C. or 7.1? C. higher than mini Gs.sub.183, respectively (Table 4). Therefore, a second panel of approximately 150 mutants were designed based on the structure of Gs in its receptor-bound conformation.sup.10, using mutagenesis. These mutations were screened in a parental construct, which had a modified linker region (see Table 2). We identified four additional mutations that increased the stability of the complex in detergent (Table 4). The best mutant (I372A) increased the apparent Tm of the complex from 29.2? C. to 34.0? C. and combined additively with V375I giving a final apparent Tm of 35.0? C. This was 3.0? C. higher than Nb80 and only 0.8? C. lower than Gs?Nb35. All of the detergent stabilising mutations decreased the stability of mini Gs in the GDP-bound conformation (Table 4).

    [0392] The detergent stabilising mutations were located around the ?1??5 helix interface. Alignment of G?s in the GPCR-bound conformation.sup.10 with the GTP-bound structure.sup.81 revealed a steric clash between Ile-372 (in the ?5 helix) and residues Met-60 and His-64 (in the ?1 helix) (FIG. 6d). This clash appears to prevent close packing of the C-terminal region of the ?1 helix against the core of the G?GTPase domain, exposing the core of the protein to the solvent. The I372A mutation was designed to eliminate this clash, and facilitate better packing in this region. The V375I mutation was designed to improve packing between the ?5 helix and the core of the protein in the GPCR-bound conformation (FIG. 6e). During the course of this work the I372A mutation was also independently reported to stabilise the rhodopsin?G.sub.i1 complex.sup.92.

    [0393] Validation of Mini Gs

    [0394] The detergent stabilised construct (mini GS.sub.345) was modified for crystallography applications by changing the linker and shortening the N-terminus (see Table 2). The final stabilised construct was named mini GS.sub.393 (see FIG. 8). This construct was able to elucidate a equal or greater shift in agonist affinity than either Nb80 or Gs?Nb35 (FIG. 9a-c) for: membrane-embedded ?.sub.1AR-WT (4.1?1.1 nM compared to 5.8?0.8 nM, or 6.8?0.6 nM, respectively) membrane-embedded ?.sub.1AR-84 (3.6?0.0 nM compared to 28?1 nM, or 16?4 nM, respectively); and DDM solubilised ?.sub.1AR-84 (4.7?0.4 nM compared to 83?2 nM, or 23?7 nM, respectively). These data demonstrate that mini Gs was able to stabilise the high-affinity agonist-bound state of ?.sub.1AR as well as, or better that either Nb80 or Gs?Nb35. Furthermore, there was no significant difference between the agonist binding affinity of membrane-embedded or detergent-solubilised ?.sub.1AR-84 coupled to mini Gs.sub.393. This demonstrates that the pharmacological response of the receptor is identical in either a lipid or detergent environment.

    [0395] Mini Gs.sub.393 was highly expressed in E. coli: it could be purified with a yield of 100 mg per litre culture, and concentrated to over 100 mg/ml (FIG. 9d). Analytical gel filtration was used to demonstrate that mini Gs.sub.393 could bind purified ?.sub.1AR-WT in lauryl maltose neopentyl glycol (LMNG) detergent. A 1:1 stochiometric mixture of mini Gs.sub.393 and ?.sub.1AR-WT resolved as a predominant peak with a retention volume of 13.2 ml compared to 13.6 ml or 17.1 ml for ?.sub.1AR-WT or mini Gs.sub.393, respectively (FIG. 9e). This result clearly demonstrated that the binding assays correlated with the formation of a stable complex between the purified protein in detergent. Furthermore, mini Gs.sub.399, a construct in which N-terminal residues 6-25 were replaced and the L272D mutation reversed (see Table 2), retained its ability to form a heterotrimer with G??. A 1:1 stochiometric mixture of mini Gs.sub.399 and G?.sub.1?.sub.2 resolved as a single peak with a retention volume of 14.6 ml compared to 15.8 ml or 16.4 ml for G?? or mini Gs.sub.399, respectively (FIG. 9f). This property may be useful for applications where the larger mini Gs heterotrimer is favourable (cryo-electron microscopy), or to study the role of G?? in G protein activation.

    [0396] The stability of the ?.sub.1AR-WT?mini Gs.sub.393 complex was tested in a number of different detergents. In longer chain detergents such as DDM the ?.sub.1AR-WT?mini Gs.sub.393 complex had an apparent Tm of 34.1? C., which was 8.2? C. higher than uncoupled ?.sub.1AR-WT. In DDM mini Gs.sub.393 was slightly less stabilising (1.7? C.) than Gs?Nb35, but slightly more stabilising (2.1? C.) than Nb80 (FIG. 10a). A similar pattern was observed in n-decyl-?-D-maltopyranoside (DM), where the ?.sub.1AR-WT?mini Gs.sub.393 complex had an apparent Tm of 30.5? C., which was 10.1? C. higher than uncoupled ?.sub.1AR-WT. In Dm mini Gs.sub.393 was slightly less stabilising than Gs?Nb35 (0.6? C.), but slightly more stabilising than Nb80 (1.9? C.) (see FIG. 11a). In short-chain detergents, such as n-octyl-?-D-glucopyranoside (OG), the ?.sub.1AR-WT?mini Gs.sub.393 complex had an apparent Tm of 19.7? C., which was more stabilising than either Gs?Nb35 (6.1? C.) or Nb80 (5.4? C.) (FIG. 10b). A similar pattern was observed in n-nonyl-?-D-glucopyranoside (NG), where the ?.sub.1AR-WT?mini Gs.sub.393 complex had an apparent Tm of 24.7? C., which was more stabilising than either Gs?Nb35 (5.7? C.) or Nb80 (8.0? C.) (see FIG. 11b). Uncoupled ?.sub.1AR-WT was completely inactivated after solubilisation in either NG or OG, demonstrating the considerable degree of thermostability imparted to the receptor by mini Gs.sub.393 coupling. NG and OG are both suitable detergents for vapour diffusion crystallisation, highlighting this a viable approach for structure determination of GPCR?mini Gs complexes.

    [0397] The nucleotide binding properties of the mutants were not extensively studied in this work, but one interesting observation was made: ?.sub.1AR-84 complexes involving mini Gs.sub.393 were completely resistant to GTP-mediated dissociation (FIGS. 10c and 10d). GTP?S was added to the competitive binding assay (after complex formation) at a concentration of 0.25 mM, which is within the physiological range of GTP in normal human cells.sup.99. Uncoupled ?.sub.1AR-84 had an isoprenaline K.sub.i of 3.0?0.1 ?M in the presence of GTP?S. Treatment of the complex with GTP?S fully reversed the shift in agonist binding affinity induced by Gs from 271?54 nM to 2.7?0.1 ?M (FIG. 10c). The shift in agonist binding affinity induced by mini Gs.sub.404 (an identical construct to mini Gs.sub.393, except that the I372A and V375I mutations were reversed) (see Table 2) was almost fully reversed by GTP?S (from 18?2 nM to 700?60 nM). However, there was no significant difference in the agonist binding affinity of the ?.sub.1AR-WT?mini Gs.sub.393 complex in either the presence or absence of GTP?S (3.6?0.0 nM compared to 5.2?0.7 nM). This unresponsiveness to GTP?S was traced to the I372A mutation, with mini Gs.sub.389 (an identical construct to mini Gs.sub.393, except that the V375I mutation was reversed) (see Table 2), behaving in almost identical fashion to mini Gs.sub.393 (see FIG. 12). Therefore, the I372A mutation appears to uncouple occupancy of the nucleotide-binding pocket from GPCR binding (see discussion). This is an interesting finding, because it may allow the formation of stable GPCR?mini Gs complexes in living cells. Combined with the thermostabilising effect of mini Gs.sub.393 coupling on GPCRs, this may allow solubilisation and purification of GPCRs that are too unstable to purify using traditional techniques.

    [0398] Discussion

    [0399] Several novel approaches have been developed to stabilise and crystallise GPCRs in active-like conformations, these include complexation with: G protein-derived peptides.sup.36,37, G protein-mimicking nanobodies.sup.38,100,101, and nanobody-stabilised heterotrimeric G proteins.sup.10. However, these approaches are not ideal: the G protein-derived peptides do not appear to induce the same conformational changes in the receptor as the heterotrimeric G protein; the G protein-mimicking nanobodies cannot recreate the native GPCR?G protein interface; and the heterotrimeric G protein complexes are large, dynamic, and unstable in detergent, making them particularly challenging targets for crystallisation. Therefore, we designed a minimal G protein, which was amenable to high throughput crystallisation of native-like GPCR?G protein complexes. Recently, we solved the structure of mini Gs in complex with the wild type human adenosine A.sub.2a receptor at 3.4 ? resolution (see Example 4). The molecular organisation of the A.sub.2a complex is remarkably similar to that of the ?.sub.2AR?Gs complex.sup.10, strongly suggesting that it is an accurate reflection of the native signalling complex.

    [0400] The G protein engineering work has also provided unique insight into the mechanism of G protein activation. We identified a steric clash between the ?1 and ?5 helices in the receptor-bound conformation, which appears to prevent close packing of the ?1 helix against the core of the G?GTPase domain (FIG. 6d). It has previously been suggested that allosteric destabilisation of the ?1 helix by GPCRs may be a key event in opening of the G?GTPase?G?AH domain interface and destabilisation of the nucleotide-binding pocket.sup.89,90,92. We demonstrated that mutation of Ile-372 to alanine, which was predicted to eliminate the steric clash between the ?1 and ?5 helices, almost completely inhibited GTP-mediated dissociation of complex. These data indicate that Ile-372 acts as a key relay between the GPCR-binding site and the nucleotide-binding pocket, and that its mutation effectively uncouples GPCR binding from nucleotide occupancy. The identification of Ile-372 as a key residue in signal transduction also demonstrates the versatility of mini G proteins, particularly minimally stabilised variants, for studying the mechanisms of G protein activation.

    [0401] Mini G proteins are novel tool, which have many potential applications, including: characterisation of receptor pharmacology, binding kinetic studies, thermostabilisation of GPCR in their active conformation, drug discovery, and crystallisation of native-like GPCR-G protein complexes. Furthermore, all of the mutations reported here are located within conserved regions of the G? subunit. Therefore, the concept is believed to be transferable to all classes of heterotrimeric G protein, which would allow the production of a panel of mini G proteins capable of coupling any GPCR.

    [0402] Materials and Methods

    [0403] Cloning Details of all constructs used in this work are provided in Tables 1 and 2. Site directed mutagenesis was performed using the Quick Change protocol (Stratagene). Insertions and deletions were performed using a modified version of a previously described method.sup.102.

    [0404] Baculovirus expression of G proteins G protein genes were cloned into the transfer vector pBacPAK8 (Clontech), and baculoviruses were prepared using the flashBAC ULTRA system (Oxford Expression Technologies). Trichopulsia ni cells (Expression Systems) were grown in ESF921 serum-free media (Expression Systems) in 5 L Optimum growth flasks (Thompson Instrument Company). Immediately before infection, heat inactivated foetal bovine serum (Sigma) was added to a final concentration of 5%. Cells were infected with third passage virus at a final concentration of 3%. In the case of co-infection with multiple viruses (for heterotrimeric Gs or G??) each virus was added to a final concentration of 3%. The final volume of culture was 3 L per flask and the final cell density was 3?10.sup.6 cells/ml. Cells were harvested 48 h post-infection by centrifugation at 5000 g for 5 mins, flash-frozen in liquid nitrogen and stored at ?80? C.

    [0405] Purification of non-lipidated G?s The cell pellet from 6 L of insect cell culture was resuspended to 400 ml in buffer A (30 mM TRIS, pH 8.0, 100 mM NaCl, 5 mM MgCl.sub.2, 5 mM imidazole, 50 ?M GDP). PMSF (1 mM), Pepstatin-A (2.5 ?M), Leupeptin (10 ?M), Complete protease tablets (Roche), DNase 1 (50 ?g/ml), and DTT (100 ?M) were added. Cells were broken by sonication (10 minutes at 70% amplitude) and clarified by centrifugation (38,000 g for 1 h). The supernatant was loaded onto a 5 ml Ni Sepharose FF column (GE Healthcare) at 5 ml/min. The column was washed sequentially with 25 ml buffer A, 50 ml buffer B (20 mM TRIS, pH 8.0, 300 mM NaCl, 10 mM imidazole, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP), and 25 ml buffer C (20 mM TRIS, pH 8.0, 300 mM NaCl, 30 mM imidazole, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP) at 5 ml/min. The column was eluted with 25 ml buffer D (20 mM TRIS, pH 9.0, 50 mM NaCl, 500 mM imidazole, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP). The eluate was diluted to 250 ml in buffer E (20 mM TRIS, pH 9.0, 50 mM NaCl, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP, 1 mM DTT) and loaded onto a 5 ml Q Sepharose HP column (GE Healthcare) at 5 ml/min. The column was washed with 50 ml buffer E and eluted with a linear gradient of 50-300 mM NaCl (in buffer E). Peak fractions were pooled and TEV protease was added to give a final ratio of 1:20 w/w (TEV: G?s). The sample was dialysed overnight against 1 L buffer F (20 mM HEPES, pH 7.5, 100 mM NaCl, 10% glycerol, 1 mM MgCl.sub.2, 10 ?M GDP). Imidazole (20 mM) and Ni-NTA resin (4 ml) were added to the sample and mixed for 1 h. The mixture was poured onto a disposable column containing 1 m Ni-NTA resin, and the flow-through collected. The column was washed with 10 ml buffer F and this wash was pooled with the flow-through. The pooled sample was concentrated to 1.5 ml using a 10 KDa MWCO Amicon Ultra centrifugal filter (Millipore). The sample was loaded onto a Superdex-200 26/600 gel filtration column (GE Healthcare), equilibrated with buffer G (10 mM HEPES, pH 7.5, 100 mM NaCl, 10% glycerol, 1 mM MgCl.sub.2, 1 ?M GDP, 0.1 mM TCEP). Peak fractions were pooled and concentrated to 50 mg/ml. The pure protein was aliquoted, flash-frozen in liquid nitrogen, and stored at ?80? C. A typical yield was 6.5 mg pure G?s per litre culture.

    [0406] Purification of non-lipidated Gs heterotrimer Purification of non-lipidated heterotrimeric Gs was performed essentially as described for non-lipidated G?s, except: the Ni Sepharose column was washed with 50 ml buffer C, instead of 25 ml; buffer D contained 300 mM imidazole, instead of 500 mM; the pH of buffers D and E was 8.5, instead of 9.0; the Q Sepharose column was eluted with a linear gradient of 50-200 mM NaCl, instead of 50-300mM; and no TEV cleavage step was performed, instead fractions from the Q Sepharose column were concentrated and loaded on the Superdex-200 column. A typical yield was 7 mg pure Gs per litre culture.

    [0407] Purification of non-lipidated G?? dimer Purification of non-lipidated G?? dimer was performed essentially as described for non-lipidated G?s, except: GDP was omitted from all buffers; MgCl.sub.2 was omitted from buffers B-G; buffers B and C contained 250 mM NaCl, instead of 300 mM; buffer D contained 25 mM NaCl, instead of 50 mM; buffer D contained 300 mM imidazole, instead of 500 mM; buffers E and F were supplemented with 1 mM EDTA; the Q Sepharose column was eluted with a linear gradient of 25-200 mM NaCl, instead of 50-300 mM; and no TEV cleavage step was performed, instead fractions from the Q Sepharose column were concentrated and loaded on the Superdex-200 column. A typical yield was 7.5 mg pure G?? per litre culture.

    [0408] Expression and purification of Nanobodies Synthetic genes (Integrated DNA Technologies) for Nb80 and Nb35 were cloned into pET26b (Novagen) for periplasmic expression in E. coli strain BL21(DE3)RIL (Agilent Technologies). Cells were lysed by sonication (10 mins at 70% amplitude). Nb80 was purified by IMAC and gel filtration, with a typical yield of 12 mg pure protein per litre culture. Nb35 was purified by IMAC, cation exchange chromatography and gel filtration, with a typical yield of 26 mg pure protein per litre culture.

    [0409] Expression and purification of mini G proteins (for screening) Mini G protein mutants were cloned in pET15b (Novagen). Expression was performed in E. coli strain BL21(DE3)RIL. Cells were grown in 2TY media supplemented with glucose (0.1%). Cultures were induced with IPTG (100 ?M) at 15? C. for 20 h. Cells were lysed by sonication (2 mins at 70% amplitude). Mutants were partially purified by IMAC. Imidazole was removed on a PD10 column (GE Healthcare), and samples were concentrated to 20 mg/ml. The partially pure protein was aliquoted, flash-frozen in liquid nitrogen, and stored at ?80? C.

    [0410] Expression and purification of mini G proteins (final protocol) BL21(DE3)RIL cells transformed with the mini G protein construct were grown in TB media supplemented with glucose (0.2%) and MgSO.sub.4 (5 mM) and antifoam (0.01%). Cells were cultured in 2 L baffled flasks (Simax), shaking at 140 rpm. Cultures were grown at 30? C. until an OD.sub.600 of 0.8 was reached. Expression was induced with IPTG (50 ?M) and the temperature reduced to 25? C. Cells were harvested 20 h post-induction by centrifugation at 5000 g for 10 mins, flash-frozen in liquid nitrogen and stored at ?80? C.

    [0411] The cell pellet from 1 L of culture was resuspended to 200 ml in buffer A (40 mM HEPES, pH 7.5, 100 mM NaCl, 10% glycerol, 10 mM imidazole, 5 mM MgCl.sub.2, 50 ?M GDP). PMSF (1 mM), Pepstatin-A (2.5 ?M), Leupeptin (10 ?M), Complete protease tablets, DNase I (50 ?g/ml), and DTT (100 ?M) were added. Cells were broken by sonication (10 minutes at 70% amplitude) and clarified by centrifugation (38,000 g for 45 mins). The supernatant was loaded onto a 10 ml Ni Sepharose FF column at 5 ml/min. The column was washed with 100 ml buffer H (20 mM HEPES, pH 7.5, 500 mM NaCl, 40 mM imidazole, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP) at 5 ml/min. The column was eluted with 30 ml buffer I (20 mM HEPES, pH 7.5, 100 mM NaCl, 500 mM imidazole, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP). TEV protease was added to give a final ratio of 1:20 w/w (TEV: G?s). DTT (1 mM) was added and the sample was dialysed overnight against 2 L buffer J (20 mM HEPES, pH 7.5, 100 mM NaCl, 10% glycerol, 1 mM MgCl.sub.2, 10 ?M GDP). Imidazole (20 mM) and Ni-NTA resin (4 ml) were added to the sample and mixed for 1 h. The mixture was poured onto a disposable column containing 1m Ni-NTA resin, and the flow-through collected. The column was washed with 10 ml buffer F and this wash was pooled with the flow-through. The pooled sample was concentrated to 1.5 ml and loaded onto a Superdex-200 26/600 gel filtration column, equilibrated with buffer K (10 mM HEPES, pH 7.5, 100 mM NaCl, 10% glycerol, 1 mM MgCl.sub.2, 1?M GDP, 0.1 mM TCEP). Peak fractions were pooled and concentrated to 100 mg/ml. The pure protein was aliquoted, flash-frozen in liquid nitrogen, and stored at ?80? C. A typical yield was 100 mg pure protein per litre culture.

    [0412] Saturation binding assay Insect cells expressing ?.sub.1AR were resuspended in 1 ml of assay buffer (20 mM HEPES, pH 7.5, 100 mM NaCl), supplemented with Complete EDTA-free protease inhibitors (Roche). Cells were broken by 10 passages through a bent 26 G needle. Cell debris was removed by centrifugation (3000 g for 5 mins at 4? C.). The supernatant was diluted and 2?0.96 ml aliquots taken for each sample. Alprenolol (120 ?l) was added to the negative sample (1 mM final concentration) and assay buffer (120 ?l) was added to the positive sample. Samples were aliquoted (12?108 ?l) into a PCR plate. [.sup.3H]-dihydroalprenolol (12 ?l) was added to each well (to give final concentrations in the range: 2.5 nM -2.56 ?M). Samples were mixed and incubated at 20? C. for 2 h. Samples (2?50 ?l duplicates) were vacuum filtered through 96-well glass fibre filter plates (Merck Millipore), pre-soaked with PEI (0.1%). Each well was washed with assay buffer (3?200 ?l). Filters were dried, punched into scintillation vials and 4 ml Ultima Gold scintillant (Perkin Elmer) was added. Radioactivity was quantified by scintillation counting (1 min per sample) using a Tri-Carb counter (Perkin Elmer). Data for negative samples were subtracted from positive samples. Data were plotted graphically (Prism) and K.sub.d values derived from one site saturation binding analysis.

    [0413] Competitive binding assay Insect cells expressing ?.sub.1AR were resuspended in 1 ml of assay buffer (25 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM MgCl.sub.2, 1 mM ascorbate), supplemented with Complete EDTA-free protease inhibitors (Roche). Cells were broken by 10 passages through a bent 26 G needle. Cell debris was removed by centrifugation (3000 g for 5 mins at 4? C.). The supernatant was diluted and a single 1.68 ml aliquot taken for each sample. Binding partner (240 ?l) was added (25 ?M final concentration). The mixture was aliquoted (17?96 into a 0.2 ml PCR plate at 20? C. Isoprenaline (12 ?l), prepared in buffer containing 1 U/ml apyrase (Sigma-Aldrich), was added to each well (final concentrations in the range: 1 pM-10 mM). Alprenolol (12 ?l) was added to the negative sample (100 ?M final concentration). Samples were mixed and incubated at 20? C. for 1.5 h. [.sup.3H]-dihydroalprenolol (12 ?l) was added to each well (5 nM or 20 nM final concentrations for ?.sub.1AR-WT or ?.sub.1AR-84, respectively). Samples were mixed and incubated at 20? C. for 1.5 h. Samples (2?50 ?l duplicates) were vacuum filtered exactly as described in the saturation binding assay protocol. Data were plotted graphically and K.sub.i values derived from one site fit K.sub.i analysis.

    [0414] Competitive binding assays using detergent-solubilised ?.sub.1AR-84 were performed using a similar protocol, except: all steps were performed at 4? C.; membranes were solubilised with DDM (0.1% final concentration) for 30 minutes, prior to addition of binding partner; separation of bound from free ligand (by gel filtration) was performed exactly as described in the thermostability assay protocol.

    [0415] Thermostability measurement of ?.sub.1AR-WT?mini Gs complexes Insect cells expressing wild type ?.sub.1AR-WT were resuspended in 1 ml of assay buffer (25 mM HEPES, pH 7.5, 400 mM NaCl, 1 mM MgCl.sub.2, 1 mM ascorbate, 0.1% BSA, 0.004% bacitracin), supplemented with Complete EDTA-free protease inhibitors (Roche). Cells were broken by 10 passages through a bent 26 G needle. Cell debris was removed by centrifugation (3000 g for 5 mins at 4? C.). The supernatant was diluted and 2?0.78 ml aliquots taken for each sample. Norepinephrine (120 ?l) was added to the negative sample (200 ?M final concentration) and assay buffer (120 ?l) was added to the positive sample. Binding partner (120 ?l) was added to both samples (25 ?M final concentration). .sup.3H-norepinephrine (120 ?l), prepared in buffer containing 1 U/ml apyrase (Sigma-Aldrich), was added to both samples (200 nM final concentration). Samples were mixed and incubated at 4? C. for 1 h. Detergent (60 ?l) was added to both samples (final concentration: DDM=0.1%; DM=0.13%; OG=0.8%). Samples were mixed and incubated on ice for 1 h. Insoluble material was removed by centrifugation (17000 g for 5 mins at 4? C.). The supernatant was aliquoted (9?120 ?l) into 0.2 ml PCR tubes. Each sample was heated to the desired temperature (between 4 and 50? C.) for exactly 30 minutes, followed by quenching on ice for 30 minutes. Samples (2?50 ?l duplicates) were applied to Toyopearl HW-40F resin, which was pre-equilibrated (25 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM MgCl.sub.2, 0.025% DDM) and packed (225 ?l bed volume) in 96-well filter plates (Merck Millipore). Plates were centrifuged (1800 rpm for 5 mins at 4? C.). The filtrate was transferred to Isoplates (Perkin Elmer), and 200 ?l Optiphase Supermix scintillant (Perkin Elmer) was added to each well. Radioactivity was quantified by scintillation counting (1 min per well) using a MicroBeta counter (Perkin Elmer). Data for negative samples were subtracted from positive samples. Data were plotted graphically and apparent melting temperature (Tm) values derived from sigmoidal dose-response (variable slope) analysis.

    [0416] Thermostability measurement of GDP-bound mini Gs mutants by differential scanning fluorimetry (DSF) Mini Gs mutants (30 ?g) were diluted to 135 ?l with assay buffer (10 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM MgCl.sub.2, 1 mM GDP, 2 mM DTT). SYPRO-orange (15 ?l) was added from a 20? stock solution to give a final concentration of 2?. Samples were mixed and 2?50 ?l aliquots (duplicates) were transferred to 0.2 ml PCR tubes (Qiagen). Thermostability measurements were performed using a Rotor-Gene Q (Qiagen). Samples were equilibrated for 90 s at 25? C. before ramping from 25 to 99? C. at 4 s/? C. The melting temperature (Tm), corresponding to the inflection point of the curve, was derived from analysis using the Rotor-Gene Q software. Tm values were calculated as the mean?SEM from three independent experiments.

    [0417] Gel filtration analysis of mini G protein complexes Mini Gs??? complexes were prepared using mini Gs.sub.399: a construct in which N-terminal residues 6-25 were replaced and the L272D mutation was reversed (see Table 2). Purified mini Gs.sub.399 was mixed with non-lipidated G?.sub.1?.sub.2 subunits in an equimolar ratio (6.7 nmol each), diluted to 200 ?l with buffer L (10 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM MgCl.sub.2, 1 ?M GDP, 0.1 mM TCEP) and incubated on ice for 4 hours. The entire sample (200 ?l) was loaded onto a Superdex-200 10/300 gel filtration column, equilibrated with buffer L.

    [0418] The ?.sub.1AR?mini Gs complex was prepared using wild type ?.sub.1AR-WT purified in LMNG detergent. Purified ?.sub.1AR-WT and mini Gs were mixed in an equimolar ratio (3.3 nmol each), diluted to 200 ?l with buffer M (10 mM HEPES, pH 7.5, 100 mM NaCl, 10% glycerol, 1 mM MgCl.sub.2, 1 ?M ascorbic acid, 1 ?M isoprenaline, 0.002% LMNG) and incubated on ice for 4 hours. The entire sample (200 ?l) was loaded onto a Superdex-200 10/300 gel filtration column, equilibrated with buffer M.

    EXAMPLE 2

    Development of an Assay to Detect Coupling of Non-Lipidated Gs to the ?.SUB.1.AR

    [0419] Introduction

    [0420] A myriad of structural and biophysical data has provided clues as to why obtaining a high-resolution structure of a G proteinGPCR complex has proved difficult: flexibility within the nucleotide-free G protein appears to be the main problem.sup.7, 24, 42, 61. We have engineered a minimal GPCR-binding protein that still couples to a GPCR but removes much of the flexibility that has made crystallisation of the complex so difficult. First, we developed an assay capable of detecting coupling of non-lipidated Gs to the ?.sub.1AR. Next, we expressed the isolated GTPase domain from G?s and demonstrated that it was able to couple ?.sub.1AR even in the absence of the ?? dimer. However, production of the GTPase domain was difficult due to poor expression and severe thermal instability. Therefore, we performed mutagenic screens and identified mutations that improved both the expression and stability of the isolated GTPase domain, whilst retaining the basic guanine nucleotide binding properties and functionality of the protein. The mutations we discovered are well conserved amongst the heterotrimeric G proteins, and are anticipated to transfer to members of all four classes of a subunits. Therefore, this approach can be used to produce a repertoire of GTPase domains capable of coupling almost all GPCRs. Herein, we describe the design of Minimal, Engineered, G protein Alpha (MEGA) domains, which couple activated GPCRs and induce the core pharmacological and conformational changes associated with the high-affinity agonist-bound state.

    [0421] Results

    [0422] Development of an Assay to Detect Coupling of Non-Lipidated Gs to the ?.sub.2AR

    [0423] We have developed a competitive binding assay capable of detecting coupling of purified, non-lipidated Gs (see Experimental Procedures) to cell membranes containing the ?.sub.1AR receptor. Initially, we screened different ?.sub.1AR constructs in order to identify receptors that displayed a large increase in agonist affinity in response to Nb80.sup.38 binding. A near wild-type ?.sub.1AR construct ?36) had a relatively high affinity for isoprenaline (approximately 180 nM), which only increased 3.5 fold in response to Nb80 binding (FIG. 13a). However, a series of minimally thermostabilised receptors displayed a much larger shift in response to Nb80 binding. One of these constructs (?84), which contained four thermostabilising mutations (see Experimental Procedures), was chosen to further characterize Nb80 and Gs coupling. ?84 had a much lower affinity for isoprenaline (approximately 7.1 ?M), but displayed a more significant shift upon Nb80 binding, resulting in an affinity of approximately 16 nM (FIG. 13b). However, Gs coupling resulted in only a small shift in agonist affinity, from approximately 6.9 ?M to 1.4 ?M (FIG. 13c). Therefore, we hypothesised that addition of Nb35, which was used to facilitate crystallisation of the ?.sub.2AR?Gs complex.sup.7, may stabilise the complex, and produce a larger shift in agonist affinity. Here, we observed a shift in isoprenaline affinity from approximately 6.9 ?M to 68 nM (FIG. 13d), similar to that obtained with Nb80.

    [0424] Expression and Characterization of the Isolated GTPase Domain of G?s

    [0425] A large number of constructs were tested to find the best method of isolating the GTPase domain from G?s. This process essentially involved deletion of the helical domain from its position within the switch I region. The strategies evaluated were: (1) deletion of the helical domain and any associated regions (residues 57-207) that were disordered in the crystal structure of the ?.sub.2AR?Gs complex.sup.7; (2) deletion of the helical domain (residues 70-193), and linking the resulting termini with a short glycine linker to retain a near native switch I region; (3) deletion of the helical domain and switch I (residues 65-203), and linking the resulting termini with a longer glycine linker; (4) deletion of the helical domain and switch I (residues 67-205), and insertion of the switch I region from structurally related small GTPases. A number of variations of each strategy were tested, thus residue ranges quoted are approximations. We found that strategy (1) removed regions of the GTPase domain vital for its stability in the absence of the receptor, and was therefore unsuitable. Strategies 2-4 were all successful, and resulted in expression of a small amount of isolated GTPase domain in E. coli (approximately 100 ?g/L culture). The expression level between different constructs was variable, but difficult to quantify. Generally, complete removal of the helical domain and switch I (strategy 3) resulted the highest expression levels.

    [0426] The isolated GTPase domain was partially purified from E. coli, and its ability to couple the ?.sub.1AR was determined using the agonist-shift assay described above. First, we tested coupling of the GTPase domain, but no increase in affinity was observed (FIG. 14a). Second, we tested the GTPase domain in the presence of ?? subunits and Nb35 (FIG. 14a), here a shift in affinity was observed (from approximately 3.3 ?M to 206 nM). Finally, we tested coupling of the GTPase domain at 4? C. (FIG. 14b), here a shift in affinity was observed (from approximately 3.9 ?M to 253 nM). This demonstrated that the isolated GTPase domain was active, and was able couple the receptor in the absence of ?? subunits. However, it indicated that the GTPase domain was thermally unstable, and would require engineering to produce a stable protein suitable for crystallisation applications.

    [0427] Stabilization of the GTPase Domain through Mutagenesis

    [0428] An initial screen of approximately 50 modifications (mutations, deletions and chimeras) was performed. The modifications were designed to: remove superfluous sequences (compared to the small GTPases), stabilise the nucleotide-binding site, constrain the conformationally dynamic switch regions, stabilise the inactive state of the G protein, or stabilise the active conformation of the G protein. No modifications were made in regions that directly interact with the receptor. The parental construct used for mutagenesis consisted of: a 20 amino acid deletion of the N-terminus, complete deletion of the helical domain, and retention of a slightly modified switch I region (see Experimental Procedures).

    [0429] Mutants were expressed in E. coli and partially purified by IMAC. In order to estimate the stabilising effect of each modification, agonist-shift assays were performed at 4 and 20? C.; a summary of the assay data is presented in Table 5. The expression levels of the mutants differed widely, thus the concentration of each mutant used in the assays could not be standardised. Instead the entire quantity of protein purified from one litre of culture was included in each assay. Importantly, the concentration of protein used in the assay does affect the magnitude of the shift in agonist affinity. Thus, the data must be interpreted as a combination of expression level and stabilising effect. Four key modifications (? switch III, A249D, L272D and H41I), which dramatically improved expression and/or stability of the isolated GTPase domain, were identified (Table 5). Both the A249D mutation and deletion of switch III resulted in significantly improved expression levels (approximately 1-2 mg/L culture); the L272D and H41I mutations did not significantly improve expression levels. All of the mutants induced a large shift in agonist affinity (10-60 nM final isoprenaline affinity) when assayed at 4? C. (Table 5). Furthermore, the A249D and ? switch III mutants induced a large shift in agonist affinity (53 and 30 nM final isoprenaline affinity respectively) when assayed at 20? C. (Table 5). The L272D and H41I mutants also induced a shift in agonist affinity (464 and 589 nM final isoprenaline affinity respectively) when assayed at 20? C. (Table 5), albeit not as large as the A249D and ? switch III mutants. However, it must be noted that the concentration of the A249D and ? switch III mutants used in the assay was approximately 5-fold higher. Four additional mutations (G49D, E5ON, G226A and S252D) that improved the stability of the GTPase domain were also identified (Table 5). However, the proximity of these mutations to the aforementioned sites indicates that their mechanism of action is likely to be similar, therefore, their additive properties must be determined empirically.

    [0430] Discussion

    [0431] The solution of high-resolution structures of GPCRs in their fully active conformation is of major importance for the design of novel agonist compounds. We have developed a unique strategy to engineer the isolated GTPase domain of G protein a subunits to couple and conformationally activate GPCRs.

    [0432] Heterotrimeric G proteins can couple GPCRs efficiently in their lipidated, membrane associated state.sup.5. MEGA domains include non-lipidated mutant G? subunits, whose mechanism of receptor binding is anticipated to be similar to that of the holoenzyme. Therefore, a prerequisite to the design of MEGA domains was the development of an assay capable of detecting coupling of non-lipidated G proteins to GPCRs. Initially, we found that non-lipidated Gs induced only a small shift in agonist affinity for a minimally thermostabilised ?.sub.1AR. However, addition of Nb35, which was used to facilitate crystallisation of the ?.sub.2AR-Gs complex.sup.7, produced a much larger response. Nb35 appears to inhibit dissociation of the G protein heterotrimer by conformationally constraining the switch II region, and stabilising the ?/? subunit interface. Nb35 is therefore likely to reduce the conformational dynamics of the GPCR-G protein ternary complex, possibly mimicking the stabilising effect of membrane anchorage, albeit through a different mechanism.

    [0433] We assessed several different strategies to isolate the GTPase domain from Gs. We found that complete removal of the helical domain and switch I resulted in slightly better expression and stability. Initially, we found that the GTPase domain induced a significant shift in agonist affinity only in the presence of ?? dimer and Nb35, suggesting that ?? subunits were still required for efficient coupling. However, we hypothesised that the ?? dimer and Nb35 may simply act to stabilise the thermally labile GTPase domain.sup.28. Therefore, we repeated the assays at 4? C., and found that the GTPase domain was capable of efficiently coupling the receptor in a ??-independent manner. GPCRs can catalyse low-level nucleotide exchange on G? subunits.sup.4, however, the ?? dimer is required to facilitate rapid exchange and thus signal amplification.sup.56,57. Deletion of the helical domain allows efficient coupling of the GTPase domain to the receptor, in a ??-independent manner. This is probably due to more rapid GDP dissociation from the GTPase domain, which results in more efficient coupling the receptor. Together, these data suggests that the mechanism of interaction between the receptor and the isolated GTPase domain is similar to that of the holoenzyme. Therefore, MEGA domains are likely to induce native-like conformational changes in the receptor, and thus represent a true mimetic of G protein coupling.

    [0434] We used mutagenesis to improve the stability and expression of the GTPase domain. A number of key mutations were identified that dramatically improved the expression level and/or stability of the GTPase domain, the mechanisms of which are discussed below. The A249D mutation improved both the expression and stability of the GTPase domain. In the small GTPases an aspartic acid is often found in this position, where it stabilises the lysine of the NKXD motif through a salt-bridge interaction. This lysine residue forms the base of the nucleotide-binding pocket and participates in a ?-cation stacking interaction with the guanine ring.sup.92. This position is not exclusively occupied by an aspartic acid in the small GTPases, however within each class it is generally conserved or non-conserved, indicating that it may be inherent to the stability of certain GTPase families. In heterotrimeric G proteins this position is occupied by either an alanine or serine residue, except G?z, where a glutamic acid residue is present. However, the lysine from the NKXD motif is stabilized through a salt-bridge interaction with an aspartic or glutamic acid from the helical domain (Asp-173 in G?s). This interaction is broken when the domain interface separates during activation.sup.7. The A249D mutation is thought to stabilise the nucleotide-binding pocket and increase the GDP binding affinity, although this has not yet been tested.

    [0435] Deletion of switch III improved both the expression and stability of the GTPase domain. In heterotrimeric G proteins switch III is involved in mediating the conformational changes induced by GTP uptake, and is required for effector binding.sup.93. In the small GTPases switch III is absent and the corresponding region consists of distinct secondary structural elements: the ?4 strand terminates in a type-I turn, which connects directly to a 3.sub.10 helical segment preceding the ?3 helix (secondary structure assignments were performed using the STRIDE web-server.sup.94,95). The improvements in stability achieved by deletion of switch III are likely to be a result of replacing a highly flexible loop with more ordered secondary structure elements. The increase in expression level is likely to result from a combination of the improved stability and a more energetically favourable folding pathway.

    [0436] The H41Imutation significantly improved the stability of the isolated GTPase domain. Histidine 41 has been reported to contribute significantly to the elevated levels of basal nucleotide exchange observed in G?s compared with Gt.sup.96. It was previously reported that mutation of histidine 41 to valine, which is found in this position in Gt, halved the level of basal nucleotide exchange of G?s.sup.96. We showed that the H41V mutation improved the stability of the MEGA domain (see Table 5), however, the H41I mutation was optimal in this position. This mutation improves the stability of the GTPase domain because it enhances the interactions between the ?5 helix and the ?N/?1 loop. Close packing in this region stabilises the ?5 helix, thus reducing the rate of GDP dissociation.sup.96.

    [0437] The L272D mutation, which is located in the ?2 helix (adjacent to switch II), significantly improved the stability of the isolated GTPase domain. Switch II changes structure dramatically between GDP and GTP-bound states.sup.97: in the GDP bound state switch II is more dynamic, and often disordered in crystal structures.sup.98; in the GTP-bound state switch II becomes highly ordered.sup.30, 99, and in Gs this region forms the main effector-binding site.sup.100 . The L272D mutation is likely to directly interact with switch II, and conformationally constrain the whole region. Intriguingly, it may form a salt bridge interaction with a highly-conserved arginine residue in switch II (Arg-231), which is ideally positioned for such an interaction in the GTP-bound state.sup.30. This is likely to improve the stability of the GTPase domain by limiting exposure of the hydrophobic residues beneath switch II to the aqueous environment.

    [0438] In summary, we have demonstrated that, despite being unstable and poorly expressed, the isolated GTPase domain from G?s can efficiently couple the ?.sub.1AR in a ??-independent manner. We have performed an extensive mutagenesis screen and identified four key mutations, which dramatically increase the expression and/or stability of the domain.

    [0439] Methods and Materials

    [0440] ?.sub.1AR constructs The ?84 construct, which was used for G protein binding assays, contained a number of modifications: an N-terminal MBP fusion protein; N-terminal truncation (residues 1-32); intracellular loop 3 deletion (residues 244-271); C-terminal truncation at residue 367; C-terminal hexa histidine-tag; a C116L mutation; an engineered disulphide bond (M40C-L103C); and four thermostabilising mutations (M90V, D322K, F327A and F338M). The receptor was expressed using the BaculoGold baculovirus expression system (BD Bioscience) in the Trichopulsia ni (High Five) cell line (Life Technologies).

    [0441] G?s GTPase domain constructs The parental GTPase domain used for the initial mutagenesis screens is described below (all numbering refers to the long isoform of G?s). The construct consisted of: an N-terminal hexa histidine-tag; N-terminal deletion (residues 1-20); helical domain deletion (residues 71-193), leaving a near native switch I intact, and linking the termini with a Gly.sub.2 linker; and two mutations in switch I region (L197A and C200S), to remove unfavorable surface residues exposed by removal of the helical domain.

    [0442] Expression and purification of heterotrimeric Gs Non-lipidated heterotrimeric Gs used in this study was composed of: human G?s (long-form: including the variably spliced region in linker-1), which contained a four amino acid deletion of the N-terminus to remove all potential palmitoylation sites.sup.101; human G?1 (containing an N-terminal hexa histidine-tag); and human G?2 containing a C68S mutation to remove the prenylation site.sup.102. Baculovirus constructs encoding each individual subunit were constructed using the flashBAC ULTRA system (Oxford Expression Technologies). The Gs heterotrimer was expressed in Spodoptera frugiperda (SF9) cells grown in TNM-FH media (Sigma) containing 10% foetal calf serum (Gibco) and 1% lipids (BD Bioscience). Cells were infected using P3 virus at concentration of 2% for each subunit, in a 1:1:1 ratio. Cells were incubated for 48 hours at 27? C. Cells were harvested by centrifugation at 4000 g for 10 minutes and washed with of PBS (15% of culture volume). The cell pellet was flash frozen in liquid nitrogen and stored at ?80? C.

    [0443] The cell pellet from three litres of culture was resuspended in 150 ml of lysis buffer (30 mM Tris, 100 mM NaCl, 10% glycerol, 5 mM MgCl.sub.2, 100 ?M GDP, 0.5 mM PMSF, 2.5 ?M Pepstatin-A, 10 ?M Leupeptin, 50 ?g/ml DNasel, 50 ?g/ml RNaseA, pH 8.0) containing Complete EDTA-free protease inhibitors, and DTT was added to a final concentration of 0.1 mM. The cells were broken by sonication, and insoluble material removed by centrifugation at 38000 g for 40 minutes. The supernatant was filtered (0.45 ?M) and loaded onto a 5 ml Ni-Sepharose fast flow HisTrap column (GE Healthcare) at 5 ml/min. The column was washed with ten column volumes of lysis buffer, followed by ten column volumes of wash buffer (20 mM Tris, 250 mM NaCl, 5 mM imidazole, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP, pH 8.0) at 5 ml/min. The column was eluted with 25 ml elution buffer (20 mM Tris, 50 mM NaCl, 200 mM imidazole, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP, pH 8.3) at 2 ml/min. The eluent was diluted with 225 ml of Q buffer (20 mM Tris, 50 mM NaCl, 10% glycerol, 0.5 mM MgCl.sub.2, 50 ?M GDP, 1 mM DTT, pH 8.3). The mixture was loaded directly onto a 5 ml Q-Sepharose HP HiTrap column (GE Healthcare) at 5 ml/min. The column was washed with ten column volumes of Q buffer at 5 ml/min. Gs was eluted with a linear NaCl gradient from 50 mM to 250 mM (Q buffer containing 250 mM NaCl) over 40 column volumes at 2 ml/min. Fractions containing Gs were pooled and concentrated to 5-10 mg/ml using a 10 KDa cut off Amicon Ultra concentrator (Millipore). Concentrated Gs was loaded onto a Superdex-200 (16/60) gel filtration column (GE Healthcare) equilibrated with GF buffer (20 mM Tris, 100 mM NaCl, 10% glycerol, 0.2 mM MgCl.sub.2, 2 ?M GDP, 0.1 mM TCEP, pH 8.0) at 1 ml/min. Fractions containing pure Gs were pooled, concentrated to 10 mg/ml, flash frozen in liquid nitrogen and stored at ?80? C. The typical yield was 1-2 mg of pure Gs per litre of culture.

    [0444] Expression and purification of Nb35 The Nb35.sup.10 gene was synthesised (Integrated DNA Technologies) and cloned into the pET26b vector (Merck). Nb35 was expressed in BL21(DE3)-RIL cells (Merck). Cultures were grown in terrific broth media, supplemented with glucose (0.1%) and MgSO.sub.4 (2 mM), to an OD.sub.600 nm of 0.8 at 37? C. Expression was induced with IPTG (50 ?M), at 28? C. for approximately 18 hours. Cells were harvested by centrifugation at 4000 g, and stored at ?80? C.

    [0445] The cell pellet from six litres of culture was resuspended in 200 ml of lysis buffer (40 mM Hepes, 100 mM NaCl, 5 mM imidazole, 5 mM MgCl.sub.2, 1 mM PMSF, 100 ?g/ml lysozyme, 50 ?g/ml DNaseA, pH 7.5) containing Complete EDTA-free protease inhibitors. The cells were incubate on ice for 30 minutes, then broken by sonication, and insoluble material removed by centrifugation at 38000 g for 30 minutes. The supernatant was filtered (0.45 ?M) and loaded onto a 5 ml Ni-Sepharose fast flow HisTrap column (GE Healthcare) at 5 ml/min. The column was washed with 15 column volumes of wash buffer (20mM Hepes, 300 mM NaCl, 40 mM imidazole, pH 7.5) at 5 ml/min. The column was eluted with 25 ml elution buffer (20 mM Hepes, 500 mM imidazole, pH 7.0) at 2 ml/min. The eluent was diluted with 225 ml of SP buffer (20 mM Hepes, pH 7.0), and loaded directly onto a 5 ml SP-Sepharose HP HiTrap column (GE Healthcare) at 5 ml/min. The column was washed with ten column volumes of SP buffer at 5 ml/min. Nb35 was eluted with a linear NaCl gradient from 0 mM to 250 mM (SP buffer containing 250 mM NaCl) over 40 column volumes at 2 ml/min. Fractions containing Nb35 were pooled and dialysed against 500 ml of GF buffer (20 mM Tris, 100 mM NaCl, 10% glycerol, pH 7.5) overnight, with two external buffer changes. Nb35 was concentrated to 20 mg/ml using a 3 KDa cut off Amicon Ultra concentrator (Millipore). Concentrated Nb35 was loaded onto a Superdex-200 (16/60) gel filtration column (GE Healthcare) equilibrated with GF buffer at 1 ml/min. Fractions containing pure Nb35 were pooled, concentrated to 20 mg/ml, flash frozen in liquid nitrogen and stored at ?80? C. The typical yield was 5 mg of pure Nb35 per litre of culture.

    [0446] Partial purification of G?s GTPase domains for use in agonist-shift assays GTPase domains were expressed in BL21(DE3)-RIL cells. Cultures were grown in 2TY media, supplemented with glucose (0.1%), to an OD.sub.600 nm of 0.5-0.8 at 25? C. Expression was induced with IPTG (100 ?M), at 15? C. for approximately 16 hours. Cells were harvested by centrifugation at 4000 g, and stored at ?80? C.

    [0447] The cell pellet from two litres of culture was resuspended in 22 ml of lysis buffer (30 mM Tris, 100 mM NaCl, 10 mM imidazole, 20% glycerol, 5 mM MgCl.sub.2, 3 mM ATP, 100 ?M GDP, 0.5 mM PMSF, 2.5 ?M Pepstatin-A, 10 ?M Leupeptin, 50 ?g/ml lysozyme, 20 ?g/ml DNasel, pH 7.5) containing Complete EDTA-free protease inhibitors. DTT (0.1 mM) was added and the cells were incubated on ice for 30 minutes. The cells were broken by sonication, and insoluble material removed by centrifugation at 50000 g for 40 minutes. The supernatant was filtered (0.45 ?M), 1 ml Ni-Sepharose fast flow resin (GE Healthcare) was added, and the suspension was mixed at 4? C. for 1.5 hours. The mixture was poured into an empty PD10 column (GE Healthcare) and washed with 20 ml of wash buffer (20 mM Tris, 300 mM NaCl, 40 mM imidazole, 20% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP, pH 7.5). The column was eluted with 2.5 ml elution buffer (20 mM Tris, 100 mM NaCl, 400 mM imidazole, 20% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP, pH 7.5). The partially purified protein was desalted into GF buffer (20 mM Tris, 100 mM NaCl, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP, 0.1 mM DTT, pH 7.5) using a PD10 column (GE Healthcare). The desalted protein was concentrated to a final volume of 400 ?L using a 10 KDa cut off Amicon Ultra concentrator (Millipore). The concentrated protein was flash frozen in liquid nitrogen and stored at ?80? C.

    [0448] Agonist-shift assay The cell pellet from approximately 2 ml of High Five culture expressing the ?84 receptor construct was resuspended in 1 ml of lysis buffer (20 mM Tris, 100 mM NaCl, 1 mM MgCl.sub.2, 1 mM ascorbic acid, pH 7.5) containing Complete EDTA-free protease inhibitors (Roche). Cells were lysed by 10 passages through a bent 26 G needle, and insoluble material removed by centrifugation (5 mins at 3000 g). The supernatant, containing crude membrane fractions, was diluted to 8 ml in lysis buffer (0.8 ml per competition curve required). G protein, MEGA domain, Nb80 or buffer (200 ?l was added to the crude membranes (0.8 ml), and homogenised by 3 passages through a bent 26 G needle. The final concentration of G protein or Nb80 used in the assay was approximately 1 mg/ml; the final concentration of MEGA domains used depended on their expression levels. Nine aliquots (88 ?l each) were transferred to a 96-well PCR plate (on ice). Isoprenaline (11 ?l) was added to seven samples to give final competitive ligand concentration curve of 1?10.sup.?3-1?10.sup.?9 M; isoprenaline dilutions were prepared in lysis buffer containing 1 U/ml apyrase (Sigma). Buffer (11 ?l) was added to one of the remaining samples to determine total signal, and alprenolol (11 ?l ) was added to the final sample to determine background signal (100 ?M final concentration). Samples were incubated at 4? C. for 2 hours (or at 20? C. for 1 hour). .sup.3H-dihydroalprenolol (Perkin Elmer) was added to each well (11 ?l) to give a final concentration of 10 nM (?Kd of ?84). Samples were incubated at 4? C. for 2 hours (or at 20? C. for 1 hour). Samples were filtered on 96-well GF/B filter plates (Millipore), pre-soaked in lysis buffer containing 0.1% PEI. Plates were washed three times (200 ?l) with ice-cold wash buffer (20 mM Tris, 100 mM NaCl, 1 mM MgCl.sub.2, pH 7.5). Plates were dried and filters punched out into scintillation vials. Scintillant (4 ml) was added, samples were incubated overnight and then tritium was counted in a liquid scintillation counter (Beckmann Coulter). Data were analysed using the one sitefit logIC50 function of Prism (GraphPad).

    EXAMPLE 3

    Applications

    [0449] MEGA domains have a wide range of applications in the design of therapeutics to modulate GPCR and G protein activity.

    [0450] Stabilisation of GPCRS During Purification

    [0451] GPCRs are conformationally dynamic, which contributes to their poor thermostability in detergent.sup.69. MEGA domains are likely to conformationally and thermally stabilise GPCR, and will therefore improve the efficiency of purification procedures.

    [0452] Thermostabilisation of GPCRS in their Fully Active Conformation

    [0453] MEGA domains are likely to significantly improve the thermostability of their bound GPCR. However, further dramatic improvements in stability may be achieved through mutagenic thermostabilisation of the receptor.sup.88 whilst in complex with the MEGA domain. The resulting MEGA-StaR complex will be highly stable, and suitable for even the most demanding applications. Furthermore, GPCRs thermostabilised in this manner may adopt a fully active conformation even in the absence of the MEGA domain or ligand, providing a unique opportunity for drug design.

    [0454] Structure Determination of GPCRS in their Fully Active Conformation

    [0455] The stabilising properties of MEGA domains will permit high-resolution structure determination of the high-affinity agonist-bound state of GPCRs, using both x-ray crystallography and NMR.

    [0456] Fragment Library Screening Against Activated GPCRs

    [0457] MEGA domains may also be a valuable tool for fragment library screening using both structural and non-structural methods. There is strong evidence to suggest that once the ternary G protein-GPCR complex is formed the ligand can be removed from the binding pocket without causing dissociation of the complex: hydroxylamine treatment of the nucleotide-free rhodopsin-transducin complex causes hydrolysis of the Schiff base bond between rhodopsin and retinal, resulting in the release of retinaloxime.sup.14. However, this causes neither dissociation of the complex, or decay of the Meta-II photochemical state into inactive opsin, furthermore the chromaphore site appears to remain in its open conformation.sup.14. Therefore it may be possible to produce a ligand-free MEGA-GPCR complex in which the empty ligand-binding pocket maintains the high-affinity agonist-bound conformation. Ligand-free complexes represent an ideal substrate for fragment library screening using biophysical methods or crystal soaking techniques. These complexes will also be of significant importance for the design of agonists to target orphan receptors.

    [0458] Screening Compounds that Block Specific G Protein-GPCR Interfaces

    [0459] The ligand-binding pocket and extracellular surface of GPCRs are the main targets exploited in drug design, however, downstream signalling proteins also have significant therapeutic potential. Several peptides and small molecules that modulate G protein a subunits have been reportee.sup.70-72. Although these molecules generally target a single class of G protein, the promiscuous nature of the G protein signalling means they are unlikely to be suitable for therapeutic applications. Structures of MEGA-GPCR complexes will allow the design of small molecules that target a specific G protein-receptor interface. Thus, signalling through a specific G protein-receptor pair could be inhibited, whilst retaining the activity of both the receptor and G protein in other signalling cascades.

    [0460] Development of Cell-Based Assays

    [0461] Due to their monomeric nature, MEGA domains will be useful in the development of fluorescent assays to study receptor/G protein coupling in vivo.

    [0462] Understanding the Molecular Mechanisms of Receptor Specificity

    [0463] MEGA domains may also allow us to determine the molecular mechanisms of receptor specificity beyond the G?-GPCR interface. MEGA domains can be reconstituted with different combinations of ?? subunits, these GPCR-MEGA-?? complexes may be more amenable to crystallisation than the full G protein-GPCR complexes. Therefore, the interactions between C-terminus of the receptor and the fay subunits can be studied. This may allow design of allosteric modulators that can target specific GPCR-G protein complexes, based on the ?? components of the G protein heterotrimer.

    [0464] Mega Domains as Therapeutic Agents

    [0465] MEGA domains can be engineered to sequester GPCRs, ?? subunits or downstream effectors. These dominant negative mutants may themselves be valuable therapeutic agents, for example in cancer therapy.

    EXAMPLE 4

    Structure of the Adenosine A.SUB.2A .Receptor Bound to an Engineered G Protein

    [0466] Introduction

    [0467] G protein-coupled receptors (GPCRs) are essential components of the chemical intercellular signalling network throughout the body. To understand the molecular mechanism of signalling, structures are necessary of receptors in both an inactive conformation and in an active conformation coupled to a heterotrimeric G protein. Here we report the first structure of the adenosine A.sub.2A receptor (A.sub.2AR) bound to a highly engineered G protein, mini-Gs, to 3.4 ? resolution. Mini-Gs binds to A.sub.2AR through an extensive interface (1048 ?.sup.105) that is similar, but not identical, to the interface between the 132-adrenergic receptor and G.sub.s. The structure of A.sub.2A R bound to mini-Gs identifies key amino acid residues involved in the transition of the receptor from an agonist-bound active-intermediate state to the fully active G protein bound state. The structure highlights both the diversity and similarity in GPCR-G protein coupling and hints at the potential complexity of the molecular basis for G protein specificity.

    [0468] Adenosine is a signalling molecule that activates four different adenosine receptors in humans, A.sub.1, A.sub.2A, A.sub.2B and A.sub.3, and has been implicated in a wide range of physiological processes including angiogenesis, immune function and sleep regulation (reviewed in .sup.104,105). In addition, there is strong evidence that high concentrations of extracellular adenosine is deleterious to cell health and contributes to pathological effects observed in neurodegenerative diseases, inflammatory disorders, cancer and ischaemia-reperfusion injury (reviewed in .sup.106). There is thus considerable interest in the development of subtype specific agonists and antagonists to the adenosine receptors. Over the last 40 years a wide range of compounds have been developed by traditional medicinal chemistry.sup.105,107 and, more recently, structure based drug design has been implemented to develop novel antagonists of the adenosine A.sub.2A receptor (A.sub.2AR) for the potential treatment of Parkinson's disease.sup.108. An agonist targeting A.sub.2AR (regadenoson) is approved by the FDA for myocardial perfusion imaging.sup.107 and agonists specific for A.sub.3R are under development for their anti-cancer and anti-inflammatory properties.sup.109.

    [0469] Comparison of the structures of A.sub.2AR bound to either inverse agonists.sup.110-112 or agonists.sup.1,4,113 elucidated molecular determinants of subtype specificity and efficacyl.sup.14. However, the mechanism of activation of the receptor to allow coupling to G proteins and the basis of G protein selectivity is not fully understood. Structures of A.sub.2AR in the inactive state have been determined bound either to the antagonists ZM241385.sup.110-112, XAC.sup.110, caffeine.sup.110 or 1,2,4-triazines.sup.108, and all the structures are very similar. An intramembrane Na.sup.+ ion that can act as an allosteric antagonist was identified in the highest resolution structure (1.8 ?).sup.115, and a homologous Na.sup.+ ion has been subsequently identified in other high-resolution structures of GPCRs.sup.96,116,117. Four agonist-bound structures of A.sub.2AR have also been determined after co-crystallisation with either adenosine, NECA.sup.1, CGS21680.sup.113 or UK432097.sup.4. All the structures are very similar and are thought to represent an active-intermediate conformation of the receptor, but not the fully active receptor that binds a G protein.sup.1. Observations that support this conclusion include the presence of key rotamer changes of conserved amino acid residues associated with activation of other GPCRs, but the absence of a significant movement of the cytoplasmic end of transmembrane helix 6 (H6) away from the receptor core.sup.114. The G protein-coupled state of A.sub.2AR exhibits higher affinity binding of agonists compared to the uncoupled state.sup.118, but it is unclear whether the agonist bound structures determined so far depict the binding pocket in a high affinity or low affinity conformation. In contrast to A.sub.2AR, crystallisation of either ?.sub.1AR or ?.sub.2AR bound to agonists resulted in structures of the inactive conformation that differ only subtly from structures bound to antagonists.sup.2,3. It is now apparent that ?.sub.2AR exists in an ensemble of conformations whether bound to antagonists, agonists or to no ligand at all, and the presence of agonists increases the probability of formation of the active state.sup.119. The activated state is then stabilised by the binding of a G protein.sup.10 or by a G protein mimetic (nanobody).sup.38. Therefore, in order to elucidate the structure of the activated state of A.sub.2AR, we have determined its structure bound to an engineered G protein.

    [0470] Results

    [0471] Structure of G protein-Bound A.sub.2AR.

    [0472] There is a single reported structure of a GPCR bound to a heterotrimeric G protein, namely G.sub.S-bound ?.sub.2AR.sup.10. The crystallisation was a real tour de force, requiring the development of a specific nanobody, Nb35, to stabilise the G??? trimer by binding at the interface between G? and G?, fusion of T4-lysozyme to the N-terminus of ?.sub.2AR, the use of a novel mono-olein derivative MAG 7:7 for crystallisation in meso and a complex procedure for purification and crystallisation. The ?.sub.2AR-G.sub.S structure.sup.10 showed that virtually all the contacts between the receptor and G protein were made to the G? subunit and therefore, in theory, G?? was unnecessary for complex formation. We therefore adopted an alternative approach, engineering the G?.sub.S subunit to make it more amenable for the formation of well-ordered crystals, which in principle should allow the crystallisation of any G.sub.S coupled receptor in the activated state.sup.120. We developed a minimal G protein, mini-G.sub.S, that comprised a truncated form of the GTPase domain of G?.sub.S, including 8 point mutations to stabilise the protein in the absence of G?? and in the presence of detergents.sup.120. Truncations included the switch III region, 23 amino acids from the N-terminus and the ?-helical domain, all of which would benefit crystal formation by decreasing the structural heterogeneity of the complex. Mini-Gs reproduced the increase in agonist affinity that occurred upon incubation of the receptor in the presence of the heterotrimeric G protein G.sub.S and it also showed identical sensitivity to the presence of the allosteric antagonist Na.sup.+ (FIGS. 15 and 16). In addition, mini-G.sub.Sreadily formed a complex with A.sub.2AR in the presence of the agonist NECA and the complex was considerably more thermostable than NECA-bound A.sub.2AR, particularly in short chain detergents (FIG. 17). This complex was crystallised in the detergent octylthioglucoside by vapour diffusion and a data set was collected from two crystals (see further methods). The A.sub.2AR-mini-G.sub.S structure was determined by molecular replacement using the structure of NECA-bound A.sub.2AR (PDB ID: 2YDV).sup.1 and the G?.sub.S GTPase domain from the ?.sub.2AR-G.sub.S complex (PDB ID: 3SN6).sup.10 as search models and the structure refined to 3.4 ? (Table 6).

    [0473] There are two mini-G.sub.SA.sub.2AR complexes per crystallographic asymmetric unit composed of either chains A and C (complex AC) or chains B and D (complex BD). The best electron density was observed for complex AC (chain A, A.sub.2AR; chain C, mini-G.sub.S), and included density for the agonist NECA bound to A.sub.2AR and density for a molecule of GDP bound to mini-G.sub.S (FIG. 18). Chain B (A.sub.2AR) in complex BD also contained density for NECA, but chain D (mini-G.sub.S) did not contain density corresponding to GDP. It is unclear from the structure why the two molecules of mini-G.sub.S differ in GDP occupancy, because the structures are virtually identical (rmsd 0.12 ? over 1127 atoms) and although the GDP site in chain D is in the vicinity of extracellular loop 2 of a symmetry related receptor (chain A), this loop is disordered and there is no suggestion that it would prevent nucleotide binding. The presence of GDP in the mini-G.sub.S structure is a reflection of the properties of the engineered G protein, which, after complex formation, is insensitive to GTP?S-mediated dissociation.sup.120. Thus this structure can be regarded as a complex between a GPCR and a GDP-bound G protein before GDP has dissociated. The two A.sub.2AR molecules in the asymmetric unit are also virtually identical (rmsd 0.05 ? over 1665 atoms), but differ significantly to previously determined A.sub.2AR structures due to the outward movement of the cytoplasmic end of transmembrane helix 6 (H6; discussed below). Structural alignment of complex AC with complex BD showed that mini-G.sub.S was oriented slightly differently between the receptors with a rotation of the GTPase domain by 3? relative to the receptor, and results in slightly different packing between mini-G.sub.S and A.sub.2AR (FIG. 19). While it is possible that this is due to the presence of GDP in one complex but not the other, it seems more likely that it arises from differences in lattice contacts. Even so, this may represent a natural variation in the interface between mini-G.sub.S and A.sub.2AR due to the flexible nature of the activated G protein and the receptor. All subsequent analyses will be discussed in the context of complex AC, as the electron density for this complex was better defined, especially for some of the residues involved in the interactions between mini-G.sub.S and A.sub.2AR.

    [0474] The interface between A.sub.2AR and mini-Gs in complex AC is formed between 20 amino acid residues from the receptor and 17 residues in mini-G.sub.S (FIGS. 19, 20 and 21), comprising a total buried surface area of 1048 ?.sup.105 on the receptor. It is striking that of the 20 amino acid residues in contact with mini-G.sub.S, there are 6 Arg residues, 10 hydrophobic residues and 2 Gln residues. The main areas in the receptor that contact mini-G.sub.S are found at the cytoplasmic end of H3, cytoplasmic loop 2 (CL2), the cytoplasmic end of H5, three residues in H6 and a positively charged region at the turn between H7 and H8 (FIG. 20). In mini-G.sub.S, contacts are made predominantly by the ?5 helix involving 14 amino acid residues that pack against residues in H3, CL2, H5, H6, H7 and H8 of A.sub.2AR. Additional interactions include His41.sup.S1.2 in ?-sheet S1, Val217.sup.S3.1 in S3 and Asp215.sup.S2S3.1 in the loop between S2 and S3 that make contact with residues in CL2 in A.sub.2AR (FIG. 22; superscripts refer to the CGN system for G proteins.sup.103). Amino acid residues in A.sub.2AR and mini-G.sub.s form complementary surfaces that pack together predominantly via van der Waals interactions (?90% of contacts) with 6 polar interactions across the interface. This complementarity is particularly evident in the packing of the sequence PLRY in CL2 of A.sub.2AR against residues in S1, S3, the S2-S3 loop and ?5, with Leu110 sitting in a pocket formed from His41 .sup.S1.2, Val217.sup.S3.1, Phe376.sup.5.8, Cys379.sup.H5.11and Arg380.sup.H5.12. Helix ?5 protrudes into the cleft within the cytoplasmic face of A.sub.2AR created through the outward movement of the cytoplasmic end of H6, with the apex of the ?5 helix, Tyr391.sup.H5.23, making extensive van der Waals interactions with Arg102.sup.3.50 (superscript refers to the Ballesteros-Weinstein numbering system for GPCRs.sup.121) that forms the whole upper surface of the cleft (FIG. 22). The overall orientation of the ?5 helix may also be facilitated by the favourable helix dipoles between H8 of the receptor and ?5, which form a nearly contiguous kinked helix.

    [0475] Comparison of the Receptor-G Protein Interface in ?.sub.2AR-Gs and A.sub.2AR-mini-Gs Structures

    [0476] Superposition of the receptors in the A.sub.2AR-mini-G.sub.S complex and the ?.sub.2AR-G.sub.S complex.sup.10 shows that the receptors have very similar architectures (rmsd 1.7 ? over 1239 atoms), with the majority of the differences occurring in the extracellular region where the amino acid sequences are the most divergent (FIG. 22). In contrast, the intracellular faces of the receptors align very well, including the large outward shift of the cytoplasmic end of H6. However, mini-G.sub.S does not superimpose exactly on the G? subunit of the heterotrimeric G protein bound to ?.sub.2AR (FIG. 22), with a difference in orientation of ?15?, although the difference is smaller)(?10? for the ?5 helix. This is a consequence of the different amino acid residues in A.sub.2AR compared to ?.sub.2AR (FIGS. 18 and 22), which results in a slightly different packing of the G proteins to the receptors. However, alignment of mini-Gs with G?s bound to ?.sub.2AR shows that they are essentially identical (rmsd 0.92 ? over 1158 atoms), with the most significant difference being an 8? tilt between the respective ?5 helices, resulting in a 3.7 ? displacement of the C? of Tyr391 in mini-Gs away from the core of the G protein (FIG. 23). Strikingly, the most significant difference between the mini-G.sub.S-A.sub.2AR interface compared to the Gs-?.sub.2AR interface also occurs in this region as a result of the different amino acid sequences at the H7-H8 boundary. In A.sub.2AR, H7 terminates with Arg291.sup.7.56 and forms the sequence R.sup.7.56IREFR (amino acid residues in italics do not contact mini-G.sub.S), compared to the sequence S.sup.7.56PDFRI in the equivalent position of ?.sub.2AR, where none of the residues make contacts with G?.sub.S. In A.sub.2AR, Arg291.sup.7.56 forms a hydrogen bond with the carbonyl group of Tyr 391.sup.5.23, with van der Waals contacts also being made by Arg291.sup.7.56, Ile292 and Arg293 to helix ?5 in mini-G.sub.S. Another region of the receptors that differs in the presence/absence of contacts to their respective G proteins is at the end of H5. In ?.sub.2AR, H5 extends an additional turn compared to A.sub.2AR where this region is disordered in the structure, perhaps because the CL3 loop in A.sub.2AR is 18 amino acid residues shorter than in 62.sub.2AR. Therefore, in ?.sub.2AR, additional contacts are made between the receptor (Ile233.sup.5.72, Lys235.sup.5.74, Ser236.sup.5.75 and Arg239.sup.5.78) and G?s (Asp323.sup.4.3, Asp343.sup.H4.23, Leu346.sup.H4.26, Arg347.sup.H4.27, T350.sup.H4S6.3 and Y358.sup.H4S6.11) that are not present in the A.sub.2AR-mini-Gs structure (FIGS. 17 and 18).

    [0477] Although there are significant differences in receptor-G protein contacts, there are also many similarities (FIG. 3). For example, at the cytoplasmic end of H3 the carbonyl groups of Ile.sup.3.54 and Arg.sup.3.55 (Thr.sup.3.55 in ?.sub.2AR) in both A.sub.2AR and 62.sub.2AR form the hydrogen bonds Ile.sup.3.54-Gln.sup.5.16 and Arg.sup.3.55-Arg.sup.H5.12, although in the ?.sub.2AR-Gs complex Gln.sup.5.16 makes an additional hydrogen bond to the side chain of Glu.sup.5.64, which is Ala in A.sub.2AR. In both receptors, Gln.sup.5.68 makes two hydrogen bonds to the G protein, but in ?.sub.2AR these are to Gln.sup.5.16 and Arg.sup.H5.17, whereas in A.sub.2AR the interaction to Gln.sup.5.16 is identical but the second hydrogen bond is to the backbone carbonyl group of Asp.sup.H5.13. In another example, Asp.sup.H5.13 forms hydrogen bonds to both receptors, but this consists of a salt bridge to Lys.sup.5.71 in ?.sub.2AR compared to a single hydrogen bond to Gln.sup.5.71 in A.sub.2AR. From these examples it is clear that although a very few contacts are identical, the majority are similar, differing in the specifics of the amino acid side chains involved, their conformation at the interface and the nature of the interaction.

    [0478] Conformational Changes in A.sub.2AR upon Mini-Gs Binding

    [0479] Previously reported structures of A.sub.2AR bound to agonists are in an active-intermediate conformation.sup.1,4,113. This assignment is based on the similarities of rotamer changes in the receptor core and the movement of transmembrane helices that are also observed in the structures of the active state of ?.sub.2AR bound to a nanobody.sup.38 and rhodopsin in an active state.sup.36,122. However, as the extent of H6 movement in agonist-bound A.sub.2AR is less than one half of that observed in the other receptors, there would be insufficient room in the cytoplasmic cleft to accommodate the C-terminal peptide of a G protein.sup.1. Comparison of the active-intermediate state of UK432097-bound A.sub.2AR.sup.12 with the structure of A.sub.2AR bound to mini-G.sub.S identified major re-arrangements in the cytoplasmic half of the receptor core to accommodate G protein binding (FIG. 24) and will be described in terms of the re-arrangements required to transition from the active-intermediate state to the G protein-bound conformation. Firstly, the cytoplasmic end of H6 moves away from the receptor core by 14 ? as measured between the C? atoms of Thr224.sup.6.26. This movement is achieved through H6 bending outwards with little discernible rotation around the helix axis. The extent of H6 movement is dictated by van der Waals interactions between Lys227.sup.6.29, Ala231.sup.6.33 and Leu235.sup.6.37 in A.sub.2AR and Leu393.sup.H5.25 and the carboxy terminus of mini-G.sub.S. The movement of H6 requires significant changes in the packing of the cytoplasmic end of H6 with helices H5 and H7. In particular, the side chains of highly conserved Tyr197.sup.5.58 and Tyr288.sup.7.53 both adopt new rotamers to fill the space previously occupied by the side chains of Leu235.sup.6.37 (whose C? moves by 3.7 ?) and Ile238.sup.6.40 (C? moves by 2.2 ?) respectively. The shift in Tyr288.sup.7.53 allows Arg102.sup.3.50 of the conserved DRY motif to adopt a fully extended conformation, packing against the side chain of Tyr391.sup.H5.23 in the ?5 helix of mini-G.sub.S.

    [0480] In contrast to the considerable re-arrangements of the cytoplasmic half of the receptor to allow mini-G.sub.S binding, there are no significant changes in the extracellular half of the receptor when the NECA-bound A.sub.2AR-mini-G.sub.S structure is compared to NECA-bound A.sub.2AR (FIG. 24). Thus the disposition of the ligand binding pocket described in the active-intermediate state does indeed describe the high-affinity state of NECA-bound to A.sub.2AR. Clearly, however, the structures are not informative of any potential changes in dynamics within the receptor that could also contribute to the change in ligand affinity.

    [0481] Conclusions

    [0482] A.sub.2AR is the first GPCR where both an active-intermediate and a fully active conformation have been defined structurally. However, the structure of the neurotensin receptor bound to the agonist peptide neurotensin.sup.1,4,110-114 shows very similar characteristics to adenosine-bound A.sub.2AR and therefore probably also represents an active-intermediate state.sup.123,124. Recently, it has been proposed based on extensive EPR data that ?.sub.2AR also exists in two distinct states in the active conformation, although the structure of the second state has not yet been elucidated.sup.119. However, it is clear from this work that there can be distinct conformations with or without G protein bound that lie on the activation pathway of agonist bound receptors. Given the highly conserved nature of the mechanism of GPCR activation, it is likely that the active-intermediate of A.sub.2AR may represent a common intermediate for many Class A GPCRs, although it may exist only transiently depending on the energy landscape of the receptor.

    [0483] The similarities and differences between the G protein interlaces of ?.sub.2AR and A.sub.2AR are a consequence of the different amino acid sequences of the receptors and result in a slightly different position and orientation of the G protein with respect to the receptor. Thus it is to be expected that G.sub.S will also interact slightly differently with other G.sub.S-coupled receptors and that other G proteins, such as Gi and Gq, will also show differences in the details of their interactions with receptors, due both to different amino acid sequences and the flexible nature of both receptors and G proteins. Thus the relatively loose nature of the G protein binding interface may allow significant variations in G protein orientation. However, one of the beauties of the conserved mechanism of G protein activation by GPCRs.sup.103 is provided that helix ?5 is displaced away from the nucleotide binding pocket, causing the order-to-disorder transition of ?1 and nucleotide release, the exact mode of interaction with the receptor is largely superfluous.

    [0484] Methods and Materials

    [0485] Expression and purification. Mini-G.sub.s (construct 414) was expressed in E. coli and purified by immobilised metal affinity chromatography (IMAC) and gel filtration chromatography (see further methods). The wild type human A.sub.2AR (residues 1-308), which contained the N154A mutation to remove a potential N-linked glycosylation site, was expressed in insect cells utilising the baculovirus expression system. A.sub.2AR was purified in the presence of the agonist NECA, in n-decyl-?-D-maltopyranoside (DM) detergent by IMAC and gel filtration chromatography (see further methods).

    [0486] Complexation and crystallisation. Agonist-bound, purified A.sub.2AR (in DM) was mixed with a 1.2-fold molar excess of mini-G.sub.s, apyrase was added and the sample was incubated overnight on ice. The complex was exchanged into n-octyl-?-D-thioglucopyranoside (OTG) detergent, purified by gel filtration, and crystallised by vapour diffusion (see further methods).

    [0487] Data collection, structure solution and refinement. Diffraction data were collected from two cryo-cooled crystals (100K), using either standard or helical collection modes, at beamline ID23-2 (European Synchrotron Radiation Facility). The structure was solved by molecular replacement using thermostabilised A.sub.2AR (PDB code 2YDV) and the G?.sub.S GTPase domain from the ?.sub.2AR-Gs complex (3SN6) as search models (see further methods).

    [0488] Further Methods

    [0489] Expression and purification of mini-G.sub.s Mini-G.sub.s414, which incorporated an N-terminal histidine tag (His.sub.10) and TEV protease cleavage site was expressed in E. coli strain BL21(DE3)RIL. Expression was induced with IPTG (50 ?M) for 20 h at 25? C. Cells were harvested by centrifugation and lysed by sonication in lysis buffer (40 mM HEPES pH 7.5, 100 mM NaCl, 10% glycerol, 10 mM imidazole, 5 mM MgCl.sub.2, 50 ?M GDP, 1 mM PMSF, 2.5 ?M Pepstatin-A, 10 ?M Leupeptin, 50 ?g/ml DNase I, 100 ?g/ml lysozyme, 100 ?M DTT), supplemented with Complete? protease inhibitors (Roche). The lysate was clarified by centrifugation and loaded onto a 10 ml Ni.sup.2+ Sepharose FF column. The column was washed with wash buffer (20 mM HEPES pH 7.5, 500 mM NaCl, 40 mM imidazole, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP) and eluted with elution buffer (20 mM HEPES pH 7.5, 100 mM NaCl, 500 mM imidazole, 10% glycerol, 1 mM MgCl.sub.2, 50 ?M GDP). TEV protease was added and the sample was dialysed overnight against dialysis buffer (20 mM HEPES pH 7.5, 100 mM NaCl, 10% glycerol, 1 mM MgCl.sub.2, 10 ?M GDP). TEV protease was removed by negative purification on Ni.sup.2+-NTA resin (Qiagen). The sample was concentrated to 1.5 ml and loaded onto a Superdex-200 26/600 gel filtration column, equilibrated with gel filtration buffer (10 mM HEPES pH 7.5, 100 mM NaCl, 10% glycerol, 1 mM MgCl.sub.2, 1 ?M GDP, 0.1 mM TCEP). Peak fractions were pooled and concentrated to 100 mg/ml. The pure protein was aliquoted, flash-frozen in liquid nitrogen, and stored at ?80? C. A typical yield was 100 mg of pure mini-G.sub.s414 per litre of culture.

    [0490] Expression and purification of adenosine A.sub.2AR Wild type human adenosine A.sub.2AR (residues 1-308) was modified to contain a C-terminal histidine tag (His.sub.10) and TEV protease cleavage site. The N154A mutation was introduced to remove a potential N-linked glycosylation site. Baculoviruses were prepared using the flashBAC ULTRA system (Oxford Expression Technologies). Trichopulsia ni cells were grown in ESF921 media (Expression Systems) to a density of 3?10.sup.6 cells/ml, infected with A.sub.2AR baculovirus and incubated for 72 h. Cells were harvested and membranes prepared by two ultracentrifugation steps in membrane buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 1 mM PMSF).

    [0491] NECA (100 ?M), NaCl (300 mM), PMSF (1 mM) and Complete? protease inhibitors (Roche) were added to the membranes, and the sample was mixed for 30 min at room temperature. Membranes were solubilised with 2% n-decyl-?-D-maltopyranoside (DM) on ice for 1 h. The sample was clarified by ultracentrifugation and loaded onto a 5 ml Ni-NTA column (Qiagen). The column was washed with wash buffer (20 mM HEPES pH 7.5, 500 mM NaCl, 10% glycerol, 80 mM imidazole, 100 ?M NECA, 0.15% DM), and eluted with elution buffer (20 mM HEPES pH 7.5, 100 mM NaCl, 10% glycerol, 300 mM imidazole, 100 ?M NECA, 0.15% DM). The eluate was concentrated using a 50 kDa cutoff Amicon unit (Millipore), and exchanged in to desalting buffer (10 mM HEPES pH 7.5, 100 mM NaCl, 10% glycerol, 100 ?M NECA, 0.15% DM) using a PD10 column (GE Healthcare). TEV protease was added, and the sample was incubated on ice overnight. The sample was concentrated to 0.2 ml and loaded onto a Superdex 200 column (GE Healthcare). Peak fractions were pooled and concentrated to approximately 20 mg/ml. A typical yield was 2 mg of pure A.sub.2AR per litre of culture.

    [0492] Complexation and crystallisation Purified A.sub.2AR was mixed with a 1.2-fold molar excess of mini-G.sub.s414. MgCl.sub.2 (1 mM) and apyrase (0.1 U) were added, and the mixture was incubated on ice overnight. The sample was diluted 10-fold in gel filtration buffer (10 mM HEPES pH 7.5, 100 mM NaCl, 100 ?M NECA, 0.35% n-octyl-?-D-thioglucopyranoside OTG), concentrated to 0.2 ml, and loaded on to a Superdex 200 column (pre-equilibrated in the same buffer). Peak fractions, containing the A.sub.2AR-mini-G.sub.s complex, were pooled and concentrated to 20 mg/ml. The A.sub.2AR-mini-G.sub.s complex was crystallised by vapour diffusion in OTG either in the presence or absence of cholesterol hemisuccinate (CHS). Crystallisation plates were set up at 4? C. using 120 nl sitting drops. Crystals used for structure solution were grown in two conditions, either: 0.1 M NaOAc pH 5.5, 10% PEG 2000 (in the presence of CHS); or 0.1 M NaOAc pH 5.7, 9.5% PEG 2000 MME (in the absence of CHS). Crystals were cryo-protected in mother liquor supplemented with 30% PEG 400 and flash frozen in liquid nitrogen.

    [0493] Data collection, processing and refinement Diffraction data were collected at the European Synchrotron Radiation Facility on beamline ID23-2 with a Pilatus 2M detector, using a 10 ?m microfocus beam (0.8729 ? wavelength). Data were collected using either standard or helical collection modes. Data from two crystals were used for structure solution. Data were processed using MOSFLM.sup.104 and AIMLESS.sup.105. The structure was solved by molecular replacement with PHASER.sup.106 using the structures of the thermostabilised A.sub.2AR (PDB code 2YDV).sup.107 and the G?.sub.s GTPase domain (residues 40-59 and 205-394) from the ?.sub.2AR-G.sub.s complex (PDB code 3SN6).sup.108 as search models. Model refinement and rebuilding were performed using REFMAC.sup.109 and COOT.sup.110.

    [0494] Competition binding assay FreeStyle HEK293-F cells transiently expressing wild type A.sub.2AR were resuspended in either assay buffer A (25 mM HEPES, pH 7.5, 100 mM KCl, 1 mM MgCl.sub.2), assay buffer B (25 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM MgCl.sub.2), or assay buffer C (25 mM HEPES, pH 7.5, 500 mM NaCl, 1 mM MgCl.sub.2), and were lysed by 10 passages through a 26 G needle. Purified binding partners were buffer-exchanged to the respective buffer before being added to the membranes at a final concentration of 25 ?M. The mixture was aliquoted and NECA was added (0 to 1 mM final concentration, prepared in assay buffers containing 1 u/mL apyrase). The samples were incubated for 90 min at 22? C., .sup.3H-ZM241385 was added at its apparent K.sub.d (2.5 nM), and the samples were incubated for a further 90 min at 22? C. Non-specific binding was determined in the presence of 100 ?M of ZM241385. Receptor-bound and free radioligand were separated by filtration through 96-well GF/B filter plates (pre-soaked with 0.1% polyethyleneimine), and washed 3 times with the appropriate buffer. Plates were dried and radioactivity was quantified by liquid scintillation counting using a Tri-Carb 2910 TR (Perkin Elmer). Data were analyzed by nonlinear regression using GraphPad Prism software. The K.sub.i for NECA binding was derived from one-site fit Ki analysis. Data from at least three independent experiments, each performed in duplicate, were analyzed using an unpaired two-tailed t-test for statistical significance.

    [0495] Thermostability assay Membranes from Trichopulsia ni cells expressing wild type human A.sub.2AR were resuspended in T.sub.m buffer (25 mM HEPES pH 7.5, 100 mM NaCl, 1 mM MgCl.sub.2) and homogenised by 10 passages through a 26-gauge needle. Binding partner was added at a final concentration of 25 ?M. .sup.3H-NECA and unlabelled NECA were mixed in a ratio of 1:5 and added to the membranes to give a final concentration of 1 ?M (approximately 10-fold above the apparent K.sub.d). The samples were incubated at room temperature for 1 h, then chilled on ice for 30 min. DDM, DM or OG were added to a final concentration of 0.1%, 0.13% or 0.8%, respectively, and samples were incubated on ice for 1 h. Cell debris was removed by centrifugation for 5 min at 20,000?g and the supernatant was aliquoted into PCR strips. Samples were heated to the desired temperature for exactly 30 min, then quenched on ice for 30 min. Samples (50 ?l) were loaded onto gel filtration resin packed into a 96-well filter plate (Millipore), which was centrifuged to separate receptor-bound from free radioligand. Non-specific binding was determined in the presence of 200 ?M unlabeled NECA. Radioactivity was quantified by liquid scintillation counting using a MicroBeta TriLux scintillation counter (PerkinElmer). Data were analyzed by nonlinear regression using GraphPad Prism software. Apparent T.sub.m values were derived from sigmoidal dose-response analysis. Results represent the mean?SEM of two independent experiments, performed in duplicate.

    TABLE-US-00001 TABLE 1 Turkey ?1AR constructs used during this work. The ?1AR-WT construct contained N- and C-terminal truncations, and the C116L mutation. These modifications were designed to prevent glycosylation or improve expression.sup.15. The ?1AR-84 construct contained an additional deletion of cytoplasmic loop three. Thermostabilising mutations (M90V, D322K, F327A, and F388M).sup.2, 3. A disulphide link between transmembrane helices 1 and 2, facilitated by the M40C and L103C mutations. The C358A mutation, designed to prevent palmitoylation. An N-terminal MBP fusion, designed to facilitate crystallisation. Construct Deleted residues Mutations Other modifications ?.sub.1AR-WT 1-32 C116L 6 His tag (C-terminus) 424-483 ?.sub.1AR-84 1-32 M40C MBP fusion 244-271 M90V (N-terminus) 368-483 L103C 6 His tag (C-terminus) C116L D322K F327A C358A F388M

    TABLE-US-00002 TABLE 2 Parental mini Gs constructs used during this work. Construct Deleted residues G?AH linker Mutations Other modifications Mini Gs.sub.77 1-21 Gly.sub.3 L197A N-terminal 6 His tag 67-193 C200S Mini Gs.sub.161 1-21 Gly.sub.5 None N-terminal 6 His tag 65-208 Mini Gs.sub.199 1-21 Gly.sub.8 G49D N-terminal 6 His tag 65-203 E50N 254-263 (switch A249D III) S252D L272D Mini Gs.sub.391 1-25 GGSGGSGG G49D N-terminal 6 His tag 65-203 E50N TEV protease site 254-263 (switch A249D III) S252D L272D I372A Mini Gs.sub.393 1-25 GGSGGSGG G49D N-terminal 6 His tag 65-203 E50N TEV protease site 254-263 (switch A249D III) S252D L272D I372A V375I Mini Gs.sub.399 1-5 GGSGGSGG G49D N-terminal 6 His tag 65-203 E50N TEV protease site 254-263 (switch A249D III) S252D I372A V375I Mini Gs.sub.404 1-25 GGSGGSGG G49D N-terminal 6 His tag 65-203 E50N TEV protease site 254-263 (switch A249D III) S252D L272D

    TABLE-US-00003 TABLE 3 Competitive binding assay data showing the isoprenaline K.sub.i of ?.sub.1AR-84 in response to different binding partners. Data are from a single experiment performed in duplicate unless otherwise stated in the table, in these cases data represent mean ? SEM, from the number of independent experiments (n) indicated. The effect of mutations on the expression level of mini Gs was estimated from SDS-PAGE gels. Mutants that caused more than a 2-fold change in expression compared to the parental construct are shown simply as an increase (+) or decrease (?). ?.sub.1AR-WT Binding CGN complex Tm in Mini Gs basal partner Mutation code.sup.a DDM (? C.) Tm (? C.) None n.a..sup.b n.a. 25.9 ? 0.0 (n = 3) n.a. Nb80 n.a. n.a. 32.0 ? 0.0 (n = 3) n.a. Gs - Nb35 n.a. n.a. 35.8 ? 0.1 (n = 3) n.a. G?s n.a. n.a. n.d..sup.c 50.1 ? 0.1 (n = 3) Mini Gs.sub.162 A249D .sup.25.1 (n = 1) 60.6 ? 0.1 (n = 3) Mini Gs.sub.164 A249D-SIII.sup.d .sup.28.6 (n = 1) 66.5 ? 0.0 (n = 3) Mini Gs.sub.165 A249D-S252D-SIII 28.5 ? 0.2 (n = 2) 68.7 ? 0.0 (n = 3) Mini Gs.sub.169 A249D-S252D-SIII-L272D .sup.28.8 (n = 1) 67.1 ? 0.0 (n = 3) Mini Gs.sub.183 G49D-E50N-A249D-S252D-SIII- 28.7 ? 0.2 (n = 4) 72.5 ? 0.0 (n = 3) L272D Mini Gs.sub.199.sup.e G49D-E50N-A249D-S252D-SIII- 29.2 ? 0.2 (n = 17) 72.5 ? 0.0 (n = 3) L272D Mini Gs.sub.254 M60A 60.sup.G.H1.8 31.5 ? 0.3 (n = 5) 70.3 ? 0.0 (n = 3) Mini Gs.sub.350 L63Y 63.sup.G.H1.11 30.9 ? 0.4 (n = 2) 70.7 ? 0.0 (n = 3) Mini Gs.sub.340 I372A 372.sup.G.H5.4 .sup.34.0 (n = 1) 66.6 ? 0.1 (n = 3) Mini Gs.sub.303 V375I 375.sup.G.H5.7 31.5 ? 0.6 (n = 3) 70.3 ? 0.0 (n = 3) Mini Gs.sub.352 L63Y?I372A .sup.34.5 (n = 1) 64.7 ? 0.1 (n = 3) Mini Gs.sub.345 I372A?V375I .sup.35.0 (n = 1) 65.4 ? 0.1 (n = 3) .sup.aCommon G? numbering (CGN) system. .sup.bNot applicable. .sup.cNot determined. .sup.dSubstitution of switch II residues 227-230 with two glycine residues. .sup.eDeletion of switch III residues 254-263.

    TABLE-US-00004 TABLE 4 Thermostability (Tm) measurements for either ?.sub.1AR-WT complexes or mini Gs mutants in the basal GDP-bound state. Tm values represent the mean ? SEM from the number of independent experiments (n) indicated in the table. Some Tm values were determined from a single experiments performed in duplicate, with an assumed error of ? 0.5? C. Tm values for mini Gs in the GDP- bound state were determined by differential scanning fluorimetry. Binding CGN ?.sub.1AR-84 isoprenaline K.sub.i (nM) Effect on partner Mutation code.sup.a 4? C. 20? C. expression None n.a..sup.b n.a. 2080 ? 181 (n = 12) 2615 ? 273 (n = 15) n.a. Nb80 n.a. n.a. n.d..sup.c 28 ? 1 (n = 2) n.a. Gs n.a. n.a. 419 ? 80 (n = 2) 271 ? 54 (n = 2) n.a. Gs - Nb35 n.a. n.a. n.d. 16 ? 4 (n = 3) n.a. Mini Gs.sub.77 Parental n.a. 99 ? 12 (n = 4) 1867 ? 228 (n = 3) n.a. Mini Gs.sub.81 H41I 41.sup.G.S1.2 32 393 Mini Gs.sub.84 H41V 41.sup.G.S1.2 51 491 Mini Gs.sub.186 A48L 48.sup.G.s1h1.2 43 174 Mini Gs.sub.130 G49D 49.sup.G.s1h1.3 25 285 Mini Gs.sub.116 E50N 50.sup.G.s1h1.4 37 724 Mini Gs.sub.134 R201A 201.sup.Ghfs2.2 31 1479 ? Mini Gs.sub.98 227-230 sub.sup.d 227.sup.G.s3h2.3 23 533 Mini Gs.sub.175 E230A 230.sup.G.H2.3 51 545 ? Mini Gs.sub.92 A249D 249.sup.G.S4.7 10 35 + Mini Gs.sub.104 A249E 249.sup.G.S4.7 70 388 Mini Gs.sub.117 S252D 252.sup.G.s4h3.3 14 94 + Mini Gs.sub.118 S252E 252.sup.G.s4h3.3 38 383 + Mini Gs.sub.105 254-263 del.sup.e 254.sup.G.s4h3.5 21 20 Mini Gs.sub.94 L272D 272.sup.G.H3.8 7 310 .sup.aCommon G? numbering (CGN) system. .sup.bNot applicable. .sup.cNot determined. .sup.dDeletion of switch III residues 254-263 is referred to as SIII. .sup.eMini Gs.sub.199 contains the same mutations as mini Gs.sub.183, but has a redesigned linker region (see Table 2), and was used as the parental construct for screening detergent stabilising mutations.

    TABLE-US-00005 TABLE 5 Agonist-shift assay data for GTPase domain mutants. Assays were performed using membranes containing the ?1AR reconstituted with partially purified GTPase domain mutants (total amount purified from 1 litre of E. coli culture). Assays were performed at 4 and 20? C. for each mutant. The table shows the final isoprenaline affinity of the receptor under each condition. The starting isoprenaline affinity of the receptor was 3.03 ? 0.81 ?M (n = 16), with values in the range of 1.5-4.4 ?M. Therefore, a shift in agonist affinity less than threefold cannot be considered significant. Quantification of expression levels was not possible due to the use of partially purified material. Therefore, a simplified scale was used to indicate the relative expression level compared to the parental construct. Approximate isoprenaline IC50 (nM) Approximate Modification/mutation At 4? C. At 20? C. expression level Parental construct 136 2100 V36D/N218K 115 2100 ? V36D/N218K/T40A 551 2400 ?? V36D/N218K/T40D 427 3200 = Y37D 81 2000 = Y37R/R42D 2300 n.d. ??? H41I 58 589 = H41L 285 3900 ? H41M 307 1800 = H41V 77 737 = A48D 185 1800 ??? G49D 37 428 = E50N 55 1100 = G49D/E50N 44 364 = S54N 462 2100 ??? R199K 108 1900 + R199D 109 1800 = R201A 46 2200 = F208N 250 1300 = G226A 127 1200 = ?227-230/GG linker 34 799 = W234A/F238A 584 4000 ? C237E 93 1900 = D240G 510 4400 ? A249S 146 1600 ? A249D 15 53 ++ A249E 104 582 + S252D 21 142 + S252E 57 575 + L270N/I348N 4300 n.d. ??? L272D 10 464 + L272E 42 110 = S275D 136 2000 = N279E/I235K 1200 2800 ??? N279D/Q235K 102 2000 ??? S286C/I382C 4200 7000 ??? D295N 2400 n.d. ??? R356S 229 2800 = R356D 161 3300 = ?255-262/G linker 1300 n.d. ?? ?254-263 31 30 ++ ?254-263/Y253P 23 142 ++ ?266-340/G?i1 chimera 4400 n.d. ??? ?266-341/ras chimera 2200 n.d. ??? Note: some mutants that did not induce a shift in agonist affinity at 4? C. were not tested at 20? C. (denoted by n.d. in the table).

    TABLE-US-00006 TABLE 6 Data collection and refinement statistics Data collection Space group P 2.sub.12.sub.12.sub.1 Cell dimensions a, b, c (?) 90.6, 111.8, 161.3 Resolution (?) 40.3-3.4 (3.49-3.40) R.sub.merge 0.173 (0.747) I/?I 3.6 (1.2) Completeness (%) 90.6 (78.5) Redundancy 2.6 (2.4) Refinement Resolution (?) 40.3-3.4 No. reflections 19788 R.sub.work/R.sub.free (%) 28.4/31.5 No. atoms 7359 Protein 7248 Ligand/detergent/nucleotide 44/40/27 Water 0 B-factors (?.sup.2) Protein 79.9 Ligand/detergent/nucleotide 67.9/98.6/69.0 R.M.S.D. Bond lengths (?) 0.008 Bond angles (?) 1.15

    REFERENCES

    [0496] 1. Lebon, G., et al. (2011). Agonist-bound adenosine A2A receptor structures; reveal common features; of GPCR activation. Nature; 474(7352): 521-5.

    [0497] 2. Rosenbaum, D. M., et al. Lyons et al. (2011). Structure and function of an irreversible agonist-?(2) adrenoceptor complex. Nature; 469(7329): 236-40.

    [0498] 3. Warne, T., et al. (2011). The structural basis for agonist and partial agonist action on a ?(1)-adrenergic receptor. Nature; 469(7329): 241-4.

    [0499] 4. Xu, F., et al. (2011). Structure of an agonist-bound human A2A adenosine receptor. Science; 332(6027): 322-7.

    [0500] 5. Herrmann, R., et al. (2004). Sequence of interactions in receptor-G protein coupling. J Biol Chem; 279(23): 24283-24290.

    [0501] 6. Herrmann, R., et al. (2006). Rhodopsin-transducin coupling: role of the Galpha C-terminus in nucleotide exchange catalysis. Vision Res; 46(27): 4582-4593.

    [0502] 7. Hamm, H. E., et al. (1988). Site of G protein binding to rhodopsin mapped with synthetic peptides from the alpha subunit. Science; 241(4867): 832-5.

    [0503] 8. Conklin, B. R., et al. (1993). Substitution of three amino acids switches receptor specificity of Gq alpha to that of Gi alpha. Nature; 363(6426): 274-276.

    [0504] 9. Conklin, B. R., et al. (1996). Carboxyl-terminal mutations of Gq alpha and Gs alpha that alter the fidelity of receptor activation. Mol Pharmacol; 50(4): 885-890.

    [0505] 10. Rasmussen, S. G., et al. (2011). Crystal structure of the 132 adrenergic receptor-Gs protein complex. Nature; 477(7366): 549-55.

    [0506] 11. Chung, K. Y., et al. (2011). Conformational changes in the G protein Gs induced by the beta2 adrenergic receptor. Nature; 477(7366): 611-615.

    [0507] 12. Chabre, M., et al. (1989). Molecular mechanism of visual transduction. Eur J Biochem; 179(2): 255-266.

    [0508] 13. Delean, A., et al. (1980). A Ternary Complex Model Explains the Agonist-Specific Binding-Properties of the Adenylate Cyclase-Coupled Beta-Adrenergic-Receptor. J Biol Chem; 255(15): 7108-17.

    [0509] 14. Bornancin, F., et al. (1989). The transitory complex between photoexcited rhodopsin and transducin. Reciprocal interaction between the retinal site in rhodopsin and the nucleotide site in transducin. Eur J Biochem; 184(3): 687-98.

    [0510] 15. Sprang, S. R. (1997). G protein mechanisms: insights from structural analysis. Annu Rev Biochem; 66: 639-78.

    [0511] 16. Fung, B. K. (1983). Characterization of transducin from bovine retinal rod outer segments. I. Separation and reconstitution of the subunits. J Biol Chem; 258(17): 10495-10502.

    [0512] 17. Fung, B. K., et al. (1983). Characterization of transducin from bovine retinal rod outer segments. II. Evidence for distinct binding sites and conformational changes revealed by limited proteolysis with trypsin. J Biol Chem; 258(17): 10503-10510.

    [0513] 18. Wittinghofer, A., et al. (2011). Structure-function relationships of the G domain, a canonical switch motif. Annu Rev Biochem; 80: 943-971.

    [0514] 19. Holm L., et al. (2010). Dali server: conservation mapping in 3D. Nucleic Acids Res; 38 (Web Server issue): W545-9.

    [0515] 20. Hall, A., et al. (1986). The effect of Mg2+ on the guanine nucleotide exchange rate of p21N-ras. J Biol Chem; 261(24): 10963-10965.

    [0516] 21. Higashijima, T., et al. (1987). Effects of Mg2+ and the beta gamma-subunit complex on the interactions of guanine nucleotides with G proteins. J Biol Chem; 262(2): 762-6.

    [0517] 22. Jones, J. C., et al. (2011). The crystal structure of a self-activating G protein alpha subunit reveals its distinct mechanism of Signal; initiation. Sci Signal; 4(159): ra8.

    [0518] 23. Majumdar, S., et al. (2004). Perturbing the linker regions of the alpha-subunit of transducin: a new class of constitutively active GTP-binding proteins. J Biol Chem; 279(38): 40137-40145.

    [0519] 24. Ferguson, K. M., et al. (1986). The influence of bound GDP on the kinetics of guanine nucleotide binding to G proteins. J Biol Chem; 261(16): 7393-7399.

    [0520] 25. Posner, B. A., et al. (1998). The A326S mutant of Gialphal as an approximation of the receptor-bound state. J Biol Chem; 273(34): 21752-21758.

    [0521] 26. Vetter, I. R., et al. (2001). The guanine nucleotide-binding switch in three dimensions. Science 294(5545): 1299-1304.

    [0522] 27. Kapoor, N., et al. (2009). Structural evidence for a sequential release mechanism for activation of heterotrimeric G proteins. J Mol Biol 393(4): 882-897.

    [0523] 28. Natochin, M., et al. (2001). Probing the mechanism of rhodopsin-catalyzed transducin activation. J Neurochem; 77(1): 202-210.

    [0524] 29. Oldham, W. M., et al. (2006). Mechanism of the receptor-catalyzed activation of heterotrimeric G proteins. Nat Struct Mol Biol; 13(9): 772-7.

    [0525] 30. Preininger, A. M., et al. (2009). Helix dipole movement and conformational variability contribute to allosteric GDP release in Galphai subunits. Biochemistry; 48(12): 2630-2642.

    [0526] 31. Abdulaev, N. G., et al. (2005). Heterotrimeric G-protein alpha-subunit adopts a preactivated conformation when associated with betagamma-subunits. J Biol Chem; 280(45): 38071-38080.

    [0527] 32. Weiss, E. R., et al. (1988). Receptor activation of G proteins. FASEB J; 2(13): 2841-2848.

    [0528] 33. Hou, Y., et al. (2000). Selective role of G protein gamma subunits in receptor interaction. J Biol Chem; 275(50): 38961-38964.

    [0529] 34. McIntire, W. E., et al. (2001). The G protein beta subunit is a determinant in the coupling of Gs to the beta 1-adrenergic and A2a adenosine receptors. J Biol Chem; 276(19): 15801-15809.

    [0530] 35. Richardson, M., et al. (1999). The alpha2A-adrenergic receptor discriminates between Gi heterotrimers of different betagamma subunit composition in Sf9 insect cell membranes. J Biol Chem; 274(19): 13525-13533.

    [0531] 36. Scheerer, P., et al. Hildebrand et al. (2008). Crystal structure of opsin in its G-protein-interacting conformation. Nature; 455(7212): 497-502.

    [0532] 37. Choe, H. W., et al. (2011). Crystal structure of metarhodopsin II. Nature; 471(7340): 651-5.

    [0533] 38. Rasmussen S. G., et al. (2011). Structure of a nanobody-stabilized active state of the ?(2) adrenoceptor. Nature; 469(7329): 175-80.

    [0534] 39. Abdulaev, N. G., et al. (2006). The receptor-bound empty pocket state of the heterotrimeric G-protein alpha-subunit is conformationally dynamic. Biochemistry; 45(43): 12986-12997.

    [0535] 40. Westfield, G. H., et al. (2011). Structural flexibility of the G alpha s alpha-helical domain in the beta2-adrenoceptor Gs complex. Proc Natl Acad Sci U S A; 108(38): 16086-91.

    [0536] 41. Markby D. W. et al. (1993). Separate GTP binding and GTPase activating domains of a G alpha subunit. Science; 262(5141): 1895-901.

    [0537] 42. Dohlman, H. G., et al. (2012). Signal; activation and inactivation by the Galpha helical domain: a long-neglected partner in G protein signaling. Sci Signal; 5(226): re2.

    [0538] 43. Phillips, W. J., et al. (1992). Rhodopsin/transducin interactions. II. Influence of the transducin-beta gamma subunit complex on the coupling of the transducin-alpha subunit to rhodopsin. J Biol Chem; 267(24): 17040-6.

    [0539] 44. Skiba, N., et al. (1996). Mapping of effector binding sites of transducin alpha-subunit using G alpha t/G alpha i1 chimeras. J Biol Chem; 271(1): 413-424.

    [0540] 45. Singh, G., et al. (2012). A constitutively active Galpha subunit provides insights into the mechanism of G protein activation. Biochemistry; 51(15): 3232-3240.

    [0541] 46. Herrmann, R., et al. (2006). Signal transfer from GPCRs to G proteins: role of the G alpha N-terminal region in rhodopsin-transducin coupling. J Biol Chem; 281(40): 30234-30241.

    [0542] 47. Bubis, J., et al. (2001). Chemical modification of transducin with iodoacetic acid: transducin-alpha carboxymethylated at Cys(347) allows transducin binding to Light-activated rhodopsin but prevents its release in the presence of GTP. Arch Biochem; Biophys 395(2): 146-157.

    [0543] 48. Grishina, G., et al. (2000). A surface-exposed region of G(salpha) in which substitutions decrease receptor-mediated activation and increase receptor affinity. Mol Pharmacol; 57(6): 1081-1092.

    [0544] 49. Barren, B., et al. (2007). Mechanisms of dominant negative G-protein alpha subunits. J Neurosci Res; 85(16): 3505-3514.

    [0545] 50. Feig, L. A., et al. (1999). Tools of the trade: use of dominant-inhibitory mutants of Ras-family GTPases. Nat Cell Biol 1(2): E25-27.

    [0546] 51. Feig, L. A., et al. (1988). Inhibition of NIH 3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP. Mol Cell Biol 8(8): 3235-3243.

    [0547] 52. Cleator, J. H., et al. (1999). The N54 mutant of Galphas has a conditional dominant negative phenotype which suppresses hormone-stimulated but not basal cAMP levels. FEBS Lett 443(2): 205-208.

    [0548] 53. Cleator, J. H., et al. (2004). A dominant negative Galphas mutant that prevents thyroid-stimulating hormone receptor activation of cAMP production and inositol 1,4,5-trisphosphate turnover: competition by different G proteins for activation by a common receptor. J Biol Chem; 279(35): 36601-36607.

    [0549] 54. Hildebrandt, J. D., et al. (1991). A mutation in the putative Mg(2+)-binding site of Gs alpha prevents its activation by receptors. Mol Cell Biol 11(10): 4830-4838

    [0550] 55. Natochin, M., et al. (2006). Dominant negative mutants of transducin-alpha that block activated receptor. Biochemistry; 45(20): 6488-6494.

    [0551] 56. Ramachandran, S., et al. (2011). A dominant-negative Galpha mutant that traps a stable rhodopsin-Galpha-GTP-betagamma complex. J Biol Chem; 286(14): 12702-12711.

    [0552] 57. Slepak, V. Z., et al. (1995). Functional analysis of a dominant negative mutant of G alpha i2. J Biol Chem; 270(8): 4037-4041.

    [0553] 58. Wu, Y. L., et al. (2004). Dominant-negative inhibition of pheromone receptor signaling by a single point mutation in the G protein alpha subunit. J Biol Chem; 279(34): 35287-35297.

    [0554] 59. Pereira, R., et al. (2005). A switch 3 point mutation in the alpha subunit of transducin yields a unique dominant-negative inhibitor. J Biol Chem; 280(42): 35696-35703.

    [0555] 60. Barren, B., et al. (2006). Mutation R238E in transducin-alpha yields a GTPase and effector-deficient, but not dominant-negative, G-protein alpha-subunit. Mol Vis 12: 492-498.

    [0556] 61. Zurita, A. R., et al. (2008). The same mutation in Gsalpha and transducin alpha reveals behavioral differences between these highly homologous G protein alpha-subunits. Proc Natl Acad Sci U S A 105(7): 2363-2368.

    [0557] 62. Yu, B., et al. (2000). Inhibition of subsets of G protein-coupled receptors by empty mutants of G protein alpha subunits in g(o): G(11): and G(16). J Biol Chem; 275(1): 71-76.

    [0558] 63. Yu, B., et al. (1998). Interaction of the xanthine nucleotide binding Goalpha mutant with G protein-coupled receptors. J Biol Chem; 273(46): 30183-30188.

    [0559] 64. Yu, B., et al. (1997). Characterization of a Goalpha mutant that binds xanthine nucleotides. J Biol Chem; 272(29): 18015-18019.

    [0560] 65. liri, T., et al. (1999). Gsalpha mutant designed to inhibit receptor signaling through Gs. Proc Natl Acad Sci U S A; 96(2): 499-504.

    [0561] 66. liri, T., et al. (1994). Rapid GDP release from Gs alpha in patients with gain and loss of endocrine function. Nature; 371(6493): 164-168.

    [0562] 67. Warner, D. R., et al. (1998). A novel mutation in the switch 3 region of Gsalpha in a patient with Albright hereditary osteodystrophy impairs GDP binding and receptor activation. J Biol Chem; 273(37): 23976-23983.

    [0563] 68. Berlot, C. H., et al. (2002). A highly effective dominant negative alpha s construct containing mutations that affect distinct functions inhibits multiple Gs-coupled receptor signaling pathways. J Biol Chem; 277(23): 21080-21085.

    [0564] 69. Serrano-Vega, M. J., et al. (2008). Conformational thermostabilization of the betal-adrenergic receptor in a detergent-resistant form. Proc Natl Acad Sci U S A 105(3): 877- 882.

    [0565] 70. Johnston, C. A., et al. (2005). Structure of Galpha(i1) bound to a GDP-selective peptide provides insight into guanine nucleotide exchange. Structure 13(7): 1069-1080.

    [0566] 71. Kimple, R. J., et al. (2002). Structural determinants for GoLoco-induced inhibition of nucleotide release by Galpha subunits. Nature; 416(6883): 878-881.

    [0567] 72. Nishimura, A., et al. (2010). Structural basis for the specific inhibition of heterotrimeric Gq protein by a small molecule. Proc Natl Acad Sci USA 107(31): 13666-13671.

    [0568] 73. Umezawa, Y., et al. (1998). CH/pi interactions as demonstrated in the crystal structure of guanine-nucleotide binding proteins, Src homology-2 domains and human growth hormone in complex with their specific ligands. Bioorg Med Chem; 6(4): 493-504.

    [0569] 74. Li, Q., et al. (1997). Communication between switch II and switch III of the transducin alpha subunit is essential for target activation. J Biol Chem; 272(35): 21673-21676

    [0570] 75. Frishman, D., et al. et al. Knowledge-based protein secondary structure assignment. Proteins 23(4): 566-579.

    [0571] 76. Heinig, M., et al. (2004). STRIDE: a web server for secondary structure assignment from known atomic coordinates of proteins. Nucleic Acids Res; 32 (Web Server issue): W500-502.

    [0572] 77. Muradov, K. G., et al. (2000). Coupling between the N- and C-terminal domains influences transducin-alpha intrinsic GDP/GTP exchange. Biochemistry; 39(14): 3937-3942.

    [0573] 78. Lambright, D. G. et al. (1994). Structural determinants for activation of the alpha-subunit of a heterotrimeric G protein. Nature; 369(6482): 621-628.

    [0574] 79. Coleman, D. E et al. (1998). Crystal structures; of the G protein Gi alpha 1 complexed with GDP and Mg2+: a crystallographic titration experiment. Biochemistry; 37(41): 14376-14385.

    [0575] 80. Noel, J. P., et al. (1993). The 2.2 A crystal structure of transducin-alpha complexed with GTP gamma S. Nature; 366(6456): 654-663.

    [0576] 81. Sunahara, R. K., et al. (1997). Crystal structure of the adenylyl cyclase activator Gsalpha. Science; 278(5345): 1943-7.

    [0577] 82. Tesmer, J. J., et al. (1997). Crystal structure of the catalytic domains of adenylyl cyclase in a complex with Gsalpha.GTPgammaS. Science 278(5345): 1907-1916.

    [0578] 83. Kleuss, C., et al. (2003). Galpha(s) is palmitoylated at the N-terminal glycine. EMBO J 22(4): 826-832.

    [0579] 84. Simonds, W. F., et al. (1991). G-protein beta gamma dimers. Membrane targeting requiRes; subunit coexpression and intact gamma C-A-A-X domain. J Biol Chem; 266(9): 5363-5366.

    [0580] 85. Spiegel, A. M., et al. (1991). The G protein connection: molecular basis of membrane association. Trends Biochem Sci; 16(9): 338-41.

    [0581] 86. Herrmann, R., et al. (2006). Signal; transfer from GPCRs to G proteins: role of the G alpha N-terminal region in rhodopsin-transducin coupling. J Biol Chem; 281(40): 30234-41.

    [0582] 87. Alexander, N. S., et al. (2014). Energetic analysis of the rhodopsin-G-protein complex links the ?5 helix to GDP release. Nat Struct Mol Biol; 21(1): 56-63.

    [0583] 88. Dror, R. O., et al. (2015). SIGNAL; TRANSDUCTION. Structural basis for nucleotide exchange in heterotrimeric G proteins. Science; 348(6241): 1361-5.

    [0584] 89. Flock, T., et al. (2015). Universal allosteric mechanism for G? activation by GPCRs. Nature; 524(7564): 173-9.

    [0585] 90. Kaya, A. I., et al. (2014). A conserved phenylalanine as a relay between the ?5 helix and the GDP binding region of heterotrimeric Gi protein a subunit. J Biol Chem; 289(35): 24475-87.

    [0586] 91. Van Eps, N., et al. (2011). Interaction of a G protein with an activated receptor opens the interdomain interface in the alpha subunit. Proc Natl Acad Sci U S A; 108(23): 9420-4.

    [0587] 92. Sun, D., et al. (2015). Probing G?il protein activation at single-amino acid resolution. Nat Struct Mol Biol; 22(9): 686-94.

    [0588] 93. Vuong T. M., et al. (1984). Millisecond activation of transducin in the cyclic nucleotide cascade of vision. Nature; 311(5987): 659-61.

    [0589] 94. Kuhn, H. 1981. Interactions of rod cell proteins with the disc membrane: influence of light, ionic strength, and nucleotides. Curr Top Membr Transp; 15: 171-201.

    [0590] 95. Fung, B. K., et al. (1981). Flow of information in the light-triggered cyclic nucleotide cascade of vision. Proc Natl Acad Sci; U S A 78(1): 152-6.

    [0591] 96. Miller-Gallacher, R. et al., (2014). The 2.1 A Resolution Structure of Cyanopindolol-Bound ?1-Adrenoceptor Identifies an Intramembrane Na+ Ion that Stabilises the Ligand-Free Receptor. PLoS One 9 (3): e92727.

    [0592] 97. Warne, T., et al, (2003). Expression and purification of truncated, non-glycosylated turkey beta-adrenergic receptors for crystallization. Biochim Biophys Acta; 1610(1): 133-40.

    [0593] 98. Hanzal-Bayer, M., et al. (2002). The complex of Arl2-GTP and PDE delta: from structure to function. EMBO J; 21(9): 2095-106.

    [0594] 99. Traut, T. W. (1994). Physiological concentrations of purines and pyrimidines. Mol Cell Biochem; 140(1): 1-22.

    [0595] 100. Ring A. M., et al. (2013). Adrenaline-activated structure of 132-adrenoceptor stabilized by an engineered nanobody. Nature; 502(7472): 575-9.

    [0596] 101. Weichert D., et al. (2014). Covalent agonists for studying G protein-coupled receptor activation. Proc Natl Acad Sci U S A; 111(29): 10744-8.

    [0597] 102. Hansson K, M. D., et al. (2008). PCR-mediated deletion of plasmid DNA. Anal Biochem; 375(2): 373-5.

    [0598] 103. Flock, T., et al. (2015). Universal allosteric mechanism for G? activation by GPCRs. Nature; 524(7564): 173-9.

    [0599] 104. Fredholm, B. B., et al. (2001). International Union of Pharmacology. XXV. Nomenclature and classification of adenosine receptors. Pharmacol Rev; 53(4): 527-552.

    [0600] 105. Fredholm, B. B., et al. (2011). International Union of Basic and Clinical Pharmacology. LXXXI. Nomenclature and classification of adenosine receptorsan update. Pharmacol Rev; 63(1): 1-34.

    [0601] 106. Chen, J. F., et al. (2013). Adenosine receptors as drug targets-what are the challenges? Nat Rev Drug Discov; 12(4): 265-286.

    [0602] 107. Muller, C. E., et al. (2011). Recent developments in adenosine receptor ligands and their potential as novel drugs. Biochim Biophys Acta; 1808(5): 1290-1308.

    [0603] 108. Congreve, M., et al. (2012). Discovery of 1,2,4-triazine derivatives as adenosine A(2A) antagonists using structure based drug design. Journal of medicinal chemistry; 55(5): 1898-1903.

    [0604] 109. Fishman, P., et al. (2012). Pharmacological and therapeutic effects of A3 adenosine receptor agonists. Drug Discov Today; 17(7-8): 359-366.

    [0605] 110. Dore, A. S., et al. (2011). Structure of the adenosine A(2A) receptor in complex with ZM241385 and the xanthines XAC and caffeine. Structure; 19(9): 1283-1293.

    [0606] 111. Hino, T., et al. (2012). G-protein-coupled receptor inactivation by an allosteric inverse-agonist antibody. Nature; 482(7384): 237-240.

    [0607] 112. Jaakola, V. P., et al. (2008). The 2.6 angstrom crystal structure of a human A2A adenosine receptor bound to an antagonist. Science; 322(5905): 1211-1217.

    [0608] 113. Lebon, G., et al. (2015). Molecular Determinants of CGS21680 Binding to the Human Adenosine A2A Receptor. Mol Pharmacol; 87(6): 907-915.

    [0609] 114. Lebon, G., et al. (2012). Agonist-bound structures of G protein-coupled receptors. Current opinion in structural biology; 22(4): 482-90.

    [0610] 115. Liu, W., et al. (2012). Structural basis for allosteric regulation of GPCRs by sodium ions. Science; 337(6091): 232-236.

    [0611] 116. Fenalti, G., et al. (2014). Molecular control of delta-opioid receptor signalling. Nature; 506(7487): 191-196.

    [0612] 117. Zhang, C., et al. (2012). High-resolution crystal structure of human protease-activated receptor 1. Nature; 492(7429): 387-392.

    [0613] 118. Murphree, L. J., et al. (2002). Human A(2A) adenosine receptors: high-affinity agonist binding to receptor-G protein complexes containing Gbeta(4). Mol Pharmacol; 61(2): 455-462.

    [0614] 119. Manglik, A., et al. (2015). Structural Insights into the Dynamic Process of beta2-Adrenergic Receptor Signaling. Cell; 161(5): 1101-1111.

    [0615] 120. Carpenter, B., et al. (2016). Engineering a minimal G Protein to facilitate crystallisation of G protein coupled receptors in their active conformation. Submitted.

    [0616] 121. Ballesteros, J. A., et al. (1995). Integrated methods for the construction of three dimensional models and computational probing of structure function relations in G protein-coupled receptors. Methods in Neurosciences; 25: 366-428.

    [0617] 122. Park, J. H., et al. (2008). Crystal structure of the ligand-free G-protein-coupled receptor opsin. Nature; 454(7201): 183-187.

    [0618] 123. Krumm, B. E., et al. (2015). Structural prerequisites for G-protein activation by the neurotensin receptor. Nat Commun; 6: 7895.

    [0619] 124. White, J. F. et al. (2012). Structure of the agonist-bound neurotensin receptor. Nature; 490(7421): 508-513.

    [0620] 125. Leslie, A. G. (2006). The integration of macromolecular diffraction data. Acta Crystallogr D Biol Crystallogr; 62(Pt 1): 48-57.

    [0621] 126. Evans, P. R., et al. (2013). How good are my data and what is the resolution? Acta Cryst. D Biol Crystallogr; 69(Pt 7): 1204-1214.

    [0622] 127. McCoy, A. J., et al. (2007). Phaser crystallographic software. J Appl Crystallogr; 40(Pt 4): 658-674.

    [0623] 128. Murshudov, G. N, et al. (2011). REFMAC5 for the refinement of macromolecular crystal structures. Acta Crystallogr D Biol Crystallogr; 67(Pt 4): 355-367.

    [0624] 129. Emsley, P., et al. (2010). Features and development of Coot. Acta Crystallogr D Biol Crystallogr; 66(Pt 4): 486-501.

    EXAMPLE 5

    Further mini-G proteins

    [0625] Summary

    [0626] The first mini-G protein developed was mini-G.sub.s. Here we extend the family of mini-G proteins to include mini-G.sub.olf, mini-G.sub.i1, mini-G.sub.o1 and the chimeras mini-G.sub.s/q and mini-G.sub.s/i. The mini-G proteins were shown to couple to relevant GPCRs and to form stable complexes with purified receptors that could be purified by size exclusion chromatography. Agonist-bound GPCRs coupled to a mini-G protein showed higher thermal stability compared to the agonist-bound receptor alone. Fusion of GFP at the N-terminus of mini-G proteins allowed receptor coupling to be monitored by fluorescence-detection size exclusion chromatography (FSEC) and, in a separate assay, the affinity of mini-G protein binding to detergent-solubilised receptors was determined. This work provides the foundation for the development of any mini-G protein and, ultimately, for the structure determination of any GPCR in a fully active state.

    [0627] Introduction

    [0628] The concept of mini-G proteins shows great promise for accelerating the rate of structure determination of GPCRs in their active states. However, there are four families of G? subunits (FIG. 28; G?.sub.s, G?, G?.sub.q, and G?.sub.12) that show different specificities for various GPCRs [24]. Thus to be truly useful as tools in structural biology, at least one member from each family needs to be converted into a mini-G protein. Here we report the development of mini-G proteins for all the major G? families. We also describe five different assays that can be used to characterize the binding of the mini-G proteins to GPCRs and show in three cases that the complexes can be purified by size exclusion chromatography. The two different methodologies for generating the mini-G proteins can be applied easily to any other G? subunit, opening the doorway to studies on potentially any GPCR from any species.

    [0629] Materials and Methods

    [0630] Ligands

    [0631] The ?.sub.1-adrenergic receptor (?.sub.1AR) agonist isoproterenol hydrochloride and inverse agonist ICI118551 hydrochloride were from Sigma-Aldrich. The adenosine A.sub.2A receptor (A.sub.2AR) agonist NECA and antagonist ZM241385 were also from Sigma Aldrich. Serotonin 5HT.sub.1B receptor (5HT.sub.1BR) agonist donitriptan hydrochloride and selective antagonist SB224289 hydrochloride were from Santa Cruz Biotechnology; the agonist sumatriptan succinate was from Cayman chemical. Angiotensin II receptor (AT.sub.1R) agonist angiotensin II was from Tocris. All radioactive ligands were from PerkinElmer.

    [0632] GPCR Constructs, Expression and Purification

    [0633] Human Adenosine A.sub.2A Receptor (A.sub.2aR)

    [0634] Two different A.sub.2AR constructs were used during this work. For SEC experiments using purified receptor, an A.sub.2AR construct was used that contained an N-terminal thioredoxin fusion protein to increase the molecular weight of the receptor. Without this fusion protein, A.sub.2AR and the mini-G protein had identical mobility on SDS-PAGE, thus making it difficult to visualise the separate components when analyzing a complex. The thioredoxin-A.sub.2AR fusion protein consisted of an N-terminal cleavable leader sequence (gp67), His10 tag and TEV protease cleavage site, followed by thioredoxin, which was connected to wild-type human A.sub.2AR (residues 6-316) through an EAAAKA linker. A.sub.2AR contained the N154A mutation to remove a potential N-linked glycosylation site. For all other experiments, a C-terminally truncated human A.sub.2AR construct was used (residues 1-317), which contained a C-terminal His10 tag and TEV protease cleavage site and the N154A mutation to remove the potential N-linked glycosylation site. Both constructs were expressed using the baculovirus expression system as described previously [19] (see Example 4). Cells were harvested by centrifugation 72 hours post infection, resuspended in hypotonic buffer (20 mM HEPES pH 7.5, 1 mM EDTA, 1 mM PMSF), flash-frozen in liquid nitrogen and stored at ?80? C. until use. Purification of the receptor was performed in DDM using Ni.sup.2+-affinity chromatography followed by SEC essentially as described previously [19].

    [0635] Turkey ?.sub.1-Adrenergic Receptor (?.sub.1AR)

    [0636] A truncated version of wild type turkey ?.sub.1AR (construct ?AR6; [25]) contained truncations at the N-terminus and the C-terminus and a C-terminal His6 tag for purification [25], and was expressed using the baculovirus expression system at 27? C. as described previously [26]. Cells were harvested by centrifugation 48 hours post infection, resuspended in hypotonic buffer (20 mM Tris HCl pH 8, 1 mM EDTA, 1 mM PMSF), flash-frozen in liquid nitrogen and stored at ?80? C. until use.

    [0637] Human Anqiotensin Type II Receptor 1 (AT.sub.1R)

    [0638] Wild type AT.sub.1R (residues 1-359) had a C-terminal factor X cleavage site followed by GFP and a His10 tag for purification, and was expressed using the tetracycline-inducible mammalian expression system as a stable cell line in HEK293 cells [27]. Cells were grown in DMEM containing 5% tetracycline-free FBS until they were 80% confluent and then tetracycline was added to a final concentration of 1 ?g/ml. Cells were grown for 24 hours and then harvested, and resuspended in PBS, flash frozen in liquid nitrogen and stored at ?80? C. until use.

    [0639] Rat Neurotensin Receptor (NTSR1)

    [0640] NTSR1 was expressed as described previously [13]. The baculovirus construct NTSR1 consisted of the hemagglutinin signal peptide and the Flag tag, followed by the wild-type rat NTSR1 (residues 43-396) and a C-terminal His10 tag. Recombinant baculovirus was generated using a modified pFastBac1 transfer plasmid (Invitrogen). Trichoplusia ni cells were infected with recombinant virus, and the temperature was lowered from 27? C. to 21? C. Cells were harvested by centrifugation 48 hours post infection, resuspended in hypotonic buffer (10 mM HEPES pH 7.5, 10 mM MgCl.sub.2, 20 mM KCl), flash-frozen in liquid nitrogen and stored at ?80? C. until use.

    [0641] Human Serotonin 5HT.sub.1B Receptor (5HT.sub.1BR)

    [0642] Wild-type 5HT.sub.1BR (residues 34-390) was modified to contain a C-terminal TEV cleavage site and a His10 tag, cloned into plasmid pBacPAK8 and recombinant baculoviruses were prepared using the FlashBAC ULTRA system (Oxford Expression Technologies). Trichoplusia ni cells were grown in ESF921 media (Expression Systems) to a density of 3?10.sup.6 cells/ml, infected with 5HT.sub.1BR baculovirus and incubated for 48 h at 27? C. for expression. Purification of the receptor was performed in either DDM or LMNG using Ni.sup.2+-affinity chromatography followed by SEC.

    [0643] Expression, Purification and Stability of G Protein Subunits

    [0644] For constructs see FIGS. 29 and 35-37. Expression, purification and stability measurements by differential scanning fluorimetry (DSF) of the mini-G proteins as well as the non-lipidated G?.sub.1?.sub.2 dimer, were performed following the protocols described in Example 1. The stability of mini-G proteins was also determined in detergent using native DSF (NanoTemper Prometheus). Mini-G proteins (2 mg/ml) in 50 mM HEPES pH 7.5 (KOH), 20 mM MgCl2, 50 mM NaCl, 1 ?M GDP were mixed with either no detergent (control), 0.1% LMNG or 0.1% DDM. Samples were incubated on ice (minimum 30 min) prior to heating on the Prometheus (20% excitation, 15? C.-85? C., rate of 2.0? C./min) and the onset of scattering determined.

    [0645] SEC of the A.sub.2AR-Mini-Gs Complex

    [0646] The thioredoxin fusion construct of A.sub.2AR was purified in DDM, mini-G protein was added in excess at a 1:1.2 molar ratio, incubated overnight on ice and then loaded onto a Superdex S200 10/300 size exclusion column (10 mM HEPES pH 7.5, 100 mM NaCl, 1 mM MgCl.sub.2, 100 ?M NECA, 0.02% DDM; 4? C., 0.5 ml/min). Peak fractions were analysed by SDS-PAGE.

    [0647] FSEC Assays

    [0648] (1) A.sub.2AR

    [0649] Insect cell membranes containing a total of 20 ?g (560 pmol) wild-type A.sub.2aR (20?10.sup.6 cells) were solubilized for 30 min on ice in 40 mM HEPES pH 7.5, 500 mM NaCl, 2 mM MgCl.sub.2, 2 U/mL apyrase (Sigma-Aldrich), and 0.5% (v/v) DDM in a final volume of 2 ml. Insoluble material was removed by ultracentrifugation (30 min, 4? C., 135,000?g). The supernatant was divided into aliquots for the subsequent assay. To 500 ?l of the supernatant was added either the agonist NECA or the inverse agonist ZM241385 (negative control), both at a final concentration of 60 ?M. GFP-mini-G.sub.s (6 ?g; 110 pmol) was then added and allowed to bind for 90 min on ice before loading 200 ?l onto a Superdex S200 10/300 size exclusion column (buffer 20 mM HEPES pH 7.5, 100 mM NaCl, 10 mM MgCl.sub.2, 1 ?M NECA or ZM241385, 0.03% DDM, 4? C., flow rate 0.45 ml/min). The control sample contained 6 ?g GFP-mini-G.sub.s only in 500 ?l assay buffer. GFP fluorescence was detected by a Hitachi fluorometer (mV) set to an excitation of 488 nm and an emission of 525 nm.

    [0650] (2) ?.sub.1AR

    [0651] Insect cell membranes containing a total of 8 ?g (178 pmol) wild-type ?.sub.1AR (30?10.sup.6 cells) were solubilized for 30 min on ice in 20 mM Tris-HCl pH 8, 500 mM NaCl, 5 mM MgCl.sub.2, 2 U/mL apyrase and 0.5% (v/v) DDM. Insoluble material was removed by ultracentrifugation (30 min, 4? C., 135,000?g). The supernatant was divided into aliquots for the subsequent assay. Isoprenaline (100 ?M final concentration) or ICI118551 (10 ?M final concentration) were added to 500 ?I of the supernatant. GFP-mini-G.sub.s (6 ?g) was then added and allowed to bind for 90 min on ice before loading 200 ?l onto a Superdex S200 10/300 size exclusion column (buffer 20 mM HEPES pH 7.5, 100 mM NaCl, 10 mM MgCl.sub.2, 1 ?M isoprenaline or ICI118551, 0.03% DDM, 4? C., flow rate 0.45 ml/min). The control sample contained 6 ?g GFP-mini-G.sub.s only in 500 ?l assay buffer.

    [0652] (3) 5HT.sub.1BR

    [0653] When detergent-solubilized unpurified receptor was used, insect cells expressing 610 pmol 5HT.sub.1BR (40?10.sup.6 cells) were resuspended in 20 mM HEPES pH 7.5, 100 mM NaCl, 10 mM MgCl.sub.2 to a final cell density of 20?10.sup.6 cells/ml and solubilized with 0.5% DDM (45 min, 4? C.). Insoluble material was removed by ultracentrifugation (30 min, 4? C., 135,000?g). The supernatant was divided into 900 ?l aliquots for the subsequent assay. GFP-mini-G.sub.o1 (5 ?g) was added with either donitriptan or SB224289, each to a final concentration of 100 ?M, and allowed to bind for 90 min on ice before loading 500?l onto a Superdex S200 10/300 size exclusion column. The control sample contained 5 ?g GFP-mini-G.sub.o1 in 500 82 l assay buffer.

    [0654] In some FSEC experiments, purified 5HT.sub.1BR was used. Donitriptan-bound, purified receptor (120 ?g; 3 nmol) in either LMNG or DDM was incubated for 90 min on ice with 4 ?g (60-80 pmol) either of GFP-mini-G.sub.i1, GFP-mini-G.sub.o1 or GFP-mini-G.sub.s (negative control) in a final volume of 450 ?l. Samples (200 ?l) were then loaded onto Superdex S200 10/300 size exclusion column (buffer 20 mM HEPES pH 7.5, 100 mM NaCl, 10 mM MgCl.sub.2, 1 ?M 0.03% DDM or 0.001% LMNG buffer, 4? C., flow rate 0.45 ml/min). Fluorescent Saturation Binding Assay (FSBA)

    [0655] (1) ?.sub.1AR

    [0656] Membranes prepared from insect cells expressing ?.sub.1AR (50?10.sup.6 cells) were solubilized in 20 mM Tris-HCl pH 8, 500 mM NaCl, 3 mM imidazole, 0.5% DDM (1 hour, 4? C., final volume 8 ml). Insoluble material was removed by ultracentrifugation (30 min, 4? C., 135,000?g) and the supernatant was divided into two aliquots. The agonist isoprenaline was added to one sample (final concentration 10 ?M) and the inverse agonist ICI118551 was added to the other (final concentration 1 ?M). Samples were then aliquoted 200 ?l per well into a black Ni.sup.2+-coated 96-well plate (Pierce; Thermo Fisher). The receptor was allowed to bind via its His tag for 1 h on ice. The supernatant was then aspirated and 200 ?l GFP-mini-G.sub.s at varying concentrations (0 to 2.8 ?M) were added and incubated for a further 90 min on ice. The supernatant was then removed by aspiration and each well washed 4 times with buffer A (10 ?M isoprenaline (agonist), 20 mM Tris-HCl pH 8, 100 mM NaCl, 1 mM MgCl.sub.2, 1 mg/mL BSA, 30 mM imidazole, 0.03% DDM,) or buffer B (1 ?M ICI118551 (inverse agonist), 20 mM Tris-HCl pH 8, 100 mM NaCl, 1 mM MgCl.sub.2, 1 mg/mL BSA, 30 mM imidazole, 0.03% DDM). Elution of the receptor-GFP-mini-G.sub.s complex from the sides of the well to make a homogeneous solution was performed with 200 ?l of the respective wash buffers that contained 300 mM imidazole. Fluorescence was then measured using a Pherastar plate reader (BMG Labtech, Inc.) with excitation at 485 nm and emission at 520 nm. ?F data (fluorescence agonist condition minus fluorescence antagonist condition) corresponding to specific binding were analysed by non-linear regression using GraphPad Prism version 5.0 (GraphPad Software, San Diego, Calif.) and apparent K.sub.D values derived from one site-specific binding analysis.

    [0657] (2) A.sub.2aR

    [0658] The assay was performed essentially as described above for ?.sub.1AR, but the buffer conditions were different. Solubilisation of insect cell membranes (40?10.sup.6 cells) was performed in 10 ml of 20 mM Tris-HCl pH 8, 500 mM NaCl, 10 mM imidazole and 0.5% DDM. After ultracentrifugation, the agonist NECA (10 ?M final concentration) was added to one supernatant sample and the inverse agonist ZM241385 (10 ?M final concentration) to the other. Washing buffers for A.sub.2aR were buffer C (10 uM NECA, 20 mM Tris-HCl pH 8, 100 mM NaCl, 1 mM MgCl2, 1 mg/mL BSA, 50 mM imidazole, 0.03% DDM) or buffer D (10 ?M ZM241385, 20 mM Tris-HCl pH 8, 100 mM NaCl, 1 mM MgCl2, 1 mg/mL BSA, 50 mM imidazole, 0.03% DDM).

    [0659] (3) 5HT.sub.1BR

    [0660] Insect cells expressing 5HT.sub.1BR (50?10.sup.6 cells) were solubilized with buffer containing 10 ?M Donitriptan, 20 mM Tris-HCl pH 8; 500 mM NaCl; 10 mM imidazole, 0.5% DDM (1 h, 4? C., final volume 6 ml). Insoluble material was removed by ultracentrifugation (30 min, 4? C., 135,000?g) and 200 ?l of supernatant was then aliquoted per well into a black Ni.sup.2+ coated 96-well plate. The receptor was allowed to bind via its His tag for 1 h on ice. The supernatant was then aspirated and 200 ?l either of GFP-mini-G.sub.o1, GFP-mini-G.sub.s/i1 or GFP-mini-G.sub.s (negative control) at varying concentrations (from 0 to 5 ?M) were added and incubated for a further 90 min on ice. The supernatant was then removed by aspiration and each well washed 4 times with buffer E (1 ?M Donitriptan, 20 mM Tris-HCl pH 8, 100 mM NaCl, 1 mM MgCl.sub.2, 1 mg/mL BSA, 50 mM imidazole, 0.03% DDM). Elution was carried out with 200 ?L of buffer E containing 300 mM imidazole. AF data (fluorescence G.sub.o1 condition minus fluorescence G.sub.s condition) corresponding to specific binding were analysed by non-linear regression using GraphPad Prism version 5.0 (GraphPad Software, San Diego, Calif.) and apparent KD values derived from one site-specific binding analysis.

    [0661] Competition Binding Assay

    [0662] Insect cells expressing 5HT.sub.1BR were resuspended in 1 ml of assay buffer (20 mM HEPES pH 7.5, 100 mM NaCl, 1 mM MgCl.sub.2, 1 mM ascorbate, 20 ?M pargyline) at a final concentration of 2?10.sup.6 cells/ml. Cells were sheared by 10 passages through a bent 26 G needle. The supernatant was diluted 10-fold in assay buffer and aliquots (900 ?l) taken for each sample. Mini-G protein (100 ?l, 25 ?M final concentration) or buffer (negative control) was added. The mixture was aliquoted into a 0.2 ml PCR plate, 96 ?l per well. Sumatriptan (12 ?l), prepared in assay buffer also containing 2 U/ml apyrase, was added to each well (final concentrations in the range of 100 pM to 1 mM). Non-specific binding was determined in the presence of 100 ?M donitriptan. Samples were mixed and incubated at 4? C. for 2 h. [.sup.3H]-GR125743 (12 ?l) was added at its apparent K.sub.D (10 nM) concentration. Samples were mixed and incubated at 4? C. for 2 h before filtering through 96-well glass fibre GF/B filter plate (Merck Millipore) and washing with ice-cold assay buffer. Filters were dried, punched into scintillation vials and 4 ml Ultima Gold scintillant (Perkin Elmer) were added. Radioactivity was quantified by scintillation counting (1 min per sample) using a Tri-Carb counter (Perkin Elmer), and K.sub.i values were determined using GraphPad Prism version 5.0 (GraphPad Software, San Diego, Calif.).

    [0663] Thermostability Assay

    [0664] (1) A.sub.2AR

    [0665] Membranes from Trichoplusia ni cells expressing wild-type human A.sub.2AR were resuspended in T.sub.m, buffer (25 mM HEPES pH 7.5, 100 mM NaCl, 1 mM MgCl.sub.2) and homogenized by ten passages through a 26 G needle. Mini-G protein was added at a final concentration of 25 ?M. .sup.3H-NECA and unlabeled NECA were mixed in a molar ratio of 1:5 and added to the membranes to give a final concentration of 1 ?M (approximately ten-fold above the apparent K.sub.D). The samples were incubated at room temperature for 1 h, then chilled on ice for 30 min. Decylmaltoside (DM) was added to a final concentration of 0.13%, and samples were incubated on ice for 1 h. Cell debris and insoluble material were removed by centrifugation (5 min, 20,000?g, 4? C.) and the supernatant was aliquoted (120 ?l) into PCR strips. Samples were heated to the desired temperature for exactly 30 min, then quenched on ice for 30 min. Samples (50 ?l) were loaded onto gel-filtration resin (Toyopearl HW-40F) packed into a 96-well filter plate (Millipore), which was centrifuged to separate receptor-bound from free radioligand [28]. Nonspecific binding was determined in the presence of 200 ?M unlabelled NECA. Radioactivity was quantified by liquid scintillation counting using a MicroBeta TriLux scintillation counter (PerkinElmer). Data were analysed by nonlinear regression using GraphPad Prism software. Apparent T.sub.m values were derived from sigmoidal dose-response analysis performed by non-liner regression. Results represent the mean?SEM of two independent experiments, performed in duplicate.

    [0666] (2) NTSR1

    [0667] Cell pellets from 10 ml of insect cell cultures were resuspended in 1.8 ml buffer containing DDM to give a final buffer composition of 50 mM TrisHCl pH 7.4, 100 mM NaCl, 1 mM MgCl2, 1% (w/v) DDM. The samples were placed on a rotating mixer at 4? C. for 1 hour. Cell debris and non-solubilized material were removed by ultracentrifugation (152,800?g, 4? C., 30 min), and the supernatant containing detergent-solubilized NTSR1 was used to test for thermal stability in the presence of NTS and mini-G proteins. For thermal denaturation curves, the supernatants were diluted 6.67-fold into assay buffer (50 mM TrisHCl pH 7.4, 100 mM NaCl, 1 mM MgCl.sub.2) containing 22.5?M mini-G protein and 10 nM .sup.3H-NTS and incubated for 1 hour on ice. After addition of apyrase (0.25 units/ml, NEB), the sample was placed on ice for an additional 30 min. Samples (120 ?l aliquots) were exposed to different temperatures between 0? C. and 60? C. for 30 min and placed on ice. Separation of receptor-ligand-mini-G protein complex from free .sup.3H-NTS (100 ?l) was achieved by centrifugation-assisted gel filtration (spin assay) using Bio-Spin 30 Tris columns (BioRad), equilibrated with RDB buffer [50 mM TrisHCl pH 7.4, 1 mM EDTA, 0.1% (w/v) DDM, 0.2% (w/v) CHAPS, 0.04% (w/v) CHS], essentially as described previously [29]. Control reactions on ice were recorded at the start and at the end of each denaturation experiment. The percentage of activity remaining after heat exposure was determined with respect to the unheated control. Data were analyzed by nonlinear regression using a Boltzmann sigmoidal equation in the Prism software (GraphPad).

    [0668] (3) AT.sub.1R

    [0669] HEK 293 cells expressing wild type AT.sub.1R were resuspended in a radioligand binding assay buffer (50 mM HEPES pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.1% BSA, 40 ?g/ml bacitracin) and homogenized by sonication (4 sec pulse). Mini-G protein and apyrase were added at a final concentration of 25 ?M and 0.1 units/ml, respectively. .sup.125I-Ang II and unlabeled Ang II were added at a concentration of 0.5 nM and 25 nM respectively (approximately 50 times the apparent KD value). The sample was incubated at room temperature (20? C.) for an hour, chilled on ice for 10 minutes and then digitonin was added to a final concentration of 1% and incubated on ice for an hour. Insoluble material was removed by centrifugation (2 min, 20,000?g, 4? C.). The reaction mix was split into a number of 115 ?l aliquots and each was incubated at various temperatures for exactly 30 minutes. The reactions were then quenched on ice for 5 minutes. .sup.125I-Ang II bound to AT.sub.1R was separated from unbound .sup.125I-Ang II using centrifugation-assisted gel filtration column, essentially as described previously [27]. Non-specific binding was determined using a 500-fold excess of cold ligand. Radioactivity was measured using liquid scintillation counting. Data was analysed by non-linear regression using GraphPad prism software and apparent T.sub.m values were derived by non-linear regression of the sigmoidal dose-response curve.

    [0670] Results and Discussion

    [0671] Initial Development of New Mini-G Proteins

    [0672] The recently designed minimal G protein, mini-G.sub.s [23], comprises only the G?GTPase domain from G.sub.s and 3 deletions and 7 mutations to thermostabilise it (FIG. 29). Mini-G.sub.s coupled to both the ?.sub.1-adrenergic receptor (?.sub.1AR) and the adenosine A.sub.2A receptor (A.sub.2AR), and resulted in the same increase in agonist affinity as observed for heterotrimeric G.sub.s coupling [19, 23 and Examples 1 and 4]. However, there are 4 families of G? subunits (FIG. 28) and GPCRs couple to distinct G proteins depending upon their physiological function [24]. Therefore, to provide tools for the structure determination of any GPCR in its fully active state, it was necessary to develop versions of mini-G proteins for at least one member from each of the other families. All of the mutations and deletions used to create mini-G.sub.s are located within conserved regions of the G? subunit (FIG. 29). Therefore, in theory, these mutations were potentially transferable to the other G? families, allowing the production of a panel of mini-G proteins capable of coupling to any GPCR.

    [0673] Archetypical members from each G? family were selected and include the following: Golf from the G.sub.s family, G.sub.i1, G.sub.o1, G.sub.z and G.sub.t from the G.sub.i family, G.sub.q and G.sub.16 from the G.sub.q/11 family, and G.sub.12 from the G.sub.12/13 family. The mutations required to convert G?.sub.s into mini-G.sub.s were transferred en bloc to the selected G? proteins to produce a mini-G protein version of each (FIG. 29). These mutations were the following: (i) deletion of all amino acid residues N-terminal of Ile/Leu.sup.HN43; (ii) deletion of the ?-helical domain between residues H.sup.H1S2.12 and the Thr, three residues N-terminal to Ile.sup.So.1, and replacement with an 8 amino acid residue linker; (iii) deletion of 10 amino acid residues of switch III between Tyr.sup.S4H3.4 and Asn/Ser.sup.S4H3.15; (iv) mutating 7 residues to D49.sup.S1H1.3, N50.sup.S1H1.4, D249.sup.S4.7, D252.sup.S4H3.3, D272.sup.H3.8, A372.sup.H5.4, I375.sup.H5.7. Residue numbers are for G?.sub.s and superscripts refer to the CGN system for comparing residues in G proteins [6]. Initial characterization of each mini-G protein was performed by assessing expression in Escherichia coli and purification by Ni.sup.2+-affinity chromatography and size exclusion chromatography (SEC). Four out of the eight engineered mini-G proteins (mini-G.sub.olf, mini-G.sub.11, mini-G.sub.o1 and mini-G.sub.12) fulfilled these initial criteria i.e. they were all stable enough in their basal conformation to allow high-yield expression and purification. The yield of purified mini-G protein per litre of culture and their stability as measured by differential scanning fluorimetry (in parentheses) are as follows: mini-G.sub.s, 100 mg/L (65? C.); mini-G.sub.olf, 80 mg/L (65? C.); mini-G.sub.o1 100 mg/L (64? C.); mini-G.sub.12 25 mg/L (73? C.). The worst expressed of the four new mini-G proteins was mini-G.sub.i1, so an additional mutation G217D was incorporated and the truncation at the N-terminus shortened, which increased the yield of pure protein to 12 mg/L, although the stability was only 48? C. Thus, mini-G.sub.olf, mini G.sub.i1, mini-G.sub.o1 and mini-G.sub.12 were all of sufficient stability to be used to test their ability to couple to relevant GPCRs. The amino acid sequences of the mini-G proteins are given in FIG. 35.

    [0674] Four mini-G proteins were not expressed in E. coli, namely mini-G.sub.z, mini-G.sub.t, mini-G.sub.16 and mini-G.sub.q (amino acid sequences are given in FIG. 36). The failure of the en bloc transfer of the deletions and mutations from mini-G.sub.s, despite the high conservation of G protein structures, highlights our lack of understanding of the folding of these proteins. Indeed, it is well known that an accessory factor, Ric8, is required for the efficient folding of G.sub.q in mammalian cells [30], and other unknown factors may also be required. For the purpose of this study, we therefore did not perform any further development of mini-G.sub.t1 and mini-G.sub.z, given that two other members of the G.sub.i family, mini-G.sub.o1 and mini-G.sub.t1, already gave stable mini-G proteins. In contrast, as neither member of the G.sub.q family tested produced a stable mini-G protein, we decided to develop alternative strategies to make a usable version of mini-G.sub.q, whilst further work on mini-G.sub.16 was terminated. The successful engineering of a version of mini-G.sub.q chimera will be discussed later.

    [0675] Assay Development and Validation using the Mini-Gs System

    [0676] The ultimate goal of developing mini-G proteins is the structure determination of GPCRs in the fully active state bound to an agonist and a mini-G protein. In the simplest format, this necessitates the purification of the GPCR in detergents and forming the G protein-GPCR complex from the purified components in vitro. It was therefore essential to devise some simple assays that could assess whether a mini-G protein had coupled to a GPCR in detergent solution. This turned out to be not as straightforward as originally anticipated due to the potential instability of either the GPCR and/or mini-G protein in either their inactive and/or active conformations. These issues were not obvious when the original work on the development of mini-G.sub.e was performed, because mini-G.sub.s is one of the most stable mini-G proteins developed and also the thermostabilised ?.sub.1-adrenergic receptor ?.sub.1AR) and the wild type adenosine A.sub.2A receptor (A.sub.2AR) were both much more stable than other GPCRs. We therefore developed five separate assays for assessing whether a mini-G protein coupled to a GPCR and/or formed a stable complex in detergent. These were all first tested using mini-G.sub.s coupling to ?.sub.1AR and A.sub.2AR. Each assay has its own limitations, which are often apparent in the subsequent sections where they were used on less stable receptors and the newly developed mini-G proteins, and these are discussed below. The five different assays that were used are the following: (i) agonist affinity shift assay; (ii) thermostability assay (TSA); (iii) fluorescence-based saturation binding analysis (FSBA) of GFP-mini-G protein binding; (iv) fluorescence-detection size exclusion chromatography (FSEC); (v) size exclusion chromatography (SEC) of purified complex. A brief rationale for the use of each assay with their advantages and disadvantages are given below.

    [0677] (i) Agonist Affinity Shift Assay

    [0678] The development of mini-G.sub.s relied on the agonist affinity shift assay to identify those mutants that coupled to ?.sub.1AR [23]. It is generally considered that the defining feature of G protein coupling is an increase in the affinity of an agonist for the G protein-GPCR complex compared to the GPCR alone. For example, wild type ?.sub.2AR binds an agonist 100-fold more tightly when coupled to a G protein than the receptor alone [31]. However, the shift in agonist affinity in other receptors is often considerably smaller than that observed for ?.sub.2AR, such as the 10-fold shift in agonist affinity observed in ?.sub.1AR [31] and may be entirely absent eg NTSR1. However, the advantage of this assay is that it can be performed using standard pharmacological procedures in high-throughput, using receptors in either membrane preparations or solubilized in detergent. Assays may use either a radiolabelled agonist in saturation binding experiments or, more usually, a radiolabelled antagonist in competition binding experiments [19, 23 and Examples 1 and 4] (and see experiments below on the serotonin 5HT.sub.1B receptor). The advantage of this assay is that it is very sensitive and can be performed on membrane-bound receptors i.e. in a format where the receptor is most stable in all conformations. The disadvantage of this assay is that some receptors may not show a shift in agonist affinity when coupled to a G protein.

    [0679] (ii) Thermostability Assay

    [0680] The thermostability of a detergent-solubilised GPCR depends upon the type of detergent used and whether the receptor is either ligand-free, agonist-bound or antagonist-bound [32, 33]. In addition, the receptor stability tends to be increased by an increase in affinity and/or decrease in the off-rate of the ligand [34]. Often, the agonist bound state is one of the least stable conformations of a receptor, presumably because agonists increase the probability of transitions to a fully active state. In the inactive state there is close packing of the intracellular surface of the transmembrane a-helices. Upon activation, the outward movement of helices 5 and 6 disrupts this close packed structure and creates a crevice where the C-terminus of the G protein binds, thus allowing G protein coupling [35]. The structures of non-rhodopsin GPCRs in the fully active state have been determined only when they have been stabilized through binding of a heterotrimeric G protein [2], a conformation-specific nanobody [14, 17, 18] or a mini-G protein [19]. The interface between a GPCR and a G protein is over 1000 ?.sup.2 [2, 19], and is therefore predicted to increase the thermostability of the agonist-bound GPCR-G protein complex compared to the agonist-bound GPCR. This was observed for both ?.sub.1AR and A.sub.2AR, which were consistently more stable in the agonist-bound state when coupled to mini-G.sub.s in a variety of different detergents compared to when mini-G.sub.s was absent [19, 23 and Examples 1 and 4].

    [0681] A typical thermostability assay measures how much of a radiolabelled agonist remains bound to a detergent-solubilised receptor after heating at different temperatures for 30 minutes [33]. The advantage of this assay is that it is fast and high-throughput and can be performed in any detergent of choice. Another advantage is that the agonist-GPCR-mini-G protein complex can be pre-formed in membranes, which may stabilise the receptor upon detergent solubilisation, allowing the assay to be performed. If there is a shift in thermostability in the presence of a mini-G protein, then this is strongly suggestive of binding or coupling.

    [0682] (iii) Fluorescence-Detection Size Exclusion Chromatography (FSEC)

    [0683] FSEC is a rapid methodology for assessing whether a membrane protein fused to GFP is stable in detergent by performing SEC on an unpurified detergent solubilisate and monitoring GFP fluorescence in the eluate [36]. A membrane protein stable in detergent gives a symmetrical peak at a size consistent with the molecular weight of the membrane protein plus the mass of specifically bound detergent and lipid. By fusing GFP to the N-terminus of mini-G proteins (FIG. 37), it was possible to use FSEC to monitor whether a stable complex was formed between the mini-G protein and a GPCR. The GFP-mini-G.sub.s fusion protein has a molecular weight of 54 kDa and migrated with a retention volume of 15.1 ml on FSEC. When this was mixed with either DDM-solubilised ?.sub.1AR or A.sub.2AR in the presence of an agonist, then an additional peak was observed at 12.1-12.5 ml (FIG. 30a,c), which was consistent with the molecular weight of the detergent-solubilised receptor bound to GFP-mini-G.sub.s (?180 kDa). This additional peak was not observed if the receptors were bound to an inverse agonist. An additional peak was sometimes observed at a retention volume of 8 ml, which corresponds to the void volume of the SEC column and was due presumably to aggregates of GFP-mini-G.sub.s.

    [0684] The advantage of this assay is that it is a quick assessment of whether a GPCR forms a complex with a mini-G protein, because the receptor does not need to be purified and the SEC experiment takes under an hour. However, the major limitation is that only small amounts of GFP-mini-Gs can be used per experiment to avoid saturation of the detector and producing a very broad peak that would obscure the presence of the complex between the GPCR and GFP-mini-G protein. Thus the concentration of the mini-G protein is below its K.sub.D for association with a receptor and therefore the assay is not quantitative. In addition, the receptor-mini-G protein complex must be detergent-stable for a peak to be observed. Many GPCR-G protein complexes are too unstable to be observed in DDM and therefore it is essential to assess milder detergents such as LMNG (see section on the serotonin 5HT.sub.1B receptor).

    [0685] (iv) Fluorescence-Based Saturation Binding Analysis of Mini-G Protein Binding

    [0686] To determine the affinity of mini-G protein binding to a receptor, the fluorescence-based saturation binding assay (FSBA) was developed. In this assay, the amount of the GFP-mini-G protein specifically bound to an immobilized receptor was determined using a fluorescent plate reader. As proof of principle, DDM-solubilized ?.sub.1AR or A.sub.2AR were immobilized onto Ni.sup.2+-coated wells of a 96-well plate via their C-terminal poly-histidine tag, in the presence of either an agonist or inverse agonist. GFP-mini-G.sub.s was then added at increasing concentrations. After washing to remove any non-specifically bound GFP-mini-G.sub.s, the amount of GFP-mini-G.sub.s fluorescence was measured (FIG. 30b,d). GFP-mini-G.sub.s showed a specific saturated binding to the receptor with apparent K.sub.D values of 201?1 nM (n=2) and 428?24 nM (n=2) for GFP-mini-G.sub.s binding to ?.sub.1AR and A.sub.2AR, respectively.

    [0687] The FSBA is a simple assay for determining the affinity of mini-G protein binding to a receptor in vitro. However, it must be appreciated that the apparent affinity determined may be specific only for the conditions in the assay. In particular, the type of detergent used may have a profound effect on the affinity, especially if it slightly destabilizes the active state of the receptor. The agonist may also affect the apparent affinity of the mini-G protein, depending on how effective the agonist is in stabilizing the active state of the receptor. However, the FSBA remains a useful tool for biophysical analyses of mini-G protein binding to a receptor.

    [0688] (v) Size Exclusion Chromatography (SEC)

    [0689] The ultimate biochemical assay for observing coupling of mini-G proteins to a receptor is combining the purified components in vitro and then observing the co-elution of the relevant proteins on SEC [23 and Example 1]. Purified A.sub.2AR and purified mini-G.sub.s were mixed at a molar ratio of 1:1.2 in the presence of the agonist NECA, the complex allowed to form and then separation was performed by SEC. The A.sub.2AR-mini-G.sub.s complex resolved as a predominant peak with an apparent molecular weight of 153 kDa compared with 133 kDa for the receptor alone and 22 kDa for mini-G.sub.s alone. SDS-PAGE analysis confirmed the presence of both A.sub.2AR and mini-G.sub.s in fractions from the 153 kDa complex (FIG. 30e).

    [0690] The advantage of using purified components and SEC for analyzing complex formation is that complex formation is observed unambiguously. The conditions for complex formation can be refined and the stability of the complex can be assessed readily after a period of days by repeating the SEC. These data are essential for successful determination of the structure of a GPCR-mini-G protein complex. The disadvantage of this assay is that sufficient quantities of purified receptor are required and this may be limiting in the initial stages of a project.

    [0691] Characterisation of Mini-G Proteins

    [0692] Mini-G.sub.olf Couples and Stabilizes A.sub.2AR

    [0693] The GTPase domains of G.sub.olf and G.sub.s share 87% sequence identity (80% for the full length ? subunits) and both G proteins couple to A.sub.2AR [37]. Of the 17 amino acid residues in mini-G.sub.s that make direct contact to residues in A.sub.2AR in the crystal structure of the A.sub.2AR mini-G.sub.s complex [19 and Example 4], all of these residues are identical except that two Arg residues in G.sub.s are replaced with two Lys residues in G.sub.olf. Despite the high degree of sequence homology between these two isoforms, G?.sub.olf is far more difficult to overexpress than G?.sub.s, in fact, the only method reported to produce functional G?.sub.olf is co-expression with the molecular chaperone RIC8B in insect cells [38]. Therefore, we constructed mini-G.sub.olf to investigate whether the mini-G protein version would be better expressed that native a subunit. Mini-G.sub.olf was constructed by transferring the 7 point mutations and 3 deletions from mini-G.sub.s (FIG. 29) and mini-G.sub.olf was highly expressed in E. coli and as stable as mini-G.sub.s. The coupling of mini-G.sub.olf to A.sub.2AR was assessed by SEC of the complex assembled in vitro from purified proteins and a thermostability assay [19, 23 and Examples 1 and 4].

    [0694] Purified NECA-bound A.sub.2AR was mixed with mini-G.sub.olf and analysed by SEC and SDS-PAGE (FIG. 31a). The apparent molecular weight of mini-G.sub.olf was 23 kDa (17.1 ml; theoretical molecular weight 26 kDa) and the apparent molecular weight of purified A.sub.2AR in DM was 133 kDa (13.3 ml). The complex A.sub.2AR-mini-G.sub.olf resolved as a predominant peak with an apparent molecular weight of 153 kDa (13 ml) and contained both A.sub.2AR and mini-G.sub.olf. Mini-G.sub.olf also stabilized agonist-bound DM-solubilised A.sub.2AR, with mini-G.sub.olf-coupled A.sub.2AR showing an apparent T.sub.m of 32.5?1? C. in comparison with 26.9?0.3? C. for the receptor alone (FIG. 31b). This stability was similar to that obtained with mini-G.sub.s (32.9? C.) under the same conditions [19 and Example 4].

    [0695] The results with mini-Golf were very encouraging in terms of both the transferability of the mutations, the expression and stability of the mini-G.sub.olf and the stability of the A.sub.2AR-mini-G.sub.olf complex. Thus where there is a high degree of homology between G proteins, then there is good transferability of the mutations, as was previously observed for the transfer of thermostabilising mutations between GPCRs [39]. These data also suggested that even if the native a subunit is poorly expressed the mini-G protein version may be highly expressed and very stable.

    [0696] Development of Chimeric Mini-G.sub.s/q, to Study G.sub.q-Coupled Receptors

    [0697] The expression of mini-G.sub.q in E. coli was unsuccessful. One possibility to explain this is that efficient folding of G.sub.q in vivo is dependent on the molecular chaperone Ric8 [30] and that mini-G.sub.q had a similar requirement. Indeed, co-expression of Ric8 with mini-G.sub.q in the baculovirus expression system led to the overproduction of mini-G.sub.q. However, upon purification of mini-G.sub.q it was not possible to dissociate Ric8 (results not shown), suggesting that the mini-G.sub.q was perhaps not correctly folded and/or was very unstable. Given the lack of success in transferring the mini-G protein mutations from G.sub.s to G.sub.q, another strategy was developed.

    [0698] The second strategy used to try and develop mini-G.sub.q was to transfer the specificity determinants of G.sub.q onto mini-G.sub.s. It is well established that the C-terminal region of a G? subunit forms the main receptor binding site [40] and is one of the main determinants of coupling specificity [41, 42]. Mutating as few as 3-5 amino acids at the C-terminus of the G alpha subunit has been shown to switch the specificity of coupling to some GPCRs [41, 42]. However, the two GPCR-G protein structures published to date [2, 19] revealed an extensive interface between the receptors and G?, suggesting that other regions of the G protein may also play a role in specificity. Recent in vivo FRET studies suggest that residues within the ?5 helix, but distal to the five C-terminal residues, strongly influence specificity [43].

    [0699] Mini-G.sub.s did not couple to any of the G.sub.q-coupled receptors tested (results not shown). We then evaluated a number of mini-G.sub.si.sub.q chimeras (FIG. 38) for both gain of binding to G.sub.q-coupled receptors (FIG. 32a,b) and loss of binding to the cognate G.sub.s-coupled receptor A.sub.2AR, predominantly using thermostability assays (FIG. 32c) and SEC (FIG. 39). First, the chimera mini-G.sub.s/q57 was constructed in which the five C-terminal amino acids of mini-G.sub.s (Q.sup.H5.22YELL.sup.H5.26) were changed to those found in G?.sub.q, which required three mutations (Q390E.sup.5.22 , E392N .sup.H5.24 and L394V.sup.H5.26). We did not observe any detectable interaction between this construct and any of the G.sub.q receptors tested (FIG. 32a,b). Furthermore, a complex between mini-G.sub.s/q57 and A.sub.2AR was still observed (FIG. 32c and FIG. 39), suggesting that the mutations were insufficient to change the specificity of G.sub.s to G.sub.q. Next, the chimera mini-G.sub.s/q58 was constructed in which the final 19 amino acid residues in the ?5 helix of mini-G.sub.s (Phe376.sup.H5.8-Leu394.sup.5.26) were changed to those in G?.sub.q; this required 13 mutations (N377A.sup.H5.9, D378A.sup.H5.10,C379V.sup.H5.11, R380K.sup.H5.12, I382T.sup.H5.14, Q384L.sup.H5.16, R385Q.sup.H5.17, M386L.sup.H5.22, H387N.sup.H5.19, R389K.sup.H5.21, Q390E.sup.H5.22, E392N.sup.H5.24 and L394V.sup.H5.26). Mini-G.sub.s/q58 did not couple to A.sub.2AR (FIG. 32c and FIG. 39), demonstrating that residues in the ?5 helix beyond the C-terminal 5 amino acids are important in G protein specificity. However, there was no significant shift in the thermostability of the G.sub.q-coupled receptor NTSR1 in the presence of mini-G.sub.s/q58 (FIG. 32b). We reasoned that this may be because the stability of mini-G.sub.s/q58 was impaired, because mutating the last 19 amino acid residues in mini-G.sub.s would have also changed residues buried in the core of the G protein, thus affecting the stability of the mini-G.sub.s backbone. Therefore, a refined version of this chimera, mini-G.sub.s/q70, was constructed in which residues in the ?5 helix whose side chains formed direct contacts (3.9 ? cut-off) with either ?.sub.2AR [2] or A.sub.2AR [19] in the G protein-bound structures were mutated to match those in G?.sub.q (R380K.sup.H5.12, Q384L.sup.H5.16, R385Q.sup.H5.17, H387N.sup.H5.19, E392N.sup.H5.24 and L394V.sup.H5.26; FIG. 38). In addition, the mutation Q390E.sup.H5.22 was included, despite only making contact to A.sub.2AR via its backbone, as it is buried in the receptor-G protein interface and may be important for binding to G.sub.q-coupled receptors. Mini-G.sub.s/q70 gave better binding to both G.sub.q-coupled receptors tested, NTSR1 and AT.sub.1R, and showed no binding to A.sub.2AR (FIG. 32 and FIG. 39).

    [0700] Two other chimeras were also constructed to try and improve on mini-G.sub.s/q70. Mini-G.sub.s/q72 contained the additional mutation C379V.sup.H5.11 compared to mini-G.sub.s/q70 and, although the C379.sup.H5.11 side chain does not form direct contacts with either A.sub.2AR or ?.sub.2AR, its mutation to Val is predicted to introduce a direct interaction between the Val ?2 carbon and Leu110 from A.sub.2AR. However, the AT.sub.1R-mini-G.sub.s/q72 complex did not have a higher thermostability than AT.sub.1R-mini-Gs/q70 (results not shown). Finally, the chimera mini-G.sub.s/q71 was constructed in which residues from other regions of G? that form direct contacts with either ?.sub.2AR [2] or A.sub.2AR [19] were mutated to match those in G?.sub.q. This included the seven mutations in mini-G.sub.s/q70 (R380K.sup.H5.12, Q384L.sup.H5.16, R385Q.sup.H5.17, H387N.sup.H5.19, Q390E.sup.H5.22, E392N.sup.H5.24 and L394V.sup.H5.26) and six additional mutations (A39R.sup.HNS1.3, H41L.sup.S1.2, D343K.sup.H4.23, L346V.sup.H4.26, R347D.sup.H4.27 and Y358I.sup.H4S6.11). D343.sup.H4.23 was the only amino acid residue whose side chain did not interact with either A.sub.2AR or ?.sub.2AR, but the mutation to Lys was included because the longer side chain could potentially interact with a receptor and the charge reversal may be important for specificity. Conversely, Thr350.sup.H4D6.3 was not mutated to Pro in mini-G.sub.s/q71 even though its side chain forms direct contacts with ?.sub.2AR. Alignment of G?.sub.s with two independently solved structures of G?.sub.q [44, 45] showed that this region of the G proteins differ significantly and thus, in G?.sub.q, this residue is unlikely to interact with the receptor. However, after all these considerations to make an improved version of mini-G.sub.s/q70, mini-G.sub.s/q71 did not improve the thermostability of agonist-bound G.sub.q-coupled receptors compared to mini-G.sub.s/q70 (FIG. 32a,b).

    [0701] Mini-G.sub.i1: Tackling Stability Issues

    [0702] Transfer of the 7 point mutations and 3 deletions from mini-G.sub.s into G?.sub.i1 to make mini-G.sub.i1 was not successful, as the resultant protein was very poorly expressed and had low stability (results not shown). Whilst the work on developing chimeras of mini-G.sub.s/q was underway, we decided to first study the reasons why mini-G.sub.i1 appeared to be so unstable. Therefore, to improve expression, stability and to allow binding of the mini-G.sub.i1 to the ?? subunits, the N-terminus (residues 4-18) was re-inserted, Asp249.sup.H3.8 was mutated back to Leu, and the G217D.sup.H2S4.3 mutation introduced based on a sequence comparison between G.sub.i1 (poorly expressed) and G.sub.s/G.sub.o (highly expressed) (FIG. 29 and FIG. 35). The resultant mini-G.sub.i1 (construct 46) yielded only 12 mg of purified protein per litre of culture and was 17? C. less stable than mini-G.sub.s, but was suitable for initial studies in GPCR coupling.

    [0703] The serotonin 5-HT.sub.1B receptor (5HT.sub.1BR) was used as a model G.sub.i-coupled receptor for developing mini-G.sub.i1 because it could be expressed and purified in DDM using the baculovirus expression system and its structure determined in the inactive state [10]. Initially, GFP-mini-G.sub.i1 was tested using FSEC for binding to purified 5HT.sub.1BR (in DDM) and bound to the agonist donitriptan. However, the GFP-mini-G.sub.i1 (FIG. 37) migrated at 13.5 ml in the absence of receptor or in the presence of donitriptan-bound 5HT.sub.1BR, indicating that no coupling occurred (FIG. 33c). However, when the LMNG-purified 5HT.sub.1BR was used, the FSEC showed two peaks, one corresponding to free GFP-mini-G.sub.i1 with a retention volume of 14.3 ml and the other corresponding to GFP-mini-G.sub.i1 bound to donitriptan-activated 5HT.sub.1BR, with a retention volume of 12.2 ml (FIG. 33d). As donitriptan-bound 5HT.sub.1BR has been crystallised, this suggested that the receptor is reasonably stable in detergent, which in turn suggested that the instability of the GFP-mini-G.sub.i1-5HT.sub.1BR-donitriptan complex was probably due to the mini-G protein rather than the receptor. This was tested by forming a heterotrimer between GFP-mini-G.sub.i146 (FIGS. 37) and ?.sub.1?.sub.2, making a mini-trimer complex with donitriptan-bound 5HT.sub.1BR in LMNG and performing FSEC. The GFP-mini-trimer in complex with the LMNG-purified 5HT.sub.1BR resolved as a single peak with a retention volume of 11.8 ml compared to 14.3 ml for the free GFP-mini-G.sub.i1?.sub.1?.sub.2 trimer (FIG. 33f). Thus the ?.sub.1?.sub.2 subunits restored the stability of mini-G.sub.i1.

    [0704] Although the mini-G.sub.i1?.sub.1?.sub.2 trimer coupled successfully to LMNG-solubilised 5HT.sub.1BR, this is not as desirable for crystallography as a mini-G protein coupled receptor due to the large size of the heterotrimeric G protein. Therefore, following the successful strategy of changing the coupling of mini-G.sub.s to that of G.sub.q by making a mini-G.sub.s/q chimera, the same strategy was applied to engineer a mini-G.sub.s/i1 chimera (FIG. 35 and FIG. 40). Therefore 9 mutations (C379V.sup.H5.11, R380T.sup.H5.12, Q384I.sup.H5.16, R385K.sup.H5.17, H387NH.sup.H5.19, Q390D.sup.H5.22, Y391C.sup.H5.23, E392G.sup.5.24 and L394F.sup.H5.26) were introduced into the ?5 helix of mini-G.sub.s to change its coupling specificity to that of G.sub.i1. A complex between GFP-mini-G.sub.s/i143 (FIG. 37) with donitriptan-bound DDM-purified 5HT.sub.1BR resolved as a single peak with a retention volume of 13.2 ml compared to 15.1 ml for the free GFP-mini-G.sub.s/i1 (FIG. 33e). Thus mini-G.sub.s/i1 was indeed more stable than mini-G.sub.i1. The specificity of mini-G.sub.s compared to mini-G.sub.s/i1 for donitriptan-bound, DDM-solubilised 5HT.sub.1BR was confirmed using FSBA (FIG. 33b). No specific coupling of GFP-mini-Gs to 5HT.sub.1BR was observed, although specific coupling to GFP-mini-G.sub.s/i1 (apparent K.sub.D 386 nM; FIG. 33b) was confirmed.

    [0705] In order to compare all the mini-G.sub.i1 constructs and the role of ?.sub.1?.sub.2, agonist affinity shift assays were performed on 5HT.sub.1BR. The uncoupled receptor showed a K.sub.i for the agonist sumatriptan in this assay of 276?10 nM, which was shifted by mini-G.sub.i146 and mini-G.sub.s/i143 to 80?13 nM and 36?2 nM, respectively (FIG. 33a). However, addition of ?.sub.1y.sub.2 to the mini-G proteins resulted in a further increase in agonist affinity to 15?1 nM and 7.2?0.8 nM for mini-G.sub.i146-?.sub.1?.sub.2 and mini-G.sub.s/i143-?.sub.1?.sub.2, respectively. Thus despite the successful generation of both mini-G.sub.i1 and mini-G.sub.s/i1, their stability is still not perfect as binding of ?.sub.1?.sub.2 stabilises the mini-G proteins and elicits a greater increase in agonist affinity upon coupling of the mini-trimers.

    [0706] Coupling of Mini-G.sub.o1 to 5HT.sub.1BR

    [0707] The GTPase domain of G.sub.o1 and G.sub.i1 are highly conserved (80% identity), but the mini-G proteins derived from them behaved very differently. Unlike the unstable mini-G.sub.i1, mini-G.sub.o1 expressed well (100 mg/L), had high stability comparable to mini-G.sub.s and it was largely insensitive to the presence of mild detergents. Since 5HT.sub.1BR couples to both G.sub.o and G.sub.i family members [46], we tested mini-G.sub.o1 coupling to 5HT.sub.1BR and compared the results to coupling with mini-G.sub.i1 (see above). On FSEC, GFP-mini-G.sub.o112 (FIG. 37) partially coupled to donitriptan-bound, DDM-solubilised 5HT.sub.1BR (unpurified), with the higher molecular weight species (retention volume 13 ml) reduced when the receptor was bound to an antagonist (FIG. 34c). This was in contrast to the results with mini-G.sub.i1 under the same conditions where no binding was observed (FIG. 33c). The partial coupling probably resulted from the low concentration of 5HT.sub.1BR and GFP-mini-G.sub.o1 used in the assay, because when the experiment was repeated using purified 5HT.sub.1BR and GFP-mini-G.sub.o1, all of the GFP-mini-G.sub.o1 bound to the receptor (FIG. 34e). In addition, the complex was purified by SEC and SDS-PAGE indicated co-elution of 5HT.sub.1BR and mini-G.sub.o1 in a 1:1.2 molar ratio (FIG. 34d). GFP-mini-G.sub.o1 bound to DDM-solubilised 5HT.sub.1BR in the presence of donitriptan with an apparent K.sub.D of 184?24 nM (FIG. 34b). In membranes, mini-G.sub.o112 shifted the agonist affinity for 5HT.sub.1BR from 276?10 nM to 32?3 nM (FIG. 34a).

    [0708] The properties of mini-G.sub.o1 make this an ideal choice for structural studies of G.sub.o/G.sub.i coupled receptors, rather than using mini-G.sub.s/i, as it is more highly expressed and more tolerant of detergents.

    [0709] Conclusions

    [0710] The aim of the work presented here was to generate a range of mini-G proteins that could be used as a basis for the structure determination of GPCRs in their fully active state. The original work in developing mini-G proteins was performed on G.sub.s [23], which turned out to be one of the best expressed and most stable of the mini-G proteins. Transfer of the relevant mutations to other G proteins was successful in deriving mini-G.sub.olf, mini-G.sub.o1 and mini-G.sub.12. Both mini-G.sub.olf and mini-G.sub.o1 coupled to relevant receptors only in the presence of an agonist and formed stable complexes that could be purified by SEC. Currently, we have not been able to demonstrate binding of mini-G.sub.12 to any receptor (results not shown), even though it is highly expressed in E. coli and has high thermal stability, suggesting that the protein is in a folded state. In contrast, initial trials to generate mini-G.sub.t1, mini-G.sub.z mini-G.sub.q and mini-G.sub.16 were unsuccessful due to no expression in E. coli. Mini-G.sub.i1 expressed very poorly, but was improved upon further mutagenesis, but was still not as stable as mini-G.sub.s and required binding of ?? subunits to attain a full agonist affinity shift in the 5HT.sub.1BR.

    [0711] The second approach to generate mini-G proteins for those that did not work initially was to make chimeras by converting the specificity of mini-G.sub.s to the specificity of the desired G protein. This was developed initially for G.sub.q by mutating in mini-G.sub.s only those residues in the ?5 helix whose side chains make contact to either ?.sub.2AR or A.sub.2AR in the crystal structures of the relevant complexes [2, 19], to match the equivalent residues in G.sub.q. The final mini-G.sub.s/q chimera was stable, overexpressed in E. coli and coupled to G.sub.q-coupled receptors but not to G.sub.s-coupled receptors. The process was also successful in generating a mini-G.sub.s/i1 amd mini-G.sub.s/o chimera. The ?5 helix provides ?70% of the buried surface area between the GTPase domain and the receptor in the two G protein-GPCR complexes crystallised to date. The work here shows that changing these contacts is sufficient to alter the specificity of coupling. However, this is not to say that the remaining 30% of the interface is not important, merely that a range of amino acid residues can be accommodated in this interface and therefore it plays a less important role in defining both specificity and the affinity of G protein binding.

    [0712] The mini-G proteins and their properties are shown in Table 7. On the whole, the expression levels are satisfactory in E. coli and the stability of the mini-G proteins in the absence of detergent is also good. However, their stability decreases in detergent, particularly in high concentrations, with the greatest decrease in stability observed at high detergent concentrations (greater than 0.5% w/v) and with detergents that are regarded as harsh for membrane protein purification [47]. Thus care must be exercised in the initial choice of detergent for forming receptor-mini-G protein complexes.

    [0713] In conclusion, the range of mini-G proteins developed here will lead to further knowledge on the active structures of receptors through the crystallisation of receptor-mini-G protein complexes. This will expand our understanding of the signaling of GPCRs as well as having useful applications for drug discovery.

    TABLE-US-00007 TABLE 7 Mutants of mini-G proteins and their characteristics. Stability in detergent measured by native Yield of pure Stability DSF (? C.) Mini-G protein per L measured by No 0.1% protein Construct of E. coli (mg) DSF (? C.) detergent LMNG 0.1% DDM G.sub.s 393 100 65.3 ? 0.0 47.7 ? 0.2 44.9 ? 0.2 39.1 ? 0.0 G.sub.olf 6 80 64.8 ? 0.4 44.3 ? 0.1 41.9 ? 0.0 37.4 ? 0.2 G.sub.s/q 70 50 67.2 ? 0.4 47.2 ? 0.3 44.2 ? 0.2 36.2 ? 0.1 G.sub.s/il 43 40 69.0 ? 0.1 44.8 ? 0.0 41.1 ? 0.1 35.9 ? 0.1 G.sub.ol 12 100 63.8 ? 0.1 43.6 ? 0.2 40.7 ? 0.1 32.6 ? 0.2 G.sub.l2 8 25 72.6 ? 0.3 50.3 ? 0.1 46.0 ? 0.1 41.2 ? 0.2 Mini-G protein Yield of pure Stability that bind protein per L measured by ?? Construct of E. coli (mg) DSF (? C.) G.sub.s 399 100 71.6 ? 0.0 G.sub.olf 9 144 66.1 ? 0.1 G.sub.s/q 76 30 70.7 ? 0.1 G.sub.il 46 12 47.8 ? 0.3 G.sub.s/il 48 10 72.1 ? 0.1 G.sub.s/ol 16 15 69.0 ? 0.1

    REFERENCES FOR EXAMPLE 5

    [0714] 1. Rosenbaum D M, Rasmussen S G, Kobilka B K. The structure and function of G-protein-coupled receptors. Nature. 2009; 459(7245):356-63. doi: 10.1038/nature08144. PubMed PMID: 19458711; PubMed Central PMCID: PMCPMC3967846.

    [0715] 2. Rasmussen S G, DeVree B T, Zou Y, Kruse A C, Chung K Y, Kobilka T S, et al. Crystal structure of the beta2 adrenergic receptor-Gs protein complex. Nature. 2011; 477(7366):549-55. Epub 2011/07/21. doi: 10.1038/nature10361. PubMed PMID: 21772288; PubMed Central PMCID: PMC3184188.

    [0716] 3. Tate C G, Schertler G F. Engineering G protein-coupled receptors to facilitate their structure determination. Curr Opin Struct Biol. 2009; 19(4):386-95. Epub 2009/08/18. doi: 10.1016/j.sbi.2009.07.004. PubMed PMID: 19682887.

    [0717] 4. Venkatakrishnan A J, Deupi X, Lebon G, Tate C G, Schertler G F, Babu M M. Molecular signatures of G-protein-coupled receptors. Nature. 2013; 494(7436):185-94. Epub 2013, Feb. 15. doi: 10.1038/nature11896. PubMed PMID: 23407534.

    [0718] 5. Venkatakrishnan A J, Deupi X, Lebon G, Heydenreich F M, Flock T, Miljus T, et al. Diverse activation pathways in class A GPCRs converge near the G-protein-coupling region. Nature. 2016; 536(7617):484-7. doi: 10.1038/nature19107. PubMed PMID: 27525504.

    [0719] 6. Flock T, Ravarani C N, Sun D, Venkatakrishnan A J, Kayikci M, Tate C G, et al. Universal allosteric mechanism for Galpha activation by GPCRs. Nature. 2015; 524(7564):173-9. Epub 2015/07/07. doi: 10.1038/nature14663. PubMed PMID: 26147082; PubMed Central PMCID: PMC4866443.

    [0720] 7. Warne T, Moukhametzianov R, Baker J G, Nehme R, Edwards P C, Leslie A G, et al. The structural basis for agonist and partial agonist action on a beta(1)-adrenergic receptor. Nature. 2011; 469(7329):241-4. Epub 2011/01/14. doi: 10.1038/nature09746. PubMed PMID: 21228877; PubMed Central PMCID: PMC3023143.

    [0721] 8. Rosenbaum D M, Zhang C, Lyons J A, Hall R, Aragao D, Arlow D H, et al. Structure and function of an irreversible agonist-beta(2) adrenoceptor complex. Nature. 2011; 469(7329):236-40. Epub 2011/01/14. doi: 10.1038/nature09665. PubMed PMID: 21228876; PubMed Central PMCID: PMC3074335.

    [0722] 9. Zhang J, Zhang K, Gao Z G, Paoletta S, Zhang D, Han G W, et al. Agonist-bound structure of the human P2Y12 receptor. Nature. 2014; 509(7498)1 19-22. doi: 10.1038/nature13288. PubMed PMID: 24784220; PubMed Central PMCID: PMCPMC4128917.

    [0723] 10. Wang C, Jiang Y, Ma J, Wu H, Wacker D, Katritch V, et al. Structural basis for molecular recognition at serotonin receptors. Science. 2013; 340(6132):610-4. doi: 10.1126/science.1232807. PubMed PMID: 23519210; PubMed Central PMCID: PMCPMC3644373.

    [0724] 11. Lebon G, Warne T, Edwards P C, Bennett K, Langmead C J, Leslie A G, et al. Agonist-bound adenosine A2A receptor structures reveal common features of GPCR activation. Nature. 2011; 474(7352):521-5. Epub 2011/05/20. doi: 10.1038/nature10136. PubMed PMID: 21593763; PubMed Central PMCID: PMC3146096.

    [0725] 12. Xu F, Wu H, Katritch V, Han G W, Jacobson K A, Gao Z G, et al. Structure of an agonist-bound human A2A adenosine receptor. Science. 2011; 332(6027):322-7. Epub 2011/03/12. doi: 10.1126/science.1202793. PubMed PMID: 21393508; PubMed Central PMCID: PMC3086811.

    [0726] 13. White J F, Noinaj N, Shibata Y, Love J, Kioss B, Xu F, et al. Structure of the agonist-bound neurotensin receptor. Nature. 2012; 490(7421):508-13. Epub 2012/10/12. doi: 10.1038/nature11558. PubMed PMID: 23051748; PubMed Central PMCID: PMC3482300.

    [0727] 14. Rasmussen S G, Choi H J, Fung J J, Pardon E, Casarosa P, Chae P S, et al. Structure of a nanobody-stabilized active state of the beta(2) adrenoceptor. Nature. 2011; 469(7329):175-80. Epub 2011/01/14. doi: 10.1038/nature09648. PubMed PMID: 21228869; PubMed Central PMCID: PMC3058308.

    [0728] 15. Choe H W, Kim Y J, Park J H, Morizumi T, Pai E F, Krauss N, et al. Crystal structure of metarhodopsin II. Nature. 2011; 471(7340):651-5. doi: nature09789 10.1038/nature09789. PubMed PMID: 21389988.

    [0729] 16. Standfuss J, Edwards P C, D'Antona A, Fransen M, Xie G, Oprian D D, et al. The structural basis of agonist-induced activation in constitutively active rhodopsin. Nature. 2011; 471(7340):656-60. doi: nature09795 10.1038/nature09795. PubMed PMID: 21389983.

    [0730] 17. Kruse A C, Ring A M, Manglik A, Hu J, Hu K, Eitel K, et al. Activation and allosteric modulation of a muscarinic acetylcholine receptor. Nature. 2013; 504(7478):101-6. doi: 10.1038/nature12735. PubMed PMID: 24256733; PubMed Central PMCID: PMCPMC4020789.

    [0731] 18. Sounier R, Mas C, Steyaert J, Laeremans T, Manglik A, Huang W, et al. Propagation of conformational changes during mu-opioid receptor activation. Nature. 2015; 524(7565):375-8. doi: 10.1038/nature14680. PubMed PMID: 26245377; PubMed Central PMCID: PMCPMC4820006.

    [0732] 19. Carpenter B, Nehme R, Warne T, Leslie A G, Tate C G. Structure of the adenosine A(2A) receptor bound to an engineered G protein. Nature. 2016; 536(7614):104-7. Epub 2016/07/28. doi: 10.1038/nature18966. PubMed PMID: 27462812; PubMed Central PMCID: PMC4979997.

    [0733] 20. Park J H, Scheerer P, Hofmann K P, Choe H W, Ernst O P. Crystal structure of the ligand-free G-protein-coupled receptor opsin. Nature. 2008; 454(7201):183-7. Epub 2008/06/20. doi: nature07063 [pii] 10.1038/nature07063. PubMed PMID: 18563085.

    [0734] 21. Scheerer P, Park J H, Hildebrand P W, Kim Y J, Krauss N, Choe H W, et al. Crystal structure of opsin in its G-protein-interacting conformation. Nature. 2008; 455(7212):497-502. Epub 2008/09/27. doi: nature07330 [pii] 10.1038/nature07330. PubMed PMID: 18818650.

    [0735] 22. Pardon E, Laeremans T, Triest S, Rasmussen S G, Wohlkonig A, Ruf A, et al. A general protocol for the generation of Nanobodies for structural biology. Nat Protoc. 2014; 9(3):674-93. doi: 10.1038/nprot.2014.039. PubMed PMID: 24577359; PubMed Central PMCID: PMCPMC4297639.

    [0736] 23. Carpenter B, Tate C G. Engineering a minimal G protein to facilitate crystallisation of G protein-coupled receptors in their active conformation. Protein engineering, design & selection: PEDS. 2016; 29(12):583-94. Epub 2016/09/28. doi: 10.1093/protein/gzw049. PubMed PMID: 27672048.

    [0737] 24. Syrovatkina V, Alegre K O, Dey R, Huang X Y. Regulation, Signaling, and Physiological Functions of G-Proteins. Journal of molecular biology. 2016; 428(19):3850-68. Epub 2016/08/16. doi: 10.1016/j.jmb.2016.08.002. PubMed PMID: 27515397; PubMed Central PMCID: PMC5023507.

    [0738] 25. Warne T, Chirnside J, Schertler G F. Expression and purification of truncated, non-glycosylated turkey beta-adrenergic receptors for crystallization. Biochim Biophys Acta. 2003; 1610(1):133-40. PubMed PMID: 12586387.

    [0739] 26. Warne T, Serrano-Vega M J, Baker J G, Moukhametzianov R, Edwards P C, Henderson R, et al. Structure of a betal-adrenergic G-protein-coupled receptor. Nature. 2008; 454(7203):486-91. Epub 2008/07/03. doi: nature07101 [pii] 10.1038/nature07101. PubMed PMID: 18594507.

    [0740] 27. Thomas J, Tate C G. Quality control in eukaryotic membrane protein overproduction. J Mol Biol. 2014; 426(24):4139-54. doi: 10.1016/j.jmb.2014.10.012. PubMed PMID: 25454020; PubMed Central PMCID: PMCPMC4271737.

    [0741] 28. Lebon G, Bennett K, Jazayeri A, Tate C G. Thermostabilisation of an agonist-bound conformation of the human adenosine A(2A) receptor. J Mol Biol. 2011; 409(3):298-310. doi: S0022-2836(11)00378-0 [Pii] 10.1016/j.jmb.2011.03.075. PubMed PMID: 21501622.

    [0742] 29. Shibata Y, White J F, Serrano-Vega M J, Magnani F, Aloia A L, Grisshammer R, et al. Thermostabilization of the neurotensin receptor NTS1. J Mol Biol. 2009; 390(2):262-77. Epub 2009/05/09. doi: S0022-2836(09)00535-X [pii] 10.1016/j.jmb.2009.04.068. PubMed PMID: 19422831.

    [0743] 30. Chan P, Thomas C J, Sprang S R, Tall G G. Molecular chaperoning function of Ric-8 is to fold nascent heterotrimeric G protein alpha subunits. Proc Natl Acad Sci U S A. 2013; 110(10):3794-9. doi: 10.1073/pnas.1220943110. PubMed PMID: 23431197; PubMed Central PMCID: PMCPMC3593926.

    [0744] 31. Green S A, Holt B D, Liggett S B. Beta 1- and beta 2-adrenergic receptors display subtype-selective coupling to Gs. Mol Pharmacol. 1992; 41(5):889-93. PubMed PMID: 1350321.

    [0745] 32. Tate C G. A crystal clear solution for determining G-protein-coupled receptor structures. Trends in biochemical sciences. 2012; 37(9):343-52. doi: 10.1016/j.tibs.2012.06.003. PubMed PMID: 22784935.

    [0746] 33. Magnani F, Serrano-Vega M J, Shibata Y, Abdul-Hussein S, Lebon G, Miller-Gallacher J, et al. A mutagenesis and screening strategy to generate optimally thermostabilized membrane proteins for structural studies. Nat Protoc. 2016; 11(8):1554-71. doi: 10.1038/nprot.2016.088. PubMed PMID: 27466713.

    [0747] 34. Zhang X, Stevens R C, Xu F. The importance of ligands for G protein-coupled receptor stability. Trends in biochemical sciences. 2015; 40(2):79-87. doi: 10.1016/j.tibs.2014.12.005. PubMed PMID: 25601764.

    [0748] 35. Lebon G, Warne T, Tate C G. Agonist-bound structures of G protein-coupled receptors. Curr Opin Struct Biol. 2012. Epub 2012 Apr. 7. doi: 10.1016/j.sbi.2012.03.007. PubMed PMID: 22480933.

    [0749] 36. Kawate T, Gouaux E. Fluorescence-detection size-exclusion chromatography for precrystallization screening of integral membrane proteins. Structure. 2006; 14(4):673-81. doi: 10.1016/j.str.2006.01.013. PubMed PMID: 16615909.

    [0750] 37. Kull B, Svenningsson P, Fredholm B B. Adenosine A(2A) receptors are colocalized with and activate g(olf) in rat striatum. Molecular pharmacology. 2000; 58(4):771-7. Epub 2000/09/22. PubMed PMID: 10999947.

    [0751] 38. Chan P, Gabay M, Wright F A, Kan W, Oner S S, Lanier S M, et al. Purification of heterotrimeric G protein alpha subunits by GST-Ric-8 association: primary characterization of purified G alpha(olf). J Biol Chem. 2011; 286(4):2625-35. doi: 10.1074/jbc.M110.178897. PubMed PMID: 21115479; PubMed Central PMCID: PMCPMC3024758.

    [0752] 39. Serrano-Vega M J, Tate C G. Transferability of thermostabilizing mutations between beta-adrenergic receptors. Mol Membr Biol. 2009; 26(8):385-96. Epub 2009 Nov. 4. doi: 10.3109/09687680903208239. PubMed PMID: 19883298.

    [0753] 40. Hamm H E, Deretic D, Arendt A, Hargrave P A, Koenig B, Hofmann K P. Site of G protein binding to rhodopsin mapped with synthetic peptides from the alpha subunit. Science. 1988; 241(4867):832-5. Epub 1988 Aug. 12. PubMed PMID: 3136547.

    [0754] 41. Conklin B R, Farfel Z, Lustig K D, Julius D, Bourne H R. Substitution of three amino acids switches receptor specificity of Gq alpha to that of Gi alpha. Nature. 1993; 363(6426):274-6. Epub 1993 May 20. doi: 10.1038/363274a0. PubMed PMID: 8387644.

    [0755] 42. Conklin B R, Herzmark P, Ishida S, Voyno-Yasenetskaya T A, Sun Y, Farfel Z, et al. Carboxyl-terminal mutations of Gq alpha and Gs alpha that alter the fidelity of receptor activation. Mol Pharmacol. 1996; 50(4):885-90. Epub 1996 Oct. 1. PubMed PMID: 8863834.

    [0756] 43. Semack A, Sandhu M, Malik R U, Vaidehi N, Sivaramakrishnan S. Structural Elements in the Galphas and Galphaq C Termini That Mediate Selective G Protein-coupled Receptor (GPCR) Signaling. J Biol Chem. 2016; 291(34):17929-40. doi: 10.1074/jbc.M116.735720. PubMed PMID: 27330078; PubMed Central PMCID: PMCPMC5016181.

    [0757] 44. Nishimura A, Kitano K, Takasaki J, Taniguchi M, Mizuno N, Tago K, et al. Structural basis for the specific inhibition of heterotrimeric Gq protein by a small molecule. Proc Natl Acad Sci U S A. 2010; 107(31):13666-71. doi: 10.1073/pnas.1003553107. PubMed PMID: 20639466; PubMed Central PMCID: PMCPMC2922266.

    [0758] 45. Tesmer V M, Kawano T, Shankaranarayanan A, Kozasa T, Tesmer J J. Snapshot of activated G proteins at the membrane: the Galphaq-GRK2-Gbetagamma complex. Science. 2005; 310(5754):1686-90. doi: 10.1126/science.1118890. PubMed PMID: 16339447.

    [0759] 46. Clawges H M, Depree K M, Parker E M, Graber S G. Human 5-HT1 receptor subtypes exhibit distinct G protein coupling behaviors in membranes from Sf9 cells. Biochemistry. 1997; 36(42):12930-8. Epub 1997 Oct. 23. doi: 10.1021/bi970112b. PubMed PMID: 9335552.

    [0760] 47. Tate C G. Practical considerations of membrane protein instability during purification and crystallisation. Methods Mol Biol. 2010; 601:187-203. doi: 10.1007/978-1-60761-344-2 12. PubMed PMID: 20099147.

    EXAMPLE 6

    Effect of Mini-Gs on GLP1R

    [0761] To assess the effect of mini-Gs on receptor stability we measured GLP1R stability following detergent solubilisation. To this end, prior to solubilisation cells expressing human GLP1R receptor were incubated with tritiated peptide agonist and mini-Gs. The mixture was allowed to reach equilibrium at room temperature for 1 hour before solubilisation at 4? C. for 1 hour. Aliquots of the receptor/ligand/mini-Gs were incubated at different temperatures for 30 minutes. Following separation of excess unbound ligand from the receptor bound molecules, the levels of retained radioactivity were measured for each temperature which was plotted against temperature points. The results was compared with the control arm of the experiment with was identical but lacked mini-Gs. Presence of the mini-Gs significantly increased the stability of the agonist bound conformation (FIG. 41).