GENE THERAPY EXPRESSION SYSTEM ALLEVIATING CARDIAC TOXICITY OF FKRP

Abstract

The present invention concerns an expression system for systemic administration comprising a sequence encoding a FKRP protein, and: —a promoter sequence allowing the expression at a therapeutically acceptable level of FKRP in the skeletal muscles and a target sequence of an miRNA expressed in the heart; or—a promoter sequence allowing the expression at a therapeutically acceptable level of FKRP in the skeletal muscles and presenting a promoter activity at a toxically acceptable level in the heart; and its use for the treatment of various diseases linked to FKRP deficiencies.

Claims

1-15. (canceled)

16. An expression system for systemic administration comprising a sequence encoding a Fukutin-related protein (FKRP), and: a promoter sequence allowing the expression at a therapeutically acceptable level of FKRP in the skeletal muscles and a target sequence of an miRNA expressed in the heart; or a promoter sequence allowing the expression at a therapeutically acceptable level of FKRP in the skeletal muscles and presenting a promoter activity at a toxically acceptable level in the heart.

17. The expression system according to claim 16, wherein the FKRP protein has the sequence SEQ ID NO: 5.

18. The expression system according to claim 16, wherein the sequence encoding the FKRP protein comprises nucleotides 1659 to 3146 of SEQ ID NO: 1, SEQ ID NO: 3, or SEQ ID NO: 4.

19. The expression system according to claim 16, wherein the expression system comprises at least one target sequence of miR208a.

20. The expression system according to claim 19, wherein the target sequence of miR208a comprises the sequence SEQ ID NO: 2.

21. The expression system according to claim 16, wherein the expression system comprises a desmin promoter.

22. The expression system according to claim 21, wherein the desmin promoter comprises a sequence as set forth in SEQ ID NO: 6.

23. The expression system according to claim 21, wherein the expression system comprises nucleotides 146 to 3946 of SEQ ID NO: 3, or nucleotides 146 to 3974 of SEQ ID NO: 4.

24. The expression system according to claim 16, wherein the expression system comprises a promoter sequence of a calpain 3 gene or a promoter sequence of miR206.

25. The expression system according to claim 24, wherein the promoter sequence of the calpain 3 gene comprises a sequence as set forth in SEQ ID NO: 7.

26. The expression system according to claim 24, wherein the promoter sequence of the miR206 comprises a sequence as set forth in SEQ ID NO: 8.

27. The expression system according to claim 16, wherein the expression system comprises a vector having a tropism higher for skeletal muscles than for heart muscles.

28. The expression system according to claim 16, wherein the expression system comprises a viral vector.

29. The expression system according to claim 28, wherein the viral vector is an adeno-associated viral vector (AAV).

30. The expression system according to claim 29, wherein the AAV is of serotype 8 or serotype 9.

31. The expression system according to claim 29, wherein the expression system comprises an AAV2/8 or an AAV2/9 vector.

32. A pharmaceutical composition comprising an expression system according to claim 16.

33. A method of treating a pathology linked to a FKRP deficiency or induced by a defect in α-dystroglycan (α-DC) glycosylation in a subject, the method comprising: administering a composition according to claim 32 to the subject, wherein the pathology is selected from the group consisting of: Limb-Girdle Muscular Dystrophy type 2I (LGMD2I), Congenital Muscular Dystrophy type 1C (MDC1C), Walker-Warburg Syndrome (WWS) and Muscle-Eye-Brain disease (MEB), advantageously LGMD2I.

34. The method according to claim 33, wherein the composition is administered systemically.

35. The method according to claim 33, wherein the composition is administered by intravenous injection.

Description

FIGURES

[0221] FIG. 1: Diagram of the vector constructs:

[0222] A/ FKRP expression cassette, devoid of target sequences for miRNA-208a (AAV-FKRP);

[0223] B/ FKRP expression cassette containing 1 (AAV-FKRP-single) or 2 (AAV-FKRP-tandem) target sequences for miRNA-208a (arrow) at the 3′ end of the FKRP gene.

[0224] FIG. 2: Cross section of the heart of a rat intravenously administered with AAV-FKRP vector: Histological analysis of the heart muscle, at day 15 after injection of AAV-FKRP at 3 doses as indicated (1.sup.e12 vg/kg; 5.sup.e12 vg/kg; 7.5.sup.e13 vg/kg) and HES staining (top, scale=50 μm) or Sirius red staining (bottom).

[0225] FIG. 3: Cross section of the heart of a mouse intravenously administered with AAV-FKRP vector: Histological analysis of the heart muscle, six weeks after injection of AAV-FKRP at dose 1.sup.e14 vg/kg and HPS staining (top, scale=200 μm) or Sirius red staining (bottom).

[0226] FIG. 4: Body mass curve of rats injected with either PBS (buffer), AAV-FKRP, AV-FKRP-single or AAV-FKRP-tandem.

[0227] FIG. 5: Vector copy number (VCN) per nucleus of AAV-FKRP, AAV-FKRP-single and AAV-FKRP-tandem in the TA (tibialis anterior) muscle of rats 2 weeks after injection.

[0228] FIG. 6: Evaluation of FKRP mRNA (A) or protein (B) in the heart of rats 2 weeks after injection of PBS (buffer), AAV-FKRP, AV-FKRP-single or AAV-FKRP-tandem. The asterisk (*) indicates a statistic difference.

[0229] FIG. 7: Histological analysis of the heart muscle of rats at day 15 after injection of AAV-FKRP, AAV-FKRP-single or AAV-FKRP-tandem (as indicated) at dose 7.5.sup.e13 vg/kg and HES staining (top, scale=50 μm) or Sirius red staining (bottom).

[0230] FIG. 8: Evaluation of FKRP mRNA (A) or protein (B) in the TA muscle of rats 2 weeks after injection of PBS (buffer), AAV-FKRP, AV-FKRP-single or AAV-FKRP-tandem.

[0231] FIG. 9: Body mass curve of rats injected with either AV-FKRP-single or AAV-FKRP-tandem.

[0232] FIG. 10: Histological analysis of the heart muscle of rats 11 weeks after injection of AAV-FKRP-single and AAV-FKRP-tandem at dose 7.5.sup.e13 vg/kg and HES staining (top, scale=50 μm) or Sirius red staining (bottom).

MATERIALS AND METHODS

[0233] 1) Generation of Recombinant AAV Vectors:

[0234] The cassette contained in vector AAV-FKRP (SEQ ID NO: 1; see FIG. 1A) corresponds to nucleotides 496 to 4550 of the sequence SEQ ID NO: 11 as disclosed in WO2019/008157. Target sequences (1 or 2 sequences, respectively) of the miRNA-208a of 22 pb (SEQ ID NO: 2), each separated by DNA spacers, have been added in the 3′UTR region of the FKRP cDNA. The corresponding cassettes (FIG. 1B) have sequence SEQ ID NO: 3 and SEQ ID NO: 4, respectively, giving rise to vector AAV-FKRP-single and AAV-FKRP-tandem, respectively.

[0235] In detail, the expression cassette of SEQ ID NO: 1 contains: [0236] 5′ITR sequences corresponding to nucleotides 1 to 145 of SEQ ID NO: 1; followed by [0237] the human desmin promoter (SEQ ID NO: 6) corresponding to nucleotides 146 to 1206 of SEQ ID NO: 1; followed by [0238] the HBB2 intron corresponding to nucleotides 1207 to 1652 of SEQ ID NO: 1; followed by consensus Kozak sequence (GCCACC) inserted just before [0239] the polynucleotide encoding the human FKRP (SEQ ID NO: 5) corresponding to nucleotides 1659 to 3146 of SEQ ID NO: 1; followed by [0240] the HBB2 polyA sequence corresponding to nucleotides 3147 to 3912 of SEQ ID NO: 1; followed by [0241] 3′ITR sequences corresponding to nucleotides 3913 to 4057 of SEQ ID NO: 1.

[0242] In detail, the expression cassette of SEQ ID NO: 3 contains: [0243] 5′ITR sequences corresponding to nucleotides 1 to 145 of SEQ ID NO: 3; followed by [0244] the human desmin promoter (SEQ ID NO: 6) corresponding to nucleotides 146 to 1206 of SEQ ID NO: 3; followed by [0245] the HBB2 intron corresponding to nucleotides 1207 to 1652 of SEQ ID NO: 3; followed by consensus Kozak sequence (GCCACC) inserted just before [0246] the polynucleotide encoding the human FKRP (SEQ ID NO: 5) corresponding to nucleotides 1659 to 3146 of SEQ ID NO: 3; followed by [0247] a target sequence of miR208a (SEQ ID NO: 2) corresponding to nucleotides 3153 to 3174 of SEQ ID NO: 3; followed by [0248] the HBB2 polyA sequence corresponding to nucleotides 3181 to 3946 of SEQ ID NO: 3; followed by [0249] 3′ITR sequences corresponding to nucleotides 3947 to 4091 of SEQ ID NO: 3.

[0250] In detail, the expression cassette of SEQ ID NO: 4 contains: [0251] 5′ITR sequences corresponding to nucleotides 1 to 145 of SEQ ID NO: 4; followed by [0252] the human desmin promoter (SEQ ID NO: 6) corresponding to nucleotides 146 to 1206 of SEQ ID NO: 4; followed by [0253] the HBB2 intron corresponding to nucleotides 1207 to 1652 of SEQ ID NO: 4; followed by consensus Kozak sequence (GCCACC) inserted just before [0254] the polynucleotide encoding the human FKRP (SEQ ID NO: 5) corresponding to nucleotides 1659 to 3146 of SEQ ID NO: 4; followed by [0255] two target sequence of miR208a (SEQ ID NO: 2) in tandem corresponding to nucleotides 3153 to 3174 and nucleotides 3181 to 3202 of SEQ ID NO: 4; followed by [0256] the HBB2 polyA sequence corresponding to nucleotides 3209 to 3974 of SEQ ID NO: 4; followed by [0257] 3′ITR sequences corresponding to nucleotides 3975 to 4119 of SEQ ID NO: 4.

[0258] Adenovirus free rAAV2/9 viral preparations were generated by packaging AAV2-ITR recombinant genomes in AAV9 capsids, using a three plasmids transfection protocol as previously described (Bartoli et al., 2006). Briefly, HEK293 cells were cotransfected with pAAV-hDesmin-hFKRP, a RepCap plasmid (pAAV2.9, Dr J. Wilson, UPenn) and an adenoviral helper plasmid (pXX6; Apparailly et al., 2005) at a ratio of 1:1:2. Crude viral lysate was harvested at 60 hr post-transfection and lysed by freeze-and-thaw cycles. The viral lysate was purified through two rounds of CsCl ultracentrifugation followed by dialysis. Viral genomes were quantified by a TaqMan real-time PCR assay using primers and probes specific of the FKRP coding sequence contained in the AAV vector genome. The primer pairs and TaqMan probes used for amplification were:

TABLE-US-00001 FKRPopt Forward: (SEQ ID NO: 9) GCCCTTCTACCCCAGGAATG FKRPopt Reverse: (SEQ ID NO: 10) AAACTTCAGCTCCAGGAACCTC; and FKRPopt Probe: (SEQ ID NO: 11) TGCCCTTTGCTGGCTTTGTGGCCCAGGC.

[0259] The vector titres are expressed in terms of viral genomes per ml (vg/ml).

[0260] 2) In Vivo Experiments:

[0261] The rats and mice were treated according to the French and European legislation regarding animal testing. In this study, Sprague-Dawley male rats 10-12 weeks old and male FKRP-deficient mice (Gicquel et al., P094, Conférence European Society Of Gene & Cell Therapy 2017, doi: 10.1089/hum.2017.29055.abstracts) 4 weeks old were used. Recombinant vectors, as per the indicated doses, were injected into the tail vein of the rats and mice as indicated. An equivalent volume of saline buffer (PBS) was administered as a control. The clinical status and animal weight were monitored on a regular basis. The animals were sacrificed at the indicated times (2 weeks or 11 weeks for the rats; 6 weeks for the mice).

[0262] 3) Western Blot:

[0263] Heart and muscle tissues were mechanically homogenized in RIPA lysis buffer (Thermo Fisher Scientific, Waltham, Mass., USA), complemented with Complete protease inhibitor cocktail EDTA-free (Roche, Bale, Switzerland). Nucleic acids contained in the samples were degraded by incubation 15 minutes at 37° C. with benzonase (Sigma, St. Louis, Mo., USA).

[0264] Proteins were separated using precast polyacrylamide gel (4-15%, BioRad, Hercules, Calif., USA) and then transferred to nitrocellulose membrane.

[0265] Rabbit polyclonal antibody against FKRP has been previously described (Gicquel et al., 2017). Nitrocellulose membranes were probed with antibodies against FKRP (1:100) and GAPDH (Santa Cruz Biotechnologies, Dallas, Tex., USA, 1:5000) for normalization, for 2 hours at room temperature.

[0266] Finally, membranes were incubated with IRDye® for detection by the Odyssey infrared-scanner (LI-COR Biosciences, Lincoln, Nebr., USA).

[0267] 4) PCR:

[0268] Vector copy number (VCN) were quantified in TA muscle by quantitative RT-PCR on HBB2 polyA sequence contained in the vector genome, and normalized using the titin gene (TTN).

TABLE-US-00002 HBB2pA Forward: (SEQ ID NO: 12) CTTGACTCCACTCAGTTCTCTTGCT; HBB2pA Reverse: (SEQ ID NO: 13) CCAGGCGAGGAGAAACCA; and HBB2pA Probe: (SEQ ID NO: 14) CTCGCCGTAAAACATGGAAGGAACACTTC. TTN Forward: (SEQ ID NO: 15) GTCCCCTGCGTATCTGCTATG; TTN Reverse: (SEQ ID NO: 16) CGCTCGTTTTCAATACTACCTCTCT; and TTN Probe: (SEQ ID NO: 17) TCCGCAGCTCTAGTGGAAGAACCACC.

[0269] FKRP mRNA was extracted from TA muscle and from heart using the TriZOL method, then quantified by quantitative RT-PCR using oligonucleotides and probe designed on the codon-optimized FKRP sequence, and normalized by the expression of P0 gene.

TABLE-US-00003 P0 Forward: (SEQ ID NO: 18) CTCCAAGCAGATGCAGCAGA; P0 Reverse: (SEQ ID NO: 19) ATAGCCTTGCGCATCATGGT; and P0 Probe: (SEQ ID NO: 20) CCGTGGTGCTGATGGGCAAGAA.

[0270] FKRPopt Forward (SEQ ID NO: 9), FKRPopt Reverse (SEQ ID NO: 10) and FKRPopt Probe (SEQ ID NO: 11) are as disclosed above.

[0271] 5) Histology:

[0272] Cross cryosections (8 μm thickness) of the cardiac muscle were stained with Hematoxyline-Eosin-Saffran (HES), sinus red or Hematoxyline-Phloxin-Saffron (HFS) using standard protocols.

[0273] The sections were mounted with the PERTEX medium (Leica). The digital images were captured using Axio Scan Z1 slide scanner (Zeiss).

[0274] Results:

[0275] 1/ Fkrp Gene Transfer Induces Cardiac Toxicity

[0276] 1-1/ In Rats

[0277] Systemic administration of AAV-FKRP (FIG. 1A; harboring SEQ ID NO: 1) was performed in 5 male rats (Sprague-Dawley), 10-12 weeks old, at 3 different doses: 1.sup.e12, 5.sup.e12 and 7.5.sup.e13 vg/kg. Two weeks after injection, the rats were euthanized and sampled. Slices of hearts were stained both with Hematoxyline-Eosin-Saffran (HES) and with Sirius red.

[0278] Histology of rat hearts after AAV-FKRP administration show cardiac damages: as shown in FIG. 2, inflammation and fibrosis are clearly observed in rats at day 15 after injection at dose 7.5.sup.e13 vg/kg. Moreover, in these conditions, one rat died.

[0279] 1-2/ In Mice

[0280] Since mouse is the only mammal species in which a FKRP-deficient animal model has been developed and therefore the only species in which the therapeutic effect of expression systems can be explored, the potential cardiac toxicity of the AAV-FKRP vector was also investigated in this model.

[0281] Systemic administration of AAV-FKRP was performed in 6 male FKRP-deficient mice, 4 weeks old, at 4 doses: 5.sup.e12, 1.5.sup.e13, 4.5.sup.e13 and 1.sup.e14 vg/kg. Six weeks after injection, the mice were euthanized and sampled. Slices of hearts were stained both with Hematoxyline-Phloxin-Saffran (HPS) and with Sirius red.

[0282] All mice survived to the study, even for the highest dose (1.sup.e14 vg/kg). On the contrary (see below), 1 rat died 2 weeks after administration at dose from 7.5.sup.e13 vg/kg. This reveals that mice are less affected than rats by AAV-FKRP systemic administration.

[0283] However, histology of mice hearts after AAV-FKRP administration reveals cardiac damages: as shown in FIG. 3, inflammation and fibrosis are observed in mice 6 weeks after injection at dose 1.sup.e14 vg/kg.

[0284] As a whole, the presented data reveal a cardiac toxic effect of AAV-FKRP, which is confirmed in 2 species (rat and mouse) and which was fully unexpected.

[0285] 2/ Decreasing Fkrp Transgene Expression in the Heart Alleviates Cardiac Toxicity without Affecting Muscular Expression

[0286] As a proof of concept to prevent FKRP cardiac toxicity, one or two copies of the target sequence of a cardiac specific micro-RNA, i.e. miR-208a, were introduced in the AAV-FKRP vector. The so obtained vectors (FIG. 1B) are named AAV-FKRP-single (containing one target sequence of miR-208a and harboring SEQ ID NO: 3) and AAV-FKRP-tandem (containing two target sequences of miR-208a in the same direction and harboring SEQ ID NO: 4).

[0287] 2-1/ Short-Term (2 Weeks) Test in Rats

[0288] Based on the previous data, the rat model was chosen for further experiments because this animal model reveals heart toxicity in a rapid and clear manner, especially at dose 7.5′13 vg/kg.

[0289] Systemic administration of AAV-FKRP containing 0, 1 or 2 copies of miR-208a target (SEQ ID NO: 2) was performed in 5 male rats (Sprague-Dawley), 10-12 weeks old, at the dose of 7.5′13 vg/kg. Two weeks after injection, the rats were euthanized and sampled.

[0290] a) Survival and Weight Follow Up:

[0291] The survival data are shown in the Table below:

TABLE-US-00004 Injected (i.v.) Survival Buffer 5/5 AAV-FKRP 4/5 AAV-FKRP-single 5/5 AAV-FKRP-tandem 5/5

[0292] The data reveal that the only death occurred in the cohort administered with AAV-FKRP, probably because of the cardiac toxicity of this construct.

[0293] Moreover, FIG. 4 shows that rats injected with AAV-FKRP do not gain weight with time whereas rats with AAV-FKRP-single or with AAV-FKRP-tandem do.

[0294] As a conclusion and after 2 weeks, it appears that the rats administered with AAV-FKRP-single or AAV-FKRP-tandem are fitter than those administered with AAV-FKRP.

[0295] b) Vector Copy Number Quantification in TA Muscle:

[0296] The data shown in FIG. 5, based on the quantification of the HBB2 polyA sequence contained in each vector genome further normalized using the titin gene (TTN), reveal a similar level of infection of the skeletal muscle tissue, i.e. the TA muscle, with the 3 vectors.

[0297] Importantly, this confirms that the introduction of the miR208a target sequence(s) does not have any negative impact on the efficiency of the vector transfer in muscles, wherein said protein should be produced at a therapeutic level to cure the muscular abnormalities associated with a deficiency of FKRP.

[0298] c) FKRP Expression in the Heart after Gene Transfer

[0299] As shown in FIG. 6, at the mRNA level (A) as well as at the protein level (B), an important decrease of FKRP transgene expression is observed with the constructs AAV-FKRP-single and AAV-FKRP-tandem compared to AAV-FKRP.

[0300] It is to be noted that one miR208a target sequence is sufficient to observe such a decrease.

[0301] d) Heart Damages after Gene Transfer

[0302] The data shown in FIG. 7 reveal a huge decrease of heart damages with the constructs AAV-FKRP-single and AAV-FKRP-tandem in comparison to AAV-FKRP. In other words, the toxic effect disappears when FKRP transgene expression is reduced in the heart, i.e. using regulation by adequate micro-RNA.

[0303] e) FKRP Expression in the Skeletal Muscle after Gene Transfer

[0304] As shown in FIG. 8 in relation to the TA muscle, at the mRNA level (A) as well as at the protein level (B), no decrease of FKRP transgene expression is observed with the constructs AAV-FKRP-single and AAV-FKRP-tandem compared to AAV-FKRP.

[0305] This confirms that the use of miR208a allows to specifically detarget the heart. It is of high importance that the introduction of the miR208a target sequence(s) does not have any negative impact on the efficiency of the FKRP expression in skeletal muscles, wherein said protein should be produced at a therapeutic level to cure the muscular abnormalities associated with a deficiency thereof

[0306] 2-2/ Long-Term (11 Weeks) Test in Rats

[0307] The same experiments as reported above have been performed on rats but 11 weeks after injection.

[0308] a) Survival and Weight Follow Up:

[0309] As a reminder, at sacrifice 2 weeks after administration with AAV-FKRP, 1 rat was died whereas all had severe cardiac damages. On the contrary, all the rats injected with AAV-FKRP-single or with AAV-FKRP-tandem survived even 11 weeks after administration.

[0310] Moreover, FIG. 9 shows that rats injected with AAV-FKRP-single or with AAV-FKRP-tandem do gain weight with time.

[0311] As a conclusion and after 11 weeks, it appears that all the rats administered with AAV-FKRP-single or AAV-FKRP-tandem are in good shape.

[0312] b) Heart Damages after Gene Transfer:

[0313] Moreover, FIG. 10 confirms that even after 11 weeks, no heart damage is observed.

[0314] In conclusion, vectors AAV-FKRP-single and AAV-FKRP-tandem do not display any cardiac toxicity.

REFERENCES

[0315] Apparailly, F., Khoury, M., Vervoordeldonk, M. J., Adriaansen, J., Gicquel, E., Perez, N., Riviere, C., Louis-Plence, P., Noel, D., Danos, O. et al. (2005) Adeno-associated virus pseudotype 5 vector improves gene transfer in arthritic joints. Hum. Gene Ther., 16, 426-434. [0316] Bartoli, M., Poupiot, J., Goyenvalle, A., Perez, N., Garcia, L., Danos, O. and Richard, I. (2006) Noninvasive monitoring of therapeutic gene transfer in animal models of muscular dystrophies. Gene Ther., 13, 20-28. [0317] Beltran-Valero de Bernabe, D., Voit, T., Longman, C., Steinbrecher, A., Straub, V., Yuva, Y., Herrmann, R., Sperner, J., Korenke, C., Diesen, C. et al. (2004) Mutations in the FKRP gene can cause muscle-eye-brain disease and Walker-Warburg syndrome. J. Med. Genet., 41, e61. [0318] Breton, C. and Imberty, A. (1999) Structure/function studies of glycosyltransferases. Curr. Opin. Struct. Biol., 9, 563-571. [0319] Brockington, M., Blake, D. J., Prandini, P., Brown, S. C., Torelli, S., Benson, M. A., Ponting, C. P., Estournet, B., Romero, N. B., Mercuri, E. et al. (2001) Mutations in the fukutin-related protein gene (FKRP) cause a form of congenital muscular dystrophy with secondary laminin alpha2 deficiency and abnormal glycosylation of alpha-dystroglycan. Am. J. Hum. Genet., 69, 1198-1209. [0320] Gicquel et al. (2017) Hum Mol Genet, doi: 10.1093/hmg/ddx066. [0321] Kanagawa, M., Kobayashi, K., Tajiri, M., Manya, H., Kuga, A., Yamaguchi, Y., Akasaka-Manya, K., Furukawa, J. I., Mizuno, M., Kawakami, H. et al. (2016) Identification of a Post-translational Modification with Ribitol-Phosphate and Its Defect in Muscular Dystrophy. Cell reports, in press. [0322] Mercuri, E., Brockington, M., Straub, V., Quijano-Roy, S., Yuva, Y., Herrmann, R., Brown, S. C., Torelli, S., Dubowitz, V., Blake, D. J. et al. (2003) Phenotypic spectrum associated with mutations in the fukutin-related protein gene. Ann. Neurol., 53, 537-542. [0323] Muller, T., Krasnianski, M., Witthaut, R., Deschauer, M. and Zierz, S. (2005) Dilated cardiomyopathy may be an early sign of the C826A Fukutin-related protein mutation. Neuromuscul. Disord., 15, 372-376. [0324] Petri et al. (2015), International Journal of Cardiology, 182 (2015) 403-411. [0325] Rosales et al. (2011), Journal of Cardiovascular Magnetic Resonance, 13:39. [0326] Sveen, M. L., Schwartz, M. and Vissing, J. (2006) High prevalence and phenotype-genotype correlations of limb girdle muscular dystrophy type 2I in Denmark. Ann. Neurol., 59, 808-815. [0327] Toromanoff et al. (2008), Molecular Therapy 16(7):1291-99. [0328] Wahbi, K., Meune, C., Hamouda el, H., Stojkovic, T., Laforet, P., Becane, H. M., Eymard, B. and Duboc, D. (2008) Cardiac assessment of limb-girdle muscular dystrophy 21 patients: an echography, Holter ECG and magnetic resonance imaging study. Neuromuscul. Disord., 18, 650-655.