METHOD FOR ESTABLISHING DIABETES DISEASE MODEL DOG

20220369608 · 2022-11-24

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a method for preparing a diabetic dog model by means of gene editing technology, a diabetic dog model prepared therefrom, as well as cells and issues thereof. The method comprises the following steps: (1) obtaining a dog fertilized egg cell, which comprises a point mutation in GCK gene, for a diabetic dog model by means of gene editing; and (2) transplanting the dog fertilized egg cell into one fallopian tube of a female dog, in which both fallopian tubes have been flushed, to prepare a diabetic dog model comprising a point mutation in GCK gene.

    Claims

    1-21. (canceled)

    22. A method for preparing a diabetic dog model, comprising the following steps: (1) obtaining a dog egg cell, which comprises a point mutation in glucokinase (GCK) gene, for a diabetic dog model by means of gene editing; and (2) transplanting the dog egg cell into one fallopian tube of a female dog, in which both fallopian tubes have been flushed, to prepare a diabetic dog model comprising a point mutation in GCK gene.

    23. The method according to claim 22, wherein the gene editing in step (1) comprises BE3, CRISPR/Cas9, TALEN and ZFN.

    24. The method according to claim 22, wherein the dog egg cell is a dog fertilized egg cell, and wherein the step (1) comprises: (i) determining a targeting site directed to exon 2 based on the sequence of dog GCK gene; (ii) synthesizing an sgRNA sequence based on the targeting site determined in step (i), and ligating the synthesized sgRNA sequence into a backbone vector to construct an sgRNA targeting vector; (iii) obtaining sgRNA with in vitro transcription of the sgRNA targeting vector, and obtaining BE3 mRNA with in vitro transcription; and (iv) mixing the sgRNA and BE3 mRNA obtained in step (iii), and intracytoplasmically injecting into a dog fertilized egg cell, resulting in the dog egg cell for transplanting.

    25. The method according to claim 24, further comprising: determining the targeting site directed to the exon 2 of GCK gene, and modifying the exon 2 with insertion, deletion, substitution and/or addition.

    26. The method according to claim 25, wherein the exon 2 is modified with point mutation.

    27. The method according to claim 25, wherein one target site in GCK gene is selected and comprises a sequence as shown by SEQ ID NO: 1.

    28. The method according to claim 25, and the sgRNA sequence synthesized based on the targeting site comprises a sequence as shown by SEQ ID NO: 8, and a complementary sequence of the sgRNA comprises a sequence as shown by SEQ ID NO: 9.

    29. The method according to claim 22, wherein in step (2), the dog egg cell is transplanted into one fallopian tube with less bleeding of the female dog, in which both fallopian tubes have been flushed.

    30. The method according to claim 22, wherein the dog egg cell contains a nucleus from a dog somatic cell, and wherein the step (1) comprises: (i) determining a targeting site directed to exon 2 based on the sequence of dog GCK gene; (ii) synthesizing an sgRNA sequence based on the targeting site determined in step (i), and ligating the synthesized sgRNA sequence into a backbone vector to construct an sgRNA targeting vector; (iii) obtaining sgRNA with in vitro transcription of the sgRNA targeting vector, and obtaining BE3 mRNA with in vitro transcription; and (iv) mixing the sgRNA and BE3 mRNA obtained in step (iii) and intracytoplasmically injecting into a dog somatic cell, and transplanting a nucleus of the dog somatic cell into a dog enucleated egg cell, resulting in the dog egg cell.

    31. A targeting vector for point mutation of dog GCK gene, comprising: an sgRNA sequence, which is designed based on a targeting site directed to an exon of dog GCK gene; and a backbone sequence.

    32. The targeting vector according to claim 31, wherein the sgRNA sequence is directed to exon 2 of the dog GCK gene.

    33. The targeting vector according to claim 31, wherein the sgRNA comprises a sequence as shown by SEQ ID NO: 8, and a complementary sequence of the sgRNA comprises a sequence as shown by SEQ ID NO: 9.

    34. A somatic cell, tissue or organ from a diabetic dog model comprising a point mutation in GCK gene obtained by the method of claim 22.

    35. The somatic cell, tissue or organ according to claim 34, which comprises a sequence as shown by SEQ ID NO: 2.

    36. The somatic cell, tissue or organ according to claim 34, which comprises a sequence as shown by SEQ ID NO: 3.

    37. The somatic cell, tissue or organ according to claim 34, which comprises a sequence as shown by SEQ ID NO: 4.

    38. The somatic cell, tissue or organ according to claim 34, wherein the somatic cell is classified as skin fibroblast GCK-KO-190619 of beagle, which is a diabetic dog model comprising a point mutation in GCK gene, and the somatic cell is deposited in China General Microbiological Culture Collection Center (CGMCC) located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101, on Jul. 23, 2019, under CGMCC deposit No. 18305.

    39. A diabetic dog model comprising a point mutation in GCK gene obtained by the method of claim 22.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0044] FIG. 1 shows the alignment result of the PCR products of the target site in a wild-type dog and a diabetic dog model comprising a point mutation in GCK gene. Wherein, 190619, 190627, 190628 and 190761 represent diabetic dog models comprising point mutation in GCK gene, and WT represents a wild-type dog.

    [0045] FIG. 2 shows the alignment result of the PCR products of the target site of 190625 and 190626, which are littermates of 190627 and 190628, and a WT dog (non-littermate).

    [0046] FIG. 3 shows the picture of a diabetic dog model prepared in the present disclosure, which comprises the point mutation in GCK gene. Wherein, the dog on left is diabetic dog model 190627 comprising the point mutation in GCK gene, and the dog on right is wild-type littermate 190626.

    [0047] FIG. 4 shows that the blood glucose level of the mutant dog is significantly higher than that of the wild-type littermate.

    [0048] FIG. 5 shows that the weight gain of the mutant dog is significantly slower than that of the wild-type littermate.

    DETAILED DESCRIPTION

    [0049] Hereinafter, the technical solutions of the present disclosure will be further described with reference to the examples and drawings. These examples are merely used for illustrating the present invention, but not to limit the protection scope thereof.

    EXAMPLES

    [0050] (1) Preparement of a diabetic dog model comprising a point mutation in GCK gene, which comprises the following steps:

    [0051] 1) determining a targeting site directed to exon 2 based on the sequence of dog GCK gene;

    [0052] 2) synthesizing an sgRNA sequence based on the targeting site determined in step (1), and ligating the synthesized sgRNA sequence into a backbone vector to construct an sgRNA targeting vector;

    [0053] 3) obtaining sgRNA with in vitro transcription of the sgRNA targeting vector, and obtaining BE3 mRNA with in vitro transcription;

    [0054] 4) transfecting beagle skin fibroblasts, screening out cell clones, extracting DNA from the cell clones, performing PCR by using targeting site-specific primers, sequencing the PCR products to obtain the gene mutation results, and then calculating the vector targeting efficiency;

    [0055] 5) mixing the sgRNA and CBE3 mRNA obtained in step (3), and intracytoplasmically injecting into a dog fertilized egg cell; and

    [0056] 6) transplanting the fertilized egg cell into one fallopian tube with less bleeding of a female dog, in which both fallopian tubes have been flushed.

    [0057] A vector expressing sgRNA directed to exon 2 of dog GCK gene was designed based on the sequence of dog GCK gene. One targeting site is designed to achieve point mutation at the target site. The targeting site of this example has the following sequence: 5′-GGATGCAGAGGGAGATGGCG-3′ (SEQ ID NO: 1).

    [0058] In this example, the sgRNA synthesized in step 2) and its complementary sequence (including sticky ends after annealling) have, respectively, the following sequences:

    TABLE-US-00012   F: (SEQ ID NO: 8) CACCGggatgcagagggagatggcg and R: (SEQ ID NO: 9) AAACcgccatctccctctgcatccC.

    [0059] When constructing the vector, the synthesized targeting sequences were annealed and ligated into PX330 which had been digested with BbsI. The sgRNA expression cassette was PCR amplified by using the following primers:

    TABLE-US-00013   SS72: (SEQ ID NO: 10) AAGGATGCAA caattg catgtgagggcctatttccca; and SS73-2: (SEQ ID NO: 11) ATGCAAGTGC caattg gccatttgtctgcagaattgg.
    The PCR products were purified and recovered. Then, the PCR products and pCBE3 were digested with MfeI-HF, purified, recovered and ligated. The resulted vector was sequenced to confirm the sgRNA-expressing vector was constructed successfully. The sgRNA-expressing vector was transformed, amplified and extracted. The targeting site of PCBE3 plasmid was PCR amplified. Then, the PCR products were recovered and were subjected to in vitro transcription by using an in vitro transcription kit. The obtained mRNAs were diluted to required injection concentration, subpackaged, and stored at −80° C. The aliquoted Cas9 and gRNA mRNA directed to the targeting site were mixed in a volume ratio of 1:1, and then used for cytoplasmic injection of the fertilized egg cells.

    [0060] In particular, linearize the pBE3-EGFP plasmid in a reaction system including 30 μg plasmid, 5 μL restriction enzyme BsaI, 10 μL 10×Buffer and ddH.sub.2O, in a total volume of 100 μL; add 100 μL phenol:chloroform:isopropyl alcohol (25:24:1) to purify the linearized plasmid; centrifuge at 12,000 g for 5 min; remove 50 μL supernatant to a 1.5 mL centrifugation tube without Rnase; add 1/10 volume of sodium acetate and 3 volumes of anhydrous ethanol to precipitate plasmid DNA; centrifuge at 12,000 g for 5 min; discard the supernatant; remove and discard residual supernatant; add 150 μL 70% ethanol to wash the plasmid, centrifuge at 12,000 g for 5 min; dry in air for 3-5 min, dissolve DNA with 15 μL RNase-free ddH.sub.2O; and measure the concentration of DNA.

    [0061] The in vitro transcription of mRNA was performed with a kit (Ambion) in an in vitro transcription system which comprised 1 μg linearized plasmid DNA, 10 μL 2×NTP/CAP, 2 μL 10×Buffer, 2 μL RNA polymerase and ddH.sub.2O, in a total volume of 20 μL. After mixing well, incubate for 1 hour at 37° C., add 1 μL TURBO DNase and digest plasmid templates, and incubate for 30 min at 37° C.; mix 20 μL in vitro transcription products, 20 μL Poly(A) polymerase and nuclease-free ddH.sub.2O to obtain a system of in vitro transcription mRNA plus poly(A) in a total volume of 100 μL; incubate for 1 hour at 37° C.; then, add 350 μL binding buffer into the reaction system and mix well; then add 250 μL anhydrous ethanol and mix well; transfer into an mRNA purification column, centrifuge at 10,000g for 1 min at room temperature; discard the filtrate, centrifuge the empty column for 1 min to rinse off impurities such as proteins; place the column into a new centrifugation tube, add 50 μL RNA eluent to the central position of the column, press the lid, incubate for 10 min at 65° C., then centrifuge at 10,000 g for 1 min at room temperature, and measure RNA quality and concentration. The CRISPR sgRNA and BE3 mRNA were mixed, resulting that the final concentration of sgRNA was 20 ng/μL and the final concentration of BE3 was 200 ng/μL, which is used for cytoplasmic injection.

    [0062] Dog skin fibroblasts were co-transfected with the constructed gRNA and BE3 plasmids, and screened with G418. DNA was extracted from cell clones obtained by screening, and used as a template for PCR amplifying, with primers GCK-CBE-S2-F (GGTCATTTGAGATGAGGG SEQ ID NO: 5) and GCK-CBE-S2-R (GAGGAGGAGAGGACGGAGT, SEQ ID NO: 6), a DNA fragment of 660 bp upstream and downstream of the target site recognized by the sgRNA. The targeting efficiency of the vectors was determined by sequencing of the target DNA fragment. The results showed that the point mutation efficiency of the target site was about 60% after transfection, screening and PCR product sequencing. Therefore, the above processes could be used for the preparement of a diabetic dog model comprising a point mutation in GCK gene.

    [0063] 10 female beagles with spontaneous estrous were used as donors of fertilized egg cells and receptors of embryo implantation for experimental research. Blood was collected from all female dogs to determine the progesterone levels in the blood. When the progesterone level reached 4-7 ng/mL, it was determined that the female dogs were in ovulation. 48 hours after ovulation, the female dogs were subjected to natural mating, followed by flushing the fertilized egg cells through surgical means. 53 fertilized egg cells were collected from 10 female dogs, treated with TCM199 medium containing 0.1% hyaluronidase to remove cumulus granulosa cells, put into HM microdroplets, and then placed on an inverted microscope equipped with a micromanipulator. A mixture containing sgRNA and Cas9 was sucked with a micro-injection needle, and injected into cytoplasm of the fertilized egg cells. After the intracytoplasmic injection, the egg cells were loaded into embryo transfer tubes, and were injected, from the fimbria, into one fallopian tube with less bleeding during the embryo flushing.

    [0064] After puppies were born, ear and tail tissues were collected for identification. Cut the tissues into pieces in a centrifugation tube, add protease K and incubate in a water bath of 56° C. for lysis for 1-3 hours. Add 700 μL Genomic Lysis Buffer with a pipette into the lysis system, mix upside down, and then centrifuge at 10000 g for 1 min. Remove the supernatant to a purifying column with a pipette, stand for 1 min at room temperature, and centrifuge at 10000 g for 1 min. Place the purifying column in a new collection tube, add 200 μL DNA pre-wash buffer, stand for 1 min at room temperature, centrifuge at 10000 g for 1 min, and discard effluent. Add 400 μL g-DNA washing buffer to the column, stand for 1 min at room temperature, centrifuge at 10000 g and discard effluent. Re-centrifuge the purifying column and collection tube at 10000 g for 2 min. Place the purifying column in a new 1.5 mL centrifugation tube, add 50 μL elution buffer, stand for 2 min at room temperature, and centrifuge at 12,000 rpm for 1 min to obtain a solution of dog genomic DNA.

    [0065] The dog genomic DNA was used as a template to carry out PCR, with the primers GCK-CBE-S2-F: GGTCATTTGAGATGAGGGG (SEQ ID NO: 5) and GCK-CBE-S2-R: GAGGAGGAGAGGACGGAGT (SEQ ID NO: 6), to amplify a DNA fragment of 660 bp upstream and downstream of the target site recognized by the sgRNA. The amplified fragment was subjected to DNA sequencing, and aligned with the sequence of dog GCK gene to determine the mutation type in GCK gene.

    [0066] The sequencing and alignment results showed that 4 of 13 puppies had point mutation in the target site.

    [0067] At 8:00 every morning, the blood glucose levels were measured simultaneously for the positive (mutant) and wild-type dogs. (1) Insert a test strip into a blood glucose meter (Sinocare); (2) stab the ear veins of a puppy with a blood lancet; (3) seep blood drop; (4) align the reaction zone of the test strip to the blood drop to syphon the blood; (5) keep still until the blood glucose meter beeps and shows blood glucose value. The body weight of the positive (mutant) and wild-type dogs were also measured at 8:00 every morning, simultaneously.

    TABLE-US-00014 TABLE 1 Embryo Transfer Summary Number of dogs No. of receptor Number of transferred comprising point No. dogs embryos Number of litters mutation in GCK gene 1 FRG1492 5  7 1 (190619) 2 FRG11482 7  4(190625/190626/190627/ 2 (190627/190628)  190628) 3 FRG11171 7  0 0 4 FRG1442 9  0 0 5 FRG11484 4  0 0 6 FRG1681 4  0 0 7 FRG11493 8  0 0 8 FRG11565 4  2 1 (190761) 9 FRG180103 2  0 0 10 FRG180816 3  1 0 Total: 10 53 14 4

    [0068] In Table 1, dog Nos. 190625 and 190626 were wild-type littermates of mutant dog Nos. 190627 and 190628.

    TABLE-US-00015 TABLE 2 Alignment of characteristic gene sequences of diabetic dog models comprising point mutation in GCK gene, wild-type littermates and wild-type dogs. No. of dogs Gene sequence Gene type 190619 5′-GGATGTAGAGGGAGATGGCG-3′ Mutant sequence 190627 5′-GGATGTAGAGGGAGATGGCG-3′ Mutant sequence 190628 5′-GGATGTAGAGGGAGATGGCG-3′ Mutant sequence 190761 5′-GGATGTAGAGGGAGATGGCG-3′ Mutant sequence 190625 5′-GGATGCAGAGGGAGATGGCG-3′ Wild-type sequence 190626 5′-GGATGCAGAGGGAGATGGCG-3′ Wild-type sequence WT 5′-GGATGCAGAGGGAGATGGCG-3′ Wild-type sequence

    [0069] FIG. 1 shows the alignment of the sequences comprising 107 nucleotides around the mutation site of four point-mutation dogs and one wild-type dog. In FIG. 1, “W” refers to tail cells, “E” refers to ear cells and “WT” refers to the cells of the wild-type dog. It can be seen that all dogs 190619, 190627, 19062 and 190761 have point mutation as compared with the wild-type (WT) dog. The WT dog is not littermate and is of wild type.

    [0070] (a) Dog 190619:

    [0071] The somatic cells of dog 190619 were classified as beagle skin fibroblasts GCK-KO-190619 comprising a point mutation in GCK gene, and were deposited in China General Microbiological Culture Collection Center (CGMCC) located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101, on Jul. 23, 2019, under CGMCC deposit No. 18305.

    [0072] In particular, the wild-type dog GCK gene comprises the following sequence around the target site of exon 2:

    TABLE-US-00016 (SEQ ID NO: 1)   5′-GGATGcustom-character AGAGGGAGATGGCG-3′.

    [0073] The corresponding sequence comprising point mutation of dog 190619 comprises the following sequence:

    TABLE-US-00017 (SEQ ID NO: 2)   5′-GGATGcustom-character AGAGGGAGATGGCG-3′.

    [0074] The mutant sequence can be determined by PCR using identification primers GCK-CBE-S2-F and GCK-CBE-S2-R, and recovered for sequencing:


    GCK-CBE-S2-F: GGTCATTTGAGATGAGGGG (SEQ ID NO:4); and


    GCK-CBE-S2-R: GAGGAGGAGAGGACGGAGT (SEQ ID NO:5).

    [0075] (b) Table 3 indicates the daily blood glucose levels and body weights of point-mutation diabetic dog models 190619, 190627, 190628 and 190761, and wild-type dogs 190625 and 190626.

    TABLE-US-00018 TABLE 3 No. of dogs Items 190619 190627 190628 190761 190625 190626 Blood glucose 18.9 26.5 13.3 18.7 8.4 8.4 (mmol/L) Weight (mean values 382 309 475 392 473 508 within 1 week of birth)

    [0076] It can be seen from FIGS. 1 and 2 that, flanking the point mutation site, GCK gene point mutation dogs 190619, 190627, 190628 and 190761 have the same gene sequence as those of wild-type dogs 190625 and 190626, which are littermates of 190627 and 190628, and wild-type (WT) non-littermate dog.

    [0077] FIG. 4 shows that the blood glucose level of the mutant dog is significantly higher than that of wild-type littermate. FIG. 5 shows that the weight gain of the mutant dog is significantly slower than that of the wild-type littermate.

    [0078] The above results indicate that the diabetic dog model 190627 prepared in the present disclosure comprising a point mutation in GCK gene exhibits diabetic phenotype, as compared with the wild-type littermates. Further, the four diabetic dog models 190619, 190627, 190628 and 190761 comprising a point mutation in GCK gene have the same genotype. Thus, it can conclude that the present disclosure has successfully prepared diabetic dog models point mutation in GCK gene.