A METHOD FOR MONITORING CANCER AND FOR REGULATION OF SEMAPHORIN 4D TO IMPROVE CANCER IMMUNOTHERAPY REGIMENS
20190030060 ยท 2019-01-31
Inventors
Cpc classification
A61K31/713
HUMAN NECESSITIES
G01N33/57484
PHYSICS
G01N2800/56
PHYSICS
A61K31/7105
HUMAN NECESSITIES
A61K31/711
HUMAN NECESSITIES
International classification
A61K31/713
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
A61K31/711
HUMAN NECESSITIES
C12N15/864
CHEMISTRY; METALLURGY
Abstract
The present invention provides a method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
Claims
1. A method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
2. The method of claim 1, wherein the agent decreases the expression level of Semaphorin 4D.
3. The method of claim 1, wherein the subject has a cancer selected from head and neck cancer and lymphoma.
4. The method of claim 1, wherein the inhibition of Semaphorin 4D decreases the level of myeloid-derived suppressor cells in the tumor microenvironment.
5. The method of claim 4, wherein the myeloid-derived suppressor cells have a phenotype that is CD33.sup.+, CD11 b.sup.+, and HLA-DR.sup./low.
6. The method of claim 1, wherein the inhibition of Semaphorin 4D results in one or more of the following effects: i) an increase in T cell proliferation; ii) an increase in IFN- levels; iii) a decrease in IL-4 levels; iv) a decrease in arginase-1 production by CD33.sup.+ myeloid cells; v) a decrease in NO production by CD33.sup. myeloid cells; vi) a decrease in IL-10 by CD33.sup.+ myeloid cells; vii) a decrease in TGF-I1 production by CD33.sup.+ myeloid cells; viii) a decrease in TGF-1 production by tumor cells. ix) an increase in effector Th1 T cells (CD4.sup.+Tbet.sup.+); x) an increase in cytotoxic T cells (CD8.sup.+Tbet.sup.+); and xi) a decrease in Tregs cells (CD4.sup.CD25.sup.+FoxP3.sup.+).
7. The method of claim 1, wherein the agent comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D.
8. The method of claim 7, wherein the nucleotide sequence of Semaphorin 4D is SEQ ID NO:2.
9. The method of claim 8, wherein a portion of the nucleic acid molecule is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% 97%, 97%, 98% or 99% complementary to at least a portion of SEQ ID NO:2.
10. The method of claim 9, wherein a portion of the nucleic acid molecule is 100% complementary to SEQ ID NO:4.
11. The method of claim 7, wherein the agent comprises a DNA molecule or an RNA molecule.
12. The method of claim 11, wherein the agent comprises an anti-sense DNA molecule or an anti-sense RNA molecule.
13. The method of claim 11, wherein the agent comprises a small interfering RNA (siRNA) molecule.
14. The method of claim 13, wherein the siRNA molecule targets the sequence SEQ ID NO:7.
15. The method of claim 1, wherein the agent comprises a small hairpin RNA (shRNA) molecule.
16. The method of claim 15, wherein the agent comprises an expression vector comprising SEQ ID NO:3.
17. The method of claim 1, wherein the method further comprises administering to the subject an effective amount of an immunotherapeutic anti-cancer agent.
18. A method of monitoring progression of cancer in a subject, comprising obtaining the results of an assay that determines the presence of Semaphorin 4D in a tissue sample from the subject, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
19. The method of claim 18, wherein the tissue sample comprises peripheral blood.
20. The method of claim 18, wherein the tissue sample comprises cancer tissue.
21. The method of claim 18, wherein the method further comprises obtaining the results of an assay that determines the presence of Semaphorin 4D in a second tissue sample from the subject, wherein increasing levels of Semaphorin 4D in the second tissue sample compared to the tissue sample from the subject obtained from an earlier point in time indicate progression of the cancer in the subject.
22. The method of claim 18, wherein the cancer is selected from head and neck cancer and lymphoma.
23. The method of claim 22, wherein the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck (HNSCC), salivary gland adenocarcinomas (SGA), metastatic HNSCC, and metastatic SGA.
24. The method of claim 18, wherein the elevated level of expression of Semaphorin 4D corresponds to a positive pixel intensity of at least 1.510.sup.5by standardized digital analysis.
25. The method of claim 18, wherein the subject has stage III or stage IV cancer.
26. The method of claim 18, wherein the subject's tumor has a dense, fibrotic peri-tumoral stroma.
27. The method of claim 18, further comprising obtaining the results of an assay that detects the presence or absence of an immune checkpoint molecule in the tissue sample, wherein the tissue sample is cancer tissue.
28. The method of claim 27, wherein the tissue is substantially negative for the presence of the checkpoint molecule.
29. The method of claim 28, further comprising administering to the subject an agent that inhibits the activity of Semaphorin 4D.
30. The method of claim 27, wherein the tissue exhibits elevated expression of the checkpoint molecule.
31. The method of claim 30, further comprising administering to the subject an agent that inhibits the activity of Semaphorin 4D and an agent that inhibits the checkpoint molecule.
32. The method of claim 31, wherein the checkpoint molecule is PD-L1 and the elevated level of expression of PD-L1 corresponds with strong focal expression in 1% of tumor cells or in tumor associated inflammatory cells or both, and having a positive pixel intensity of at least 1.510.sup.5 by standardized digital analysis.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0021] The skilled artisan will understand that the drawings, described below, are for illustration purposes only. The drawings are not intended to limit the scope of the present teachings in any way.
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029] MDSC from total PBMC. PBMC were separated by density gradient centrifugation then plated for 72 hrs in NM or CM from NOK versus CM of HN4, HN6, HN13 and SCC-9 cell lines. The average MDSC generation from PBMC was 20%. For flow cytometry analysis total PBMC were gated followed by a CD33.sup.+ HLA-DR.sup.lo gate. (B) Induction of MDSC from total CD33.sup.+ cells by HNSCC cell line CM is decreased by anti-Sema4D Ab treatment. Total CD33.sup.+ cells separated from PBMC using CD33 microbeads magnetic cell sorting (MACS), were cultured for 72 hrs in HNSCC HN4 and SCC-9 CM only (), CM with IgG Isotype, or CM with anti-Sema4D antibody (10 ug/ml). Total myeloid cells were gated for CD33.sup.+ CD11b.sup.+ followed by a CD11b.sup.+ HLA-DR.sup./low gate. For both experiments initial plating cell density was 1 ml of 2.510.sup.5 in 24 well plate. NM: Normal media. CM: conditioned media.
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047] Oxygen in hypoxia chambers. CFSE stained T cells activated using anti-CD3, CD28 beads, proliferation detected using flow cytometry. (E) Flowcytometry analysis for tracking T cell proliferation using CF SE under hypoxia. (F) Graphical representation of T cell proliferation detected in E using Flowcytometry analysis. (G) IFN- levels upon inhibition of Sema4D under hypoxia, detected using ELISA and read using spectrophotometer
DETAILED DESCRIPTION OF THE INVENTION
[0048] One of the mechanisms by which malignancies can induce immune suppression is through the production of cytokines that affect the maturation and differentiation of inflammatory cells in the tumor microenvironment. The inventor has surprisingly discovered that inhibition of Semaphorin 4D inhibits tumor-mediated immunosuppression, and that inhibiting Semaphorin 4D can be employed in methods useful for treating cancer. The inventor has also discovered methods which can be used in monitoring cancer progression involving monitoring detection of Semaphorin 4D.
[0049] Semaphorin 4D (Sema4D) is a pro-angiogenic cytokine produced by several malignancies, which has been described in the regulation of the immune system. Described herein are studies which examined the role of human Head and Neck Squamous Cell Carcinoma (HNSCC) secreted Sema4D on myeloid cell differentiation. CD33.sup.+ cells cultured in HNSCC cell line derived-conditioned medium differentiated into myeloid derived suppressor cells (MDSC) (CD33.sup. CD11b.sup.+ HLA-DR.sup./low). The addition of anti-Sema4D antibody to HNSCC conditioned medium significantly reduced the expansion of the MDSC population. Similarly, knockdown of Sema4D in a HNSCC cell line resulted in a loss of MDSC function as shown by a decrease in the production of the immune suppressive cytokines, arginase-1, TGF-, and IL-10 by MDSC, concomitant with recovery of T cell proliferation and IFN- production following stimulation of CD3/CD28. Importantly, CD33.sup. myeloid and T cells cultured in conditioned medium of HNSCC cells in which Sema4D was knocked down, promoted anti-tumor inflammatory profile, through recovery of the effector T cells (CD4.sup.+Tbet.sup.and CD8.sup.+Tbet.sup.+), as well as a decrease in Tregs (CD4.sup.CD25.sup.+FoxP3.sup.+) cell. It is also shown herein that Sema4D was comparative to GM-CSF in its induction of MDSC. Collectively, this work describes a novel immunosuppressive role for Sema4D in HNSCC through induction of MDSC, and highlights it as a therapeutic target to enhance the antitumorigenic inflammatory response in HNSCC and other epithelial malignancies.
[0050] Reference will now be made in detail to the presently preferred embodiments of the invention which, together with the drawings and the following examples, serve to explain the principles of the invention. These embodiments describe in sufficient detail to enable those skilled in the art to practice the invention, and it is understood that other embodiments may be utilized, and that structural, biological, and chemical changes may be made without departing from the spirit and scope of the present invention. Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.
[0051] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual, 2.sup.nd edition (1989); Current Protocols in Molecular Biology (F. M. Ausubel et al. eds. (1987)); the series Methods in Enzymology (Academic Press, Inc.); PCR: A Practical Approach (M. MacPherson et al. IRL Press at Oxford University Press (1991)); PCR 2: A Practical Approach (M. J. MacPherson, B. D. Hames and G. R. Taylor eds. (1995)); Antibodies, A Laboratory Manual (Harlow and Lane eds. (1988)); Using Antibodies, A Laboratory Manual (Harlow and Lane eds. (1999)); and Animal Cell Culture (R. I. Freshney ed. (1987)).
[0052] Definitions of common terms in molecular biology may be found, for example, in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN 019879276X); Kendrew et al. (eds.); The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341).
[0053] For the purpose of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with the usage of that word in any other document, including any document incorporated herein by reference, the definition set forth below shall always control for purposes of interpreting this specification and its associated claims unless a contrary meaning is clearly intended (for example in the document where the term is originally used). The use of or means and/or unless stated otherwise. As used in the specification and claims, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a cell includes a plurality of cells, including mixtures thereof. The use of comprise, comprises, comprising, include, includes, and including are interchangeable and not intended to be limiting. Furthermore, where the description of one or more embodiments uses the term comprising, those skilled in the art would understand that, in some specific instances, the embodiment or embodiments can be alternatively described using the language consisting essentially of and/or consisting of.
[0054] As used herein, the term about means plus or minus 10% of the numerical value of the number with which it is being used.
[0055] In one embodiment, the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
[0056] Semaphorin 4D, also known as CD100, is a transmembrane protein that belongs to the semaphorin gene family. Semaphorin 4D is expressed on the cell surface as a homodimer, but upon cell activation Semaphorin 4D can be released from the cell surface via proteolytic cleavage to generate sSEMA4D, a soluble form of the protein, which is also biologically active. See Suzuki et al., Nature Rev. Immunol. 3:159-167 (2003); Kikutani et al., Nature Immunol. 9:17-23 (2008). In some embodiments, the human Semaphorin 4D amino acid sequence is SEQ ID NO:1 and the nucleotide sequence is SEQ ID NO:2. Information about Semaphorin 4D gene sequences and variants can also be found in the NCBI gene database. See, e.g., https://www.ncbi.nlm.nih.gov/gene/(gene ID: 10507).
[0057] In certain embodiments, Semaphorin 4D is expressed on the surface of or secreted by a cell. In another embodiment, Semaphorin 4D is membrane bound. In another embodiment, Semaphorin 4D is soluble. In another embodiment, Semaphorin 4D may include a full-sized Semaphorin 4D or a fragment thereof, or a Semaphorin 4D variant polypeptide, wherein the fragment of Semaphorin 4D or Semaphorin 4D variant polypeptide retains some or all functional properties of the full-sized Semaphorin 4D.
[0058] The full-sized human Semaphorin 4D protein is a homodimeric transmembrane protein consisting of two polypeptide chains of 150 kDa. Semaphorin 4D belongs to the semaphorin family of cell surface receptors and is also referred to as CD100. Both human and mouse Semaphorin 4D are proteolytically cleaved from their transmembrane form to generate 120-kDa soluble forms, indicating the existence of two Semaphorin 4D isoforms (Kumanogoh et al., Cell Science 116(7):3464 (2003)). Semaphorins consist of soluble and membrane-bound proteins that were originally defined as axonal-guidance factors which play an important role in establishing precise connections between neurons and their appropriate target. Structurally considered a class IV semaphorin, Semaphorin 4D consists of an amino-terminal signal sequence followed by a characteristic Sema domain, which contains 17 conserved cysteine residues, an Ig-like domain, a lysine-rich stretch, a hydrophobic transmembrane region, and a cytoplasmic tail.
[0059] In one embodiment, the invention provides a method of inhibiting tumor-mediated immunosuppression in a subject undergoing immunotherapy, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D. In some embodiments, the immunotherapeutic agent comprises T cells.
[0060] In some embodiments, the inhibition of Semaphorin 4D decreases the level of myeloid-derived suppressor cells in the tumor microenvironment. In some embodiments, the myeloid-derived suppressor cells have a phenotype that is CD33.sup.+, CD11b.sup.+, and HLA-DR.sup./low. In some embodiments, the inhibition of Semaphorin 4D results in one or more of the following effects: [0061] i) an increase in T cell proliferation; [0062] ii) an increase in IFN- levels; [0063] iii) a decrease in IL-4 levels; [0064] iv) a decrease in arginase-1 production by CD33.sup.+ myeloid cells; [0065] v) a decrease in NO production by CD33.sup.+ myeloid cells; [0066] vi) a decrease in IL-10 by CD33.sup. myeloid cells; [0067] vii) a decrease in TGF-1 production by CD33.sup.+ myeloid cells; [0068] viii) a decrease in TGF-1 production by tumor cells. [0069] ix) an increase in effector Th1 T cells (CD4.sup.+Tbet.sup.+); [0070] x) an increase in cytotoxic T cells (CD8.sup.+Tbet.sup.+); and [0071] xi) a decrease in Tregs cells (CD4.sup.+CD25.sup.+FoxP3.sup.+).
[0072] The term subject as used herein is not limiting and is used interchangeably with patient. In some embodiments, the subject refers to animals, such as mammals. For example, mammals contemplated include humans, primates, dogs, cats, sheep, cattle, goats, pigs, horses, chickens, mice, rats, rabbits, guinea pigs, and the like. The terms subject and patient.
[0073] As used herein, treat and all its forms and tenses (including, for example, treating, treated, and treatment) can refer to therapeutic or prophylactic treatment. In certain aspects of the invention, those in need thereof of treatment include those already with a pathological condition of the invention (including, for example, a cancer), in which case treating refers to administering to a subject (including, for example, a human or other mammal in need of treatment) a therapeutically effective amount of a composition so that the subject has an improvement in a sign or symptom of a pathological condition of the invention. The improvement may be any observable or measurable improvement. Thus, one of skill in the art realizes that a treatment may improve the patient's condition, but may not be a complete cure of the pathological condition. In other certain aspects of the invention, those in need thereof of treatment include, those in which a pathological condition is to be prevented, in which case treating refers to administering a therapeutically effective amount of a composition to a subject (including, for example, a human or other mammal in need of treatment) at risk of developing a disease or condition such as cancer.
[0074] In accordance with the invention, a therapeutically effective amount or effective amount is administered to the subject. As used herein a therapeutically effective amount or effective amount is an amount sufficient to decrease, suppress, or ameliorate one or more symptoms associated with the disease or condition.
[0075] Cancer refers to leukemias, lymphomas, carcinomas, and other malignant tumors of potentially unlimited growth that can expand locally by invasion and potentially systemically by metastasis. Examples of cancers include, but are not limited to, cancer of the adrenal gland, bone, brain, breast, bronchi, colon and/or rectum, gallbladder, head and neck, kidneys, larynx, liver, lung, neural tissue, pancreas, prostate, parathyroid, skin, stomach, and thyroid. Certain other examples of cancers include, acute and chronic lymphocytic and granulocytic tumors, adenocarcinoma, adenoma, basal cell carcinoma, cervical dysplasia and in situ carcinoma, Ewing's sarcoma, epidermoid carcinomas, giant cell tumor, glioblastoma multiforma, hairy-cell tumor, intestinal ganglioneuroma, hyperplastic corneal nerve tumor, islet cell carcinoma, Kaposi's sarcoma, leiomyoma, leukemias, lymphomas, malignant carcinoid, malignant melanomas, malignant hypercalcemia, marfanoid habitus tumor, medullary carcinoma, metastatic skin carcinoma, mucosal neuroma, myeloma, mycosis fungoides, neuroblastoma, osteo sarcoma, osteogenic and other sarcoma, ovarian tumor, pheochromocytoma, polycythermia vera, primary brain tumor, small-cell lung tumor, squamous cell carcinoma of both ulcerating and papillary type, hyperplasia, seminoma, soft tissue sarcoma, retinoblastoma, rhabdomyosarcoma, renal cell tumor, topical skin lesion, veticulum cell sarcoma, and Wilm's tumor. In some embodiments, the cancer is head and neck cancer. In some embodiments, the cancer is lymphoma.
[0076] In some embodiments, the subject is administered one or more anti-cancer agents and/or radiotherapy in combination with the agent that inhibits Semaphorin 4D.
[0077] In some embodiments, the anti-cancer agent is an immunotherapeutic agent. In some embodiments, administering the agent that inhibits tumor-mediated immunosuppression caused by Semaphorin 4D can bolster the effectiveness of the immunotherapeutic anti-cancer agent administered to the subject.
[0078] The cancer immunotherapy is not limiting and can include one or more immunotherapies. There are several different approaches to immunotherapy. For example, immunotherapies can include monoclonal antibodies, checkpoint inhibitors/immune modulators, therapeutic cancer vaccines, oncolytic viruses, adoptive T cell transfer, cytokines, and adjuvant immunotherapy.
[0079] In certain embodiments, the combination of therapeutic agents discussed herein may be administered concurrently as a single composition in a pharmaceutically acceptable carrier, or concurrently as separate compositions with each agent in a pharmaceutically acceptable carrier. In another embodiment, the combination of therapeutic agents can be administered sequentially. The duration of time separating administrations in sequential administrations is not necessarily limiting.
[0080] In some embodiments, the agent that inhibits Semaphorin 4D is combined with an immunogenic agent, such as cancerous cells, purified tumor antigens (including recombinant proteins, peptides, and carbohydrate molecules), cells, and cells transfected with genes encoding immune stimulating cytokines (He et al. (2004) J. Immunol. 173:4919-28).
[0081] The agent that inhibits Semaphorin 4D can be further combined with a vaccination protocol. Many experimental strategies for vaccination against tumors have been devised (see Rosenberg, S. (2000) Development of Cancer Vaccines, ASCO Educational Book Spring: 60-62; Logothetis, C., 2000, ASCO Educational Book Spring: 300-302; Khayat, D. (2000) ASCO Educational Book Spring: 414-428; Foon, K. (2000) ASCO Educational Book Spring: 730-738; see also Restifo and Sznol, Cancer Vaccines, Ch. 61, pp. 3023-3043 in DeVita et al. (eds.), 1997, Cancer: Principles and Practice of Oncology. Fifth Edition). In one of these strategies, a vaccine is prepared using autologous or allogeneic tumor cells. These cellular vaccines have been shown to be most effective when the tumor cells are transduced to express GM-CSF. GM-CSF has been shown to be a potent activator of antigen presentation for tumor vaccination (Dranoff et al. (1993) Proc. Natl. Acad. Sci U.S.A. 90: 3539-43).
[0082] The study of gene expression and large scale gene expression patterns in various tumors has led to the definition of so called tumor specific antigens (Rosenberg (1999) Immunity 10:281-7). In many cases, these tumor specific antigens are differentiation antigens expressed in the tumors and in the cell from which the tumor arose. More importantly, many of these antigens can be shown to be the targets of tumor specific T cells found in the host. In certain embodiments, the agent that inhibits Semaphorin 4D may be used in conjunction with one or more recombinant proteins and/or peptides expressed in a tumor in order to generate an immune response to these proteins. These proteins are normally viewed by the immune system as self-antigens and are, therefore, tolerant to them. The tumor antigen may also include the protein telomerase, which is required for the synthesis of telomeres of chromosomes and which is expressed in more than 85% of human cancers and in only a limited number of somatic tissues (Kim et al. (1994) Science 266: 2011-2013). These somatic tissues may be protected from immune attack by various means. Tumor antigen may also be neo-antigens expressed in cancer cells because of somatic mutations that alter protein sequence or create fusion proteins between two unrelated sequences (i.e., bcr-abl in the Philadelphia chromosome), or idiotype from B cell tumors.
[0083] Other tumor vaccines may include the proteins from viruses implicated in human cancers such a Human Papilloma Viruses (HPV), Hepatitis Viruses (HBV and HCV) and Kaposi's Herpes Sarcoma Virus (KHSV). Another form of tumor specific antigen which may be used in conjunction with Semaphorin 4D blockade is purified heat shock proteins (HSP) isolated from the tumor tissue itself. These heat shock proteins contain fragments of proteins from the tumor cells and these HSPs are highly efficient at delivery to antigen presenting cells for eliciting tumor immunity (Suot & Srivastava (1995) Science 269:1585-1588; Tamura et al. (1997) Science 278:117-120).
[0084] Dendritic cells (DC) are potent antigen presenting cells that can be used to prime antigen-specific responses. DC's can be produced ex vivo and loaded with various protein and peptide antigens as well as tumor cell extracts (Nestle et al. (1998) Nature Medicine 4: 328-332). DCs may also be transduced by genetic means to express these tumor antigens as well. DCs have also been fused directly to tumor cells for the purposes of immunization (Kugler et al. (2000) Nature Medicine 6:332-336). As a method of vaccination, DC immunization may be effectively further combined with the agent that inhibits Semaphorin 4D to activate more potent anti-tumor responses.
[0085] Non-limiting examples of tumor vaccines that can also be used include peptides possible head and neck cancer antigens, such as p53, melanoma-associated antigens (MAGEs) such as MAGE-3, NY-ESO-1, cyclin B1, caspase-8, SART-1, carcino-embryonal antigen, and extracellular matrix metalloproteinase inducer (EMMPRIN) (CD147). The peptides can be coupled with antigen presenting cells, such as dendritic cells in some embodiments.
[0086] Semaphorin 4D inhibiting agents can also be used in combination with bispecific antibodies that target Fc or Fc receptor-expressing effector cells to tumor cells (see, e.g., U.S. Pat. Nos. 5,922,845 and 5,837,243). Bispecific antibodies can be used to target two separate antigens. For example anti-Fc receptor/anti-tumor antigen (e.g., Her-2/neu) bispecific antibodies have been used to target macrophages to sites of tumor. This targeting may more effectively activate tumor specific responses. The T cell arm of these responses could be augmented by the use of a Semaphorin 4D inhibiting agents. In some embodiments, antigen may be delivered directly to DCs by the use of bispecific antibodies which bind to tumor antigen and a dendritic cell specific cell surface marker.
[0087] In another embodiment, a Semaphorin 4D inhibiting agent can be used in conjunction with anti-neoplastic antibodies, such as Rituxan (rituximab), Herceptin (trastuzumab), Bexxar (tositumomab), Zevalin (ibritumomab), Campath (alemtuzumab), Lymphocide (eprtuzumab), Avastin (bevacizumab), and Tarceva (erlotinib), Kadcyla (ado-trastuzumab emtansine), Perj eta (pertuzumab), Adcetris (brentuximab vedotin), Erbitux (cetuximab), Vectibix (panitumumab), Gazyva (obinutuzumab), Arzerra (ofatumumab), Cyramza (ramucirumab), Blincyto (blinatumomab) nimotuzumab, panitumumab, zalutumumab, cetuximab, matuzumab, figitumumab, bavituximab, Ch14.18, and rilotumumab. In some embodiments, the antibody can be bound to a toxin. By way of example and not wishing to be bound by theory, treatment with an anti-cancer antibody or an anti-cancer antibody conjugated to a toxin can lead to cancer cell death (e.g., tumor cells) which would potentiate an immune response mediated by Semaphorin 4D inhibiting agents. In an exemplary embodiment, a treatment of a hyperproliferative disease (e.g., a cancer tumor) may include an anti-cancer antibody in combination with a Semaphorin 4D inhibiting agent, concurrently or sequentially or any combination thereof, which may potentiate an anti-tumor immune responses by the host.
[0088] Tumors evade host immune surveillance by a large variety of mechanisms. Many of these mechanisms may be overcome by the inactivation of proteins, which are expressed by the tumors and which are immunosuppressive. These include, among others, TGF- (Kehrl, J. et al. (1986) J Exp. Med. 163: 1037-1050), IL-10 (Howard, M. & O'Garra, A. (1992) Immunology Today 13: 198-200), and Fas ligand (Hahne, M. et al. (1996) Science 274: 1363-1365). In another example, antibodies to each of these entities may be further combined with Semaphorin 4D inhibiting agents to counteract the effects of immunosuppressive agents and favor anti-tumor immune responses by the host.
[0089] In another embodiment, a Semaphorin 4D inhibiting agent can be used in conjunction with one or more checkpoint inhibitors or immune modulators. Checkpoint inhibitors/immune modulators can make cancer cells more susceptible to attack by the immune system. Checkpoint inhibitors and immune modulators include CTLA-4 inhibitors such as Yervoy and tremelimumab, PD-1/PD-L1 inhibitors such as Keytruda, Opdivo, MPDL3280A and MEDI4736, LAG-3 inhibitors and KIR inhibitors. In some embodiments, the immune modulator is selected from CD27 inhibitors and GITR inhibitors.
[0090] Other antibodies that may be used to activate host immune responsiveness can be further used in combination with Semaphorin 4D inhibiting agents. These include molecules on the surface of dendritic cells that activate DC function and antigen presentation. Anti-CD40 antibodies are able to substitute effectively for T cell helper activity (Ridge, J. et al. (1998) Nature 393: 474-478) and can be used in conjunction with Semaphorin 4D inhibiting agents (Ito, N. et al. (2000) Immunobiology 201 (5) 527-40). Activating antibodies to T cell costimulatory molecules, such as OX-40 (Weinberg, A. et al. (2000) Immunol 164: 2160-2169), 4-1BB (Melero, I. et al. (1997) Nature Medicine 3: 682-685 (1997), and ICOS (Hutloff, A. et al. (1999) Nature 397: 262-266) may also provide for increased levels of T cell activation.
[0091] Bone marrow transplantation is currently being used to treat a variety of tumors of hematopoietic origin. While graft versus host disease is a consequence of this treatment, therapeutic benefit may be obtained from graft vs. tumor responses. In some embodiments, combined Semaphorin 4D blockade can be used to increase the effectiveness of the donor engrafted tumor specific T cells.
[0092] In some embodiments, the subject is administered Semaphorin 4D inhibiting agents in combination with T cells. There are also several treatment protocols that involve ex vivo activation and expansion of antigen specific T cells and adoptive transfer of these cells into recipients in order to generate antigen-specific T cells against tumor. Adoptive T cell transfer is an anti-cancer approach that enhances the natural cancer-fighting ability of the body's T cells by removing immune system cells, growing and/or making changes to them outside of the body, and then re-infusing them back into the patient. In some embodiments, T cells can be collected from a sample of a patient's tumor and multiplied in a laboratory. In some embodiments, T cells can be taken out of the body and genetically modified to attack antigens on cancer cells. In some embodiments, T cells can be taken out of the body and equipped with special receptors called chimeric antigen receptors (CARs); when given back to the patient, these CAR T cells recognize and attack cancer cells.
[0093] In some embodiments, the Semaphorin 4D inhibiting agent can be used in conjunction with oncolytic virus immununotherapy. An oncolytic virus is virus that can activate a greater immune response.
[0094] In some embodiments, the Semaphorin 4D inhibiting agent can be used in conjunction with one or more cytokines. In some embodiments, the cytokine is selected from IL-2 and IFN-alpha.
[0095] The agent that inhibits Semaphorin 4D may also be combined with standard cancer treatments. For example, Semaphorin 4D blockade may be effectively combined with chemotherapeutic regimes. In these instances, it may be possible to reduce the dose of other chemotherapeutic reagent administered (Mokyr et al. (1998) Cancer Research 58: 5301-5304). In some embodiments, chemotherapeutic compounds should result in increased levels of tumor antigen in the antigen presentation pathway as a result of increased cell death. Other combination therapies that may result in synergy with Semaphorin 4D blockade through cell death include radiation, surgery, or hormone deprivation. Each of these protocols creates a source of tumor antigen in the host. Angiogenesis inhibitors may also be combined with Semaphorin 4D blockade.
[0096] In some embodiments, the anti-cancer agent is selected from the group consisting of Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Paclitaxel Albumin-stabilized Nanoparticle Formulation), ABVD, ABVE, ABVE-PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Adrucil (Fluorouracil), Afatinib Dimaleate, Afinitor (Everolimus), Aldara (Imiquimod), Aldesleukin, Alemtuzumab, Alimta (Pemetrexed Disodium), Aloxi (Palonosetron Hydrochloride), Ambochlorin (Chlorambucil), Amboclorin (Chlorambucil), Aminolevulinic Acid, Anastrozole, Aprepitant, Aredia (Pamidronate Disodium), Arimidex (Anastrozole), Aromasin (Exemestane), Arranon (Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwinia chrysanthemi, Avastin (Bevacizumab), Axitinib, Azacitidine, BEACOPP, Becenum (Carmustine), Beleodaq (Belinostat), Belinostat, Bendamustine Hydrochloride, BEP, Bevacizumab, Bexarotene, Bexxar (Tositumomab and I 131 Iodine Tositumomab), Bicalutamide, BiCNU (Carmustine), Bleomycin, Blinatumomab, Blincyto (Blinatumomab), Bortezomib, Bosulif (Bosutinib), Bosutinib, Brentuximab Vedotin, Busulfan, Busulfex (Busulfan), Cabazitaxel, Cab ozantinib-S-Malate, CAF, Campath (Alemtuzumab), Camptosar (Irinotecan Hydrochloride), Capecitabine, CAPDX, Carboplatin, CARBOPLATIN-TAXOL, Carfilzomib, Carmubris (Carmustine), Carmustine, Carmustine Implant, Casodex (Bicalutamide), CeeNU (Lomustine) Ceritinib, Cerubidine (Daunorubicin Hydrochloride), Cervarix (Recombinant HPV Bivalent Vaccine), Cetuximab, Chlorambucil, CHLORAMBUCIL-PREDNISONE, CHOP, Cisplatin, Clafen (Cyclophosphamide), Clofarabine, Clofarex (Clofarabine), Clolar
[0097] (Clofarabine), CMF, Cometriq (Cabozantinib-S-Malate), COPP, COPP-ABV, Cosmegen (Dactinomycin), Crizotinib, CVP, Cyclophosphamide, Cyfos (Ifosfamide), Cyramza (Ramucirumab), Cytarabine, Cytarabine, Liposomal, Cytosar-U (Cytarabine), Cytoxan (Cyclophosphamide), Dabrafenib, Dacarbazine, Dacogen (Decitabine), Dactinomycin, Dasatinib, Daunorubicin Hydrochloride, Decitabine, Degarelix, Denileukin Diftitox,
[0098] Denosumab, DepoCyt (Liposomal Cytarabine), DepoFoam (Liposomal Cytarabine), Dexrazoxane Hydrochloride, Docetaxel, Doxil (Doxorubicin Hydrochloride Liposome), Doxorubicin Hydrochloride, Doxorubicin Hydrochloride Liposome, Dox-SL (Doxorubicin Hydrochloride Liposome), DTIC-Dome (Dacarbazine), Efudex (Fluorouracil), Elitek (Rasburicase), Ellence (Epirubicin Hydrochloride), Eloxatin (Oxaliplatin), Eltrombopag Olamine, Emend (Aprepitant), Enzalutamide, Epirubicin Hydrochloride, EPOCH, Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erlotinib Hydrochloride, Erwinaze (Asparaginase Erwinia chrysanthemi), Etopophos (Etoposide Phosphate), Etoposide, Etoposide Phosphate, Evacet (Doxorubicin Hydrochloride Liposome), Everolimus, Evista (Raloxifene Hydrochloride), Exemestane, Fareston (Toremifene), Faslodex (Fulvestrant), FEC, Femara (Letrozole), Filgrastim, Fludara (Fludarabine Phosphate), Fludarabine Phosphate, Fluoroplex (Fluorouracil), Fluorouracil, Folex (Methotrexate), Folex PFS (Methotrexate), FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRI-CETUXIMAB, FOLFIRINOX, FOLFOX, Folotyn (Pralatrexate), FU-LV, Fulvestrant, Gardasil (Recombinant HPV Quadrivalent Vaccine), Gardasil 9 (Recombinant HPV Nonavalent Vaccine), Gazyva (Obinutuzumab), Gefitinib, Gemcitabine Hydrochloride, GEMCITABINE-CISPLATIN, GEMCITABINE-OXALIPLATIN, Gemtuzumab Ozogamicin, Gemzar (Gemcitabine Hydrochloride), Gilotrif (Afatinib Dimaleate), Gleevec (Imatinib Mesylate), Gliadel (Carmustine Implant), Gliadel wafer (Carmustine Implant), Glucarpidase, Goserelin Acetate, Halaven (Eribulin Mesylate), Herceptin (Trastuzumab), HPV Bivalent Vaccine, Recombinant, HPV Nonavalent Vaccine, Recombinant, HPV Quadrivalent Vaccine, Recombinant, Hycamtin (Topotecan Hydrochloride), Hyper-CVAD, Ibrance (Palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, Iclusig (Ponatinib Hydrochloride), Idamycin (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, Ifex (Ifosfamide), Ifosfamide, Ifosfamidum (Ifosfamide), Imatinib Mesylate, Imbruvica (Ibrutinib), Imiquimod, Inlyta (Axitinib), Intron A (Recombinant Interferon Alfa-2b), Iodine 131 Tositumomab and Tositumomab, Ipilimumab, Iressa (Gefitinib), Irinotecan Hydrochloride, Istodax (Romidepsin), Ixabepilone, Ixempra (Ixabepilone), Jakafi (Ruxolitinib Phosphate), Jevtana (Cabazitaxel), Kadcyla (Ado-Trastuzumab Emtansine), Keoxifene (Raloxifene Hydrochloride), Kepivance (Palifermin), Keytruda (Pembrolizumab), Kyprolis (Carfilzomib), Lanreotide Acetate, Lapatinib Ditosylate, Lenalidomide, Lenvatinib Mesylate, Lenvima (Lenvatinib Mesylate), Letrozole, Leucovorin Calcium, Leukeran (Chlorambucil), Leuprolide Acetate, Levulan (Aminolevulinic Acid), Linfolizin (Chlorambucil), LipoDox (Doxorubicin Hydrochloride Liposome), Liposomal Cytarabine, Lomustine, Lupron (Leuprolide Acetate), Lupron Depot (Leuprolide Acetate), Lupron Depot-Ped (Leuprolide Acetate), Lupron Depot-3 Month (Leuprolide Acetate), Lupron Depot-4 Month (Leuprolide Acetate), Lynparza (Olaparib), Margibo (Vincristine Sulfate Liposome), Matulane (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Megace (Megestrol Acetate), Megestrol Acetate, Mekinist (Trametinib), Mercaptopurine, Mesna, Mesnex (Mesna), Methazolastone (Temozolomide), Methotrexate, Methotrexate LPF
[0099] (Methotrexate), Mexate (Methotrexate), Mexate-AQ (Methotrexate), Mitomycin C, Mitoxantrone Hydrochloride, Mitozytrex (Mitomycin C), MOPP, Mozobil (Plerixafor), Mustargen (Mechlorethamine Hydrochloride), Mutamycin (Mitomycin C), Myleran (Busulfan), Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogamicin), Nanoparticle Paclitaxel (Paclitaxel Albumin-stabilized Nanoparticle Formulation), Navelbine (Vinorelbine Tartrate), Nelarabine, Neosar (Cyclophosphamide), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Nilotinib, Nivolumab, Nolvadex (Tamoxifen Citrate), Nplate (Romiplostim), Obinutuzumab, OEPA, Ofatumumab, OFF, Olaparib, Omacetaxine Mepesuccinate, Oncaspar (Pegaspargase), Ontak (Denileukin Diftitox), Opdivo (Nivolumab), OPPA, Oxaliplatin, Paclitaxel, Paclitaxel Albumin-stabilized Nanoparticle Formulation, PAD, Palbociclib, Palifermin, Palonosetron Hydrochloride, Pamidronate Disodium, Panitumumab, Paraplat (Carboplatin), Paraplatin (Carboplatin), Pazopanib Hydrochloride, Pegaspargase, Peginterferon Alfa-2b, PEG-Intron (Peginterferon Alfa-2b), Pembrolizumab, Pemetrexed Disodium, Perjeta (Pertuzumab), Pertuzumab, Platinol (Cisplatin), Platinol-AQ (Cisplatin), Plerixafor, Pomalidomide, Pomalyst (Pomalidomide), Ponatinib Hydrochloride, Pralatrexate, Prednisone, Procarbazine Hydrochloride, Proleukin (Aldesleukin), Prolia (Denosumab), Promacta (Eltrombopag Olamine), Provenge (Sipuleucel-T), Purinethol (Mercaptopurine), Purixan (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride, Ramucirumab, Rasburicase, R-CHOP, R-CVP, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nonavalent Vaccine, Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon Alfa-2b, Regorafenib, R-EPOCH, Revlimid (Lenalidomide), Rheumatrex (Methotrexate), Rituxan (Rituximab), Rituximab, Romidepsin, Romiplostim, Rubidomycin (Daunorubicin Hydrochloride), Ruxolitinib Phosphate, Sclerosol Intrapleural Aerosol (Talc), Siltuximab, Sipuleucel-T, Somatuline Depot (Lanreotide Acetate), Sorafenib Tosylate, Sprycel (Dasatinib), STANFORD V, Sterile Talc Powder (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate, Sutent (Sunitinib Malate), Sylatron (Peginterferon Alfa-2b), Sylvant (Siltuximab), Synovir (Thalidomide), Synribo (Omacetaxine Mepesuccinate), TAC, Tafinlar (Dabrafenib), Talc, Tamoxifen Citrate, Tarabine PFS (Cytarabine), Tarceva (Erlotinib Hydrochloride), Targretin (Bexarotene), Tasigna (Nilotinib), Taxol (Paclitaxel),Taxotere (Docetaxel), Temodar (Temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid (Thalidomide), Thiotepa, Toposar (Etoposide), Topotecan Hydrochloride, Toremifene, Torisel (Temsirolimus), Tositumomab and I 131 Iodine Tositumomab, Totect (Dexrazoxane Hydrochloride), TPF, Trametinib, Trastuzumab, Treanda (Bendamustine Hydrochloride), Trisenox (Arsenic Trioxide), Tykerb (Lapatinib Ditosylate), Vandetanib, VAMP, Vectibix (Panitumumab), VeIP, Velban (Vinblastine Sulfate), Velcade (Bortezomib), Velsar (Vinblastine Sulfate), Vemurafenib, VePesid (Etoposide), Viadur (Leuprolide Acetate), Vidaza (Azacitidine), Vinblastine Sulfate, Vincasar PFS (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposome, Vinorelbine Tartrate, VIP, Vismodegib, Voraxaze (Glucarpidase), Vorinostat, Votrient (Pazopanib Hydrochloride), Wellcovorin (Leucovorin Calcium), Xalkori (Crizotinib), Xeloda (Capecitabine), XELIRI, Xgeva (Denosumab), Xofigo (Radium 223 Dichloride), Xtandi (Enzalutamide), Yervoy (Ipilimumab), Zaltrap (Ziv-Aflibercept), Zelboraf (Vemurafenib), Zevalin (Ibritumomab Tiuxetan), Zinecard (Dexrazoxane Hydrochloride), Ziv-Aflibercept, Zoladex (Goserelin Acetate), Zoledronic Acid, Zolinza (Vorinostat), Zometa (Zoledronic Acid), Zydelig (Idelalisib), Zykadia (Ceritinib), and Zytiga (Abiraterone Acetate).
[0100] In some embodiments, the anti-cancer agent is selected from gefitinib, erlotinib or cilengitide.
[0101] In some embodiments, the therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D is an antibody. The term antibody is used to refer to any antibody like molecule that has an antigen binding region, and includes full length antibody molecules, antibody fragments such as Fab, Fab, F(ab)2, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like. The techniques for preparing and using various antibody based constructs and fragments are well known in the art. Means for preparing and characterizing antibodies are also well known in the art (see, e.g., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 1988; incorporated herein by reference).
[0102] Monoclonal antibodies (mAbs) as used herein also include sequences corresponding to human antibodies, animal antibodies, and combinations thereof. The term chimeric antibody, as used herein, includes antibodies that have variable regions derived from an animal antibody, such as a rat or mouse antibody, fused to another molecule, for example, the constant domains derived from a human antibody. One type of chimeric antibodies, humanized antibodies, have had the variable regions altered (through mutagenesis or CDR grafting) to match (as much as possible) the known sequence of human variable regions. CDR grafting involves grafting the CDRs from an antibody with desired specificity onto the FRs of a human antibody, thereby replacing much of the non-human sequence with human sequence. Humanized antibodies, therefore, more closely match (in amino acid sequence) the sequence of known human antibodies. By humanizing mouse monoclonal antibodies, the severity of the human anti-mouse antibody, or HAMA, response is diminished.
[0103] Antibodies that bind Semaphorin 4D have been described in the art. See, for example, US Publ. Nos. 2008/0219971 A1, US 2010/0285036 A1, and US 2006/0233793 A1, International Patent Applications WO 93/14125, WO 2008/100995, and WO 2010/129917, and Herold et al., Int. Immunol. 7(1): 1-8 (1995), each of which is herein incorporated in its entirety by reference. Such antibodies can be used in the methods of the present invention. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the antibody is a mouse monoclonal antibody. In some embodiments, the antibody is clone 30/CD100 (Cat #610670) (BD Biosciences PharMingen, San Diego, Calif.). In some embodiments, the antibody is clone eBio133-1C6 (Cat #14-1009) (eBioscience, San Diego, Calif.). In some embodiments, the antibody comprises one or more complementarity determining regions (CDRs) identical to the CDRs of clone 30/CD100. In some embodiments, the antibody comprises one or more complementarity determining regions (CDRs) identical to the CDRs of clone eBio133-1C6.
[0104] In certain embodiments, an anti-Semaphorin 4D antibody for use in the methods provided herein binds human, murine, or both human and murine Semaphorin 4D. Also useful are antibodies which bind to the same epitope as any of the aforementioned antibodies and/or antibodies which competitively inhibit binding or activity of any of the aforementioned antibodies.
[0105] In some embodiments, it may be desirable to humanize the antibody in order to attenuate any adverse immune reaction. Humanized antibodies can be produced, for example by replacing an immunogenic portion of an antibody with a corresponding, but non-immunogenic portion (i.e., chimeric antibodies). See, e.g., Robinson et al., WO/1987/002671; Akira et al., EP Application 184,187; Taniguchi, EP Application 171,496; Morrison et al., EP Application 173,494; Neuberger et al., WO 86/01533; Cabilly et al., EP Application 125,023, all of which are incorporated herein by reference. In some embodiments, the agent that inhibits Semaphorin 4D is a humanized antibody. In some embodiments, the antibody is a humanized antibody of antibody clone 30/CD100. In some embodiments, the antibody is a humanized antibody of antibody clone eBio133-1C6 In some embodiments, the antibody is a fully human antibody.
[0106] In some embodiments, the Semaphorin 4D inhibitory agent useful in the methods of the invention comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D. The nucleic acid molecule can be of any length, so long as at least part of the molecule hybridizes sufficiently to Semaphorin 4D mRNA. The nucleic acid molecule can bind to any region of Semaphorin 4D mRNA. In some embodiments, the nucleic acid molecule binds to a particular domain of Semaphorin 4D mRNA. In some embodiments, the nucleotide sequence of human Semaphorin 4D is shown in SEQ ID NO:2 (GenBank Accession No. U60800.1). In some embodiments, a region of the nucleic acid molecule is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% complementary to at least a portion of SEQ ID NO:2. In some embodiments, the portion of SEQ ID NO:2 comprises SEQ ID NO:4 (5-GGCCTGAGGACCTTGCAGAAGA -3), corresponding to a portion of Homo sapiens semaphorin 41) (SEMA4D), Homo sapiens semaphorin 4D (SEMA4D), transcript variant 1, mRNA NCBI Reference Sequence: NM_006378.3 (SEQ.ID NO:5) and transcript variant 2, mRNA NCBI Reference Sequence: NM_001142287.1 (SEQ ID NO:6). In some embodiments, a region of the nucleic acid molecule is 100% complementary to SEQ ID NO:4.
[0107] In some embodiments, the composition can comprise a DNA molecule, such as an antisense DNA molecule. In some embodiments, the composition can comprise an RNA molecule, such as an anti-sense RNA molecule, a small interfering RNA (siRNA) molecule, or small hairpin RNA (shRNA) molecule, which may or may not be comprised on a vector, including a viral vector (such as an adeno-associated viral vector, an adenoviral vector, a retroviral vector, or a lentiviral vector) or a non-viral vector. In some embodiments, the expression of the DNA or RNA molecule may be regulated by a regulatory region specific to one or more types of cancer.
[0108] A target sequence on a target mRNA can be selected from a given cDNA sequence corresponding to the Semaphorin 4D, in some embodiments, beginning 50 to 100 nt downstream (i.e., in the 3 direction) from the start codon. The target sequence can, however, be located in the 5 or 3 untranslated regions, or in the region nearby the start codon.
[0109] In one embodiment, the Semaphorin 4D inhibitory agent comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D mRNA. In some embodiments, the nucleic acid molecule is a DNA. In some embodiments, the nucleic acid molecule is an RNA.
[0110] In some embodiments, the composition comprises an anti-sense DNA. Anti-sense DNA binds with mRNA and prevents translation of the mRNA. The anti-sense DNA can be complementary to a portion of Semaphorin 4D mRNA. In some embodiments, the anti-sense DNA is complementary to the entire reading frame of Semaphorin 4D. In some embodiments, the anti-sense DNA is complementary to the entire reading frame of SEQ ID NO:2. In some embodiments, the antisense DNA is complementary to a portion of SEQ ID NO:2. In some embodiments, the antisense DNA is at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, at least about 1000 nucleotides, at least about 1200 nucleotides, at least about 1500 nucleotides, at least about 2000 nucleotides, at least about 2500 nucleotides, at least about 3000 nucleotides, at least about 3500 nucleotides, or at least about 4000 nucleotides.
[0111] In some embodiments, the composition comprises an anti-sense RNA. Anti-sense RNA binds with mRNA and prevents translation of the mRNA. The anti-sense RNA can be complementary to a portion of Semaphorin 4D mRNA. In some embodiments, the anti-sense RNA is complementary to the entire reading frame of Semaphorin 4D. In some embodiments, the anti-sense RNA is complementary to the entire reading frame of SEQ ID NO:2. In some embodiments, the antisense RNA is complementary to a portion of SEQ ID NO:2. In some embodiments, the antisense RNA is at least about 15 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 150 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 400 nucleotides, at least about 500 nucleotides, at least about 600 nucleotides, at least about 700 nucleotides, at least about 800 nucleotides, at least about 900 nucleotides, at least about 1000 nucleotides, at least about 1200 nucleotides, at least about 1500 nucleotides, at least about 2000 nucleotides, at least about 2500 nucleotides, at least about 3000 nucleotides, at least about 3500 nucleotides, or at least about 4000 nucleotides.
[0112] In some embodiments, the composition is an siRNA targeting Semaphorin 4D. SiRNAs are small single or dsRNAs that do not significantly induce the antiviral response common among vertebrate cells but that do induce target mRNA degradation via the RNAi pathway. The term siRNA refers to RNA molecules that have either at least one double stranded region or at least one single stranded region and possess the ability to effect RNA interference (RNAi). It is specifically contemplated that siRNA can refer to RNA molecules that have at least one double stranded region and possess the ability to effect RNAi. The dsRNAs (siRNAs) may be generated by various methods including chemical synthesis, enzymatic synthesis of multiple templates, digestion of long dsRNAs by a nuclease with RNAse III domains, and the like. An siRNA directed to at least a particular region of Semaphorin 4D means that a particular Semaphorin 4D siRNA includes sequences that result in the reduction or elimination of expression of the target gene, i.e., the siRNA is targeted to the region or gene.
[0113] The nucleotide sequence of the siRNA is defined by the nucleotide sequence of its target gene. The Semaphorin 4D siRNA contains a nucleotide sequence that is essentially identical to at least a portion of the target gene. In some embodiments, the siRNA contains a nucleotide sequence that is completely identical to at least a portion of the Semaphorin 4D gene. Of course, when comparing an RNA sequence to a DNA sequence, an identical RNA sequence will contain ribonucleotides where the DNA sequence contains deoxyribonucleotides, and further that the RNA sequence will typically contain a uracil at positions where the DNA sequence contains thymidine.
[0114] In some embodiments, a Semaphorin 4D siRNA comprises a double stranded structure, the sequence of which is substantially identical to at least a portion of the target gene. Identity, as known in the art, is the relationship between two or more polynucleotide (or polypeptide) sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polynucleotide sequences, as determined by the match of the order of nucleotides between such sequences. Identity can be readily calculated by standard practices in the art.
[0115] One of skill in the art will appreciate that two polynucleotides of different lengths may be compared over the entire length of the longer fragment. Alternatively, small regions may be compared. Normally sequences of the same length are compared for a final estimation of their utility in the practice of the present invention. In some embodiments, there is 100% sequence identity between the dsRNA for use as siRNA and at least 15 contiguous nucleotides of the target gene, although a dsRNA having 70%, 75%, 80%, 85%, 90%, or 95% or greater may also be used in the present invention. A siRNA that is essentially identical to a least a portion of the target gene may also be a dsRNA wherein one of the two complementary strands (or, in the case of a self-complementary RNA, one of the two self-complementary portions) is either identical to the sequence of that portion or the target gene or contains one or more insertions, deletions or single point mutations relative to the nucleotide sequence of that portion of the target gene. siRNA technology thus has the property of being able to tolerate sequence variations that might be expected to result from genetic mutation, strain polymorphism, or evolutionary divergence.
[0116] In some embodiments, the invention provides an Semaphorin 4D siRNA that is capable of triggering RNA interference, a process by which a particular RNA sequence is destroyed (also referred to as gene silencing). In specific embodiments, Semaphorin 4D siRNA are dsRNA molecules that are 100 bases or fewer in length (or have 100 base pairs or fewer in its complementarity region). In some embodiments, a dsRNA may be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 225, 250, 275, 300, 325, 350, 375, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, or 1000 nucleotides or more in length. In certain embodiments, Semaphorin 4D siRNA may be approximately 21 to 25 nucleotides in length. In some cases, it has a two nucleotide 3 overhang and a 5 phosphate. The particular Semaphorin 4D RNA sequence is targeted as a result of the complementarity between the dsRNA and the particular Semaphorin 4D RNA sequence. It will be understood that dsRNA or siRNA of the disclosure can effect at least a 20, 30, 40, 50, 60, 70, 80, 90 percent or more reduction of expression of a targeted Semaphorin 4D RNA in a cancer cell. dsRNA of the invention (the term dsRNA will be understood to include siRNA and/or candidate siRNA) is distinct and distinguishable from antisense and ribozyme molecules by virtue of the ability to trigger RNAi. Structurally, dsRNA molecules for RNAi differ from antisense and ribozyme molecules in that dsRNA has at least one region of complementarity within the RNA molecule. In some embodiments, the complementary (also referred to as complementarity) region comprises at least or at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, or 500 contiguous bases. In some embodiments, long dsRNA are employed in which long refers to dsRNA that are 1000 bases or longer (or 1000 base pairs or longer in complementarity region). The term dsRNA includes long dsRNA, intermediate dsRNA or small dsRNA (lengths of 2 to 100 bases or base pairs in complementarity region) unless otherwise indicated. In some embodiments of the disclosure, dsRNA can exclude the use of siRNA, long dsRNA, and/or intermediate dsRNA (lengths of 100 to 1000 bases or base pairs in complementarity region).
[0117] It is specifically contemplated that a dsRNA may be a molecule comprising two separate RNA strands in which one strand has at least one region complementary to a region on the other strand. Alternatively, a dsRNA includes a molecule that is single stranded yet has at least one complementarity region as described above (such as when a single strand with a hairpin loop is used as a dsRNA for RNAi). For convenience, lengths of dsRNA may be referred to in terms of bases, which simply refers to the length of a single strand or in terms of base pairs, which refers to the length of the complementarity region. It is specifically contemplated that embodiments discussed herein with respect to a dsRNA comprised of two strands are contemplated for use with respect to a dsRNA comprising a single strand, and vice versa. In a two-stranded dsRNA molecule, the strand that has a sequence that is complementary to the targeted mRNA is referred to as the antisense strand and the strand with a sequence identical to the targeted mRNA is referred to as the sense strand. Similarly, with a dsRNA comprising only a single strand, it is contemplated that the antisense region has the sequence complementary to the targeted mRNA, while the sense region has the sequence identical to the targeted mRNA. Furthermore, it will be understood that sense and antisense region, like sense and antisense strands, are complementary (i.e., can specifically hybridize) to each other.
[0118] Strands or regions that are complementary may or may not be 100% complementary (completely or fully complementary). It is contemplated that sequences that are complementary include sequences that are at least 50% complementary, and may be at least 50%, 60%, 70%, 80%, or 90% complementary. In some embodiments, siRNA generated from sequence based on one organism may be used in a different organism to achieve RNAi of the cognate target gene. In other words, siRNA generated from a dsRNA that corresponds to a human gene may be used in a mouse cell if there is the requisite complementarity, as described above. Ultimately, the requisite threshold level of complementarity to achieve RNAi is dictated by functional capability. It is specifically contemplated that there may be mismatches in the complementary strands or regions.
[0119] Mismatches may number at most or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 residues or more, depending on the length of the complementarity region.
[0120] In some embodiments, the single RNA strand or each of two complementary double strands of a dsRNA molecule may be of at least or at most the following lengths: 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, or more (including the full-length of a particular's gene's mRNA without the poly-A tail) bases or base pairs. If the dsRNA is composed of two separate strands, the two strands may be the same length or different lengths. If the dsRNA is a single strand, in addition to the complementarity region, the strand may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 or more bases on either or both ends (5 and/or 3) or as forming a hairpin loop between the complementarity regions.
[0121] In some embodiments, the strand or strands of dsRNA are 100 bases (or base pairs) or less. In specific embodiments, the strand or strands of the dsRNA are less than 70 bases in length. With respect to those embodiments, the dsRNA strand or strands may be from 5-70, 10-65, 20-60, 30-55, 40-50 bases or base pairs in length. A dsRNA that has a complementarity region equal to or less than 30 base pairs (such as a single stranded hairpin RNA in which the stem or complementary portion is less than or equal to 30 base pairs) or one in which the strands are 30 bases or fewer in length is specifically contemplated, as such molecules evade a mammalian's cell antiviral response. Thus, a hairpin dsRNA (one strand) may be 70 or fewer bases in length with a complementary region of 30 base pairs or fewer. In some cases, a dsRNA may be processed in the cell into siRNA.
[0122] The siRNA of the invention can comprise partially purified RNA, substantially pure RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally-occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, including modifications that make the siRNA resistant to nuclease digestion.
[0123] One or both strands of the siRNA of the disclosure can comprise a 3 overhang. As used herein, a 3 overhang refers to at least one unpaired nucleotide extending from the 3-end of a duplexed RNA strand.
[0124] Thus, in some embodiments, the Semaphorin 4D siRNA of the invention comprises at least one 3 overhang of from 1 to about 6 nucleotides (which includes ribonucleotides or deoxynucleotides) in length, from 1 to about 5 nucleotides in length, from 1 to about 4 nucleotides in length, or from about 2 to about 4 nucleotides in length.
[0125] In some embodiments in which both strands of the Semaphorin 4D siRNA molecule comprise a 3 overhang, the length of the overhangs can be the same or different for each strand. In some embodiments, the 3 overhang is present on both strands of the siRNA, and is 2 nucleotides in length. For example, each strand of the Semaphorin 4D siRNA of the invention can comprise 3 overhangs of dithymidylic acid (TT) or diuridylic acid (uu).
[0126] In order to enhance the stability of the present Semaphorin 4D siRNA, the 3 overhangs can be also stabilized against degradation. In some embodiments, the overhangs are stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine nucleotides in the 3 overhangs with 2-deoxythymidine, is tolerated and does not affect the efficiency of RNAi degradation. In particular, the absence of a 2 hydroxyl in the 2-deoxythymidine significantly enhances the nuclease resistance of the 3 overhang in tissue culture medium.
[0127] In some embodiments, the Semaphorin 4D siRNA of the invention comprises the sequence AA(N19)TT or NA(N21), where N is any nucleotide. These Semaphorin 4D siRNA comprise approximately 30-70% GC, and in some embodiments comprise approximately 50% G/C. The sequence of the sense siRNA strand corresponds to (N19)TT or N21 (i.e., positions 3 to 23), respectively. In the latter case, the 3 end of the sense siRNA is converted to TT. The rationale for this sequence conversion is to generate a symmetric duplex with respect to the sequence composition of the sense and antisense strand 3 overhangs. The antisense RNA strand is then synthesized as the complement to positions 1 to 21 of the sense strand.
[0128] Because position 1 of the 23-nt sense strand in these embodiments is not recognized in a sequence-specific manner by the antisense strand, the 3-most nucleotide residue of the antisense strand can be chosen deliberately. However, the penultimate nucleotide of the antisense strand (complementary to position 2 of the 23-nt sense strand in either embodiment) is generally complementary to the targeted sequence.
[0129] In another embodiment, the Semaphorin 4D siRNA of the invention comprises the sequence NAR(N17)YNN, where R is a purine (e.g., A or G) and Y is a pyrimidine (e.g., C or U/T). The respective 21-nt sense and antisense RNA strands of this embodiment therefore generally begin with a purine nucleotide. Such siRNA can be expressed from pol III expression vectors without a change in targeting site, as expression of RNAs from pol III promoters is only believed to be efficient when the first transcribed nucleotide is a purine.
[0130] In some embodiments, the Semaphorin 4D siRNA of the disclosure can be targeted to any stretch of approximately 19-25 contiguous nucleotides in any of the target mRNA sequences (the target sequence). Techniques for selecting target sequences for siRNA are given, for example, in Tuschl T et al., The siRNA User Guide, revised Oct. 11, 2002, the entire disclosure of which is herein incorporated by reference. The siRNA User Guide is available on the worldwide web at a website maintained by Dr. Thomas Tuschl, Department of Cellular Biochemistry, AG 105, Max-Planck-Institute for Biophysical Chemistry, 37077 Gottingen, Germany, and can be found by accessing the web site of the Max Planck Institute and searching with the keyword siRNA. Thus, in some embodiments, the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.
[0131] In some embodiments of the invention, the Semaphorin 4D siRNA targets the Semaphorin 4D ORF sequence: 5-CAAGACGCTGCAGTTCGTTAA-3 (SEQ ID NO:7). In some embodiments, the siRNA molecule is complementary to SEQ ID NO:7.
[0132] In some embodiments, the Semaphorin 4D inhibitory agent useful in the methods of the invention comprises an shRNA molecule that targets Semaphorin 4D mRNA (Semaphorin 4D shRNA). shRNA is an artificial RNA molecule with a tight hairpin turn that can be used to silence target gene expression via RNA interference (RNAi). In certain cases, expression of Semaphorin 4D shRNA in cells is achieved through delivery of non-viral vectors (such as plasmids or bacterial vectors) or through viral vectors. shRNA is useful because it has a relatively low rate of degradation and turnover.
[0133] In some embodiments, the oligonucleotide used to knockdown Semaphorin 4D protein levels using shRNA is 5-GGCCTGAGGACCTTGCAGAAGA-3 (SEQ ID NO:3). In order to obtain long-term gene silencing, expression vectors that continually express siRNAs in stably transfected mammalian cells can be used (Brummelkamp et al., Science 296: 550-553, 2002; Lee et al., Nature Biotechnol. 20:500-505, 2002; Miyagishi, M, and Taira, K. Nature Biotechnol. 20:497-500, 2002; Paddison, et al., Genes & Dev. 16:948-958, 2002; Paul et al., Nature Biotechnol. 20:505-508, 2002; Sui et al., Proc. Natl. Acad. Sci. USA 99(6):5515-5520, 2002; Yu et al., Proc. Natl. Acad. Sci. USA 99(9):6047-6052, 2002). Many of these plasmids have been engineered to express shRNAs lacking poly (A) tails. Transcription of shRNAs is initiated at a polymerase III (pol III) promoter and is believed to be terminated at position 2 of a 4-5-thymine transcription termination site. Upon expression, shRNAs are thought to fold into a stem-loop structure with 3 UU-overhangs. Subsequently, the ends of these shRNAs are processed, converting the shRNAs into .sup.21 nt siRNA-like molecules. The siRNA-like molecules can, in turn, bring about gene-specific silencing in the transfected mammalian cells.
[0134] The length of the stem and loop of shRNAs can be varied. In some embodiments, stem lengths could range anywhere from 25 to 29 nucleotides and loop size could range between 4 to 23 nucleotides without affecting silencing activity. Moreover, presence of G-U mismatches between the two strands of the shRNA stem does not necessarily lead to a decrease in potency.
[0135] In some embodiments, the present invention is directed towards methods of administering subjects with compositions comprising expression vectors and/or chemically synthesized shRNA molecules that target Semaphorin 4D. In some embodiments, the composition comprises a nucleotide sequence expressing a small hairpin RNA (shRNA) molecule. In some embodiments, the shRNA molecule is expressed by an expression vector comprising SEQ ID NO:3. In some embodiments, the expression vector is a lentivirus expression vector.
[0136] In some embodiments, it is contemplated that nucleic acids or antibodies of the invention may be labeled. The label may be fluorescent, radioactive, enzymatic, or calorimetric. It is contemplated that a dsRNA may have one label attached to it or it may have more than one label attached to it. When more than one label is attached to a dsRNA, the labels may be the same or be different. If the labels are different, they may appear as different colors when visualized. The label may be on at least one end and/or it may be internal. Furthermore, there may be a label on each end of a single stranded molecule or on each end of a dsRNA made of two separate strands. The end may be the 3 and/or the 5 end of the nucleic acid. A label may be on the sense strand or the sense end of a single strand (end that is closer to sense region as opposed to antisense region), or it may be on the antisense strand or antisense end of a single strand (end that is closer to antisense region as opposed to sense region). In some cases, a strand is labeled on a particular nucleotide (G, A, U, or C). When two or more differentially colored labels are employed, fluorescent resonance energy transfer (FRET) techniques may be employed to characterize the dsRNA.
[0137] Labels contemplated for use in several embodiments are non-radioactive. In many embodiments of the invention, the labels are fluorescent, though they may be enzymatic, radioactive, or positron emitters. Fluorescent labels that may be used include, but are not limited to, BODIPY, Alexa Fluor, fluorescein, Oregon Green, tetramethylrhodamine, Texas Red, rhodamine, cyanine dye, or derivatives thereof. The labels may also more specifically be Alexa 350, Alexa 430, AMCA, BODIPY 630/650, BODIPY 650/665, BODIPY-FL, BODIPY-R6G, BODIPY-TMR, BODIPY-TRX, Cascade Blue, Cy3, Cy5, DAPI, 6-FAM, Killer Red, Fluorescein Isothiocyanate, HEX, 6-JOE, Oregon Green 488, Oregon Green 500, Oregon Green 514, Pacific Blue, REG, Rhodamine Green, Rhodamine Red, Renographin, ROX, SYPRO, TAMRA, TET, Tetramethylrhodamine, and/or Texas Red. A labeling reagent is a composition that comprises a label and that can be incubated with the nucleic acid to effect labeling of the nucleic acid under appropriate conditions. In some embodiments, the labeling reagent comprises an alkylating agent and a dye, such as a fluorescent dye. In some embodiments, a labeling reagent comprises an alkylating agent and a fluorescent dye such as Cy3, Cy5, or fluorescein (FAM). In still further embodiments, the labeling reagent is also incubated with a labeling buffer, which may be any buffer compatible with physiological function (i.e., buffers that is not toxic or harmful to a cell or cell component) (termed physiological buffer).
[0138] In some embodiments, the nucleic acids of the invention can be modified. In some embodiments, the nucleic acids can be modified to include a phosphorothioate (PS) backbone. The modification to the backbone can be throughout the molecule or at one or more defined sites. In some embodiments, the nucleic acids can be modified to encompass peptide nucleic acids (PNA). In some embodiments, the nucleic acids can be modified to encompass phosphorodiamidate morpholino oligomers (PMO).
[0139] In some embodiments, the nucleic acid molecules of the invention can include derivatives such as 5-oligonucleotides (phosphorothioate derivatives or S-oligos). S-oligos (nucleoside phosphorothioates) are isoelectronic analogs of an oligonucleotide (O-oligo) in which a nonbridging oxygen atom of the phosphate group is replaced by a sulfur atom. The S-oligos of the present invention may be prepared by treatment of the corresponding O-oligos with 3H-1,2-benzodithiol3-one-1,1-dioxide which is a sulfur transfer reagent. See Iyer et al., J. Org. Chem. 55:4693-4698 (1990); and Iyer et al., J. Am. Chem. Soc. 112:1253-1254 (1990), the disclosures of which are fully incorporated by reference herein.
[0140] In some embodiments of the invention, a dsRNA has one or more non-natural nucleotides, such as a modified residue or a derivative or analog of a natural nucleotide. Any modified residue, derivative or analog may be used to the extent that it does not eliminate or substantially reduce (by at least 50%) RNAi activity of the dsRNA.
[0141] A person of ordinary skill in the art is well aware of achieving hybridization of complementary regions or molecules. Such methods typically involve heat and slow cooling of temperature during incubation, for example.
[0142] In some embodiments, the nucleic acid molecules of the present methods are encoded by expression vectors. The expression vectors may be obtained and introduced into a cell. Once introduced into the cell the expression vector is transcribed to produce various nucleic acids. Expression vectors include nucleic acids that provide for the transcription of a particular nucleic acid. Expression vectors include plasmid DNA, linear expression elements, circular expression elements, viral expression constructs (including adenoviral, adeno-associated viral, retroviral, lentiviral, and so forth), and the like, all of which are contemplated as being used in the compositions and methods of the present disclosure. In some embodiments one or at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acid molecules binding to Semaphorin 4D RNA are encoded by a single expression construct. Expression of the nucleic acid molecules binding to Semaphorin 4D RNA may be independently controlled by at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more regulatory elements. In certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more expression constructs can be introduced into a cell. Each expression construct can encode 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleic acid molecules binding to Semaphorin 4D RNA. In some embodiments, nucleic acid molecules binding to Semaphorin 4D RNA may be encoded as expression domains. Expression domains include a transcription control element, which may or may not be independent of other control or promoter elements; a nucleic acid; and optionally a transcriptional termination element.
[0143] Any suitable viral vector can be used in the methods of the invention. For example, vectors derived from adenovirus (AV); adeno-associated virus (AAV; including AAV serotypes); retroviruses (e.g, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of the viral vectors can also be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses. For example, an AAV vector of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like.
[0144] Selection of recombinant viral vectors suitable for use in the invention, are within the skill in the art. See, for example, Dornburg R (1995), Gene Therap. 2: 301-310; Eglitis M A (1988), Biotechniques 6: 608-614; Miller A D (1990), Hum Gene Therap. 1: 5-14; and Anderson W F (1998), Nature 392: 25-30, the entire disclosures of which are herein incorporated by reference.
[0145] The ability of a RNA of the claimed invention to cause RNAi-mediated degradation of the target mRNA can be evaluated using standard techniques for measuring the levels of RNA or protein in cells. For example, Semaphorin 4D siRNA of the invention can be delivered to cultured cells, and the levels of target mRNA can be measured by Northern blot or dot blotting techniques, or by quantitative RT-PCR. Alternatively, the levels of Semaphorin 4D protein in the cultured cells can be measured by ELISA or Western blot. A suitable cell culture system for measuring the effect of the present siRNA on target mRNA or protein levels may be utilized. RNAi-mediated degradation of Semaphorin 4D mRNA by an siRNA containing a given target sequence can also be evaluated with animal models, for example.
[0146] In other embodiments, the method comprises administering a composition comprising an antibody that reduces activity of Semaphorin 4D. As used herein, the term antibody includes any immunologic binding agent, such as IgG, IgM, IgA, IgD and IgE. Generally, IgG and/or IgM may be utilized because they are the most common antibodies in the physiological situation and because they are most easily made in a laboratory setting. The term antibody may be used to refer to any antibody-like molecule that has an antigen binding region, and includes antibody fragments such as Fab, Fab, F(ab)2, single domain antibodies (DABs), Fv, scFv (single chain Fv), and the like. Monoclonal and humanized antibodies are also contemplated in the disclosure.
[0147] In some embodiments, the nucleic acids can be administered to the subject either as naked nucleic acid, in conjunction with a delivery reagent, or as a recombinant plasmid or viral vector that expresses the nucleic acids. Delivery of nucleic acids or vectors to an individual may occur by any suitable means, but in specific embodiments it occurs by one of the following: cyclodextrin delivery system; ionizable lipids; DPC conjugates; GalNAc-conjugates; self-assembly of oligonucleotide nanoparticles (DNA tetrahedra carrying multiple siRNAs); or polymeric nanoparticles made of low-molecular-weight polyamines and lipids (see Kanasty et al. Nature Materials 12, 967-977 (2013) for review of same).
[0148] Suitable delivery reagents for administration in conjunction with the present nucleic acids or vectors include the Minis Transit TKO lipophilic reagent; lipofectin; lipofectamine; cellfectin; or polycations (e.g., polylysine), or liposomes. In specific embodiments, a particular delivery reagent comprises a liposome.
[0149] Liposomes can aid in the delivery of the present nucleic acids or vectors to a particular tissue, and can also increase the blood half-life of the nucleic acids. Liposomes suitable for use in the invention are formed from standard vesicle-forming lipids, which generally include neutral or negatively charged phospholipids and a sterol, such as cholesterol. The selection of lipids is generally guided by consideration of factors such as the desired liposome size and half-life of the liposomes in the blood stream. A variety of methods are known for preparing liposomes, for example as described in Szoka et al. (1980), Ann. Rev. Biophys. Bioeng. 9: 467; and U.S. Pat. Nos. 4,235,871, 4,501,728, 4,837,028, and 5,019,369, the entire disclosures of which are herein incorporated by reference.
[0150] In certain aspects, the liposomes encapsulating the present nucleic acids comprise a ligand molecule that can target the liposome to a particular cell or tissue at or near the site of interest. Ligands that bind to receptors prevalent in the tissues to be targeted, such as monoclonal antibodies that bind to surface antigens, are contemplated. In particular cases, the liposomes are modified so as to avoid clearance by the mononuclear macrophage and reticuloendothelial systems, for example by having opsonization-inhibition moieties bound to the surface of the structure. In one embodiment, a liposome of the invention can comprise both opsonization-inhibition moieties and a ligand. Opsonization-inhibiting moieties for use in preparing the liposomes of the disclosure are typically large hydrophilic polymers that are bound to the liposome membrane. As used herein, an opsonization inhibiting moiety is bound to a liposome membrane when it is chemically or physically attached to the membrane, e.g., by the intercalation of a lipid-soluble anchor into the membrane itself, or by binding directly to active groups of membrane lipids. These opsonization-inhibiting hydrophilic polymers form a protective surface layer which significantly decreases the uptake of the liposomes by the macrophage-monocyte system (MMS) and reticuloendothelial system (RES); e.g., as described in U.S. Pat. No. 4,920,016, the entire disclosure of which is herein incorporated by reference. Liposomes modified with opsonization-inhibition moieties thus remain in the circulation much longer than unmodified liposomes. For this reason, such liposomes are sometimes called stealth liposomes.
[0151] Stealth liposomes are known to accumulate in tissues fed by porous or leaky microvasculature. Thus, target tissue characterized by such microvasculature defects, for example solid tumors, will efficiently accumulate these liposomes; see Gabizon, et al. (1988), P.N.A.S., USA, 18: 6949-53. In addition, the reduced uptake by the RES lowers the toxicity of stealth liposomes by preventing significant accumulation in the liver and spleen. Thus, liposomes of the invention that are modified with opsonization-inhibition moieties can deliver the present nucleic acids to tumor cells.
[0152] Opsonization inhibiting moieties suitable for modifying liposomes are preferably water-soluble polymers with a number-average molecular weight from about 500 to about 40,000 Daltons, and more preferably from about 2,000 to about 20,000 Daltons. Such polymers include polyethylene glycol (PEG) or polypropylene glycol (PPG) derivatives; e.g., methoxy PEG or PPG, and PEG or PPG stearate; synthetic polymers such as polyacrylamide or poly N-vinyl pyrrolidone; linear, branched, or dendrimeric polyamidoamines; polyacrylic acids; polyalcohols, e.g., polyvinylalcohol and polyxylitol to which carboxylic or amino groups are chemically linked, as well as gangliosides, such as ganglioside GM1. Copolymers of PEG, methoxy PEG, or methoxy PPG, or derivatives thereof, are also suitable. In addition, the opsonization inhibiting polymer can be a block copolymer of PEG and either a polyamino acid, polysaccharide, polyamidoamine, polyethyleneamine, or polynucleotide. The opsonization inhibiting polymers can also be natural polysaccharides containing amino acids or carboxylic acids, e.g., galacturonic acid, glucuronic acid, mannuronic acid, hyaluronic acid, pectic acid, neuraminic acid, alginic acid, carrageenan; aminated polysaccharides or oligosaccharides (linear or branched); or carboxylated polysaccharides or oligosaccharides, e.g., reacted with derivatives of carbonic acids with resultant linking of carboxylic groups.
[0153] In some embodiments, the opsonization-inhibiting moiety is a PEG, PPG, or derivatives thereof. Liposomes modified with PEG or PEG-derivatives are sometimes called PEGylated liposomes. The opsonization inhibiting moiety can be bound to the liposome membrane by any one of numerous well-known techniques. For example, an N-hydroxysuccinimide ester of PEG can be bound to a phosphatidyl-ethanolamine lipid-soluble anchor, and then bound to a membrane. Similarly, a dextran polymer can be derivatized with a stearylamine lipid-soluble anchor via reductive amination using Na(CN)BH 3 and a solvent mixture such as tetrahydrofuran and water in a 30:12 ratio at 60 degrees C.
[0154] Recombinant plasmids that express nucleic acids of the invention are discussed above. Such recombinant plasmids can also be administered directly or in conjunction with a suitable delivery reagent, including the Minis Transit LT 1 lipophilic reagent; lipofectin;
[0155] lipofectamine; cellfectin; polycations (e.g., polylysine) or liposomes.
[0156] The nucleic acids reducing the level of Semaphorin 4D of the invention can be administered to the subject by any suitable means. For example, the nucleic acids can be administered by gene gun, electroporation, or by other suitable parenteral or enteral administration routes, or by injection, for example, by intramuscular or intravenous injection.
[0157] Suitable parenteral administration routes include intravascular administration (e.g. intravenous bolus injection, intravenous infusion, intra-arterial bolus injection, intra-arterial infusion and catheter instillation into the vasculature); peri- and intra-tissue administration (e.g., peri-tumoral and intra-tumoral injection, intra-retinal injection or subretinal injection); subcutaneous injection or deposition including subcutaneous infusion (such as by osmotic pumps); direct (e.g., topical) application to the area at or near the site of interest, for example by a catheter or other placement device (e.g., a corneal pellet or a suppository, eye-dropper, or an implant comprising a porous, non-porous, or gelatinous material); and inhalation. In a particular embodiment, injections or infusions of the composition(s) are given at or near the site of disease.
[0158] The nucleic acids reducing the level of Semaphorin 4D of the invention can be administered in a single dose or in multiple doses. Where the administration of a composition is by infusion, the infusion can be a single sustained dose or can be delivered by multiple infusions. Injection of the agent directly into the tissue is at or near the site of need. Multiple injections of the agent into the tissue at or near the site of interest are encompassed within this disclosure.
[0159] One skilled in the art can also readily determine an appropriate dosage regimen for administering the nucleic acids reducing the level of Semaphorin 4D of the invention to a given subject. For example, the composition(s) can be administered to the subject once, such as by a single injection or deposition at or near the site of interest. In some embodiments, the composition(s) can be administered to a subject once or twice daily to a subject once weekly for a period of from about three to about twenty-eight days, in some embodiments, from about seven to about ten weeks. In some dosage regimens, the composition(s) is injected at or near the site of interest once a day for seven days. Where a dosage regimen comprises multiple administrations, it is understood that the effective amount of composition(s) administered to the subject can comprise the total amount of composition(s) administered over the entire dosage regimen.
[0160] In one embodiment, the present invention is directed towards a composition for treating cancer comprising an isolated nucleic acid that decreases the level and/or activity of Semaphorin 4D and a pharmaceutically acceptable carrier. In some embodiments, the nucleic acid comprises SEQ ID NO:3 or a fragment or derivative thereof capable of decreasing the level and/or activity of Semaphorin 4D.
[0161] The Semaphorin 4D inhibitory agents of the disclosure may be formulated as pharmaceutical compositions prior to administration to a subject, according to techniques known in the art. See, e.g., Remington's Pharmaceutical Science, 17th ed., Mack Publishing Company, Easton, Pa. (1985), the entire disclosure of which is herein incorporated by reference. In some embodiments, pharmaceutical compositions of the present invention are characterized as being at least sterile and pyrogen-free. As used herein, pharmaceutical formulations include formulations for human and veterinary use.
[0162] Pharmaceutical compositions of the disclosure can also comprise conventional pharmaceutical excipients and/or additives. Suitable pharmaceutical excipients include stabilizers, antioxidants, osmolality adjusting agents, buffers, and pH adjusting agents. Suitable additives include physiologically biocompatible buffers (e.g., tromethamine hydrochloride), additions of chelants (such as, for example, DTPA or DTPA-bisamide) or calcium chelate complexes (as for example calcium DTPA, CaNaDTPA-bisamide), or, optionally, additions of calcium or sodium salts (for example, calcium chloride, calcium ascorbate, calcium gluconate or calcium lactate). Pharmaceutical compositions of the invention can be packaged for use in liquid form, or can be lyophilized.
[0163] For solid compositions, conventional nontoxic solid carriers can be used; for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like. For example, a solid pharmaceutical composition for oral administration can comprise any of the carriers and excipients listed above and 10-95%, or 25%-75%, of one or more compositions of the invention. In some embodiments, a pharmaceutical composition for aerosol (inhalational) administration can comprise 0.01-20% by weight or 1%-10% by weight, of one or more compositions of the invention encapsulated in a liposome as described above, and propellant. A carrier can also be included as desired; e.g., lecithin for intranasal delivery.
Methods of Screening for Anti-Cancer Agents
[0164] In some embodiments, an assay for Semaphorin 4D activity in cells can be used to determine the functionality of the Semaphorin 4D in the presence of an agent which may act as an inhibitor, and thus, agents that interfere with the activity of Semaphorin 4D can be identified.
[0165] In some embodiments, the Semaphorin 4D of the present invention is employed in a screening process for compounds which bind Semaphorin 4D or one of its binding partners or both and which inhibits the biological activity of the Semaphorin 4D interaction. Inhibitors of Semaphorin 4D are particularly advantageous and can be used in methods as therapeutic agents in the treatment of cancer, such as head and neck cancer and lymphoma.
[0166] By inhibitor is intended naturally occurring and/or synthetic agents capable of inhibiting the biological activity of Semaphorin 4D, which can include inhibiting transcription or translation of Semaphorin 4D mRNA.
[0167] In some embodiments, the screening procedures involve producing appropriate cells which produce Semaphorin 4D. Such cells can include cells from mammals, yeast, Drosophila or E. coli. In some embodiments, the cells express Semaphorin 4D endogenously. In other embodiments, the cells have been transfected or engineered to express Semaphorin 4D. In some embodiments, cells expressing Semaphorin 4D (or extracts or purified preparations from cells) are contacted with a test compound to observe stimulation or inhibition of a functional response.
[0168] In some embodiments, assays can test binding of Semaphorin 4D to its targets or assays can involve competition with a competitor compound, such as a labeled competitor.
[0169] Potential antagonists are not limiting and examples include antibodies, peptides, carbohydrates, or small molecules which bind to Semaphorin 4D or its targets. These agents can be selected and screened 1) at random, 2) by a rational selection or 3) by design using for example, ligand modeling techniques (e.g., computer modeling).
[0170] For random screening, agents such as antibodies, peptides, carbohydrates, pharmaceutical agents and the like are selected at random and are assayed for their ability to bind to or block the interaction of the Semaphorin 4D to its targets or reduce expression of Semaphorin 4D.
[0171] Alternatively, agents may be rationally selected or designed. As used herein, an agent is said to be rationally selected or designed when the agent is chosen based on the configuration of the Semaphorin 4D or its targets.
[0172] In one aspect, the invention provides a method of screening for an anti-cancer agent which inhibits Semaphorin 4D, comprising: (a) contacting Semaphorin 4D; and (b) assaying the agent's effect on the Semaphorin 4D activity. In some embodiments, the activity to be tested is generation of myeloid-derived suppressor cells.
[0173] In one embodiment, the present invention is directed towards methods of screening for anti-cancer agents comprising i) contacting a cell culture medium comprising Semaphorin 4D and/or cells comprising Semaphorin 4D with the agent; ii) and assaying whether Semaphorin 4D activity is reduced, wherein if Semaphorin 4D activity is reduced, the agent has anti-cancer activity.
[0174] In some embodiments, the assaying of part ii) comprises culturing a cell population comprising myeloid cells in the cell culture medium and detecting the presence or absence of myeloid-derived suppressor cells, wherein if the level of myeloid-derived suppressor cells is reduced relative to a control sample lacking the agent, then the agent has anti-cancer activity. In some embodiments, the myeloid-derived suppressor cells have a phenotype that is CD33.sup.+, CD11b.sup.+, and HLA-DR.sup./low. In some embodiments, the cell culture medium comprising Semaphorin 4D is a conditioned medium from a cancer cell line. In some embodiments, the cell culture medium is from a head and neck squamous cell carcinoma cell line. In some embodiments, the cell line is a human cell line. In some embodiments, the cell line is selected from the group consisting of HN4, HN6, HN13, and SCC-9.
[0175] In some embodiments, the cell population comprises total PBMC. In some embodiments, the cell population comprises total myeloid cells (CD33.sup.+) isolated from PBMC.
[0176] In some embodiments, the candidate anti-cancer agent reduces the level of myeloid-derived suppressor cells by at least about 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or about 95% relative to a control lacking the agent.
[0177] In some embodiments, the agent is selected from a nucleic acid or an antibody. In some embodiments, the agent comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D, wherein the assaying of part ii) comprises detecting Semaphorin 4D mRNA and/or protein and comparing its level to a control sample lacking the agent.
Diagnostic/Prognostic Screening Assays
[0178] In another embodiment, the invention provides a method of monitoring progression of cancer in a subject, comprising obtaining the results of an assay that determines the presence of Semaphorin 4D in a tissue sample from the subject, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
[0179] In some embodiments, the cancer is selected from head and neck cancer and hematological malignancies, such as lymphoma. In some embodiments, the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck (HNSCC), salivary gland adenocarcinomas (SGA), metastatic HNSCC, and metastatic SGA. In some embodiments, the subject has stage III or stage IV cancer.
[0180] The tissue sample is not particularly limiting. In some embodiments, the tissue sample comprises peripheral blood. In some embodiments, the tissue sample comprises cancer tissue. In some embodiments, the tissue sample comprises cancer tissue from head and neck cancer.
[0181] In some embodiments, Semaphorin 4D is detected by an antibody. In some embodiments, the antibody is clone 30/CD100 (Cat #610670) (BD Biosciences PharMingen, San Diego, Calif.). In some embodiments, the antibody is clone eBio133-1C6 (Cat #14-1009) (eBioscience, San Diego, Calif.). In some embodiments, the antibody is clone 133-1C6 (available through Novus Biosciences).
[0182] In some embodiments, Semaphorin 4D is detected by an ELISA (enzyme-linked immunosorbent assay) technique. In some embodiments, Semaphorin 4D is detected by immunohistochemistry.
[0183] In some embodiments, the method further comprises obtaining the results of an assay that determines the presence of Semaphorin 4D in a second tissue sample from the subject, wherein increasing levels of Semaphorin 4D in the second tissue sample compared to the tissue sample from the subject obtained from an earlier point in time indicate progression of the cancer in the subject. Additional tissue samples can be obtained at later periods of time in order to monitor progression by assaying for the presence of Semaphorin 4D in the tissue sample.
[0184] In some embodiments, an elevated level of expression of Semaphorin 4D corresponds to a positive pixel intensity of at least 1.510.sup.5 by standardized digital analysis as described herein. The pixel intensity can be determined digitally by the Algorithm (Positive Pixel count v9) of the Leica Aperio software. The cut off value 1.510.sup.5 was determined as the mean between the negative/low expression and the positive/high expression values (see the materials and methods of Example 3, below).
[0185] In some embodiments, the subject's tumor has a fibrotic peri-tumoral stroma. For example, stromal analysis for fibrosis can be carried out by a pathologist on H&E and IHC stained sections under light microscopy. For analysis of fibrosis in the tumor stroma, delicately fibrous stroma (+), moderately fibrotic (++) and densely fibrotic (+++) parameters can used. In some embodiments, the subject's tumor has a dense, fibrotic peri-tumoral stroma. In some embodiments, the stroma is analyzed by cell staining. In some embodiments, the stroma is stained with Picrosirius stain.
[0186] In some embodiments, the method further comprises obtaining the results of an assay that detects the presence or absence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D. In some embodiments, there is an inverse correlation between elevated Semaphorin 4D in the tissue and the presence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D.
[0187] In some embodiments, the method further comprises obtaining the results of an assay that detects the presence or absence of immune checkpoint molecules, such as PD-L1, in the tissue sample, wherein the tissue sample is cancer tissue. In some embodiments, the cancer tissue is PD-L1.sup.ve/low. The level of PD-L1 can be assayed and measured relative to its expression in normal oral epithelium. In some embodiments, when the PD-L1 level is negative or low, the method further comprises administering to the subject an agent that inhibits the activity of Semaphorin 4D. In some embodiments, this agent is administered as a monotherapy.
[0188] In some embodiments, the tissue is positive for the presence of the immune checkpoint molecule, such as PD-L1. Since PD-L1 is negative in normal epithelium, in some embodiments, the cut off value for elevated PD-L1 (PD-L1.sup.+ve/high) is strong focal expression 1% in tumor cells or in tumor associated inflammatory cells or both, and using a positive pixel intensity of at least 1.510.sup.5 by standardized digital analysis as described above and in the Examples.
[0189] In some embodiments where the tissue is both positive for the immune checkpoint molecule and Semaphorin 4D, the method further comprises administering to the subject an agent that inhibits the activity of Semaphorin 4D and an agent that inhibits the immune checkpoint molecule. In one embodiment, the inhibitor is a PD-L1 inhibitor.
Sample Embodiments
[0190] This section describes exemplary compositions and methods of the invention, presented without limitation, as a series of paragraphs, some or all of which may be alphanumerically designated for clarity and efficiency. Each of these paragraphs can be combined with one or more other paragraphs, and/or with disclosure from elsewhere in this application, including the materials incorporated by reference, in any suitable manner. Some of the paragraphs below expressly refer to and further limit other paragraphs, providing without limitation examples of some of the suitable combinations.
[0191] 1. A method of inhibiting tumor-mediated immunosuppression in a subject, comprising administering to the subject a therapeutically effective amount of an agent that inhibits the activity of Semaphorin 4D.
[0192] 2. The method of paragraph 1, wherein the agent decreases the expression level of Semaphorin 4D.
[0193] 3. The method of any of paragraphs 1-2, wherein the cancer is selected from head and neck cancer and lymphoma.
[0194] 4. The method of any of paragraphs 1-3, wherein the inhibition of Semaphorin 4D decreases the level of myeloid-derived suppressor cells in the tumor microenvironment.
[0195] 5. The method of any of paragraphs 1-4, wherein the myeloid-derived suppressor cells have a phenotype that is CD33.sup.+, CD11b.sup.+, and HLA-DR.sup./low.
[0196] 6. The method of any of paragraphs 1-5, wherein the inhibition of Semaphorin 4D results in one or more of the following effects:
[0197] i) an increase in T cell proliferation;
[0198] ii) an increase in IFN- levels;
[0199] iii) a decrease in IL-4 levels;
[0200] iv) a decrease in arginase-1 production by CD33.sup.+ myeloid cells;
[0201] v) a decrease in NO production by CD33.sup.+ myeloid cells;
[0202] vi) a decrease in IL-10 by CD33.sup. myeloid cells;
[0203] vii) a decrease in TGF-1 production by CD33.sup.+ myeloid cells;
[0204] viii) a decrease in TGF-1 production by tumor cells.
[0205] ix) an increase in effector Th1 T cells (CD4.sup.+Tbet.sup.+);
[0206] x) an increase in cytotoxic T cells (CD8.sup.+Tbet.sup.+); and
[0207] xi) a decrease in Tregs cells (CD4.sup.+CD25.sup.+FoxP3.sup.+).
[0208] 7. The method of any of paragraphs 1-6, wherein the agent comprises a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D.
[0209] 8. The method of any of paragraphs 1-7, wherein the nucleotide sequence of Semaphorin 4D is SEQ ID NO:2.
[0210] 9. The method of any of paragraphs 1-8, wherein a portion of the nucleic acid molecule is at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96% 97%, 97%, 98% or 99% complementary to at least a portion of SEQ ID NO:2.
[0211] 10. The method of any of paragraphs 1-9, wherein a portion of the nucleic acid molecule is 100% complementary to SEQ ID NO:4.
[0212] 11. The method of any of paragraphs 1-10, wherein the agent comprises a DNA molecule or an RNA molecule.
[0213] 12. The method of any of paragraphs 1-11, wherein the agent comprises an anti-sense DNA molecule or an anti-sense RNA molecule.
[0214] 13. The method of any of paragraphs 1-12, wherein the agent comprises a small interfering RNA (siRNA) molecule.
[0215] 14. The method of any of paragraphs 1-13, wherein the siRNA molecule targets the sequence CAAGACGCTGCAGTTCGTTAA (SEQ ID NO:7).
[0216] 15. The method of any of paragraphs 1-14, wherein the agent comprises a small hairpin RNA (shRNA) molecule.
[0217] 16. The method of any of paragraphs 1-15, wherein the agent comprises an expression vector comprising SEQ ID NO:3.
[0218] 17. The method of any of paragraphs 1-16, wherein the expression vector is a lentivirus vector.
[0219] 18. The method of any of paragraphs 1-17, wherein the agent comprises an antibody specifically binding to Semaphorin 4D.
[0220] 19. The method of any of paragraphs 1-18, wherein the method further comprises administering to the subject an effective amount of an additional anti-cancer therapeutic agent.
[0221] 20. The method of any of paragraphs 1-19, wherein the anti-cancer agent comprises an immunotherapeutic agent.
[0222] 21. The method of any of paragraphs 1-20, wherein the immunotherapeutic agent comprises T cells.
[0223] 22. A method of screening for an agent that has anti-cancer activity, comprising
[0224] i) contacting a cell culture medium comprising Semaphorin 4D and/or cells comprising Semaphorin 4D with the agent; and
[0225] ii) assaying whether Semaphorin 4D activity is reduced, wherein if Semaphorin 4D activity is reduced, the agent has anti-cancer activity.
[0226] 23. The method of paragraph 22, wherein the assaying of part ii) comprises culturing a cell population comprising myeloid cells in the cell culture medium and detecting the presence or absence of myeloid-derived suppressor cells, wherein if the level of myeloid-derived suppressor cells is reduced relative to a control sample lacking the agent, then the agent has anti-cancer activity.
[0227] 24. The method of paragraph 23, wherein the myeloid-derived suppressor cells have a phenotype that is CD33.sup.+, CD11 b.sup., and HLA-DR.sup./low.
[0228] 25. The method of any of paragraphs 22-24, wherein the cell population comprises total PBMC.
[0229] 26. The method of any of paragraphs 22-25, wherein the cell population comprises total myeloid cells (CD33.sup.+) isolated from PBMC.
[0230] 27. The method of any of paragraphs 22-26, wherein the cell culture medium comprising Semaphorin 4D is a conditioned medium from a head and neck squamous cell carcinoma cell line.
[0231] 28. The method of paragraph 27, wherein the cell line is a human cell line. 29. The method of paragraph 28, wherein the cell line is selected from the group consisting of HN4, HN6, HN13, and SCC-9.
[0232] 30. The method of paragraph 23, wherein the level of myeloid-derived suppressor cells is reduced at least about 50% relative to a control lacking the agent.
[0233] 31. The method of any of paragraphs 22-30, wherein the agent is a nucleic acid molecule that comprises a nucleotide sequence that binds to at least a portion of a nucleotide sequence of Semaphorin 4D, wherein the assaying of part ii) comprises detecting Semaphorin 4D mRNA and/or protein and comparing its level to a control sample lacking the agent.
[0234] 32. A method of monitoring progression of cancer in a subject, comprising obtaining the results of an assay that determines the presence of Semaphorin 4D in a tissue sample from the subject, wherein elevated levels of Semaphorin 4D compared to a tissue sample from a healthy donor indicate progression of the cancer in the subject.
[0235] 33. The method of paragraph 32, wherein the tissue sample comprises peripheral blood.
[0236] 34. The method of paragraph 32, wherein the tissue sample comprises cancer tissue.
[0237] 35. The method of any of paragraphs 32-34, wherein the presence of Semaphorin 4D is detected by an antibody.
[0238] 36. The method of any of paragraphs 32-35, wherein the Semaphorin 4D is detected by an ELISA (enzyme-linked immunosorbent assay) technique.
[0239] 37. The method of any of paragraphs 32-35, wherein the Semaphorin 4D is detected by immunohistochemistry.
[0240] 38. The method of any of paragraphs 32-37, wherein the method further comprises obtaining the results of an assay that determines the presence of Semaphorin 4D in a second tissue sample from the subject, wherein increasing levels of Semaphorin 4D in the second tissue sample compared to the tissue sample from the subject obtained from an earlier point in time indicate progression of the cancer in the subject.
[0241] 39. The method of any of paragraphs 32-38, wherein the cancer is selected from head and neck cancer and lymphoma. 40. The method of any of paragraphs 32-39, wherein the cancer is head and neck cancer.
[0242] 41. The method of any of paragraphs 32-40, wherein the cancer is selected from the group consisting of squamous cell carcinoma of the head and neck (HNSCC), salivary gland adenocarcinomas (SGA), metastatic HNSCC, and metastatic SGA.
[0243] 42. The method of any of paragraphs 32-41, wherein the elevated level of expression of Semaphorin 4D corresponds to a positive pixel intensity of at least 1.510.sup.5 by standardized digital analysis.
[0244] 43. The method of any of paragraphs 32-42, wherein the subject has stage III or IV cancer.
[0245] 44. The method of any of paragraphs 32-43, wherein the subject's tumor has a dense, fibrotic peri-tumoral stroma.
[0246] 45. The method of any of paragraphs 32-44, wherein the dense, fibrotic peri-tumoral stroma is detected by cell staining.
[0247] 46. The method of any of paragraphs 32-45, further comprising obtaining the results of an assay that detects the presence or absence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D.
[0248] 47. The method of any of paragraphs 32-46, wherein there is an inverse correlation between elevated Semaphorin 4D in the tissue and the presence of tumor associated inflammatory cells that have elevated expression of Semaphorin 4D.
[0249] 48. The method of any of paragraphs 32-47, further comprising obtaining the results of an assay that detects the presence or absence of an immune checkpoint molecule such as PD-L1 in the tissue sample, wherein the tissue sample is cancer tissue.
[0250] 49. The method of any of paragraphs 32-48, wherein the cancer tissue is PD-L1.sup.ve/low.
[0251] 50. The method of any of paragraphs 32-49, further comprising administering to the subject an agent that inhibits the activity of Semaphorin 4D.
[0252] 51. The method of any of paragraphs 32-50, wherein the tissue is positive for the presence of the checkpoint molecule, such as PD-L1, wherein the cut off value for elevated PD-L1 (PD-L1.sup.+ve/high) is strong focal expression 1% in tumor cells or in tumor associated inflammatory cells or both, and using a positive pixel intensity of at least 1.510.sup.5 by standardized digital analysis.
[0253] 52. The method of any of paragraphs 32-51, further comprising administering to the subject an agent that inhibits the activity of Semaphorin 4D and an agent that inhibits the checkpoint molecule.
[0254] 53. The method of paragraph 52, wherein the checkpoint molecule is PD-L1.
[0255] In some embodiments, the methods of the present invention are combined with one or more other known treatments. For the treatment of cancer, one or more other known treatments can include radiation, surgery, chemotherapy or administration of other anti-cancer agents and combinations thereof.
[0256] Application of the teachings of the present invention to a specific problem is within the capabilities of one having ordinary skill in the art in light of the teaching contained herein. Examples of the compositions and methods of the invention appear in the following non-limiting Examples.
EXAMPLES
Example 1
Human Head and Neck Squamous Cell Carcinoma Associated Semaphorin 4D Induces Expansion of Myeloid Derived Suppressor Cells
[0257] The present example investigated whether HNSCC derived Sema4D plays a role in inducing MDSC and examined its effect on T cell phenotype and function. It was found that Sema4D produced by the HNSCC HN6 and HN13 cell lines polarized myeloid cells into MDSC phenotype, which corresponded with a reduction in T cell proliferation and IFN- production. Furthermore, shRNA inhibition of Sema4D in HN6 resulted in a decrease in the production of the immunosuppressive factors; arginase-1, TGF-, and IL-10 by myeloid cells and the recovery of autologous T cell proliferation, IFN- production, specifically leading to an increase in the effector T cell population and decrease in Tregs. These findings describe HNSCC-associated Sema4D production as one of the mechanisms by which the tumors induce MDSC, that subsequently mediate their immunosuppression effects on T cells.
Results
[0258] Sema4D Expressed by HNSCC Cell Lines Induces CD33.sup.+, CD11b.sup.+, HLA-DR.sup./low Cells
[0259] To examine the effects of HNSCC-derived condition medium on myeloid differentiation, total human PBMC or total myeloid cells (CD33.sup.+) isolated from PBMC were plated in conditioned medium from HNSCC cell lines HN4, HN6, HN13 and SCC-9. Total PBMC or separated myeloid cells cultured in HNSCC conditioned medium displayed markers characteristic of MDSC, namely CD33.sup.+ CD11 b.sup.+ HLA-DR.sup./low compared to cells cultured in normal medium (NM) or NOK conditioned medium. The percentage of MDSC developed from total PBMC were 20% (
[0260] Several groups have recently described an immunomodulatory role for tumor produced pro-angiogenic factors (Chouaib et al. 2012. Front Immunol 3: 21). Given the immune modulatory role previously described for Sema4D in the immune system (Ishida et al. 2003. Int Immunol 15: 1027-1034; Chabbert-de Ponnat et al. 2005. Int Immunol 17: 439-447), we sought to investigate if the pro-angiogenic factor, Sema4D secreted by HNSCC (Basile et al. 2006. Proc Natl Acad Sci USA 103: 9017-9022), plays a role in the induction of CD33.sup.+ CD11 .sup.+ HLA-DR.sup.1/low myeloid cells. Immunoblotting was performed on conditioned medium from HN6 and HN13 HNSCC cell lines and their cellular lysates as served as controls. We detected the cleaved form of Sema4D in the medium at 120 KDa (
Sema4D Inhibition Rescues MDSC Induced T Cell Suppression
[0261] We next sought to ascertain whether HNSCC-derived Sema4D mediated its suppressive effects when myeloid cells were cultured with primary T cells. The induction of HLA-DR.sup./low cells by HN6 conditioned media was still observed upon co-culture of the CD33.sup.+ cells with autologous T cells (
HN6 Secreted Sema4D Induces an Immunosuppressive T Cell Phenotype
[0262] To investigate which T cell subset is rescued following blockade of Sema4D, a phenotypic analysis of the T cells was performed. We found that inhibition of Sema4D restored effector Th1 cells (CD4.sup.+Tbet.sup.+) and cytotoxic T cells (CD8.sup.+Tbet.sup.+) cells, and significantly decreased Tregs (CD4.sup.+CD25.sup.FoxP3.sup.+) at different myeloid to T cell ratios (
Sema4D Enhances GM-CSF-IL-6 Mediated Induction of MDSC
[0263] In order to better assess the role of HNSCC-derived Sema4D on myeloid differentiation, we compared Sema4D with another well-described MDSC inducer, GM-CSF (Lechner et al. 2010. J Immunol 185: 2273-2284). GM-CSF has been shown to be produced by several MDSC inducing human solid tumors including HNSCC and to best induce human CD33.sup.+ suppressive cells upon combination with IL-6 (Lechner et al. 2010. J Immunol 185: 2273-2284; Condamine et al., 2011. Trends Immunol 32: 19-25; Pak et al., 1995. Clin Cancer Res 1: 95-103; Young et al., 1997. Int J Cancer 74: 69-74). In fact, we tested the HN6 HNSCC cell line using ELISA and it showed to produce both GM-CSF and IL-6 (data not shown). To compare the effect of tumor secreted Sema4D on the induction of MDSC to GM-CSF-mediated induction, CD33.sup.+ cells were co-cultured with T cells in HN6 medium with immune depletion of Sema4D versus immune depletion of GM-CSF. Immune depletion of Sema4D resulted in a significant reduction in the MDSC population that was comparable to that observed upon depletion of GM-CSF in HN6 conditioned medium (
Sema4D Promotes the Production of Immunosuppressive Mediators by MDSC
[0264] To investigate whether HNSCC associated-Sema4D has an effect on MDSC viability, a WST cell proliferation assay and a CFSE proliferation tracking experiment, were performed using CD33.sup.+ cells grown in conditioned medium from the HN6 cells in which Sema4D has been knocked down using shRNA. The loss of Sema4D resulted in a significant decrease in the proliferation of total CD33.sup.+ cells, as well as that of the CD33.sup.+HLA-DR.sup./low population compared to conditioned medium from controls (
[0265] The myeloid cells mediate their suppressive effects by various mechanisms. Among these arginase-1 and nitric oxide (NO) play a major role in MDSC suppressive effect. To investigate whether Sema4D produced by HNSCC-HN6 can affect arginase-1 production, CD33.sup.+ enriched myeloid cells were grown in conditioned media from Sema4D-shRNA HN6, and then checked for arginase-1 expression. A significant reduction in arginase-1 production by the CD33.sup.+ cells was observed when grown in Sema4D-shRNA HN6 conditioned media (
[0266] MDSC can also indirectly induce its suppressive effect, through production of other immune suppressive cytokines like IL-10 and expansion of Tregs in a TGF- dependent pathway (Vuk-Pavlovic et al., 2010. Prostate 70: 443-455; Capparuccia et al., 2009. J Cell Sci 122: 1723-1736). These cytokines were assessed by ELISA, specifically to measure IL-10 and TGF- produced by MDSC (Cuenca et al., 2011. Mol Med 17: 281-292). Interestingly, there was a significant reduction in both IL-10 and TGF- production by CD33.sup.+ cells upon inhibition of Sema4D in HN6 (
Material and Methods
Cell Lines and Tissue Culture
[0267] Human normal oral keratinocytes (NOK), human derived HNSCC cell lines WSU-HN6, and WSU-HN13 underwent DNA authentication (Johns Hopkins genetic resources core facility, Baltimore, Md.) to ensure consistency in cell identity in comparison with their source (Martin et al. 2014. Oncotarget 5: 8906-8923). SCC-9 was obtained from American Type Culture Collection (ATCC) (Manassas, Va.). The WSU-HN4 cell line was a generous gift from Dr. Silvio Gutkind (NIDCR, Bethesda, Md.). All HNSCC cell lines used were derived from primary carcinomas of the Tongue. All cell lines were grown and maintained in DMEM supplemented with 10% FBS, 100 units/ml penicillin, 100 g/ml streptomycin, and 250 ng/ml amphotericin B (Sigma, St. Louis, Mo.) at 37 C. in humidified air with 5% CO.sub.2. For treatment with conditioned medium, culture medium was collected from confluent HNSCC cells grown in 5 ml DMEM for 24 hrs. For myeloid and T cell co-culture experiments, conditioned medium supplemented with 5% FBS was used.
Separation of Myeloid and T Cells from Human Peripheral Blood
[0268] Mononuclear cell suspension was prepared from peripheral blood of healthy donors obtained from commercial vendors, Biological Speciality Corp (Colmar, Pa.) or New York Blood Center (New York, N.Y.) using Ficoll-Paque Plus density-gradient centrifugation (GE Healthcare Life Sciences, Pittsburgh, Pa.). CD33.sup.+ myeloid cells were separated from the PBMC using Magnetic Cell Sorting (MACS) CD33 microbeads (Cat #130-045-501), HLA-DR positive cells were separated using anti-HLA-DR microbeads (Cat #130-046-100) (Miltenyi Biotec Inc, Auburn, Calif.). Autologous T cells were enriched by negative selection with the Human Pan T cell isolation kit (Cat #19051, STEMCELL Technologies Inc., Vancouver, BC, Canada).
Flow Cytometry Characterization of MDSC and T Cells
[0269] MDSC were characterized using multicolor staining fluorochrome-labeled anti-human CD33-PerCP/Cy5.5 (Cat #303414), HLA-DR-APC (Cat #307610), CD11b-PE (Cat #301306), CD14-FITC (Cat #325604) (Biolegend, San Diego, Calif.). For T cell analysis CD3-APC/Cy7 (Cat #300317) (Biolegend), CD8a PE-Cy7 (cat #25-0088-42), CD25-APC (Cat #17-0259-42), Foxp3-PE (Cat #12-4776-42), T-bet PerCP-Cyanine5.5 (Cat #45-5825-82) (eBioscience, Inc., San Diego, Calif.). For anti-FoxP3-PE and anti-Tbet-PerCP/Cy5.5, fixation and permeabilization buffer (Cat #00-8333) eBiosciences was used For T cell proliferation, T cells were stained with CF SE (Cat #C34554) (Life Technologies, Grand Island, N.Y.), prior to plating. Dynabeads human T-activator CD3/CD28 (Life Technologies) were used at a 1:3 (T cell: bead) ratio after coculture with myeloid cells for at least 4 hrs. Data was acquired using a BD LSR II Flow cytometer, FlowJo software (Tree Star, Ashland, Oreg.) and analyzed using BD FACSDiva software (BD Biosciences, San Jose, Calif.).
Immunoblot, Antibodies and Reagents
[0270] Cells were harvested in cell lysis buffer (20 mM Tris-HCL (pH7.5), 150 mM NaCl, 1 mM Na.sub.2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM -glycerophosphate, 1 mM Na.sub.3VO.sub.4, 1 ug/ml leupeptin) (Cat #9803) (Cell Signaling Tech., Danvers, Mass.) with the addition of 1 protease inhibitor Complete Mini, EDTA-Free (cat #11836170001) (Roche Diagnostics Corporation, Indianapolis, Ind.). Whole-cell lysate was separated using SDS-PAGE. The primary antibodies Sema4D (30/CD100, Cat #610670) (BD Biosciences PharMingen, San Diego, Calif.), Arginase-1 (A-2: sc-365547), GAPDH (8C2: sc-81545), and -actin (Cat # sc-2301), (Santa Cruz Biotechnology, Inc., Dallas, Tex.), were used. The secondary antibodies used were anti-rabbit IgG (Cat #sc-2301) and anti-mouse IgG (Cat # sc-2302) (Santa Cruz Biotechnology, Inc.). For Arginase-1 detection 15 g of protein were loaded, while for Sema4D detection 70-100 g were loaded. For detection of Sema4D in the tumor conditioned medium, equal aliquots of the medium or of a concentrate of the medium using Millipore amicon Ultra centrifugal filter units were loaded after adding the sample buffer. Cell viability was measured using the cell proliferation reagent, WST-1 (Roche Diagnostics Corporation). The plate was read at 450 nm on BioTek Epoch microplate spectrophotometer (BioTek, Winooski, Vt.). The recombinant human Sema4D (sCD100) (Cat #310-29) was obtained from (Peprotech, Rocky Hill, N.J.). Recombinant human GM-CSF (Cat #215-GM-010) (R&D Systems, Inc. Minneapolis, Minn.), and Il-6 recombinant human (Cat #11395) from (Sigma-Aldrich, St. Louis, Mo.) were also used. Griess reagent (Cat #G2930) (Promega corporation, Madison, Wis.) was used to measure the Nitrite (NO.sub.2) concentration as a stable nonvolatile byproduct of nitric oxide (NO) in the media, read at absorbance of 520 nm using BioTek Epoch microplate spectrophotometer (BioTek).
Anti-Sema4D Treatment and Immune Depletion
[0271] For target protein inhibition in the conditioned medium anti-Sema4D (Cat #610670) (BD Biosciences) was used at concentration (10 g/ml). For immune-depletion, immunoprecipitation of Sema4D or GM-C SF, was carried out by overnight incubation of the conditioned media with Sema4D (Cat # ab39710) (Abcam, Cambridge, MA) or GM-CSF (clone: BVD2-21C11) (Cat #502301) (Biolegend) (10 g/ml) mAbs using protein A beads, followed by precipitation.
Sema4D shRNA and Lentivirus Infections
[0272] The lentivirus and short-hairpin RNA (shRNA) system were a kind gift of Dr. John R. Basile, UMB (Basile et al. 2006. Proc Natl Acad Sci USA 103: 9017-9022). In brief, the shRNA sequences for human Sema4D were obtained from Cold Spring Harbor Laboratory's RNAi library (RNAi Codex; http:katandin.csh1.org:9331_homepage_portal_scripts_main2.p1). The oligonucleotides (Invitrogen, Grand Island, N.Y.) used to knockdown Sema4D protein levels were: 5-GGCCTGAGGACCTTGCAGAAGA-3 (SEQ ID NO:3). The Sema4D shRNA oligonucleotides were cloned into lentiviral expression vector pWPI GW as previously described (Basile et al. 2006. Proc Natl Acad Sci USA 103: 9017-9022). pWPI (empty) vector was used as negative control. Infections were performed using Fugene HD transfection reagent (Cat #E2311, Promega, Madison, Wis.).
ELISA
[0273] Human ELISA MAX IFN- (Cat #430103), TGF-1 total (Cat #436707), IL-10 (Cat #430601), and IL-4 (Cat #430301) were obtained from Biolegend. Samples were run in triplicates and read using BioTek Epoch microplate spectrophotometer at 450 nm wavelength.
Statistics
[0274] Student's paired t tests were performed as appropriate. All data analysis was presented with custom STDEV and p values were annotated as: * p0.05; ** p0.01; *** p0.001.
Example 2
Diagnostic Assays for Sema4D
[0275] Herein, it is presented for the first time a rapid and sensitive diagnostic test for head and neck cancer patients, as well as patients with hematologic malignancies using ELISA and IHC to measure Sema4D. The proposed ELISA test can be performed on patient's sera for diagnostic measures, and the IHC on head and neck cancer tissue can indicate the status of the tumor progression.
Material and Methods
ELISA
[0276] ELISA performed using specimens from HNSCC patients, lymphoma patients and healthy donor serum. For the standard, human recombinant Semaphorin 4D (Cat#310-29) (PEPROTECH, Rocky Hill, N.J.) was used. Semaphorin 4D (clone eBio133-1C6) (Cat#14-1009) (eBioscience, San Diego, Calif.) was used as the primary detection antibody. The secondary antibody, goat anti-mouse anti-IgM HRP (Caltag Cat #M31507) was applied followed by detection with tetramethybenzidine (TMB) substrate.
[0277] ELISA Protocol: [0278] 1. Assay Diluent (AD) is 5% FBS in PBS; Plates-Immunlon (Nunc #14-245-153) [0279] 2. Coat with protein, dilute standard in PBS (200 ng/ml) and add 50 ul/well (4C overnight) [0280] 3. Block with AD-100 ul/well 2 hr RT [0281] 4. Wash w PBST (0.05% Tween20 in 1 PBS) [0282] 5. Primary Ab (eBioscience 10 ul/ml from 0.5 mg/ml stock) in AD; incubate 2 hr RT; wash [0283] 6. Add 2nd Ab (goat anti mouse IgM HRP; stock lmg/m1) 1:1000 dilution in AD for 1 hr RT [0284] 7. Wash, Detect w TMB, stop with 2N sulfuric acid
Immunohistochemistry
[0285] Immunohistochemistry was carried out on paraffin embedded tissue microarray including 124 primary HNSCC, 9 primary adenocarcinomas of the salivary glands, 3 metastatic HNSCC, 4 metastatic adenocarcinomas of the salivary glands to lymph nodes, 12 normal oral mucosa, 3 normal salivary glands and 4 normal epiglottis tissue. The microarray was obtained from US Biomax, Inc. (Rockville, Md.). Citrate buffer (Cat #21545, Millipore, Billerica, Mass.) and EDTA free trypsin (Corning, Manassas, Va.) (Cat #25-050-CI) were used for antigen retrieval. 3% H.sub.20.sub.2 was used to quench the endogenous peroxidase. Tissue was incubated in the primary antibody Semaphorin 4D (clone 30/CD100) (Cat #610670) (BD Biosciences PharMingen, San Diego, Calif.) at 1:50 dilution in 2% BSA in PBS with 0.1% Tween, overnight in 4 degrees C. The Secondary antibody and the ABC (Vectastain Vector Elite Cat #PK-6102 mouse IgG) (Vector laboratories, Burlingame, Calif.) were used, followed by DAB (Cat #SK-4105) (Vector laboratories). Tissue was scanned and photomics were taken using ScanScope Aperio software.
Results
Sema4D is a Diagnostic Marker in Peripheral Blood of Cancer Patients
[0286] To investigate if Sema4D is a candidate diagnostic marker for cancer patients in peripheral blood, we carried ELISA on sera from HNSCC patients, lymphoma patients and healthy donors. HNSCC patients showed almost double the expression of Sema4D in their sera compared to healthy donors (p=0.00017). Also high levels of Sema4D were detected in sera of 2 of the lymphoma patients compared to the healthy donors (
Sema4D Insitu Expression as a Predictive Marker for Disease Progression
[0287] To investigate the use of Sema4D as a prognostic marker in HNSCC, we carried out immunohistochemistry on primary HNSCC, primary adenocarcinomas of the salivary gland, metastatic HNSCC and metastatic salivary gland tumors to lymph nodes. Collectively, Stages I and II of the primary HNSCC showed negative to week expression of Sema4D. Stages III and IV showed strong diffuse expression of Sema4D. Metastatic HNSCC and salivary gland metastatic adenocarcinomas to lymph nodes showed strong and diffuse expression. In stages III, and IV HNSCC as well as in the metastatic lesions, increased inflammatory cell infiltrate with strong expression of Sema4D in the tumor stroma was noticed.
[0288] The control normal oral epithelium showed week to negative basal and parabasal expression of Sema4D. The normal epiglottis lining showed moderate diffuse expression and the normal salivary gland tissue showed diffuse weak to moderate expression of Sema4D in the acini and ductal structures.
Example 3
Semaphorin 4D in Human Head and Neck Cancer Tissue and Peripheral Blood: A Dense Fibrotic Peri-Tumoral Stromal Phenotype
[0289] In this study, the immunohistochemical expression of Sema4D by HNC tumor cells in correlation to tumor progression, extent of fibrosis and TAIs infiltration in the peri-tumoral stroma, as well as PD-L1 expression was investigated. It is shown that high levels of Sema4D expression (Sema4D.sup.+ve/high) by HNC tumor cells significantly correlated with clinical staging, being highest in stage III. It also showed a positive nonsignificant correlation with nodal metastasis. Sema4D.sup.+ve/high expression in tumor cells correlated significantly with dense fibrotic noninflamed peri-tumoral stroma and inversely with infiltrating Sema4D.sup.+ve/high TAIs. Interestingly, knockdown of Sema4D in stage III HNC cell line, showed inhibition of TGF-1 production by the tumor cells. Sema4D identified a unique subset of HNC tumors distinct from the PD-L1 positive tumors. Furthermore, high levels of circulating Sema4D were detected in HNC patients' sera compared to healthy donors. These data provide a novel role for Sema4D in the context of fibrosis and inflammation within the tumor microenvironment and demonstrate its value as a novel diagnostic, prognostic and immune monitoring biomarker in HNC.
Results
[0290] Sema4D Expression by Tumor Cells Correlates with Tumor Progression
[0291] Sema4D expression has been described in several epithelial malignancies, but it is believed that there are no studies investigating whether it correlates with clinical progression in HNC (Ch'ng E et al., Cancer. 2007; 110(1):164-172; Wang et al., World J Gastroenterol. 2015; 21(7):2191-2198). Immunohistochemical (IHC) analysis was performed on 160 human tissue samples. These included twenty one cases of normal tissue, and one hundred and thirty-nine cases of HNC. The malignancies consisted of 119 primary squamous cell carcinomas of the head and neck (HNSCC), 9 primary salivary gland adenocarcinomas (SGA), 4 metastatic HNSCC and 4 metastatic SGA to the lymph nodes. One normal tongue specimen was excluded due to lack of epithelial tissue and three cases of malignancy were excluded due to lack of tumor tissue for analysis (
[0292] The pattern of expression of Sema4D was generally membranous and cytoplasmic. The normal oral epithelium and salivary acini were negative to low positive (Sema4D.sup.ve/low), with mean strong positive pixel intensity ranging from 10.sup.4 to 210.sup.5 (
[0293] Sema4D.sup.+ve/high expression was observed in in 47 (34.5%) cases out of the 136 primary and metastatic malignancies (Table 5). The cut off value to consider Sema4D.sup.+ve/high in tumor cells was 510.sup.5 strong pixel intensity as guided by the standardized digital analysis (
Sema4D Expression by Tumor Cells Correlates with a Dense Fibrotic Peri-Tumoral Stroma
[0294] The peri-tumoral-stroma is a very important reflection of the complexity of the tumor (Hanahan D and Weinberg R A. Cell. 2011; 144(5):646-674; Pietras K and Ostman A. Exp Cell Res. 2010; 316(8):1324-1331). To determine whether Sema4D has a role in modulating the immune response within the tumor microenvironment, we examined the stroma in all of the provided specimens. Sema4D.sup.+ve/high expression by HNC tumor cells of the primary malignancies correlated with a dense fibrotic peri-tumoral stroma representing 23% of the total cohort (
[0295] As shown in
Sema4D Expression by Tumor Associated Inflammatory Cells (TAIs)
[0296] Te peri-tumoral stroma was further investigated for the extent of inflammation. When infiltrating TAIs were present, almost all of them showed positivity for Sema4D (Sema4D.sup.+ve/high TAIs). The stroma in Stage I and II HNC tumors showed mild to moderate infiltrate of Sema4D.sup.+ve/high TAIs (
HNC Stratification According to Sema4D and PD-L1 Expression
[0297] Programmed death-ligand 1 (PD-L1) expression has been linked to poor patients' prognosis (Lin et al., PLoS One. 2015; 10(11): e0142656. ; Chen et al., Oral Oncol. 2015; 51(11):1004-1010; Mukaigawa et al., J Surg Oncol. 2016; 114(1):36-43). The inhibition of PD-1/PD-L1 pathway had shown promising overall response rate in many clinical studies. Yet patients' response had been linked to the initial presence of an inflamed tumor microenvironment (Cho et al., Oral Oncol. 2011; 47(12): 1148-1153 ; Zandberg et al., Oral Oncol. 2014; 50(7):627-632; Kirilovsky et al., Int Immunol. 2016; 28(8):373-382; Ferris et al., J Natl Cancer Inst. 2016; 108(8)). Our findings that tumor cells expressing Sema4D.sup.ve/high correlated positively with a dense fibrotic stroma and inversely with Sema4D.sup.+ve/high TAIs, triggered the question; if HNC tumors expressing high Sema4D represent a distinct tumor phenotype other than the inflamed, PD-L1 positive tumors. To investigate the Sema4D/PD-L1 differential expression, we stained the same HNC tumor set studied for Sema4D with PD-L1. The specimens from the normal epithelium, normal salivary glands and epiglottis, were negative for PD-L1 as well as the normal epithelium from the tumor margin (
Materials and Methods
HNC Tissue Microarray
[0298] Formalin-fixed, paraffin-embedded tissues of HNC tissue microarray (HN802 and HN803c) was obtained from US Biomax (Rockville, Md.). The tissue microarray of hundred and sixty cases of head and neck cancer with normal tissue included demographic data, TNM system, clinical stage, and pathologic grade. The hematoxylin and eosin sections were examined by an oral and maxillofacial (OMF) pathologist to verify histopathological diagnosis prior to immunohistochemical (IHC) staining.
Serum Samples
[0299] The patient specimens were collected under an approved protocol by the Institutional Review Board at the University of Maryland School of Medicine. Banked HNC patient samples were obtained from patients with their written and informed consent. Healthy donor sera were purchased from Innovative research (Novi, Mich.).
Immunohistochemistry
[0300] For Sema4D staining, the avidin-biotin complex (ABC) technique was used following Vectastain elite ABC kit (PK-6102) mouse IgG (Vector Laboratories, CA). Briefly, tissue sections were deparaffinized in xylene, rehydrated in graded ethanol, treated with Tris-EDTA buffer for antigen retrieval, and quenched in hydrogen peroxide to block endogenous peroxidase. Tissue sections were blocked with 2.5% normal serum, incubated overnight at 4 degrees C. with anti-Sema4D antibody 1:200, (clone 30/CD100; BD Transduction Laboratories), followed by biotinylated secondary antibody (catalog no. BA-9200) and then the ABC reagent. Diaminobenzidine (SK-4105) was used as chromogen and counterstained with Mayer's hematoxylin (Sigma-Aldrich Corp.). The Sema4D labeling index (LI) reflecting the intensity and extent of staining in the tumor cells was defined semiquantitatively as (0, 1, 2, and 3) and digitally using the Aperio software (Positive Pixel count v9) Blue, yellow, orange and red. Where (0) was negative (Blue digitally), (1) was diffuse weak staining (yellow digitally), (2) diffuse weak positivity with scattered strong positive <25% (yellow with scattered orange digitally), and (3) was for diffuse strong positivity or focal strong positive >25% (orange and red digitally). Since Sema4D showed negative to weak expression with focal strong positivity in some normal epithelium (
[0301] Stromal analysis for fibrosis or TAIs infiltrate was carried out by OMP pathologist on the H&E and IHC stained sections under light microscopy. For analysis of fibrosis in the tumor stroma, delicately fibrous stroma (+), moderately fibrotic (++) and densely fibrotic (+++) parameters were used. For the analysis of the tumor associated inflammatory cells (TAIs), (0, 1, 2, and 3) LI was used to reflect the extent of infiltrate of Sema4D.sup.+ve/high TAIs in the peri-tumoral stroma. Where (0) was stroma completely negative, (1) was mild, (2) moderate and (3) for heavy infiltrate. The cut off value for the extent of infiltrate of Sema4D.sup.+ve/high TAIs was the score (2). Photos were taken using the Aperio ScanScope and Image Scope software.
Sema4D ELISA
[0302] The serum concentration of Sema4D was determined by ELISA. Immulon 4 HBX microtiter plates (Thermo Scientific, Waltham, MA) were coated with 50 microliters of undiluted serum, washed, then incubated with anti-human CD100 antibody (clone: 133-1C6; Novus Biologicals). Goat anti-mouse IgM-HRP (catalog no. M31507; Life Technologies) was added followed by detection with TMB (Pierce). The serum concentrations of Sema4D were calculated using the standard curve established for recombinant Sema4D (catalog no. 310-29) (Peprotech, RockyHill, N.J.). The detection limit was 3.1 ng/mL. For detection of TGF-1 by WSU-HN6 tumor cells, Human ELISA TGF-1 total (catalog no. 436707) was purchased from BioLegend (San Diego, Calif.). Conditioned medium was run in triplicate and plates were read using a BioTek Epoch microplate spectrophotometer at 450 nm wavelength.
Cell Lines, Sema4D shRNA and Lentivirus Infections
[0303] The cell lines, normal oral keratinocytes (NOK) and oral squamous cell carcinoma WSU-HN6, derived from a stage III (T3N2bM0) primary malignancy of the base of the tongue, were DNA authenticated at (Johns Hopkins Genetic Resources Core Facility, Baltimore, Md.) to ensure consistency in cell identity in comparison with their source (Jeon et al., Int J Cancer. 2004; 112(2):249-258). To detect TGF-1 production by tumor cells in response to Sema4D, Sema4D knockdown using shRNA lentivirus system was used. The lentivirus and shRNA system were a gift of Dr. John R. Basile (University of Maryland, Baltimore) (Basile et al., Proc Natl Acad Sci USA. 2006; 103(24):9017-9022). In brief, the shRNA sequences for human Sema4D were obtained from Cold Spring Harbor Laboratory's RNAi library (RNAi Codex; http:katahdin.csh1.org:9331_homepage_portal_scripts_main2.p1). The oligonucleotides (Invitrogen, Grand Island, N.Y.) used to knockdown Sema4D protein levels were 5-GGCCTGAGGACCTTGCAGAAGA-3 (SEQ ID NO:3). The Sema4D shRNA oligonucleotides were cloned into lentiviral expression vector pWPI GW as previously described (Basile et al., Proc Natl Acad Sci USA. 2006; 103(24):9017-9022). pWPI (empty) vector was used as negative control. Transductions were performed using FuGENE HD transfection reagent (catalog no. E2311; Promega).
Statistical Analysis
[0304] The primary outcome variable, staining status of Sema4D in tumor tissue, was defined as Sema4D.sup.+ve/high (score=3) and Sema4D.sup.ve/low (score=0, 1, 2); and the secondary outcome variable, PD-L1, defined as PD-L1.sup.+ve/high (1%) and negative low (<1%). The independent variables are tumor clinical stage coded as (I+II, III, and IV), Nodal metastasis (yes/no), Sema4D.sup.+ve/high TAIs infiltrate (moderate to heavy are scores 2, 3), negative to low are 0, 1) and fibrotic tumor microenvironment as (+,++,+++). Other factors included patient characteristics such as age (<45, 45-54, 55-64, 65+), sex, organ category (Oral cavity, Salivary glands, Larynx-Pharynx-Nose, Lymph node), histological grade (1, 2, 3), Pathology (SCC, SGA) and type of tissue (normal or malignant). The associations of two categorical variables were evaluated using two-sided Fisher Exact test or Chi-square test and the association of a continuous variable and a categorical variable were evaluated using two sample t-test or ANOVA F test for the categorical variable having more than two levels. P-values <0.05 were considered statistically significant. If at least one categorical variable had more than two levels and the overall test p-value <0.05, Post Hoc pairwise comparisons were performed. Bonferroni corrections were used for adjusting the p-values of the post hoc tests for multiple comparisons (Dunn). All the analyses were conducted using SAS 9.3.2 software. In addition, the associations of Sema4D levels by ELISA were analyzed using Graph pad Prism software, with age, sex, tumor stage etc. were evaluated by two sample t-test or ANOVA F test.
Sema4D Detection in Sera of HNC Patients
[0305] The current findings of Sema4D expression in tumor cells and in TAIs, in addition to previous in vitro study showing that HNC cells can produce soluble Sema4D in the tumor-conditioned medium, led to an investigation of whether soluble Sema4D can be detected in patient's peripheral blood. ELISA was used to assess Sema4D levels in 10 healthy donors (HD) and 30 HNC patients' specimens. In the 10 HD, serum Sema4D levels were 24.617.3 ng/mL. There was a statistically insignificant gender difference: levels of sera Sema4D in men (27.315.9 ng/mL, n=9) were higher than that in women (not detectable, n=1). The demographics of the 30 HNC patients in this study are summarized in Table 4. The levels of Sema4D in the HNC sera (418.2276.8 ng/mL) were significantly higher than those in HD (27.315.9 ng/mL) (p<0.0001) (
TABLE-US-00001 TABLE 1 Sema4D expression in HNC tumor cells in correlation to tumor progression, peri-tumoral stromal fibrosis and Sema4D.sup.+ve/high TAIs. Sema4D expression in tumor cells ve/low +ve/high No (%) No (%) Total P-value Tumor stage I + II 41 (73.21) 15 (26.79) 56 0.0141 III 16 (45.71) 19 (54.29) 35 IV 25 (73.53) 9 (26.47) 34 Total 82 (65.6) 43 (34.4) 125 Lymph nodal metastasis Yes 26 (56.62) 20 (43.48) 46 0.117 No 63 (70) 27 (30) 90 Total 89 (65.4) 47 (34.6) 136 Stromal Fibrosis * Delicate 37 (82.22) 8 (17.78) 45 0.0001 Moderate 20 (76.92) 6 (23.08) 26 Dense 7 (23.33) 23 (76.67) 30 Total 64 (63.3) 37 (36.6) 101 Sema4D.sup.+ve/high TAIs infiltrate No/low 28 (50.91) 27 (49.09) 55 0.0006 Yes/high 56 (80) 14 (20) 70 Total 89 (71.2) 41 (32.8) 125 * 24 specimens were excluded from the analysis of the fibrosis category, due to dominating tumor islands with no abundant surrounding stroma to be assessed.
TABLE-US-00002 TABLE 2 Differential expression of Sema4D and PD-L1 in HNC. Sema4D in PD-L1 in tumor cells tumor cells ve/low +ve/high Total P-value ve/low 65 (48%) 23 (17%) 88 (65%) 0.23 +ve/high 39 (29%) 8 (6%) 47 (35%) Total 104 (77%) 31 (23%) 135 (100%) PD-L1 in tumor cells Sema4D in and TAIs tumor cells ve/low +ve/high Total P-value ve/low 59 (43.7%) 29 (21.5%) .sup.88 (65.2%) 0.153 +ve/high 37 (27.4%) 10 (7.4%) 47 (34.8) Total 96 (72%).sup. 39 (28%).sup. 135 (100%)
TABLE-US-00003 TABLE 3 PD-L1 expression in relation to peri-tumoral fibrosis and Sema4D expressing TAIs. PD-L1 expression in tumor cells ve/low +ve/high Total P-value Stromal fibrosis Delicate 30 (66.67%) 15 (33.33%) 45 0.06 Moderate 18 (72.00%) 7 (28.00%) 25 Dense 27 (90.00%) 3 (10.00%) 30 Total 75 25 100 Sema4D.sup.+ve/high TAIs infiltrate No (0, 1) 48 (87.27%) 7 (12.73%) 55 0.01 Yes (2, 3) 48 (68.57%) 22 (31.43%) 70 Total 96 29 125
TABLE-US-00004 TABLE 4 Sema4D analysis in the sera of HNC patients in relation to demographics and clinical characteristics Number of Sema4D Characteristics patients (ng/ml) P-value Mean age SD (year) 30 57.7 11.6 Race White 26 390.6 279.sup. 0.4 Black 3 511.6 115.sup. Asian 1 854 Sex Male 27 393 258 0.142 Female 3 642 398 Stage I 1 97.7 0.055 II 3 277.7 123.sup. III 3 566 286 IV 16 512.5 55 N/A 7 245.5 87 Location Oral 13 466 95 0.5 OP & BOT & tonsils 15 395 57 Supra/trans glottic 2 600 79 LN status N0 5 406 423 0.559 N1/N2/N3 18 488 228
TABLE-US-00005 TABLE 5 Descriptive analysis of Sema4D staining according to tissue type. Sema4D expression in tumor cells and normal tissue Type ve/low +ve/high N/A Total Net *Primary 85 (66.4%) 43 (33.6%) 3 131 128 (82.1%) Malignancy .sup.#Metastatic 4 (50.0%) 4 (50%) 0 8 8 (5.1%) .sup.##Normal/ 11 (55%) 9 (45%) 1 21 20 (12.8%) NAT Total 100 (52.6%) 56 (35.9%) 4 160 156 (100%).sup. *Primary malignancies had 119 SCC (76.3%), 9 (5.7%) SGA. .sup.#4 SCC (2.5%) and 4 SGA (2.5%), metastatic to lymph nodes. .sup.##Normal tissue: 11 Tongue, 2 normal tissue adjacent to tumor margin (NAT), 3 Salivary gland tissue, and 4 epiglottis.
TABLE-US-00006 TABLE 6 Sema4D expression in tumor cells in correlation to Patient's demographics and histological grading. Sema4D expression in tumor cells ve/low +ve/high No (%) No (%) Total P value Age No (%).sup. No (%).sup. <45 14 (70) 6 (30).sup. 20 0.745 45-54 29 (61.7) 18 (38.3) 47 55-64 21 (61.76) 13 (38.24) 34 65+ 25 (71.43) 10 (28.57) 35 Total 89 47 136 Gender F 46 (66.67) 23 (33.33) 69 0.76 M 43 (64.18) 24 (35.82) 67 Total 89 47 136 Organ Oral cavity and 34 (70.83) 14 (29.17) 48 0.458 salivary glands larynx, 51 (63.75) 29 (36.25) 80 pharynx and nasal cavity metastatic to 4 (50%) 4 (50%) 8 lymph node Total 89 47 136 Pathological Diagnosis Normal 11 (55) 9 (45).sup. 20 0.0024 SCC 86 (69.67) 37 (30.33) 123 SGA 3 (23.08) 10 (76.92) 13 Total 100 56 156 SCC Hist grade 1 28 (71.79) 11 (28.21) 36 0.513 2 35 (64.81) 19 (35.19) 54 3 20 (76.92) 6 (23.08) 26 83 36 119
TABLE-US-00007 TABLE 7 Sema4D.sup.+ve/high TAIs in correlation to malignancy, pathological diagnosis and clinical staging TAIs expressing Sema4D No (0, 1) Yes (2, 3) N (%) N (%) Total P value Malignancy Normal 13 (68.42) 6 (31.58) 19 0.043 Malignant 55 (43.65) 71 (56.35) 126 Total 68 77 145 Pathological Diagnosis SCC 46 (39.32) 71 (60.68) 117 0.0004 SGA 9 (100) 0 (0) 9 Total 55 71 126 Tumor stage I + II 26 (47.27) 29 (52.73) 55 0.79 III 15 (44.12) 18 (55.88) 33 IV 14 (40.00) 21 (60.00) 35 Total 55 68 123
TABLE-US-00008 TABLE 8 Descriptive analysis of PD-L1 staining according to tissue type PD-L1 expression in malignant tissue and normal cells Net Type ve/low +ve/high N/A Total (%) Primary 98 (74.81%) 30 (22.90%) 3 (2.29%) 131 128 (82.1%) Malig- nancy Meta- 7 (87.50%) 1 (12.50%) 0 (0.00%) 8 8 (5.1%) stasis Normal/ 21 (100%).sup. 0 0 (0.0%) 21 21 (12.8%) NAT 0.00 Total 126 31 3 160 157 (100%).sup.
TABLE-US-00009 TABLE 9 PD-L1 expression in correlation to tumor progression PD-L1 expression in tumor tissue ve/low +ve/high Total P value Tumor Stage I + II 44 (80%).sup. 11 (20%) 55 0.816 III 27 (77.1%) 8 (22.9%) 35 IV 26 (74.3%) 9 (25.7%) 35 Total 97 28 125 Nodal metastasis No (0, 1) 72 (80%).sup. 18 (20%) 55 0.277 Yes (2, 3) 33 (71.7%) 13 (28.3%) 70 Total 105 31 136
[0306] While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those of skill in the art.
[0307] Throughout this disclosure, various publications, patents and published patent specifications are referenced by an identifying citation. The disclosures of these publications, patents and published patent specifications are hereby incorporated by reference into the present disclosure to more fully describe the state of the art to which this invention pertains.