Mini-III RNases, Methods for Changing the Specificity of RNA Sequence Cleavage by Mini-III RNases, and Uses Thereof
20190032035 · 2019-01-31
Inventors
- Janusz Bujnicki (Warszawa, PL)
- Krzysztof Skowronek (Izabelin, PL)
- Dawid Glów (Konskowola, PL)
- Malgorzata Kurkowska (Warszawa, PL)
Cpc classification
C12N9/22
CHEMISTRY; METALLURGY
International classification
Abstract
The object of the invention is a Mini-III RNase with amino acid sequence comprising an acceptor part, and a transplantable a4 helix, and a transplantable a5b-a6 loop, which form structures of a4 helix and a5b-a6 loop, respectively, in the Mini-III RNase structure, wherein the fragments which form structures of a4 helix and a5b-a6 loop, respectively, correspond structurally to respective structures of a4 helix and a5b-a6 loop formed by amino acid sequence fragments 46-52 and 85-98, respectively, of Mini-III RNase from Bacillus stubtilis shown in SEQ ID NO: 1, wherein the said Mini-III RNase exhibits sequence specificity in dsRNA cleavage being dependent only on a ribonucleotide sequence of the substrate, and independent from an occurrence of secondary structures in the substrate's structure, and independent from a presence of other assisting proteins, and wherein the Mini-III RNase is not the Mini-III protein from Bacillus stubtilis of SEQ ID NO: 1, nor SEQ ID NO: 1 with D94R mutation. The invention also relates to a method of obtaining a chimeric Mini-III RNase, a Mini-III RNase encoding construct, a cell with a Mini-III RNase encoding gene, use of Mini-III RNase for dsRNA cleavage, as well as a method of dsRNA cleavage depending only on a ribonucleotide sequence.
Claims
1. A Mini-III RNase with amino acid sequence comprising an acceptor part, and a transplantable 4 helix, and a transplantable 5b-6 loop, which form structures of 4 helix and 5b-6 loop, respectively, in the Mini-III RNase structure, wherein the fragments which form structures of 4 helix and 5b-6 loop, respectively, correspond structurally to respective structures of 4 helix and 5b-6 loop formed by amino acid sequence fragments 46-52 and 85-98, respectively, of Mini-III RNase from Bacillus stubtilis shown in SEQ ID NO: 1, wherein said Mini-III RNase exhibits sequence specificity in dsRNA cleavage that is dependent only on a ribonucleotide sequence of a substrate, and independent from an occurrence of secondary structures in the substrate's structure, and independent from a presence of other assisting proteins, and wherein the Mini-III RNase is not the Mini-III protein from Bacillus stubtilis of SEQ ID NO: 1 , nor SEQ ID NO: 1 with D94R mutation.
2. The Mini-III RNase according to claim 1, characterised in that the amino acid sequence is constructed of an acceptor part, derived from a Mini-III RNase of one microorganism, with inserted transplantable 4 helix and/or transplantable 5b-6 loop, respectively, derived from 4 helix and/or 5b-6 loop sequence of a Mini-III RNase from a different microorganism.
3. The Mini-III RNase according to claim 1 or 2, characterised in that the amino acid sequence thereof includes an acceptor part derived from Mini-III RNase of BsMiniIII.sup.wt (SEQ ID NO: 1), or Mini-III CkMiniIII.sup.wt of Caldicellulosiruptor kristjanssonii (SEQ ID NO: 2), or CrMiniIII.sup.wt of Clostridium ramosum (SEQ ID NO: 4), or CtMiniIII.sup.wt of Clostridium thermocellum (SEQ ID NO: 6), or FpMiniIII.sup.wt of Faecalibacterium prausnitzii (SEQ ID NO: 8), or FnMiniIII.sup.wt of Fusobacterium nucleatum subsp. nucleatum (SEQ ID NO: 10), or SeMiniIII of Staphylococcus epidermidis (SEQ ID NO: 12), or TmMiniIII.sup.wt of Thermotoga maritima (SEQ ID NO: 14), or TtMiniIII.sup.wt of Thermoanaerobacter tengcongensis, presently Caldanaerobacter subterraneus subsp. tengcongensis (SEQ ID NO: 16) or an amino acid sequence identical therewith in at least 80%, preferably in 85%, more preferably in 90%, most preferably in 95%; a transplantable 4 helix derived from BsMiniIII.sup.wt with amino acid sequence including amino acids in positions 46-52 of SEQ ID NO: 1, or from CkMiniIII.sup.wt with amino acid sequence including amino acids 36-42 of SEQ ID NO: 2, or from CtMiniIII.sup.wt with amino acid sequence including amino acids 40-46 of SEQ ID NO: 4, or from CtMiniIII.sup.wt with amino acid sequence including amino acids in positions 56-62 of SEQ ID NO: 6, or from FpMiniIII.sup.wt with amino acid sequence including amino acids in positions 45-51 of SEQ ID NO: 8, or from FnMiniIII.sup.wt with amino acid sequence including amino acids 45-51 of SEQ ID NO: 10, or from SeMiniIII.sup.wt with amino acid sequence including amino acids in positions 43-49 of SEQ ID NO: 12, or from TmMiniIII.sup.wt with amino acid sequence including amino acids 45-51 of SEQ ID NO: 14, or from TtMiniIII.sup.wt with amino acid sequence including amino acids 50-56 of SEQ ID NO: 16) or an amino acid sequence identical therewith in at least 80%, preferably in 85%, more preferably in 90%, most preferably in 95%, and/or a transplantable 5b-6 loop derived from BsMiniIII.sup.wt with amino acid sequence including amino acids in positions 85-98 of SEQ ID NO: 1, or from CkMiniIII.sup.wt with amino acid sequence including amino acids 73-86 of SEQ ID NO: 2, or from CtMiniIII.sup.wt with amino acid sequence including amino acids 79-88 of SEQ ID NO: 4, or from CtMiniIII.sup.wt with amino acid sequence including amino acids in positions 93-106 of SEQ ID NO: 6, or from FpMiniIII.sup.wt with amino acid sequence including amino acids in positions 82-95 of SEQ ID NO: 8, or from FnMiniIII.sup.wt with amino acid sequence including amino acids 82-95 of SEQ ID NO: 10, or from SeMiniIII.sup.wt with amino acid sequence including amino acids in positions 82-95 of SEQ ID NO: 12, or from TmMiniIII.sup.wt with amino acid sequence including amino acids 82-93 of SEQ ID NO: 14, or from TtMiniIII.sup.wt with amino acid sequence including amino acids 87-100 of SEQ ID NO: 16, or an amino acid sequence identical therewith in at least 80%, preferably in 85%, more preferably in 90%, most preferably in 95%.
4. The Mini-III RNase according to claim 1, characterised in that it maintains the Mini-III RNase activity and includes a sequence or a fragment of an amino acid sequence from Caldicellulosiruptor kristjanssonii shown in SEQ ID NO: 2, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00031 WSSWNNYY WSSWNNRR where N=A, C, G, U; W=A, U; S=C, G; Y=C, U.
5. The Mini-III RNase according to claim 1, characterised in that it maintains the Mini-III RNase activity and includes a sequence or a fragment of an amino acid sequence from Clostridium ramosum shown in SEQ ID NO: 4, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00032 SNWSSW SNWSSW where N=A, C, G, U; W=A, U; S=C, G.
6. The Mini-III RNase according to claim 1, characterised in that it maintains the Mini-III RNase activity and includes a sequence or a fragment of an amino acid sequence from Clostridium thermocellum shown in SEQ ID NO: 6, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00033 WSSW WSSW where W=A, U; S=C, G.
7. The Mini-III RNase according to claim 1, characterised in that it maintains the Mini-III RNase activity and includes a sequence or a fragment of an amino acid sequence from Faecalibacterium prausnitzii shown in SEQ ID NO: 8, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00034 WSSW WSSW where W=A, U; S=C, G.
8. The Mini-III RNase according to claim 1, characterised in that it maintains the Mini-III RNase activity and includes a sequence or a fragment of an amino acid sequence from Fusobacterium nucleatum shown in SEQ ID NO: 10, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00035 ASSW USSW where W=A, U; S=C, G.
9. The Mini-III RNase according to claim 1, characterised in that it maintains the Mini-III RNase activity and includes a sequence or a fragment of an amino acid sequence from Staphylococcus epidermidis shown in SEQ ID NO: 12, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00036 WNSU WNSA where N=A, C, G, U; W=A, U; S=C, G.
10. The Mini-III RNase according to claim 1, characterised in that it maintains the Mini-III RNase activity and includes a sequence or a fragment of an amino acid sequence from Thermotoga maritima shown in SEQ ID NO: 14, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00037 WSSWNG WSSWNC where N=A, C, G, U; W=A, U; S=C, G.
11. The Mini-III RNase according to claim 1, characterised in that it maintains the Mini-III RNase activity and includes a sequence or a fragment of an amino acid sequence from Thermoanaerobacter tengcongensis (Caldanaerobacter subterraneus subsp. tengcongensis) shown in SEQ ID NO: 16, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00038 WSSWNNYY WSSWNNYY where N=A, C, G, U; W=A, U; S=C, G; Y=C, U.
12. The Mini-III RNase according to claims 1-3, characterised in that the Mini-III RNase is a chimeric protein selected from Ct(FpH) of SEQ ID NO: 18, Ct(FpL) of SEQ ID NO: 20, Ct(FpHL) of SEQ ID NO: 22, Bs(FpH) of SEQ ID NO: 24, Bs(FpL) of SEQ ID NO: 26, Se(FpH) of SEQ ID NO: 28.
13. A method of obtaining a chimeric Mini-III RNase, characterised in that the method includes the steps of: a) cloning a gene which encodes the Mini-III RNase, wherein amino acid sequence thereof includes fragments which form structures of 4 helix and 5b-6 loop, respectively, corresponding structurally to respective structures of 4 helix and 5b-6 loop formed by amino acid sequence fragments 46-52 and 85-98, respectively, of Mini-III RNase from Bacillus stubtilis shown in SEQ ID NO: 1, b) modifying the gene which encodes said RNase by exchanging at least one of the fragments encoding 4 helix and/or 5b-6 loop structures, respectively, with a fragment encoding 4 helix and/or 5b-6 loop structures, respectively, from a gene which encodes a Mini-III RNase of a different microorganism, wherein said Mini-III RNase shows sequence specificity in dsRNA cleavage being dependent only on aribonucleotide sequence and independent from an occurrence of secondary structures in the substrate's structure, and independent from a presence of other assisting proteins, and wherein the Mini-III RNase is not the Mini-III protein from Bacillus stubtilis with amino acid sequence shown in SEQ ID NO: 1, nor SEQ ID NO: 1 with D94R mutation.
14. The method of obtaining a chimeric Mini-III RNase according to claim 13, characterised in that step b) involves an insertion of a transplantable 4 helix and/or a transplantable 5b-6 loop into an acceptor part, wherein the acceptor part is derived from Mini-III RNase of BsMiniIII.sup.wt (SEQ ID NO: 1), or Mini-III CkMiniIII.sup.wt of Caldicellulosiruptor kristjanssonii (SEQ ID NO: 2), or CrMiniIII.sup.wt of Clostridium ramosum (SEQ ID NO: 4), or CtMiniIII.sup.wt of Clostridium thermocellum (SEQ ID NO: 6), or FpMiniIII.sup.wt of Faecalibacterium prausnitzii (SEQ ID NO: 8), or FnMiniIII.sup.wt of Fusobacterium nucleatum subsp. nucleatum (SEQ ID NO: 10), or SeMiniIII.sup.wt of Staphylococcus epidermidis (SEQ ID NO: 12), or TmMiniIII.sup.wt of Thermotoga maritima (SEQ ID NO: 14), or TtMiniIII.sup.wt of Thermoanaerobacter tengcongensis, presently Caldanaerobacter subterraneus subsp. tengcongensis (SEQ ID NO: 16), or includes an amino acid sequence identical therewith in at least 80%, preferably in 85%, more preferably in 90%, most preferably in 95%; the transplantable 4 helix is derived from BsMiniIII.sup.wt with amino acid sequence including amino acids in positions 46-52 of SEQ ID NO: 1, or from CkMiniIII.sup.wt with amino acid sequence including amino acids 36-42 of SEQ ID NO: 2, or from CtMiniIII.sup.wt with amino acid sequence including amino acids 40-46 of SEQ ID NO: 4, or from CtMiniIII.sup.wt with amino acid sequence including amino acids in positions 56-62 of SEQ ID NO: 6, or from FpMiniIII.sup.wt with amino acid sequence including amino acids in positions 45-51 of SEQ ID NO: 8, or from FnMiniIII.sup.wt with amino acid sequence including amino acids 45-51 of SEQ ID NO: 10, or from SeMiniIII.sup.wt with amino acid sequence including amino acids in positions 43-49 of SEQ ID NO: 12, or from TmMiniIII.sup.wt with amino acid sequence including amino acids 45-51 of SEQ ID NO: 14, or from TtMiniIII.sup.wt with amino acid sequence including amino acids 50-56 of SEQ ID NO: 16, or includes an amino acid sequence identical therewith in at least 80%, preferably in 85%, more preferably in 90%, most preferably in 95%, and/or the transplantable 5b-6 loop is derived from BsMiniIII.sup.wt with amino acid sequence including amino acids in positions 85-98 of SEQ ID NO: 1, or from CkMiniIII.sup.wt with amino acid sequence including amino acids 73-86 of SEQ ID NO: 2, or from CtMiniIII.sup.wt with amino acid sequence including amino acids 79-88 of SEQ ID NO: 4, or from CtMiniIII.sup.wt with amino acid sequence including amino acids in positions 93-106 of SEQ ID NO: 6, or from FpMiniIII.sup.wt with amino acid sequence including amino acids in positions 82-95 of SEQ ID NO: 8, or from FnMiniIII' with amino acid sequence including amino acids 82-95 of SEQ ID NO: 10, or from SeMiniIII.sup.wt with amino acid sequence including amino acids in positions 82-95 of SEQ ID NO: 12, or from TmMiniIII.sup.wt with amino acid sequence including amino acids 82-93 of SEQ ID NO: 14, or from TtMiniIII.sup.wt with amino acid sequence including amino acids 87-100 of SEQ ID NO: 16, or includes an amino acid sequence identical therewith in at least 80%, preferably in 85%, more preferably in 90%, most preferably in 95%.
15. The method of obtaining a chimeric Mini-III RNase according to claims 13-14, characterised in that the transplantable 4 helix and the transplantable 5b-6 loop in the gene encoding Mini-III RNase are derived from different microorganisms.
16. The method of obtaining a chimeric Mini-III RNase according to claims 13-15, characterised in that the gene encoding Mini-III RNase comprises any sequence which encodes an amino acid sequence from a group consisting of SEQ ID NO: 18, 20, 22, 24, 26, 28.
17. The method of obtaining a chimeric Mini-III RNase according to claims 13-16, characterised in that the method further includes the steps of c) culturing cells which express the gene from step b), and d) isolating and purifying the expressed protein from step c), and optionally step e) of determining the sequence specificity of the protein obtained in step d).
18. A Mini-III RNase obtained with the method according to claims 13-17.
19. A construct encoding the Mini-III RNase according to claims 1-12, 18.
20. A cell comprising the gene encoding the Mini-III RNase according to claims 1-12, 18, or the construct according to claim 19.
21. Use of the Mini-III RNase according to claims 1-12 and 18 to cleave dsRNA in a manner dependent only on a ribonucleotide sequence, and independent from an occurrence of secondary structures in the substrate's structure, and independent from a presence of other assisting proteins.
22. A method of cleaving dsRNA in a manner dependent only on a ribonucleotide sequence, and independent from an occurrence of secondary structures in the substrate's structure, and independent from an presence of other assisting proteins, characterised in that the method includes interaction between a dsRNA substrate and the Mini-III RNase according to claims 1-12 or claim 18.
23. The method of cleaving dsRNA according to claim 22, characterised in that the Mini-III RNase includes a sequence from Caldicellulosiruptor kristjanssonii shown in SEQ ID NO: 2, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00039 WSSWNNYY WSSWNNRR where N=A, C, G, U; W=A, U; S=C, G; Y=C, U.
24. The method of cleaving dsRNA according to claim 22, characterised in that the Mini-III RNase includes a sequence from Clostridium ramosum shown in SEQ ID NO: 4, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00040 SNWSSW SNWSSW where N=A, C, G, U; W=A, U; S=C, G.
25. The method of cleaving dsRNA according to claim 22, characterised in that the Mini-III RNase includes a sequence from Clostridium thermocellum shown in SEQ ID NO: 6, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00041 WSSW WSSW where W=A, U; S=C, G.
26. The method of cleaving dsRNA according to claim 22, characterised in that the Mini-III RNase includes a sequence from Faecalibacterium prausnitzii shown in SEQ ID NO: 8, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00042 WSSW WSSW where W=A, U; S=C, G.
27. The method of cleaving dsRNA according to claim 22, characterised in that the Mini-III RNase includes a sequence from Fusobacterium nucleatum shown in SEQ ID NO: 10, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00043 ASSW USSW where W=A, U; S=C, G.
28. The method of cleaving dsRNA according to claim 22, characterised in that the Mini-III RNase includes a sequence from Staphylococcus epidermidis shown in SEQ ID NO: 12, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00044 WNSU WNSA where N=A, C, G, U; W=A, U; S=C, G.
29. The method of cleaving dsRNA according to claim 22, characterised in that the Mini-III RNase includes a sequence from Thermotoga maritima shown in SEQ ID NO: 14, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00045 WSSWNG WSSWNC where N=A, C, G, U; W=A, U; S=C, G.
30. The method of cleaving dsRNA according to claim 22, characterised in that the Mini-III RNase includes a sequence from Thermoanaerobacter tengcongensis (Caldanaerobacter subterraneus subsp. tengcongensis) shown in SEQ ID NO: 16, wherein the Mini-III RNase shows sequence specificity in dsRNA cleavage and cleaves dsRNA within a consensus sequence TABLE-US-00046 WSSWNNYY WSSWNNYY where N=A, C, G, U; W=A, U; S=C, G; Y=C, U.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0111] For better understanding of the invention, it has been illustrated with embodiments and attached figures wherein:
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
MODES FOR CARRYING OUT THE INVENTION
[0120] The following examples are included only to illustrate the invention and to explain particular aspects thereof, and not to limit it, and should not be construed as the entire range thereof which is defined in the appended claims.
[0121] In the following examples, unless indicated otherwise, standard materials and methods described in Sambrook J. et al., Molecular Cloning: A Laboratory manual, 2.sup.nd edition. 1989. Cold Spring Harbor, N.Y. Cold Spring Harbor laboratory Press were used, or procedures were followed in accordance with manufacturers' instructions for specific materials and methods.
[0122] In the present specification, unless indicated otherwise, standard abbreviations for amino acids and nucleotides or ribonucleotides are used.
EXAMPLES
Example 1
[0123] The cloning of Sequences Encoding Patricular Mini-III RNases
[0124] Microorganisms were purchased in a freeze-dried form from DSMZ (Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures) (Table 1). Following the suspension of lyophilisates in 500 l of TE buffer (10 mM Tris-HCl pH 8.0, 1 mM EDTA pH 8.0), the suspensions were extracted with phenol (saturated with 100 mM Tris-HCl, pH 8.5). The aqueous phase was re-extracted with phenol:chloroform (1/1 v/v) mixture, and subsequently nucleic acids were precipitated by the addition of 50 l of 3 M sodium acetate pH 5.2 and 1 mL of ethanol. Precipitated nucleic acids were centrifuged (12 000 g, 10 min., 4 C.), and the fluid was removed. The pellet was washed with 1 mL of 70% ethanol, and then dried. Obtained DNA was suspended in 20 l of TE buffer.
TABLE-US-00017 TABLE 1 The origin of cloned sequences encoding Mini-III RNases Optimal Growth GenInfo Identifier SEQ ID DSMZ Temperature Enzyme Organism Strain (GI) NO: No. ( C.) CkMiniIII Caldicellulosiruptor I77R1B 311792827 3 12137 70 kristjanssonii CrMiniIII Clostridium ramosum 113-I 167756029 5 1402 37 CtMiniIII Clostridium thermocellum 125974551 7 1237 55 FpMiniIII Faecalibacterium A2-165 160943938 9 17677 37 prausnitzii FnMiniIII Fusobacterium 1612A 19704899 11 15643 37 nucleatum subsp. nucleatum SeMiniIII Staphylococcus PCI 27467211 13 1798 37 epidermidis 1200 TmMiniIII Thermotoga maritima MSB8 15644486 15 3109 80 TtMiniII Thermoanaerobacter MB4 20808680 17 15242 75 tengcongensis, presently Caldanaerobacter subterraneus subsp. tengcongensis (Tte)
TABLE-US-00018 TABLE 2 Primer sequences used for the amplification of genomic DNA encoding particular Mini-III RNases. SEQ ID Primer Sequence NO: Fckminilll CCTCCATGGTCAGTCCTTTAGTATATG 30 Rckminilll CCTCTCGAGTTATTGACAGCTATTCTTGGC 31 Fcrminilll GGACCATGGGCCCTGAACTGATTAATGC 32 Rcrminilll GGCCTCGAGTTATTTGTTGTTGATGTACTG 33 Fctminilll CAGGCATATGGTTTGGGAATTTTTTGAC 34 Rctminilll GACCTCGAGTCAATTCTGTGAAACAGCC 35 Ffpminilll GGACCATGGACGAAAGCGAAAAAATTG 36 Rfpminilll GCGCTCGAGTTATTTCTGATCAGGATCAAAC 37 Ffnminilll CCGCATATGGACAATGTAGATTTTTCAAAG 38 Rfnminilll GTGCTCGAGTCATCATTCTCCCTTTATAAC 39 TATATTTATAATTTTTTTTATTTC Fseminilll TAGACATATGGCAGTGGCTAAACATATGAAC 40 Rseminilll ATCTCGAGCTACCTTTCATCCACTA 41 Ftmminilll GCTTCATATGGAAAAACTCTTCAGATTCG 42 Rtmminilll CTTCTCGAGTTATTCCTGAGCGCTTCC 43 Fttminilll CGCACATATGGAAAAGGATAAGATGATTCTTG 44 Rttminilll GCTCTCGAGTCATTCTTCCGTGTATTCCATAG 45
[0125] Sequences encoding Mini-III RNases were amplified from genomic DNA in PCR using Pfu polymerase and primers listed in Table 2.
[0126] To obtain recombinant plasmids which would enable inducible overexpression of Mini-III RNases with N-terminal hexahistidine tag, PCR products were cleaved with Ndel and Xhol enzymes and ligated with pET28a vector (Novagen) cleaved with the same enzymes. Ligation was conducted for 1 hour at room temperature with 1 U of phage T4 DNA ligase (Thermo Scientific). Next, 10 l of reaction mixture was used to transform 100 l of chemically competent bacteria (Escherichia coli Top10 strain: F-mcrA (mrr-hsdRMS-mcrBC) 80lacZ M15 lacX74 deoR recA1 araD139 (araA-leu)7697 galU galK rpsL endA1 nupG [Invitrogen]), and the transformants were selected on a solid LB medium supplemented with 50 g/mL kanamycin. From selected clones, plasmid DNA was isolated using Plasmid Mini kit (A&A Biotechnology), followed by sequencing to verify the correctness of the obtained constructs.
[0127] In this way, constructs enabling the efficient inducible overproduction of Mini-III RNases from particular microorganism were obtained.
Example 2
[0128] Expression and Purification of Proteins from Recombinant Plasmids Encoding Wild Type Mini-III RNases.
[0129] E. coli strain BL21(DE3) (F-ompT gal dcm Ion hsdSB(rB- mB-) (DE3 [lad lacUV5-T7 gene 1 ind1 sam7 nin5]) was transformed with recombinant plasmids carrying Mini-III nuclease genes obtained in Example 1. The transformation was performed as in Example 1. Transformants were selected on LB solid medium supplemented with 50 g/mL kanamycin and 1% glucose. 25 mL of liquid LB medium with 50 g/mL kanamycin and 1% glucose was inoculated with selected colonies of extransformants and incubated for 5 hours at the temperature of 37 C. with shaking. Then, 500 mL of liquid ZY (Studier 2005) supplemented with kanamycin to the concentration of 100 g/mL was inoculated with 25 mL of culture grown in LB medium, and incubated with shaking at the temperature of 37 C. for 24 h. The cultures were centrifuged at 5000 g for 10 min at 4 C., suspended in STE buffer (0.1 M NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA pH 8.0), and again centrifuged. The pellet was suspended in 20 mL of lysis solution (50 mM Tris-HCl pH 8.0, 300 mM NaCl, 10 mM imidazole, 10% glycerol), and then bacterial cells were disintegrated with a single pass through the cell disintegrator (Constant Systems LTD) at overpressure of 1360 atmospheres. Lysates were clarified by centrifugation at 20 000 g at the temperature of 4 C. for 20 min to get rid of insoluble cell debris. Recombinant proteins were purified by affinity chromatography method using the polyhistidine tag present in the polypeptide chain.
[0130] The cell lysate obtained from a 5 L culture (10 flasks with 500 mL each) was applied to a 71.5 cm column containing 5 mL of Ni-NTA agarose bed (Sigma-Aldrich) which had been equilibrated with four volumes of lysis buffer. The column was washed sequentially with the following buffers: lysis (150 mL), lysis supplemented with 2 M NaCl (50 mL), lysis supplemented with imidazole to the concentration of 20 mM (50 mL). Purified recombinant proteins were eluted with lysis buffer supplemented with imidazole to the concentration of 250 mM, and fractions of 1.5 mL were collected. The flow rate during the purification was 0.9 mL/min, and the temperature was 4 C. Purified protein fractions were mixed with equal volume of glycerol, and then stored at 20 C.
[0131] Thereby, the highly purified enzyme preparations were obtained while maintaining the activity thereof, and in a buffer enabling convenient longer storage thereof at the temperature of 20 C.
Example 3
[0132] Determination of Optimal Reaction Conditions for In Vitro Cleavage of dsRNA Substrates by Purified Enzymes
[0133] In order to determine optimal conditions of the reaction buffer, the limited cleavage of c1)6 phage genome was performed in buffers listed in Table 3.
TABLE-US-00019 TABLE 3 Buffer Buffer Composition B 10 mM Tris-HCl pH 7.5, 10 mM MgCl.sub.2, 0.1 mg/mL BSA B1 10 mM Tris-HCl pH 7.5, 1 mM MgCl.sub.2, 0.1 mg/mL BSA G 10 mM Tris-HCl pH 7.5, 10 mM MgCl.sub.2, 50 mM NaCl, 0.1 mg/mL BSA G1 10 mM Tris-HCl pH 7.5, 1 mM MgCl.sub.2, 50 mM NaCl, 0.1 mg/mL BSA O 50 mM Tris-HCl pH 7.5, 10 mM MgCl.sub.2, 100 mM NaCl, 0.1 mg/mL BSA O1 50 mM Tris-HCl pH 7.5, 1 mM MgCl.sub.2, 100 mM NaCl, 0.1 mg/mL BSA R 10 mM Tris-HCl pH 8.5, 10 mM MgCl.sub.2, 100 mM KCl, 0.1 mg/mL BSA R1 10 mM Tris-HCl pH 8.5, 1 mM MgCl.sub.2, 100 mM KCl, 0.1 mg/mL BSA Y 33 mM TRIS acetate pH 7.9, 20 mM Mg(CH.sub.3COO).sub.2, 66 mM CH.sub.3CO.sub.2K, 0.1 mg/mL BSA 2XY 66 mM TRIS acetate pH 7.9, 40 mM Mg(CH.sub.3COO).sub.2, 132 mM CH.sub.3CO.sub.2K, 0.2 mg/mL BSA Bs 10 mM Tris-HCl pH 7.5, 1 mM MgCl.sub.2, 5 mM NaCl, 0.1 mg/mL BSA BG 10 mM Tris-HCl pH 7.5, 10 mM MgCl.sub.2, 25 mM NaCl, 0.1 mg/mL BSA
[0134] In the experiment, 1.5 g of dsRNA was used, and 3.3 g of BsMiniIII, 80 ng of CkMiniIII, 23.5 g of CrMiniIII, 5 g of CtMiniIII, 0.8 g of FnMiniIII, 1.1 g of FpMiniIII, 2.1 g of SeMiniIII, 0.185 g of TmMiniIII, 11.5 ng of TtMiniIII, obtained in Example 2. Aliquots corresponding to 0.5 g dsRNA were collected after 5, 10, and 15 minutes of reaction, except for the TtMiniIII and SeMiniIII, where reaction times were 2, 4 and 6 minutes, and 20, 40 and 60 minutes, respectively.
[0135] Cleavage products were separated by electrophoresis in 1.5% agarose gel supplemented with a final concentration of 0.5 g/mL ethidium bromide. The buffer which generated the most visible band pattern was selected as an optimal one. As a result the following buffers were selected: for CrMiniIIIBs buffer; for CkMiniIIIG1 buffer; for CtMiniIIIB1 buffer; for FpMiniIIIBs buffer; for FnMiniIIIB buffer; for SpMiniIIIR buffer; for TmMiniIIIR buffer; for TtMiniIIIB1 buffer. In these conditions, clear differences were observed in the pattern of bands obtained in electrophoretic separation of cleavage products (
[0136] In this way, convenient conditions for using purified enzymes in in vitro reactions were determined, and the presence of differences in sequence specificities thereof between the particular Mini-III RNases was shown.
Example 4
[0137] Determination of a Preferred Cleavage Sequence for Particular Mini-III RNases using high throughput Sequencing
[0138] Limited cleavage of 5 g of 6 genome was performed with each enzyme for 5 min. (conditions are given in Table 4). The amount of particular enzymes used in reactions were as given in Example 3.
TABLE-US-00020 TABLE 4 Optimal reaction conditions for particular sequence specific Mini-III RNases. Buffer Reaction (composition given Temperature Enzyme in Table 3 above) [ C.] BsMiniIII Bs 37 CrMiniIII Bs 37 CkMiniIII G1 65 CtMiniIII B1 55 FpMiniIII Bs 37 FnMiniIII F 37 SeMiniIII R 37 TmMiniIII R 65 TtMiniIII Bs 65
[0139] The reactions were quenched by the addition of EDTA to the concentration of 20 mM, and subsequently RNA was purified using GeneJET RNA Cleanup and Concentration Micro Kit (Thermo Scientific). Purified reaction products were subjected to denaturation at 95 C. for 1 min, cooled on ice, and next 3 RNA ends were ligated with 50 pmols of 5 pre-adenyiated adapters UniShPreA (Table 5) using truncated RNA K2270 ligase II (New England Biolabs) at the temperature of 16 C. for 16 hours. Ligation products were purified from unused adapters using GeneJET RNA Cleanup and Concentration Micro Kit (Thermo Scientific), and next they were used as a template in reverse transcription reactions using Maxima reverse transcriptase (Thermo Scientific) and UniShRT primer complementary to UniShPreA sequence (Table 5). Reactions were incubated for 5 minutes at the temperature of 50 C. and terminated by heating for 5 minutes at the temperature of 80 C. The obtained cDNA was purified using GeneJET DNA Micro Kit (Thermo Scientific), and then 3-ends were ligated with 50 pmols of pre-adenylated adapters PreA3Univ (Table 5) employing thermostable ligase App DNA/RNA (New England Biolabs). Ligation products were purified with GeneJET DNA Micro Kit. Thus prepared double-stranded cDNA was amplified with PCR (15-18 amplification cycles) using a pair of primers/adapters (Table 5) which enabled the sequencing of obtained products in MiSeq sequencer (Illumine). PCR products were separated on 1.5% agarose gel, and a fraction of size between 200 and 700 base pairs was re-isolated using GeneJET Gel Extraction kit (Thermo Scientific).
TABLE-US-00021 TABLE 5 Primer sequences used to prepare libraries for high throughput sequencing of dsRNA ends resulting from the cleavage of 6 bacteriophage genome by sequence-specific Mini-III RNases. SEQ ID Primer Sequence NO: UniShPreA AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGA 46 UniShRT TCTACACTCTTTCCCTACACGAC 47 PreA3Univ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC 48
[0140] The prepared material was subjected to the high throughput sequencing using MiSeq sequencer (Illumine). Reads obtained from this analysis were aligned to c1)6 bacteriophage genome sequence with Bowtie 2 software (version 0.2), available on the Galaxy platform (http://usegalaxy.ora), using end-to-end mode and default parameters. Taking into account the geometry of substrate cleavage by Mini-III, the total number of reads starting in position X of + strand and position X+1 of strand was calculated. In this way, we established a rating of cleaving particular sites in 06 bacteriophage aenome for each enzyme. To determine the substrate preference of each enzyme, we used 14-nucleotide sequence fragments flanking 200 most frequent cleavage sites. In this analysis a software for finding de nova motifsMEME2 was used with parameters set to default except for the minimum width of motifs which was set for 14 nucleotides. The profiles established for the preferred cleavage sequence for the tested Mini-III RNases are shown in
Example 5
[0141] Cleavage of Isolated dsRNA Substrates Produced Using RT PCR and Enzymatic Synthesis with Mini-III RNases
[0142] To confirm the results obtained from the analysis of data from high throughput sequencing of products of RNA cleavage by Mini-III nucleases, short fragments of bacteriophage genome were synthesized comprising potential cleavage sites for Mini-III nucleases (Table 6). To achieve this, reverse transcription of 6 dsRNA genome was performed using Maxima reverse transcriptase (Thermo Scientific) and random six-nucleotide primers. Subsequently, based on the high throughput sequencing results, sites in bacteriophage genome were selected and pairs of primers were designed to enable amplification of fragments comprising these sites in dsRNA. One of the primers introduced the promoter sequence for phage T7 DNA-dependent RNA polymerase, while the otherthe promoter sequence for phage c1)6 RNA-dependent RNA polymerase (Table 7).
TABLE-US-00022 TABLE 6 dsRNA substrates - isolated short fragments of bacteriophage 6 genome comprising potential cleavage sites for Mini-III nucleases (given nucleotide positions are in reference to 6 genome sequence) (references to 6 genome sequence: S: NC_003714.1; L: NC_003714; M: NC_003714.3; McGraw, T. et al., Journal of Virology, (1986) 58(1), 142-151; Gottlieb, P. et al., Virology, (1988) 163(1), 183-190; Mindich, L. et al., Journal of Virology, (1988) 62(4), 1180-1185, respectively). Fragment Fragment 6 Starting Ending Cleavage Genome Nucleotide Nucleotide Position Fragment Position Position 910 S 804 948 949 S 910 998 2021 L 1786 2112 3292 L 3041 3384 4486 L 4421 4569 4754 L 4650 4928
TABLE-US-00023 TABLE 7 Sequences of primers used to prepare dsRNA being isolated fragments of 6 bacteriophage genome. For specific reactions, pairs of primers marked with substrate cleavage position were used. Cleavage SEQ ID Position Primer Sequence NO: 910 910fT7 TAATACGACTCACTATAGGGCTGCTCGCGCGTTG 49 910rP6 GGAAAAAAATCAGACACAACTGACGCGATCG 50 949 949fT7 TAATACGACTCACTATAGGGCCTCTCTCTCTGGCCACGATC 51 949rP6 GGAAAAAAATGCCCTGTACAGCAGGCATAAG 52 2021 2021fT7 TAATACGACTCACTATAGGGCTCCTATCATGGCCGTTGC 53 2021rP6 GGAAAAAAACTTCGAGATCAGGGTTGGACG 54 3292 3292fT7 TAATACGACTCACTATAGGGTACCGCGATCAACACTGTCGTC 55 3292rP6 GGAAAAAAACGAATCAGGACGTCTGGACG 56 4486 4486fT7 TAATACGACTCACTATAGGGCTGTCTCCCCTCGGTTTCATC 57 4486rP6 GGAAAAAAATCGACAGACGACAGCGCTG 58 4754 4754fT7 TAATACGACTCACTATAGGGCTCATCGCCTCGATGAACCAAG 59 4754rP6 GGAAAAAAACTACTGCTTTCGAGCGGTCG 60
dsRNA synthesis reaction was performed using Replicator RNAi Kit (Thermo Scientific) according to the protocol recommended by the manufacturer. The concentration of products of the synthesis reaction was measured spectrophotometrically.
[0143] To cleave the substrates being isolated 6 bacteriophage genome fragments, the panel of described enzymes was used in their optimal conditions described in Table 4. Cleavage products were separated by electrophoresis using polyacrylarnide gel (8%, TAE: 40 mM Tris-HCl, 20 mM acetic acid, and 1 mM EDTA), stained with ethidium bromide for 10 minutes, and visualized using UV light, The results of cleavage of selected substrates are shown in
[0144] In this way, the results of high throughput sequencing and applicability of described method to identify cleavage sites for Mini-III RNases in cl=.6 bacteriophage genome were confirmed.
Example 6
[0145] Preparation of Substrate Libraries with Substitutions and Generation of dsRNA Substrates with Introduced Substitutions
[0146] To generate template DNA for dsRNA 910S synthesis, and to introduce a substitutions of a motif recognised by Mini-III RNases, dsDNA obtained in RT-PCR of bacteriophage genorne fragment comprising a fragment of phage genome S segment from position 804 to position 948 was inserted to Sinal site in pUC19 plasmid, whereby pUC910S plasmid was generated. Substitutions at each position of the cleavage site were obtained using inside-out PCR, in which pUC910S plasmid was used as a template, as well as three sets of primers comprising degenerate sequence at the positions subjected to changes (Table 8). Substitutions in positions outside the cleavage site were obtained using inside-out PCR, in which pUC910S plasmid was used as a template, as well as a pair of primers introducing a single substitution outside ACCU sequence (Table 8).
TABLE-US-00024 TABLE 8 Sequences of primers used for the construction of substrate libraries with substitutions and production of the dsRNA substrates with introduced substitutions. To generate suitable libraries, pairs of primers were used, of which one has f and the other r at the end of their names. Symbols N, W, S mean as follows: N =A, C, G, U; W =A, T; S =C, G. SEQ ID Library Primer Sequence NO: 1 WSSWf SSWCTCTCTCTGGCCACGATC 61 WSSWr WTTCCCTCCCAGCACG 62 2 ANNTf NNTCTCTCTCTGGCCACGATC 63 ANNTr TTTCCCTCCCAGCACG 64 3 NCCNf CCNCTCTCTCTGGCCACGATC 65 NCCNr NTTCCCTCCCAGCACG 66 4 3T-r TTTACCTCCCAGCACGACCGCGAC 67 3T-f CCTCTCTCTCTGGCCACGATCGCGTC 68 5 4C-r GCCCTCCCAGCACGACCGCGA 69 4G-r CCCCTCCCAGCACGACCGCGAC 70 4T-r ACCCTCCCAGCACGACCGC 71 4-f AACCTCTCTCTCTGGCCACGATCGCGTC 72 6 11C-r CCTCCCTCTCTGGCCACGATCGCGTCAG 73 11G-r CCTCGCTCTCTGGCCACGATCGCGTCAG 74 7 12A-r CCTCTATCTCTGGCCACGATCGCGTCAG 75 11/12-f TTTCCCTCCCAGCACGACCGCGAC 76
5-ends of obtained PCR products were phosphorylated using T4 polynucleotide kinase (Thermo Scientific), and circular molecules were reconstructed using phage T4 DNA Haase (Thermo Scientific). Obtained plasmids were subjected to DNA sequencing in order to characterise substitution(s) in particular clones. Selected clones (Tables 9 and 10) comprising a change in motif sequence recognised by Mini-III were used for dsRNA synthesis using Replicator RNAi Kit (Thermo Scientific).
TABLE-US-00025 TABLE 9 Nucleotide sequences at the preferred site in dsRNA substrates from the panel of substrates comprising substitutions in the sequence of recognised motif. Substrate Sequence Complementary Sequence S910ACCU ACCU AGGU S910AGGU AGGU ACCU S910GCCU GCCU AGGC S910ACCG ACCG CGGU S910AGGA AGGA UCCU S910UGGU UGGU ACCA S910ACGU ACGU ACGU S910ACUU ACUU AAGU S910AGAU AGAU AUCU S910UCCA UCCA UGGA S910UGGA UGGA UCCA S910CCCA CCCA UGGG S910UCCG UCCG CGGA S910GCCG GCCG CGGC S910CCCG CCCG CGGG S910UCGU UCGU ACGA S910AAAU AAAU AUUU S910AGUU AGUU AACU S910UCGA UCGA UCGA S910UGCA UGCA UGCA
TABLE-US-00026 TABLE 10 Nucleotide sequences at the preferred site in dsRNA substrates from clones comprising substitutions outside ACCU sequence in the recognised motif. ACCU sequences and complementary sequence AGGU are in bold. Substrate Sequence Complementary sequence 910-3G-U UAAACCUCUC GAGAGGUUUA 910-4A-C GCAACCUCUC GAGAGGUUGC 910-4A-G GGAACCUCUC GAGAGGUUCC 910-4A-U GUAACCUCUC GAGAGGUUAC 910-11U-A GAAACCUCAC GTGAGGUUUC 910-11U-G GAAACCUCGC GCGAGGUUUC 910-12C-A GAAACCUCUA TAGAGGUUUC
[0147] In this way, a panel of substrates was obtained enabling precise and systematic determination of the sequence preferences of Mini-III RNases in a strictly controlled system.
Example 7
The Effect of Substitutions in a Recognised Sequence on Cleavage Rate of Selected Mini-III RNases
[0148] The synthesized panel of 910S substrates comprising substitutions in ACCU sequence, shown in Table 9, was used to investigate the cleavage rate of selected Mini-III enzymes. The reactions were performed in conditions optimal for a particular enzyme described in a table (Table 4). To each reaction, 1.2 g of dsRNA was added. Subsequently, after 15, 30, 60, and 120 minutes from the reaction initiation, 15 l aliquots were collected and mixed with 3 l of loading dye and 1.5 l of phenol:chloroform (1:1 v:v) mixture, followed by cooling the sample on ice. Polyacrylamide gel (8%, TAE: 40 mM Tris-HCl, 20 mM acetic acid, and 1 mM EDTA) was loaded with 5l of thus obtained mixture, followed by electrophoresis, gel staining with ethidium bromide (0.5 g/ml) for 10 minutes, and visualisation of RNA using UV light. The molar ratio of product to substrate was determined densitometrically by measuring the intensity of a band corresponding to the substrate and to the larger of reaction products using ImageQuantTL software (GE Healtcare). The rate was determined from a range for which the reaction was linear in time. Next, the obtained values were normalised to the initial rate of cleaving a substrate comprising ACCU sequence. The results are shown in
[0149] The synthesized panel of 910S substrate variants comprising substitutions outside ACCU sequence, shown in Table 10, was used to investigate the cleavage efficiency of selected Mini-III enzymes. Selection of enzymes was performed based on the analysis of high throughput sequencing results. In this experiment, we used enzymes with recognised sequence motif containing, in addition to four main nucleotides, also nucleotides outside of this sequence. Reactions proceeded as in the case of 910S substrates comprising substitutions in ACCU sequence, wherein reactions were terminated after 60 minutes from the initiation thereof. The cleavage efficiency was determined by dividing the percentage amount of the larger of products by the number of minutes of reaction. Next, the obtained values were normalised to the initial rate of cleaving a substrate comprising ACCU sequence. The results are shown in
[0150] In this way, precise sequence preferences of tested enzymes were established.
Example 8
[0151] The Use of the Model of dsRNA-BsMiniIII Complex Structure for the Selection of Structural Elements Which may be Engaged in Recognising the Preferred Sequence
[0152] As a result of the visual analysis of the model of BsMiniIII with dsRNA dimer complex structure, it was found that two elements of the structure are located close enough to the RNA substrate to participate in the selection of the substrate sequence to cleave, and the differences in the amino acid sequence of these two elements can be responsible for the differences observed among the tested enzymes in preference towards various substrates. Selected structure elements are 4 helix and 5b-6 loop (
TABLE-US-00027 TABLE 11 Equivalent amino acid flanking sequences of 4 helix and 5b-6 loop in particular Mini-III which may be engaged in recognising the preferred sequence. Sequences of 4 helix Sequences of 5b-6 loop fragments participating in fragments participating in sequence recognition (the sequence recognition (the range range of given positions for of given positions for amino acid amino acid residues is in residues is in reference to the Enzyme SEQ ID NO reference to the SEQ ID NO) SEQ ID NO) BsMiniIII 1 HKKSSRI (46-52) AKSGTTPKNTDVQT (85-98) CkMiniIII 2 YLRTTMY (36-42) AKPKTIPRNAKLSD (73-86) CrMiniIII 4 QREAVKY (40-46) TKGSKNESLD (79-88) CtMiniIII 6 HKRSIAY (56-62) AKSATVPKNADITD (93-106) FpMiniIII 8 NAEKVKY (45-51) ASKASVAKHASPEE (82-95) FnMiniIII 10 NKYVKAK (45-51) SNIKTFPRSCTVME (82-95) SeMiniIII 12 HQVSKSY (43-49) AKSYTKAKNTDIQT (82-95) TmMiniIII 14 HERVKEH (45-51) SKAAKRHGNDPT (82-93) TtMiniIII 16 NEQTVKY (50-56) AKASTVPKGASVKE (87-100)
[0153] In this way, amino acid positions were selected, which define an optimal sequence region for the exchange of elements responsible for sequence specificity between enzymes.
Example 9
The Method for Exchanging Structural Elements Between Wild Type Mini-III RNases
[0154] Recombinant plasmids used for overproduction of particular enzymes (FpMiniIII, CtMiniIII, BsMiniIII, and SpMiniIII) were amplified in PCR so as to obtain a product comprising the whole plasmid used as a template with the omission of a short fragment of the sequence encoding the structure element to be exchanged (transplanted). Sequences of used primers are given in Table 12.
TABLE-US-00028 TABLE 12 Sequences of primers used for the construction of particular chimeric proteins. Each pair of primers shown in the table was used in separate PCR reaction. Primer Pair Primer Sequence SEQ ID NO: CtR1 CtR1Up GCTTCATAAGCGCTCCATTGCT 77 CtR1Dw AGCAATGGAGCGCTTATGAAGC 78 CtR2 CtR2Up CAATGCCAAATCGGCCACGGTTCCGAAAAATG 79 CtR2Dw ATCCGTAATATCCGCATTTTTCGGAAC 80 FpR1 FpR1Up ATGCAGAAAAAGTTAAA 81 FpR1Dw TTTAACTTTTTCTGCAT 82 FpR2 FpR2Up CGTCAAAAGCAAGCGTTGCAAAACATG 83 FpR2Dw TTCTTCCGGACTTGCATGTTTTGCAAC 84 CpR1 CpR1f TATGTCAAAGCAAAGGCAC 85 CpR1r TCAGAACATGTACCGGTACG 86 CpR2 CpR2f TACAGGTATGCTACCGGTTTTGAGTCTTTG 87 CpR2r CGTTCCTTCCCCTGCGGAC 88 FpR FpR1f TACGTTAGCGCCAAAG 89 FpR1r TTACCTGCGCTCAGAC 90 FpR2 FpR2f TATCGTGCAAGCACCGGTTTTG 91 FpR2r CGACCACGTTTAAAAACTGCCAGTTC 92 BsR1 BsR1f TATGTTTCAGCAAAGTCACA 93 BsR1r TCAGATCATTTGGTTTGGTAAAG 94 BsR2 BsR2f TACCGCTACAGTACAGC 95 BsR2r CGTTTCTGCCTCTTTTCAGC 96 SeR1 SeR1f TACGTTTCAGCGAAAAGTC 97 SeR1r TCAGACGATGAGGTTTACTTTGTAATTTTAG 98 SeR2 SeR2f TATCGTAAAAGTTCAGCGTTAG 99 SeR2r CGTTACGTCCTCGTTTTAAAAC 100 ET ET-long GTCCGGCGTAGAGGATCG 101 ET-reverse TCCCATTCGCCAATCC 102
[0155] PCR was performed using Pfu polymerase. Reaction products were treated with phage T4 polynucleotide kinase in the presence of 1 mM ATP in order to phosphorylate DNA 5-ends, and subsequently, they were combined with synthetic double-stranded oligonucleotides comprising a sequence encoding the exchanged element derived from a different microorganism (Table 10). In the case of sequences encoding 5b-6 loop, the insert was obtained by filling in 3-ends of the hybrid resulting from the renaturation of two oligonucleotides with partly complementary sequences (Table 11).
[0156] Ligation was conducted at room temperature for 1 hour in the presence of 5% PEG 4000 and 5 units of phage T4 DNA ligase. Ligation products were used to transform E. coli Top 10 strain, and then the selection was performed as described in Example 1. The material from single colonies was used in PCR using Taq polymerase and ET-long and ET-reverse primers (Table 12) which amplified the whole insert. Amplification product was subjected to sequencing which enabled the selection of clones with desired insert orientation in relation to vector sequence. Obtained chimeric proteins are listed in the table (Table 13).
TABLE-US-00029 TABLE 13 The origin of particular structural elements in produced chimeric proteins. Donor Donor of of Amino Acid Nucleotide Chimeric Transplantable Transplantable Sequence SEQ Sequence Protein Acceptor Part 4 Helix 5b-6 Loop ID NO: SEQ ID NO: Ct(FpH) CtMiniIII FpMiniIII 18 19 Ct(FpL) CtMiniIII FpMiniIII 20 21 Ct(FpHL) CtMiniIII FpMiniIII FpMiniIII 22 23 Bs(FpH) BsMiniIII FpMiniIII 24 25 Bs(FpL) BsMiniIII FpMiniIII 26 27 Se(FpH) SeMiniIII FpMiniIII 28 29
[0157] In this way, the effective method for exchanging structural elements involved in the target sequence selection by Mini-III RNases has been developed and employed.
Example 10
[0158] Expression and Purification of Mini-III RNase Protein Variants with Exchanged Structural Elements, and Analysis of the Sequence Preference Thereof
[0159] Overexpression and purification of Mini-III RNase chimeric proteins was performed as described in Example 2, wherein E. coli BL21(DE3) strain was transformed with plasmid carrying genes encoding Mini-III chimaeras. The next step was to measure the initial rate of cleaving the substrates selected from pUC910S substitution variants. The kinetics measurement for the cleavage of these substrates was performed as described in Example 8. The results are shown in
[0160] In this way, we have demonstrated the effectiveness of the method for exchanging transplantable 4 helix and/or transplantable 5b-6 loop as a method for obtaining enzymes with changed/increased catalytic activity, and/or changed sequence preference.
SEQUENCE LISTING
[0161] SEQ ID NO 1 amino acid sequence of BsMiniIII.sup.wt RNase from Bacillus subtilis; [0162] SEQ ID NO 2-amino acid sequence of CkMiniIII.sup.wt RNase from Caldicellulosiruptor kristjanssonii; [0163] SEQ ID NO 3-nucleotide sequence of CkMiniIII.sup.wt RNase from Caldicellulosiruptor kristjanssonii; [0164] SEQ ID NO 4-amino acid sequence of CrMiniIII.sup.wt RNase from Clostridium ramosum; [0165] SEQ ID NO 5-nucleotide sequence of CrMiniIII.sup.wt RNase from Clostridium ramosum; [0166] SEQ ID NO 6-amino acid sequence of CtMiniIII.sup.wt RNase from Clostridium thermocellum; [0167] SEQ ID NO 7-nucleotide sequence of CtMiniIII.sup.wt RNase from Clostridium thermocellum; [0168] SEQ ID NO 8-amino acid sequence of FpMiniIII.sup.wt RNase from Faecalibacterium prausnitzii; [0169] SEQ ID NO 9-nucleotide sequence of FpMiniIII.sup.wt RNase from Faecalibacterium prausnitzii; [0170] SEQ ID NO 10-amino acid sequence of FnMiniIII.sup.wt RNase from Fusobacterium nucleatum subsp. Nucleaturn; [0171] SEQ ID NO 11-nucleotide sequence of FnMiniIII.sup.wt RNase from Fusobacterium nucleatum subsp. Nucleaturn; [0172] SEQ ID NO 12-amino acid sequence of SeMiniIII.sup.wt RNase from Staphylococcus epidermidis; [0173] SEQ ID NO 13-nucleotide sequence of SeMiniIII.sup.wt RNase from Staphylococcus epidermidis; [0174] SEQ ID NO 14-amino acid sequence of TmMiniIII.sup.wt RNase from Thermotoga maritima; [0175] SEQ ID NO 15-nucleotide sequence of TmMiniIII.sup.wt RNase from Thermotoga maritima; [0176] SEQ ID NO 16-amino acid sequence of TtMiniIII.sup.wt RNase from Thermoanaerobacter tengcongensis, presently Caldanaerobacter subterraneus subsp. Tengcongensis; [0177] SEQ ID NO 17-nucleotide sequence of TtMiniIII.sup.wt RNase from Thermoanaerobacter tengcongensis, presently Caldanaerobacter subterraneus subsp. Tengcongensis; [0178] SEQ ID NO 18-amino acid sequence of chimeric protein-Ct(FpH); [0179] SEQ ID NO 19-nucleotide sequence of chimeric protein-Ct(FpH); [0180] SEQ ID NO 20-amino acid sequence of chimeric protein-Ct(FpL); [0181] SEQ ID NO 21-nucleotide sequence of chimeric protein-Ct(FpL); [0182] SEQ ID NO 22-amino acid sequence of chimeric protein-Ct(FpHL); [0183] SEQ ID NO 23-nucleotide sequence of chimeric protein-Ct(FpHL); [0184] SEQ ID NO 24-amino acid sequence of chimeric protein-Bs(FpH); [0185] SEQ ID NO 25-nucleotide sequence of chimeric protein-Bs(FpH); [0186] SEQ ID NO 26-amino acid sequence of chimeric protein-Bs(FpL); [0187] SEQ ID NO 27-nucleotide sequence of chimeric protein-Bs(FpL); [0188] SEQ ID NO 28-amino acid sequence of chimeric protein-Se(FpH); [0189] SEQ ID NO 29-nucleotide sequence of chimeric protein-Se(FpH); [0190] SEQ ID NO from 29 to 102-meaning provided in the description; [0191] SEQ ID NO 103-nucleotide sequence of a fragment from one of the substrates (910S), being a fragment of bacteriophage phi6 (6) genome, within which dsRNA cleavage occurs.
TABLE-US-00030 SEQUENCE LISTING <110> MIBMIK <120> Methods for changing sequence specificity of Mini-III RNases <130> PZ/3534/AGR/PCT <160> 103 <170> PatentIn version 3.5 <210> 1 <211> 143 <212> PRT <213> Bacillus subtilis <400> 1 Met Leu Glu Phe Asp Thr Ile Lys Asp Ser Lys Gln Leu Asn Gly Leu 151015 Ala Leu Ala Tyr Ile Gly Asp Ala Ile Phe Glu Val Tyr Val Arg His 202530 His Leu Leu Lys Gln Gly Phe Thr Lys Pro Asn Asp Leu His Lys Lys 354045 Ser Ser Arg Ile Val Ser Ala Lys Ser Gln Ala Glu Ile Leu Phe Phe 505560 Leu Gln Asn Gln Ser Phe Phe Thr Glu Glu Glu Glu Ala Val Leu Lys 65707580 Arg Gly Arg Asn Ala Lys Ser Gly Thr Thr Pro Lys Asn Thr Asp Val 859095 Gln Thr Tyr Arg Tyr Ser Thr Ala Phe Glu Ala Leu Leu Gly Tyr Leu 100105110 Phe Leu Glu Lys Lys Glu Glu Arg Leu Ser Gln Leu Val Ala Glu Ala 115120125 Ile Gln Phe Gly Thr Ser Gly Arg Lys Thr Asn Glu Ser Ala Thr 130135140 <210> 2 <211> 132 <212> PRT <213> Caldicellulosiruptor kristjanssonii <400> 2 Met Leu Ser Pro Leu Val Tyr Ala Tyr Ile Gly Asp Ala Val Tyr Glu 151015 Leu Phe Val Arg Asn Lys Ile Ile Ala Glu Asn Pro Asp Leu Thr Pro 202530 Tyr Leu Tyr Tyr Leu Arg Thr Thr Met Tyr Val Lys Ala Ser Ser Gln 354045 Ala Met Ala Ile Lys Lys Leu Tyr Glu Glu Leu Asp Glu Asp Glu Lys 505560 Arg Ile Val Lys Arg Gly Arg Asn Ala Lys Pro Lys Thr Ile Pro Arg 65707580 Asn Ala Lys Leu Ser Asp Tyr Lys Tyr Ala Thr Ala Leu Glu Ala Leu 859095 Ile Gly Tyr Leu Tyr Leu Ala Asn Asn Ile Glu Arg Leu Asn Tyr Ile 100105110 Leu Ser Gln Thr Tyr Asp Ile Ile Thr Glu Glu Tyr Ser Asn Ala Lys 115120125 Asn Ser Cys Gln 130 <210> 3 <211> 399 <212> DNA <213> Caldicellulosiruptor kristjanssonii <400> 3 atgcttagtc ctttagtata tgcttatatt ggagatgcag tatatgagtt gtttgtaaga 60 aacaaaataa tagctgaaaa tccagatttg accccctacc tatactatct tagaactact 120 atgtatgtaa aagcttcgag tcaagcaatg gctataaaaa aattatatga agagcttgat 180 gaagatgaaa aaagaattgt aaagagaggc agaaatgcaa aaccaaaaac cattcccaga 240 aatgccaagt tgagtgatta taaatatgcc acggcccttg aggcactaat tggttatctt 300 tatttagcaa ataacattga gagattaaat tatattcttt cacaaacgta tgatataata 360 actgaagaat acagcaatgc caagaatagc tgtcaataa 399 <210> 4 <211> 125 <212> PRT <213> Clostridium ramosum <400> 4 Met Gly Pro Glu Leu Ile Asn Ala Ser Val Leu Ala Tyr Leu Gly Asp 151015 Ser Ile Phe Glu Val Leu Val Arg Asp Tyr Leu Val Lys Glu Ser Gly 202530 Phe Val Lys Pro Asn Asp Leu Gln Arg Glu Ala Val Lys Tyr Val Ser 354045 Ala Ser Ser His Ala Ala Phe Met His Asp Met Leu Asp Glu Glu Phe 505560 Phe Ser Ala Asp Glu Val Gly Thr Tyr Lys Arg Gly Arg Asn Thr Lys 65707580 Gly Ser Lys Asn Glu Ser Leu Asp His Met His Ser Thr Gly Phe Glu 859095 Ala Val Ile Gly Thr Leu Tyr Leu Glu Glu Asn Phe Asp Arg Ile Lys 100105110 Val Ile Phe Glu Arg Tyr Lys Gln Tyr Ile Asn Asn Lys 115120125 <210> 5 <211> 378 <212> DNA <213> Clostridium ramosum <400> 5 atgggccctg aactgattaa tgcaagcgtt ctggcatatc tgggtgatag catttttgaa 60 gttctggtgc gtgattatct ggtgaaagaa agcggttttg tgaaaccgaa tgatctgcag 120 cgtgaagccg ttaaatatgt tagcgcaagc agccatgcag catttatgca tgatatgctg 180 gatgaagaat ttttcagcgc agatgaagtt ggcacctata aacgtggtcg taataccaaa 240 ggtagcaaaa atgaaagcct ggatcatatg catagcaccg gttttgaagc agttattggc 300 accctgtatc tggaagaaaa tttcgatcgc atcaaagtga tcttcgagcg ctataaacag 360 tacatcaaca acaaataa 378 <210> 6 <211> 140 <212> PRT <213> Clostridium thermocellum <400> 6 Met Val Trp Glu Phe Phe Asp Lys Ile Thr Gly Glu Phe Asn Tyr Lys 151015 Pro Asp Glu Val Ser Gln Leu Ser Pro Leu Val Leu Ala Tyr Ile Gly 202530 Asp Ala Val Tyr Glu Val Phe Ile Arg Thr Met Leu Val Ser Gly Gly 354045 Asn Val Pro Val His Val Leu His Lys Arg Ser Ile Ala Tyr Val Lys 505560 Ala Lys Ala Gln Ser Asp Ile Val His Arg Ile Met Pro Leu Leu Thr 65707580 Glu Glu Glu Leu Asn Ile Val Arg Arg Gly Arg Asn Ala Lys Ser Ala 859095 Thr Val Pro Lys Asn Ala Asp Ile Thr Asp Tyr Arg Tyr Ala Thr Gly 100105110 Phe Glu Ser Leu Leu Gly Phe Leu Tyr Leu Lys Lys Asp Tyr Asp Arg 115120125 Leu Met Asp Ile Leu Arg Met Ala Val Ser Gln Asn 130135140 <210> 7 <211> 423 <212> DNA <213> Clostridium thermocellum <400> 7 atggtttggg aattttttga caaaattaca ggtgagttta attacaaacc ggatgaagta 60 agccaactgt cgcctttagt gcttgcatac ataggtgacg ccgtgtatga ggttttcatc 120 cgtacaatgc ttgtgtccgg aggaaacgta ccggtacatg ttctccataa gcgctccatt 180 gcttatgtca aagcaaaggc acagtcggat attgtccaca ggataatgcc tttgctgacg 240 gaggaggagc ttaatattgt ccgcagggga aggaacgcca aatcggccac ggttccgaaa 300 aatgcggata ttacggatta caggtatgct accggttttg agtctttgtt gggttttctt 360 tatttgaaaa aagattatga ccgattgatg gatatattgc gaatggctgt ttcacagaat 420 tga 423 <210> 8 <211> 134 <212> PRT <213> Faecalibacterium prausnitzii <400> 8 Met Asn Glu Ser Glu Lys Ile Asp Pro Arg Glu Leu Ser Pro Leu Ala 151015 Leu Ala Phe Val Gly Asp Ser Val Leu Glu Leu Leu Val Arg Gln Arg 202530 Leu Val Glu His His Arg Leu Ser Ala Gly Lys Leu Asn Ala Glu Lys 354045 Val Lys Tyr Val Ser Ala Lys Ala Gln Phe Arg Glu Glu Gln Leu Leu 505560 Glu Pro Leu Phe Thr Glu Asp Glu Leu Ala Val Phe Lys Arg Gly Arg 65707580 Asn Ala Ser Lys Ala Ser Val Ala Lys His Ala Ser Pro Glu Glu Tyr 859095 Arg Ala Ser Thr Gly Phe Glu Cys Leu Leu Gly Trp Leu Tyr Leu Asn 100105110 Gly Gln Leu Glu Arg Val His Gln Leu Phe Glu Val Leu Trp Gln Gln 115120125 Phe Asp Pro Asp Gln Lys 130 <210> 9 <211> 405 <212> DNA <213> Faecalibacterium prausnitzii <400> 9 atgaatgaaa gcgaaaaaat tgatccgcgt gaactgagtc cgctggcact ggcatttgtt 60 ggtgatagcg ttctggaact gctggttcgt cagcgtctgg ttgaacatca tcgtctgagc 120 gcaggtaaac tgaatgcaga aaaagttaaa tacgttagcg ccaaagcaca gtttcgtgaa 180 gaacagctgc tggaaccgct gtttaccgaa gatgaactgg cagtttttaa acgtggtcgt 240 aatgcaagca aagcaagcgt tgcaaaacat gcaagtccgg aagaatatcg tgcaagcacc 300 ggttttgaat gtctgctggg ttggctgtat ctgaatggtc agctggaacg tgttcatcag 360 ctgtttgaag ttctgtggca gcagtttgat cctgatcaga aataa 405 <210> 10 <211> 129 <212> PRT <213> Fusobacterium nucleatum subsp. nucleatum <400> 10 Met Asp Asn Val Asp Phe Ser Lys Asp Ile Arg Asp Tyr Ser Gly Leu 151015 Glu Leu Ala Phe Leu Gly Asp Ala Ile Trp Glu Leu Glu Ile Arg Lys 202530 Tyr Tyr Leu Gln Phe Gly Tyr Asn Ile Pro Thr Leu Asn Lys Tyr Val 354045 Lys Ala Lys Val Asn Ala Lys Tyr Gln Ser Leu Ile Tyr Lys Lys Ile 505560 Ile Asn Asp Leu Asp Glu Glu Phe Lys Val Ile Gly Lys Arg Ala Lys 65707580 Asn Ser Asn Ile Lys Thr Phe Pro Arg Ser Cys Thr Val Met Glu Tyr 859095 Lys Glu Ala Thr Ala Leu Glu Ala Ile Ile Gly Ala Met Tyr Leu Leu 100105110 Lys Lys Glu Glu Glu Ile Lys Lys Ile Ile Asn Ile Val Ile Lys Gly 115120125 Glu <210> 11 <211> 390 <212> DNA <213> Fusobacterium nucleatum subsp. nucleatum <400> 11 atggacaatg tagatttttc aaaggatata agagattaca gtggactgga attagcattt 60 ttaggagatg ctatttggga actggaaata agaaaatatt acttacaatt tggctataat 120 attcctactt taaataaata tgttaaagct aaggtaaatg caaaatatca aagtctgatt 180 tataagaaaa ttataaatga tttagatgaa gaatttaaag ttataggaaa aagagctaaa 240 aatagtaaca taaaaacttt tccaaggagt tgtacagtga tggaatataa ggaagcgaca 300 gccttagaag ctattatcgg agcaatgtat ttgttaaaaa aagaagaaga aataaaaaaa 360 attataaata tagttataaa gggagaatga 390 <210> 12 <211> 132 <212> PRT <213> Staphylococcus epidermidis <400> 12 Met Ala Lys His Met Asn Val Lys Leu Leu Asn Pro Leu Thr Leu Ala 151015 Tyr Met Gly Asp Ala Val Leu Asp Gln His Val Arg Glu Tyr Ile Val 202530 Leu Lys Leu Gln Ser Lys Pro His Arg Leu His Gln Val Ser Lys Ser 354045 Tyr Val Ser Ala Lys Ser Gln Ala Lys Thr Leu Glu Tyr Leu Leu Asp 505560 Ile Asp Trp Phe Thr Glu Glu Glu Leu Ser Val Leu Lys Arg Gly Arg 65707580 Asn Ala Lys Ser Tyr Thr Lys Ala Lys Asn Thr Asp Ile Gln Thr Tyr 859095 Arg Lys Ser Ser Ala Leu Glu Ala Val Ile Gly Phe Leu Tyr Leu Asp 100105110 His Gln Ser Glu Arg Leu Glu Asn Leu Leu Glu Thr Ile Val Arg Ile 115120125 Val Asp Glu Arg 130 <210> 13 <211> 399 <212> DNA <213> Staphylococcus epidermidis <400> 13 atggctaaac atatgaacgt aaaacttctt aatcctttaa cattggcata tatgggtgat 60 gcagtacttg atcaacatgt gcgtgaatat atcgtgctaa aattacaaag taaacctcat 120 cgtttgcacc aagtatcgaa aagttacgtt tcagcgaaaa gtcaagctaa gactttagag 180 tatttgttag atattgactg gtttacagag gaagagctaa gtgttttaaa acgaggacgt 240 aacgctaaaa gttatacaaa agctaaaaat actgacattc aaacttatcg taaaagttca 300 gcgttagaag ctgttatcgg atttttatat ttagaccatc aatcagaacg attagaaaac 360 ttattagaaa caattgttag gatagtggat gaaaggtaa 399 <210> 14 <211> 140 <212> PRT <213> Thermotoga maritima <400> 14 Met Glu Lys Leu Phe Arg Phe Glu Ala Glu Pro Glu Lys Leu Pro Pro 151015 Ala Val Leu Ala Tyr Leu Gly Asp Ala Val Leu Glu Leu Ile Phe Arg 202530 Ser Arg Phe Thr Gly Asp Tyr Arg Met Ser Val Ile His Glu Arg Val 354045 Lys Glu His Thr Ser Lys His Gly Gln Ala Trp Met Leu Glu Asn Ile 505560 Trp Asn Leu Leu Asp Glu Arg Glu Gln Glu Ile Val Lys Arg Ala Met 65707580 Asn Ser Lys Ala Ala Lys Arg His Gly Asn Asp Pro Thr Tyr Arg Lys 859095 Ser Thr Gly Phe Glu Ala Leu Ile Gly Tyr Leu Phe Leu Lys Arg Glu 100105110 Phe Asp Arg Ile Glu Glu Leu Leu Arg Val Val Met Asp Leu Glu Ser 115120125 Leu Arg Lys Lys Asn Pro Gly Gly Ser Ala Gln Glu 130135140 <210> 15 <211> 423 <212> DNA <213> Thermotoga maritima <400> 15 atggaaaaac tcttcagatt cgaagcagaa ccggagaaac tgccaccggc cgttctagcg 60 tatctgggag atgccgttct ggagctcatc ttcagatcga gattcacagg agattacaga 120 atgtccgtca tacacgagag ggtcaaggaa cacacctcga aacacggtca ggcatggatg 180 ctggagaata tatggaatct cctcgacgaa agagagcaag aaatagttaa aagagcgatg 240 aattcgaagg cagcgaaaag acacgggaac gaccctacat acagaaagag caccggtttc 300 gaagctttga tcgggtatct attcttgaaa agagaattcg acagaattga agaactgctt 360 cgggtggtga tggatcttga gagtctacgg aagaaaaatc ctggaggaag cgctcaggaa 420 taa 423 <210> 16 <211> 136 <212> PRT <213> Thermoanaerobacter tengcongensis <400> 16 Met Glu Lys Asp Lys Met Ile Leu Val Lys Glu Lys Gly Val Leu Asp 151015 Leu Ser Pro Leu Val Leu Ala Phe Ile Gly Asp Ala Val Tyr Ser Leu 202530 Tyr Val Arg Thr Lys Ile Val Glu Lys Gly Asn Met Lys Leu Ala His 354045 Leu Asn Glu Gln Thr Val Lys Tyr Val Lys Ala Ser Ser Gln Ala Arg 505560 Ser Leu Glu Arg Ile Tyr Asp Leu Leu Thr Glu Glu Glu Lys Glu Ile 65707580 Val Arg Arg Gly Arg Asn Ala Lys Ala Ser Thr Val Pro Lys Gly Ala 859095 Ser Val Lys Glu Tyr Lys Tyr Ala Thr Ala Phe Glu Ala Leu Val Gly 100105110 Tyr Leu Tyr Leu Leu Glu Arg Phe Asp Arg Leu Tyr Phe Leu Leu Ser 115120125 Leu Ser Met Glu Tyr Thr Glu Glu 130135 <210> 17 <211> 477 <212> DNA <213> Thermoanaerobacter tengcongensis <400> 17 atgggcagca gccatcatca tcatcatcac agcagcggcc tggaagttct gttccagggg 60 ccccatatgg aaaaggataa gatgattctt gtaaaggaaa agggggtttt agacttatcc 120 ccccttgttt tggctttcat tggagatgcg gtttacagcc tttatgtcag aactaagatt 180 gtggagaaag ggaatatgaa attggctcat ttaaatgagc aaactgtgaa gtacgttaag 240 gcatcttcac aggctaggtc tcttgagcga atttacgacc ttctcactga agaagaaaag 300 gaaattgtga gaaggggaag aaatgccaaa gcttctacag ttccaaaagg agcaagtgtt 360 aaagagtata agtatgccac tgcctttgaa gcattagtgg gatatttgta ccttttagaa 420 agatttgata ggctttactt tcttttgagc ctttctatgg aatacacgga agaatga 477 <210> 18 <211> 140 <212> PRT <213> artificial <220> <223> AA sequence of chimeric protein Ct(FpH) <400> 18 Met Val Trp Glu Phe Phe Asp Lys Ile Thr Gly Glu Phe Asn Tyr Lys 151015 Pro Asp Glu Val Ser Gln Leu Ser Pro Leu Val Leu Ala Tyr Ile Gly 202530 Asp Ala Val Tyr Glu Val Phe Ile Arg Thr Met Leu Val Ser Gly Gly 354045 Asn Val Pro Val His Val Leu Asn Ala Glu Lys Val Lys Tyr Val Lys 505560 Ala Lys Ala Gln Ser Asp Ile Val His Arg Ile Met Pro Leu Leu Thr 65707580 Glu Glu Glu Leu Asn Ile Val Arg Arg Gly Arg Asn Ala Lys Ser Ala 859095 Thr Val Pro Lys Asn Ala Asp Ile Thr Asp Tyr Arg Tyr Ala Thr Gly 100105110 Phe Glu Ser Leu Leu Gly Phe Leu Tyr Leu Lys Lys Asp Tyr Asp Arg 115120125 Leu Met Asp Ile Leu Arg Met Ala Val Ser Gln Asn 130135140 <210> 19 <211> 423 <212> DNA <213> artificial <220> <223> NA sequence of chimeric protein Ct(FpH) <400> 19 atggtttggg aattttttga caaaattaca ggtgagttta attacaaacc ggatgaagta 60 agccaactgt cgcctttagt gcttgcatac ataggtgacg ccgtgtatga ggttttcatc 120 cgtacaatgc ttgtgtccgg aggaaacgta ccggtacatg ttctgaatgc agaaaaagtt 180 aaatatgtca aagcaaaggc acagtcggat attgtccaca ggataatgcc tttgctgacg 240 gaggaggagc ttaatattgt ccgcagggga aggaacgcca aatcggccac ggttccgaaa 300 aatgcggata ttacggatta caggtatgct accggttttg agtctttgtt gggttttctt 360 tatttgaaaa aagattatga ccgattgatg gatatattgc gaatggctgt ttcacagaat 420 taa 423 <210> 20 <211> 140 <212> PRT <213> artificial <220> <223> AA sequence of chimeric protein Ct(FpL) <400> 20 Met Val Trp Glu Phe Phe Asp Lys Ile Thr Gly Glu Phe Asn Tyr Lys 151015 Pro Asp Glu Val Ser Gln Leu Ser Pro Leu Val Leu Ala Tyr Ile Gly 202530 Asp Ala Val Tyr Glu Val Phe Ile Arg Thr Met Leu Val Ser Gly Gly 354045 Asn Val Pro Val His Val Leu His Lys Arg Ser Ile Ala Tyr Val Lys 505560 Ala Lys Ala Gln Ser Asp Ile Val His Arg Ile Met Pro Leu Leu Thr 65707580 Glu Glu Glu Leu Asn Ile Val Arg Arg Gly Arg Asn Ala Ser Lys Ala 859095 Ser Val Ala Lys His Ala Ser Pro Glu Glu Tyr Arg Tyr Ala Thr Gly 100105110 Phe Glu Ser Leu Leu Gly Phe Leu Tyr Leu Lys Lys Asp Tyr Asp Arg 115120125 Leu Met Asp Ile Leu Arg Met Ala Val Ser Gln Asn 130135140 <210> 21 <211> 423 <212> DNA <213> artificial <220> <223> NA sequence of chimeric protein Ct(FpL) <400> 21 atggtttggg aattttttga caaaattaca ggtgagttta attacaaacc ggatgaagta 60 agccaactgt cgcctttagt gcttgcatac ataggtgacg ccgtgtatga ggttttcatc 120 cgtacaatgc ttgtgtccgg aggaaacgta ccggtacatg ttctccataa gcgctccatt 180 gcttatgtca aagcaaaggc acagtcggat attgtccaca ggataatgcc tttgctgacg 240 gaggaggagc ttaatattgt ccgcagggga aggaacgcgt caaaagcaag cgttgcaaaa 300 catgcaagtc cggaagaata caggtatgct accggttttg agtctttgtt gggttttctt 360 tatttgaaaa aagattatga ccgattgatg gatatattgc gaatggctgt ttcacagaat 420 taa 423 <210> 22 <211> 140 <212> PRT <213> artificial <220> <223> AA sequence of chimeric protein Ct(FpHL) <400> 22 Met Val Trp Glu Phe Phe Asp Lys Ile Thr Gly Glu Phe Asn Tyr Lys 151015 Pro Asp Glu Val Ser Gln Leu Ser Pro Leu Val Leu Ala Tyr Ile Gly 202530 Asp Ala Val Tyr Glu Val Phe Ile Arg Thr Met Leu Val Ser Gly Gly 354045 Asn Val Pro Val His Val Leu Asn Ala Glu Lys Val Lys Tyr Val Lys 505560 Ala Lys Ala Gln Ser Asp Ile Val His Arg Ile Met Pro Leu Leu Thr 65707580 Glu Glu Glu Leu Asn Ile Val Arg Arg Gly Arg Asn Ala Ser Lys Ala 859095 Ser Val Ala Lys His Ala Ser Pro Glu Glu Tyr Arg Tyr Ala Thr Gly 100105110 Phe Glu Ser Leu Leu Gly Phe Leu Tyr Leu Lys Lys Asp Tyr Asp Arg 115120125 Leu Met Asp Ile Leu Arg Met Ala Val Ser Gln Asn 130135140 <210> 23 <211> 422 <212> DNA <213> artificial <220> <223> NA sequence of chimeric protein Ct(FpHL) <400> 23 atggtttggg aattttttga caaaattaca ggtgagttta attacaaacc ggatgaagta 60 agccaactgt cgcctttagt gcttgcatac ataggtgacg ccgtgtatga ggttttcatc 120 cgtacaatgc ttgtgtccgg aggaaacgta ccggtacatg ttctgaatgc agaaaaagtt 180 aaatatgtca aagcaaaggc acagtcggat attgtccaca ggataatgcc tttgctgacg 240 gaggaggagc ttaatattgt ccgcagggga aggaacgcgt caaaagcaag cgttgcaaaa 300 catgcaagtc cggaagaata caggtatgct accggttttg agtctttgtt gggttttctt 360 tatttgaaaa aagattatga ccgattgatg gatatattgc gaatggctgt ttcacagaat 420 ta 422 <210> 24 <211> 141 <212> PRT <213> artificial <220> <223> AA sequence of chimeric protein Bs(FpH) <400> 24 Met Val Glu Phe Asp Thr Ile Lys Asp Ser Lys Gln Leu Asn Gly Leu 151015 Ala Leu Ala Tyr Ile Gly Asp Ala Ile Phe Glu Val Tyr Val Arg His 202530 His Leu Leu Lys Gln Gly Phe Thr Lys Pro Asn Asp Leu Asn Ala Glu 354045 Lys Tyr Val Ser Ala Lys Ser Gln Ala Glu Ile Leu Phe Phe Leu Gln 505560 Asn Gln Ser Phe Phe Thr Glu Glu Glu Glu Ala Val Leu Lys Arg Gly 65707580 Arg Asn Ala Lys Ser Gly Thr Thr Pro Lys Asn Thr Asp Val Gln Thr 859095 Tyr Arg Tyr Ser Thr Ala Phe Glu Ala Leu Leu Gly Tyr Leu Phe Leu 100105110 Glu Lys Lys Glu Glu Arg Leu Ser Gln Leu Val Ala Glu Ala Ile Gln 115120125 Phe Gly Thr Ser Gly Arg Lys Thr Asn Glu Ser Ala Thr 130135140 <210> 25 <211> 426 <212> DNA <213> artificial <220> <223> NA sequence of chimeric protein Bs(FpH) <400> 25 atggttgaat ttgatacgat aaaagattct aagcagctta acggtcttgc gcttgcttat 60 ataggtgatg ccatttttga agtgtatgtc aggcatcacc tgcttaagca gggctttacc 120 aaaccaaatg atctgaatgc agaaaaatat gtttcagcaa agtcacaggc tgagatccta 180 ttttttctgc agaatcaatc attttttacg gaagaagagg aagcggtgct gaaaagaggc 240 agaaatgcca agtcagggac aacacctaaa aatacagatg ttcagacgta ccgctacagt 300 acagcatttg aagcgcttct gggctacctt tttctagaga aaaaagagga acgacttagt 360 cagctcgtag ccgaagctat acaattcggg acgtcaggga ggaaaacaaa tgagtcagca 420 acataa 426 <210> 26 <211> 143 <212> PRT <213> artificial <220> <223> AA sequence of chimeric protein Bs(FpL) <400> 26 Met Val Glu Phe Asp Thr Ile Lys Asp Ser Lys Gln Leu Asn Gly Leu 151015 Ala Leu Ala Tyr Ile Gly Asp Ala Ile Phe Glu Val Tyr Val Arg His 202530 His Leu Leu Lys Gln Gly Phe Thr Lys Pro Asn Asp Leu His Lys Lys 354045 Ser Ser Arg Ile Val Ser Ala Lys Ser Gln Ala Glu Ile Leu Phe Phe 505560 Leu Gln Asn Gln Ser Phe Phe Thr Glu Glu Glu Glu Ala Val Leu Lys 65707580 Arg Gly Arg Asn Ala Ser Lys Ala Ser Val Ala Lys His Ala Ser Pro 859095 Glu Glu Tyr Arg Tyr Ser Thr Ala Phe Glu Ala Leu Leu Gly Tyr Leu 100105110 Phe Leu Glu Lys Lys Glu Glu Arg Leu Ser Gln Leu Val Ala Glu Ala 115120125 Ile Gln Phe Gly Thr Ser Gly Arg Lys Thr Asn Glu Ser Ala Thr 130135140 <210> 27 <211> 432 <212> DNA <213> artificial <220> <223> NA sequence of chimeric protein Bs(FpL) <400> 27 atggttgaat ttgatacgat aaaagattct aagcagctta acggtcttgc gcttgcttat 60 ataggtgatg ccatttttga agtgtatgtc aggcatcacc tgcttaagca gggctttacc 120 aaaccaaatg atcttcataa gaaatcaagc cggattgttt cagcaaagtc acaggctgag 180 atcctatttt ttctgcagaa tcaatcattt tttacggaag aagaggaagc ggtgctgaaa 240 agaggcagaa acgcgtcaaa agcaagcgtt gcaaaacatg caagtccgga agaataccgc 300 tacagtacag catttgaagc gcttctgggc tacctttttc tagagaaaaa agaggaacga 360 cttagtcagc tcgtagccga agctatacaa ttcgggacgt cagggaggaa aacaaatgag 420 tcagcaacat aa 432 <210> 28 <211> 131 <212> PRT <213> artificial <220> <223> AA sequence of chimeric protein Se(FpH) <400> 28 Met Val Ala Lys His Met Asn Val Lys Leu Leu Asn Pro Leu Thr Leu 151015 Ala Tyr Met Gly Asp Ala Val Leu Asp Gln His Val Arg Glu Tyr Ile 202530 Val Leu Lys Leu Gln Ser Lys Pro His Arg Leu Asn Ala Glu Lys Tyr 354045 Val Ser Ala Lys Ser Gln Ala Lys Thr Leu Glu Tyr Leu Leu Asp Ile 505560 Asp Trp Phe Thr Glu Glu Glu Leu Ser Val Leu Lys Arg Gly Arg Asn 65707580 Ala Lys Ser Tyr Thr Lys Ala Lys Asn Thr Asp Ile Gln Thr Tyr Arg 859095 Lys Ser Ser Ala Leu Glu Ala Val Ile Gly Phe Leu Tyr Leu Asp His 100105110 Gln Ser Glu Arg Leu Glu Asn Leu Leu Glu Thr Ile Val Arg Ile Val 115120125 Asp Glu Arg 130 <210> 29 <211> 394 <212> DNA <213> artificial <220> <223> NA sequence of chimeric protein Se(FpH) <400> 29 atggtggcta aacatatgaa cgtaaaactt cttaatcctt taacattggc atatatgggt 60 gatgcagtac ttgatcaaca tgtgcgtgaa tatatcgtgc taaaattaca aagtaaacct 120 catcgtctga atgcagaaaa atacgtttca gcgaaaagtc aagctaagac tttagagtat 180 ttgttagata ttgactggtt tacagaggaa gagctaagtg ttttaaaacg aggacgtaac 240 gctaaaagtt atacaaaagc taaaaatact gacattcaaa cttatcgtaa aagttcagcg 300 ttagaagctg ttatcggatt tttatattta gaccatcaat cagaacgatt agaaaactta 360 ttagaaacaa ttgttaggat agtggatgaa ataa 394 <210> 30 <211> 27 <212> DNA <213> artificial <220> <223> Primer FckminiIII <400> 30 cctccatggt cagtccttta gtatatg 27 <210> 31 <211> 30 <212> DNA <213> artificial <220> <223> Primer RckminiIII <400> 31 cctctcgagt tattgacagc tattcttggc 30 <210> 32 <211> 28 <212> DNA <213> artificial <220> <223> Primer FcrminiIII <400> 32 ggaccatggg ccctgaactg attaatgc 28 <210> 33 <211> 30 <212> DNA <213> artificial <220> <223> Primer RcrminiIII <400> 33 ggcctcgagt tatttgttgt tgatgtactg 30 <210> 34 <211> 28 <212> DNA <213> artificial <220> <223> Primer FctminiIII <400> 34 caggcatatg gtttgggaat tttttgac 28 <210> 35 <211> 28 <212> DNA <213> artificial <220> <223> Primer RctminiIII <400> 35 gacctcgagt caattctgtg aaacagcc 28 <210> 36 <211> 27 <212> DNA <213> Artificial <220> <223> Primer FfpminiIII <400> 36 ggaccatgga cgaaagcgaa aaaattg 27 <210> 37 <211> 31 <212> DNA <213> Artificial <220> <223> Primer RfpminiIII <400> 37 gcgctcgagt tatttctgat caggatcaaa c 31 <210> 38 <211> 30 <212> DNA <213> artificial <220> <223> Primer FfnminiIII <400> 38 ccgcatatgg acaatgtaga tttttcaaag 30 <210> 39 <211> 54 <212> DNA <213> artificial <220> <223> Primer RfnminiIII <400> 39 gtgctcgagt catcattctc cctttataac tatatttata atttttttta tttc 54 <210> 40 <211> 31 <212> DNA <213> artificial <220> <223> Primer FseminiIII <400> 40 tagacatatg gcagtggcta aacatatgaa c 31 <210> 41 <211> 25 <212> DNA <213> artificial <220> <223> Primer RseminiIII <400> 41 atctcgagct acctttcatc cacta 25 <210> 42 <211> 29 <212> DNA <213> artificial <220> <223> Primer FtmminiIII <400> 42 gcttcatatg gaaaaactct tcagattcg 29 <210> 43 <211> 27 <212> DNA <213> artificial <220> <223> Primer RtmminiIII <400> 43 cttctcgagt tattcctgag cgcttcc 27 <210> 44 <211> 32 <212> DNA <213> artificial <220> <223> Primer FttminiIII <400> 44 cgcacatatg gaaaaggata agatgattct tg 32 <210> 45 <211> 32 <212> DNA <213> artificial <220> <223> Primer RttminiIII <400> 45 gctctcgagt cattcttccg tgtattccat ag 32 <210> 46 <211> 36 <212> DNA <213> artificial <220> <223> Primer UniShPreA <400> 46 agatcggaag agcgtcgtgt agggaaagag tgtaga 36 <210> 47 <211> 23 <212> DNA <213> artificial <220> <223> Primer UniShRT <400> 47 tctacactct ttccctacac gac 23 <210> 48 <211> 33 <212> DNA <213> artificial <220> <223> Primer PreA3Univ <400> 48 gatcggaaga gcacacgtct gaactccagt cac 33 <210> 49 <211> 34 <212> DNA <213> artificial <220> <223> Primer 910fT7 <400> 49 taatacgact cactataggg ctgctcgcgc gttg 34 <210> 50 <211> 31 <212> DNA <213> artificial <220> <223> Primer 910rP6 <400> 50 ggaaaaaaat cagacacaac tgacgcgatc g 31 <210> 51 <211> 41 <212> DNA <213> artificial <220> <223> Primer 949fT7 <400> 51 taatacgact cactataggg cctctctctc tggccacgat c 41 <210> 52 <211> 31 <212> DNA <213> artificial <220> <223> Primer 949rP6 <400> 52 ggaaaaaaat gccctgtaca gcaggcataa g 31 <210> 53 <211> 39 <212> DNA <213> artificial <220> <223> Primer 2021fT7 <400> 53 taatacgact cactataggg ctcctatcat ggccgttgc 39 <210> 54 <211> 30 <212> DNA <213> artificial <220> <223> Primer 2021rP6 <400> 54 ggaaaaaaac ttcgagatca gggttggacg 30 <210> 55 <211> 42 <212> DNA <213> artificial <220> <223> Primer 3292fT7 <400> 55 taatacgact cactataggg taccgcgatc aacactgtcg tc 42 <210> 56 <211> 29 <212> DNA <213> artificial <220> <223> Primer 3292rP6 <400> 56 ggaaaaaaac gaatcaggac gtctggacg 29 <210> 57 <211> 41 <212> DNA <213> artificial <220> <223> Primer 4486fT7 <400> 57 taatacgact cactataggg ctgtctcccc tcggtttcat c 41 <210> 58 <211> 28 <212> DNA <213> artificial <220> <223> Primer 4486rP6 <400> 58 ggaaaaaaat cgacagacga cagcgctg 28 <210> 59 <211> 42 <212> DNA <213> artificial <220> <223> Primer 4754fT7 <400> 59 taatacgact cactataggg ctcatcgcct cgatgaacca ag 42 <210> 60 <211> 29 <212> DNA <213> artificial <220> <223> Primer 4754rP6 <400> 60 ggaaaaaaac tactgctttc gagcggtcg 29 <210> 61 <211> 21 <212> DNA <213> artificial <220> <223> Primer WSSWf <400> 61 sswctctctc tggccacgat c 21 <210> 62 <211> 16 <212> DNA <213> artificial <220> <223> Primer WSSWr <400> 62 wttccctccc agcacg 16 <210> 63 <211> 21 <212> DNA <213> artificial <220> <223> Primer ANNTf <220> <221> misc_feature <222> (1)..(2) <223> n is a, c, g, or t <400> 63 nntctctctc tggccacgat c 21 <210> 64 <211> 16 <212> DNA <213> artificial <220> <223> Primer ANNTr <400> 64 tttccctccc agcacg 16 <210> 65 <211> 21 <212> DNA <213> artificial <220> <223> Primer NCCNf <220> <221> misc_feature <222> (3)..(3) <223> n is a, c, g, or t <400> 65 ccnctctctc tggccacgat c 21 <210> 66 <211> 16 <212> DNA <213> artificial <220> <223> Primer NCCNr <220> <221> misc_feature <222> (1)..(1) <223> n is a, c, g, or t <400> 66 nttccctccc agcacg 16 <210> 67 <211> 24 <212> DNA <213> artificial <220> <223> Primer 3T-r <400> 67 tttacctccc agcacgaccg cgac 24 <210> 68 <211> 26 <212> DNA <213> artificial <220> <223> Primer 3T-f <400> 68 cctctctctc tggccacgat cgcgtc 26 <210> 69 <211> 21 <212> DNA <213> artificial <220> <223> Primer 4C-r <400> 69 gccctcccag cacgaccgcg a 21 <210> 70 <211> 22 <212> DNA <213> artificial <220> <223> Primer 4G-r <400> 70 cccctcccag cacgaccgcg ac 22 <210> 71 <211> 19 <212> DNA <213> artificial <220> <223> Primer 4T-r <400> 71 accctcccag cacgaccgc 19 <210> 72 <211> 28 <212> DNA <213> artificial <220> <223> Primer 4-f <400> 72 aacctctctc tctggccacg atcgcgtc 28 <210> 73 <211> 28 <212> DNA <213> artificial <220> <223> Primer 11C-r <400> 73 cctccctctc tggccacgat cgcgtcag 28 <210> 74 <211> 28 <212> DNA <213> artificial <220> <223> Primer 11G-r <400> 74 cctcgctctc tggccacgat cgcgtcag 28 <210> 75 <211> 28 <212> DNA <213> artificial <220> <223> Primer 12A-r <400> 75 cctctatctc tggccacgat cgcgtcag 28 <210> 76 <211> 24 <212> DNA <213> artificial <220> <223> Primer 11/12-f <400> 76 tttccctccc agcacgaccg cgac 24 <210> 77 <211> 22 <212> DNA <213> artificial <220> <223> Primer CtR1Up <400> 77 gcttcataag cgctccattg ct 22 <210> 78 <211> 22 <212> DNA <213> artificial <220> <223> Primer CtR1Dw <400> 78 agcaatggag cgcttatgaa gc 22 <210> 79 <211> 32 <212> DNA <213> artificial <220> <223> Primer CtR2Up <400> 79 caatgccaaa tcggccacgg ttccgaaaaa tg 32 <210> 80 <211> 27 <212> DNA <213> artificial <220> <223> Primer CtR2Dw <400> 80 atccgtaata tccgcatttt tcggaac 27 <210> 81 <211> 17 <212> DNA <213> artificial <220> <223> Primer FpR1Up <400> 81 atgcagaaaa agttaaa 17 <210> 82 <211> 17 <212> DNA <213> artificial <220> <223> Primer FpR1Dw <400> 82 tttaactttt tctgcat 17 <210> 83 <211> 27 <212> DNA <213> artificial <220> <223> Primer FpR2Up <400> 83 cgtcaaaagc aagcgttgca aaacatg 27 <210> 84 <211> 27 <212> DNA <213> artificial <220> <223> Primer FpR2Dw <400> 84 ttcttccgga cttgcatgtt ttgcaac 27 <210> 85 <211> 19 <212> DNA <213> artificial <220> <223> Primer CpR1f <400> 85 tatgtcaaag caaaggcac 19 <210> 86 <211> 20 <212> DNA <213> artificial <220> <223> Primer CpR1r <400> 86 tcagaacatg taccggtacg 20 <210> 87 <211> 30 <212> DNA <213> artificial <220> <223> Primer CpR2f <400> 87 tacaggtatg ctaccggttt tgagtctttg 30 <210> 88 <211> 19 <212> DNA <213> artificial <220> <223> Primer <400> 88 cgttccttcc cctgcggac 19 <210> 89 <211> 16 <212> DNA <213> artificial <220> <223> Primer FpR1f <400> 89 tacgttagcg ccaaag 16 <210> 90 <211> 16 <212> DNA <213> artificial <220> <223> Primer FpR1r <400> 90 ttacctgcgc tcagac 16 <210> 91 <211> 22 <212> DNA <213> artificial <220> <223> Primer FpR2f <400> 91 tatcgtgcaa gcaccggttt tg 22 <210> 92 <211> 26 <212> DNA <213> artificial <220> <223> Primer FpR2r <400> 92 cgaccacgtt taaaaactgc cagttc 26 <210> 93 <211> 20 <212> DNA <213> artificial <220> <223> Primer BsR1f <400> 93 tatgtttcag caaagtcaca 20 <210> 94 <211> 23 <212> DNA <213> artificial <220> <223> Primer BsR1r <400> 94 tcagatcatt tggtttggta aag 23 <210> 95 <211> 17 <212> DNA <213> artificial <220> <223> Primer BsR2f <400> 95 taccgctaca gtacagc 17 <210> 96 <211> 20 <212> DNA <213> artificial <220> <223> Primer BsR2r <400> 96 cgtttctgcc tcttttcagc 20 <210> 97 <211> 19 <212> DNA <213> artificial <220> <223> Primer SeR1f <400> 97 tacgtttcag cgaaaagtc 19 <210> 98 <211> 31 <212> DNA <213> artificial <220> <223> Primer SeR1rf <400> 98 tcagacgatg aggtttactt tgtaatttta g 31 <210> 99 <211> 22 <212> DNA <213> artificial <220> <223> Primer SeR2f <400> 99 tatcgtaaaa gttcagcgtt ag 22 <210> 100 <211> 22 <212> DNA <213> artificial <220> <223> Primer SeR2r <400> 100 cgttacgtcc tcgttttaaa ac 22 <210> 101 <211> 18 <212> DNA <213> artificial <220> <223> Primer ET-long <400> 101 gtccggcgta gaggatcg 18 <210> 102 <211> 16 <212> DNA <213> artificial <220> <223> Primer ET-reverse <400> 102 tcccattcgc caatcc 16 <210> 103 <211> 14 <212> RNA <213> phi6 bacteriophage <400> 103 gggaaaccuc ucuc 14