CONSTRUCT OF NUCLEIC ACIDS COMPRISING A PROMOTER LINKED TO A NUCLEOTIDE SEQUENCE ENCODING THE PRECURSOR OF miRNA 319e OF V. VINÍFERA; METHOD FOR REGULATING THE EXPRESSION OF A TARGET SEQUENCE IN A TARGET CELL AND ITS USE IN POST-TRANSCRIPTIONAL GENE SILENCING OF A TARGET SEQUENCE

Abstract

A nucleic acid construct comprising a promoter operably linked to a nucleotide sequence coding for the precursor of Vitis vinifera miRNA 319e capable of generating an amiRNA hairpin structure that includes a complementary hypervariable sequence between 60-100% to a target sequence. A method of regulating the expression of a target sequence in a target cell comprising introducing the nucleic acid construct into a target cell, and using the construct in the post-transcriptional gene silencing of a target sequence in a constitutive and stable manner.

Claims

1. A nucleic acid construct comprising a promoter operatively linked to a coding nucleotide sequence, wherein the coding sequence generates the miRNA 319e precursor of Vitis vinifera.

2. The nucleic acid construct comprising a promoter operatively linked to a coding nucleotide sequence according to claim 1, wherein the construct is capable of generating an amiRNA hairpin structure that includes a hypervariable sequence complementary between 60-100% to a target sequence.

3. The nucleic acid construct comprising a promoter operably linked to a coding nucleotide sequence according to claim 1, wherein the sequence of the amiRNA hairpin structure comprises a hypervariable sequence complementary between 60-100% to a target sequence is located between nucleotides 10 to 31 and 76 to 96 of SEQ ID 1.

4. A method for regulating the expression of a target sequence in a cell, said method comprising: a) introducing a nucleic acid construct comprising a promoter operatively linked to a coding nucleotide sequence according to claim 1, wherein the sequence is linked to a transcription promoter so that the transcription of the antisense strand of the precursor is regulated; and (b) growing the target cell to which the construct was introduced according to step (a) under the appropriate conditions for the promoter to activate the antisense strand transcription of the amiRNA precursor, the amiRNA is produced, and it binds to the target RNA to cleave it.

5. The nucleic acid construct comprising a promoter operably linked to a coding nucleotide sequence according to claim 1, wherein the construct is used in the post-transcriptional gene silencing of a target sequence.

6. The nucleic acid construct comprising a promoter operably linked to a coding nucleotide sequence according to claim 1, wherein the construct is included in plants to be constitutively expressed and generate stable transgenic lines.

7. The nucleic acid construct comprising a promoter operably linked to a coding nucleotide sequence according to claim 1, wherein the construct is included as grafts on plants.

8. The nucleic acid construct comprising a promoter operably linked to a coding nucleotide sequence according to claim 1, wherein the construct is included in plants by sprinkling the construct on the plants.

9. The nucleic acid construct comprising a promoter operably linked to a coding nucleotide sequence according to claim 1, wherein the construct is included in a franca plant without grafting.

Description

DESCRIPTION OF FIGURES

[0047] FIG. 1.Vitis vinifera miR319e from Thompson seedless. A) Pre-miR319e molecule sequence. B) miRNA hairpin model expected for pre-miR319e sequence of Thompson Seedless.

[0048] FIG. 2.Artificial vvi-pre-miR319e molecules model with target sequence against GFP gene designed by the microRNAs design tool WMD3-Web MicroRNA.

[0049] FIG. 3.Two-step PCR for the design of artificial vvi-pre-miR319e against GFP gene (amiR319e-GFP). A) Design strategy of artificial vvi-pre-miR319e against GFP gene by two-step PCR using Overlapping long-primerspresented therein. B) amiR319e-GFP structures, where the dark blue areas represent the 21-nucleotide molecule amiR319e-GFP, the light blue areas represent the amiR*319e molecule of 21 nucleotides and the underlined nucleotides represent the non-modifiable residue bases.

[0050] FIG. 4.Functional evaluation of amiR-319e-GFP in transgenic plants of Nicotiana benthamiana. A) Functional analysis of the amiR319e-GFP gene in N. benthamiana plants double transformed from genomic DNA samples (left) and cDNA (right) using primers for the kanamycin resistance gene (nptII gene in GFP cassette transformation), Hygromycin resistance gene (hptII gene present in cassete transformation amiR319e-GFP) and green fluorescent protein gene (gfp gene present in GFP cassete transformation). B) Analysis of fluorescence emission of GFP in transformed plants and control lines without intervention (wild type).

[0051] FIG. 5.Grafting test of plants expressing MIR B mGFP on mGFP plants. A) Grafting of Vitis vinifera Thompson Seedless plants constitutively expressing MIR B mGFP (digitally red colored) on plants constitutively expressing mGFP. B) Analysis of GFP expression at 30 days post-graft by epifluorescence microscopy. Patterns 1 and 2 correspond to leaves located under the graft in the region immediately adjacent to this, pattern 3 corresponds to a leaf located in a region far from the graft area. C) Quantification of the red (chlorophyll emission) and green (green fluorescent protein emission) channels of the microphotographs.

[0052] FIG. 6.Evaluation of mGFP expression after removing MIR B mGFP graft to evaluate the persistence and/or stability of the graft induced silencing. A) Grafted plant (mGFP pattern+MIR B mGFP graft) in a biosecurity greenhouse allowing it to enter in recess, (B) Verification of the grafted region regarding the new generation of sprouts. C) Evaluation of GFP expression in the leaves formed during the spring in the area corresponding to the pattern after 8 months post-graft. (D) Quantification of the red (chlorophyll emission) and green (green fluorescent protein emission) channels of the microphotographs.

EXAMPLES

Example 1

Design of Artificial vvi miR319e

[0053] Cloning of miR319e Gene and Target Gene Selection

[0054] The design and construction of the pre-miRNAs was performed from the pre-miRNA template of Vitis vinifera, vvi-MIR319e chosen from the miRBase database. The sequence of vvi-MIR319e was cloned from the genome DNA of Thompson Seedless by PCR and the sequence data from the V. vinifera PN400 genome reference (Jaillon et al., 2007). The segment of the genome containing the pre-miR319e sequence was amplified by PCR using the following primers:

TABLE-US-00001 TABLE1 Pre-miR319eprimers Primer Sequence Length 319e-forward 5 CACAACTTTCACTATGGATG3 20 319e-reverse 5 GGAAAAGAGAAGAACTAGGAG3 21

[0055] PCR amplification was performed according to the following conditions: 94 C. for 2 min; 35 cycles of 94 C. for 30 s, 55 C. for 30 s, and 72 C. for 30 s; and a final elongation at a temperature of 72 C. for 2 min. The obtained PCR product corresponds to a fragment of 214 bases (FIG. 1a), whose sequence includes 107 bases corresponding to the pre-vvi-MIR319e between bases 114 and 134 (sequence underlined in FIG. 1a). This sequence will form the stem-loop structure predicted in FIG. 1b).

[0056] The obtained PCR product was cloned into the pGEMT Easy vector (Promega Corporation, Madison, Wis., USA) and sequenced for later use.

[0057] To evaluate the phenomenon of post-transcriptional silencing, a modified version of the GFP mGFP5-ER gene will be considered as a target sequence (Siemering et al., 1996, NCBI Acc. Number U87974). By means of the microRNA design tool WMD3-Web MicroRNA (Griffiths-Jones et al., 2008), mature miRNAs capable of recognizing areas containing at least one nucleotide difference between both sequences at position 10 (region A) or 11 (region B) were selected. In this way, two favorable regions were used to design the modified vvi-MIR 319e.

[0058] Five mature miRNAs used for the specific design of modified vvi-MIR319e directed against the sGFP and mGFP isoforms were chosen. These include the mature miRNAs designed to recognize the A region: MIR A sGFP: corresponds to the complementary sequence of the sGFP isoform, MIR A mGFP: corresponds to the complementary sequence of the mGFP isoform, MIR A.1 mGFP: corresponds to the sequence that has almost perfect complementarity with the sGFP isoform and only the nucleotide at position 10 is complementary to the mGFP isoform and the mature miRNAs designed to recognize the B region (between nucleotides 743 and 763 of the alignment). For region B, two mature miRNAs were used: MIR B mGFP with perfect complementarity with mGFP and MIR B sGFP, which presents perfect complementarity with the sGFP isoform.

[0059] After the design and construction of the pre-miRNA, its secondary structure was analyzed by the mfold folding analysis tool (Zuker, 2003), available at http://mfold.rna.albany.edu/?q=mfold, obtaining 5 possible structures (FIG. 2).

[0060] To continue the tests, a mature 21-nt miRNA was selected, which includes a sequence for detecting the GFP coding sequences between residues 743 and 763 (FIG. 3a).

[0061] From this, the primers of the long type primer were designed. A 2-step PCR was performed (FIG. 3a) to produce the pre-miRNA sequences that make it possible to obtain an amiR319e with structural and spatial characteristics (folding) that make it possible to form the characteristic stem-loop structure (FIG. 3b).

Example 2

Synthesis of Artificial vvi miR319e and Assembly in Expression System

[0062] Synthesis of Artificial Pre-amiR319e V. Vinifera.

[0063] A pre-amiR319e was constructed using two-step PCR by means of partial overlapping of 2 primers of the long type primers:

TABLE-US-00002 Primer Sequence Length Long- 5 AAAAAGCAGGCTGAGCTCTGCA 87 primer GAAATGCGGGATCATACGATGTCAT 1 GAACAACTCCATCGCTGAAGAAGAT GATGAACTTCATGCT3 Long- 5 AGAAAGCTGGGTGAGCTCAGAG 81 primer AAGAACTACGAGATCACACATGGCA 2 TGAACAAGGAGCATGAAGTTCATCA TCTTCTTCA3

[0064] Structurally, three parts of the pre-amiR319e must be considered for its synthesis: a) the miRNA region, b) the miR319e framework, and c) Borders and boundaries. The considerations for the design and construction of each component of the pre-amiR319e are detailed below.

[0065] a) miRNA Region

[0066] This corresponds to a 21-nt miRNA that includes the pre-amiR319e sequence for GFP. For the construction of this component, the following requirements were considered: a) the conservation of the unpaired bases, associated with the conformation of the main stem of the pre-miR319e, and b) the conservation of the G-U bonds that form the main stem.

[0067] Once the GFP-miRNA of 21-nt was selected, it was modified in positions 1, 12, 18, and 21 (5-3 ) by U, G, U, and U, respectively. These bases should be considered as non-modifiable for all miRNAs based on miR319e.

[0068] b) Backbone Sequence

[0069] For the constitution of the construct backbone, sequences 1-9, 32-75 and 97-107 were maintained.

[0070] c) Borders or Boundaries Sequences

[0071] The 5 and 3 flanking regions defined by starters long-primers included two additional sequences: Sac I restriction sites and attB recombination signals at the 5 and 3 ends. The starters long-primers were designed by the automated web tool for the design of starters for VVI-miR319e pre-miRNA. This tool is available at:

[0072] http://www.flujogenico.cl/plantbiotech/amir319edesigner.

[0073] Starters Long-Primers Sequences:

TABLE-US-00003 Long- 5 AAAAAGCAGGCTGAGCTCTGCAGAAATGCGGGA primer1 TCATACGATGTCATGAACAACTECCATCGCTGAAGA AGATGATGAACTTCATGCT3 Long- 5 AGAAAGCTGGGTGAGCTCAGAGAAGAACTACGA primer2 TCACACATGGCATGAACAAGGAGCATGAAGTTCATC ATCTTCTTCA3

[0074] Pre-amiR319e Construction

[0075] The pre-amiR319e was constructed by means of a two-stage PCR:

[0076] Amplification step 1: A reaction mixture containing 0.5 U of KAPAHiFi (KAPA Biosystems, Wilmington, Mass., USA), 0.3 mM dNTPs (Promega Corporation, Madison, Wis., USA), 1 Fidelity Buffer with MgCl.sub.2 and 50 pmol of each Long-primer, obtaining a final volume of 25 L, was prepared. The PCR procedure considered the following program: 94 C. for 2 min; 10 cycles of 94 C. for 15 s, 55 C. for 30 s, and 72 C. for 15 s, and a final elongation at 72 C. for 30 s. An amplification product named stage 1 product was obtained.

[0077] Amplification stage 2: A second round of amplification was carried out from the product obtained in stage 1, this with the aim of completing the sequence of the attBs signal necessary for recombination in the vector pDONR207. This step consisted in the preparation of a reaction mixture containing 0.5 U of KAPA HiFi (KAPA Biosystems), 0.3 mM dNTPs (Promega Corporation), 1 Fidelity Buffer with MgCl2, 7.5 pmol of each primer: attB-F5GGGGACAAGTTTGTACAAAAAAGCAGGCTTC 3 and attB-R5GGGGACCACTTTGTACAAGAAAGCTGGGT 3, and 10 L of product obtained in step 1. The PCR procedure considered the following program: 94 C. for 1 min; 5 cycles of 94 C. for 15 s, 45 C. for 30 s, and 72 C. for 20 s; 20 cycles of 94 C. for 15 s, 60 C. for 30 s, and 72 C. for 20 s; and a final extension at 72 C. for 1 min. The final amplification product was resolved on a 1.5% UltraPure agarose gel (Thermo Fisher Scientific) and visualized by staining with ethidium bromide. The band of interest was recovered by extraction from the gel using the Zymoclean Gel DNA kit (Zymo Research) according to the manufacturer's instructions. The product obtained is named stage 2 product.

[0078] Recombination of the Artificial Pre-miRNA in Vector pDONR207

[0079] The PCR product obtained from the second amplification was incorporated into the vector pDONR207 by the Clonase BP Gateway System (Thermo Fisher Scientific), according to the manufacturer's protocol. From this reaction results a vector containing the pre-miRNA-GFP (pDONR-pre-amiRNA-GFP), of which an aliquot was used to transform Escherichia coli One Shot TOP 10 competent cells (Thermo Fisher Scientific), following the manufacturer's instructions. From this, transformed cells were selected by incubation in LB medium supplemented with 15 mg/L of gentamicin overnight at 37 C. The selected clones were cultured in 5 mL of LB medium supplemented with 100 mg/L of Spectinomycin at 37 C. overnight with shaking at 180 rpm. Then, the cultures were centrifuged at 8000 g and DNA extraction was performed by means of the Zyppy plasmid Miniprep kit (Zymo Research). Plasmid DNA was checked by PCR and by restriction enzyme analysis. This PCR was carried out using the amiRNA F and amiRNA R primers (Table 1), in a PCR reaction that considered the following program: 94 C. for 2 min; 35 cycles of 94 C. for 15 s, 60 C. for 30 s, and 72 C. for 20 s; and a final extension at 72 C. for 1 min. Restriction analysis was carried out by incubation of 10 U of Sac I (New England Biolabs, USA), 1 NEB1.1 (New England BioLabs), 1 g/L of purified BSA and 500 ng of plasmid, leaving the reaction overnight at 37 C. The restriction assay was resolved on a 1.5% agarose gel and visualized by staining with ethidium bromide. The selected pDONR-pre-amiRNA-GFP plasmid was confirmed by sequencing (Macrogen).

[0080] Preparation of Pre-amiRNA-GFP Expression Vector

[0081] The pDONR-pre-amiRNA-GPF vector was recombined into the expression vector pGWB502 (Nakagawa et al., 2007). To achieve recombination, 150 ng of pDONR-pre-amiRNA-GFP and 150 ng of pGWB502 were mixed, using the Clonase LR Gateway System (Thermo Fisher Scientific) according to the manufacturer's instructions. The recombination mixture was used to transform E. coli One Shot TOP 10 competent cells, and positive clones were selected in LB medium supplemented with 100 mg/L spectinomycin. Positive clones were verified by PCR and restriction analysis using 10 U of Sac I enzyme (New England Biolabs, USA) and 1 NEB2. The resulting vector was named PGWB-pre-amiRNA-GFP.

Example 3

Transformation of Nicotiana Benthamiana with Rhizobium Radiobacter Comprising the Pre-amiRNAs Constructed

[0082] This example shows the procedure carried out for the preparation of Rhizobium radiobacter recombinant cells comprising the constructs coding for the pre-amiRNA and its use for transforming Nicotiana benthamiana and generating transgenic lines.

[0083] Preparation of Rhizobium Radiobacter (Example: Agrobacterium Tumefaciens)

[0084] Electrocompetent Rhizobium radiobacter GV3101 cells were prepared and electroporated with the constructs PGWB-pre-miRNA GFP and pB1121-mGFP5ER according to the protocol presented by McCormac et al. (1998). Electroporation was carried out in a Gene Pulser II system (Bio-Rad, Hercules, Calif., USA) adjusted to 1.25 kV, 25 FD and 400. The success of the transformation was determined by PCR of colonies and restriction analysis.

[0085] Recombinant Rhizobium cells containing the constructs PGWB-pre-amiRNA-GFP and pB1121-mGFP5ER were incubated overnight in LB medium supplemented with 100 mg/L of spectinomycin and 50 mg/L of kanamycin, respectively, at 28 C. and 180 rpm. An aliquot of this culture (50 L) was transferred to 150 mL of LB medium supplemented with the corresponding antibiotic and incubated at 28 C. with shaking at 180 rpm until the culture reached an OD600 of 0.3. The cells were centrifuged for 10 min at room temperature and 3,000 g, to be resuspended in 40 mL of liquid MS medium (Murashigue and Skoog, 1962) supplemented with 0.5 L of a 1M solution of acetosyringone (Sigma-Aldrich, St. Louis, Mich., USA), forming a suspension. The suspension was maintained at room temperature for 30 to 60 min before co-culture.

[0086] Preparation and Transformation of Nicotiana Benthamiana

[0087] A modified protocol was used to transform Nicotiana benthamiana from that described by Sun et al. (2006).

[0088] From this, Nicotiana seeds were disinfected by immersion in bleach (10% bleach plus 3 drops of Tween-20) for 10 min and washed 6 times with water for 1 min each wash. The disinfected seeds were hydrated for 2 h in water with occasional agitation. Seeds were dried using filter papers, seeded in Petri dishes containing MSO solid medium (MS medium (Murashige and Skoog, 1962) containing 15 g/L of sucrose and 3.2 g/L of phytagel, pH 5.8) and incubated for 7 days in the dark at 25 C.

[0089] Then, the seeds were subjected to incubation in a photoperiod of 16 h/8 h (light/dark) until the germination of these. After germination, the seedlings were co-incubated with the Rhizobium suspensions that include PGWB-pre-amiRNA GFP and pBI121-mGFP5ER.

[0090] The plants and bacterial suspensions were subjected to vacuum (20 mm Hg) for 1 min. After this, the cotyledon segments of the plants were dried with filter paper and seeded in Petri dishes with MS1 solid medium (MS salts medium, 30 g/L sucrose, and 1.5 mg/L zeatin, pH 5.8), being incubated for 48 h in darkness at 25 C.

[0091] Regeneration and Rooting

[0092] From the transformed plants the cotyledons were obtained and plated in Petri dishes with solid MS2 medium (MS medium containing 30 g/L of sucrose, 1.5 mg/L of zeatin, 250 mg/L of timentin, 200 mg/L of carbenicillin, 200 mg/L of cefotaxime, 50 mg/L of hygromycin, and 300 mg/L of kanamycin, pH 5.2). The cotyledons were transferred to fresh medium every 7 d until the time of callus formation. The calli were transferred to MS3 medium (MS medium containing 30 g/L of sucrose, 1 mg/L of zeatin, 250 mg/L of timentin, 200 mg/L of carbenicillin, 200 mg/L of cefotaxime, 50 mg/L of hygromycin B, and 300 mg/L of kanamycin) until the time of flowering (3-4 weeks). The shoots were transferred to MS4 medium (MS medium containing 30 g/L of sucrose, 250 mg/L of timentin, 200 mg/L of carbenicillin, 200 mg/L of cefotaxime, 25 mg/L of hygromycin B, and 150 mg/L of kanamycin), and were grown until the time of root formation (2-3 weeks).

[0093] After one month of culture, the specimens were transplanted into individual plastic bags of 350 mL with 150 mL of grass. The plants were covered with similar transparent plastic bags to prevent dehydration of the plant. After three weeks under these conditions, the plants were adapted for analysis.

Example 4

Analysis of the Transgene Conditions and Evaluation of the Silencing by the Pre-amiRNA Designed

[0094] From the protocol described in Example 3, three transgenic lines of N. benthamiana were generated: one for GFP, one for amiR319e-GFP and one comprising the GFP construct plus amiR319e-GFP. The three lines were initially characterized to confirm their transgenic status.

[0095] First, the genomic DNA of the transformed N. benthamiana plants was extracted for characterization by means of PCR. For this purpose, specific primers were used against the GFP gene: mGFP-F 5ACAGATCTTCGATTTCAAGGAGGACGGAA 3and mGFP-R 5CCAGGCCTTCATGTTTGTATAGTTCATCCATGC 3, nptII gene (NPTII F 5AGGCTATTCGGCTATGACTGG 3and NPTII R 5ATACCGTAAAGCACGAGGAAGC 3), gene MIR319 (PreamiRNA-F 5GAGCTCTGCAGAAATGCGGGATCATA 3 tyPre-amiRNA-R 5GAGCTCAGAGAAGAACTACGAGATCA 3), hptII gene (HPT-F and HPT-R), and EF1 gene of N. benthamiana. The PCR reaction performed included 1 Green GoTaq Buffer, 1.25 mM MgCl2, 0.25 mM dNTPs, 0.6 U of GoTaq Flexi DNA Polymerase (Promega Corporation) and 10 pmol of each primer. The PCR program consisted of: 95 C. for 3 min; 30 cycles of 94 C. for 30 s, 59 C. for 30 s, and 72 C. for 30 s; and a final extension stage at 72 C. for 2 min. The analysis of the different genes by PCR of the three transgenic lines confirmed the transgenic status of the plants for each case, as appropriate (FIG. 4a).

[0096] In parallel, GFP emission was determined by fluorescence microscopy in an HCS LSI microscope (Leica Microsystems, Inc., Buffalo Grove, Ill., USA). From the analysis of GFP emission, the presence of GFP fluorescence was observed only in the plants transformed individually with GFP, the samples of plants transformed with GFP plus amiR319e-GFP lacking fluorescence. Control lines without intervention (wild type) do not present GFP emission and the lines transformed only with amiR319e-GFP either (FIG. 4b).

[0097] Analysis of Target Messenger RNA (mRNA)

[0098] A rapid detection analysis of GFP mRNA in the transgenic plants was carried out by the technique modified 5 rapid amplification of 5 cDNA ends (5 RACE). The mRNA content was extracted and purified by Dynabeads of oligo (dT) 25 (Thermo Fisher Scientific) according to the manufacturer's instructions.

[0099] Then, a DNA adapter was ligated to the mRNA by the mixture of the adapter sequence and the mRNA. The ligation reaction was performed by mixing 1 T4 RNA ligase buffer (Thermo Fisher Scientific), 1 mM ATP, 24 U of RNAs in Plus RNase inhibitor (Promega Corporation, USA) and 5 U of T4 RNA ligase (Thermo Fisher Scientific). This mixture was incubated for 1 h at 37 C., and the mRNAs bound to adapters were re-purified using Dynabeads. The isolated nucleic acids were resuspended in 10 L of 10 mM Tris-HCl.

[0100] The mRNAs linked to adapters were used as templates to generate their respective cDNA. For this reaction, 10 L of the mRNAs bound to adapters were added to a mix reaction containing 0.4 mM of each dNTP and 0.5 g of an oligo (dT) 15 primer (Promega Corporation). The mixture was denatured for 5 min at 65 C. and placed on ice. Then, 1 SuperScript First-Strand Buffer (Thermo Fisher Scientific), 24 U of RNasin plus RNase inhibitor (Promega Corporation), 10 mM of DTT, and 200 U of Superscript II RT (Thermo Fisher Scientific) were added to the mixture denatured. The reaction was incubated for 10 min at 25 C., 1 h at 42 C. and 10 min at 70 C. Finally, 0.3 U of Ribonuclease H (Promega Corporation) was added and the mixture was incubated for 30 min at 37 C.

[0101] Following the protocol, the cDNA subjected to reverse transcription was amplified by PCR using the mGFP-F and -R primers (for the GFP gene), NPTII-F and -R (for the NPTII gene), and Pre-amiRNA-F and -R (pre-amiRNA319e-GFP). For PCR amplification, reaction mixtures were prepared with 1 KAPA Taq buffer plus Mg2.sub.+ (KAPA Biosystems), 0.2 mM dNTPs (10 pmol of each primer), 0.4 U of KAPATaq polymerase (KAPA Biosystems) and 1 L of a 1:5 dilution of cDNA. The PCR program included: denaturation at 95 C. for 3 min and 30 cycles of 30 s at 94 C., 30 s at 60 C. (for the N. benthamiana pre-amiRNA and NPTII genes) or at 57 C. (for the GFP gene), and 30 s at 72 C. A final extension was performed for 1 min at 72 C. The amplified products were resolved on 1.5% agarose gels and visualized by staining with ethidium bromide.

[0102] Analysis of amiRNA319e-GFP.

[0103] RT-PCR was used to detect the final loop structures of the pre-amiR319e-GFP miRNA in the plant. All procedures were modified from Varkonyi-Gasic et al. (2007), starting with 100 mg of fresh leaves. The process begins with the extraction of total RNA from the plant. The primers used in this case for RT-PCR were designed according to Chen et al. (2005). From the total RNA, 500 nanograms were taken and mixed with 1 L of each stem-loop primer (Stock 10 mM) and 0.5 L of each dNTP (10 mM). The mixture was incubated for 5 min at 65 C. and then cooled on ice for 2 min. After this, 4 L of 5 First Strand buffer (Thermo Fischer Scientific) was added and mixed with 2 L of 0.1 M DTT, 0.1 L of RNase-OUT (40 U/L) (Invitrogen, USA) and 0.25 L of Superscript II reverse transcriptase (200 U/L) (Thermo Fischer Scientific). The mixture was centrifuged, and it was included in an Eppendorf Mastercycler Nexus thermocycler (Thermo Fisher Scientific), undergoing the following program: 30 min at 16 C. and 60 cycles of 30 s at 30 C., 30 s at 42 C. and 1 s 50 C. Finally, the mix reaction was incubated for 5 min at 85 C. The amplified product was used as a template for a second PCR in which the universal RT-PCR primer was mixed with the previously described miR319e-GFP forward or miR166c forward primers. The PCR conditions were 3 minutes at 95 C. and 35 cycles of 30 s at 95 C., 30 seconds at 60 C. and 30 s at 72 C. A final extension was applied for 5 min at 72 C. The PCR products were separated by agarose gel electrophoresis using 3% agarose.

Example 5

Mobility Evaluation of Pre-amiR319e Silencing Signals

[0104] This example presents the mobility evaluation of silencing signals generated by MIR B mGFP. For this, a line of Vitis vinifera L. Thompson Seedless was developed that will express the miRNA constitutively.

[0105] In order to determine the capacity of movement and transmission of gene silencing, the line produced was used in grafting trials on stable transgenic vine plants for mGFP.

[0106] From the experiment, the results generated showed a phenomenon of bidirectionality of movement of the silencing signals, resulting more efficient the movement from graft to the rootstock. Changes in the phenotype were observed from green fluorescent protein expression under epifluorescence microscopy, when using as a graft (upper part) the line that generates the silencing signals and as a rootstock the line that expresses constitutively the mGFP isoform (FIG. 5). When the graft was removed, after 8 months post-graft, it was observed that the fluorescence in the rootstock (green channel emission) was similar to that of a control plant (mGFP) (FIG. 6).

TABLE-US-00004 Sequences SEQ1. (SEQIDNO1) 5- 1112131 CACAACTTTCACTATGGATGCGCCTTCTCRTCTTGTTTTTC 41516171 TCCCTTTGTTCTCCTCTCACTATCTTTCTCCTTTTTTCCA 8191101111 TGAGCTTAATTGTCAAGAAAACTGCAGAAATGGGGGTTCC 121131141151 TTTGCAGCCCAAAACAACTCCATCGCTGAAGAAGATGATG 161171181191 AACTTCATGCTCCTTGTTTTGGACTGAAGGGAGCTCCTAG 201211 TTCTTCTCTTTTCC -3