T CELL RECEPTORS

Abstract

The present invention relates to modified T cell receptors (TCRs) and to their use in adoptive cell therapy (ACT), in particular for the transfer of T lymphocytes. The TCRs are mutated in the transmembrane regions of the alpha and beta chains with mutations favoring the correct TCR chain pairing. The correct pairing of the transferred exogenous alpha and beta TCR chains improves the functional activity and safety of the genetically modified T cells for the therapy of tumours and infectious diseases. The invention also relates to T cell receptor alpha or beta chain, to a recombinant TCR, a TCR complex, a nucleic acid coding for the TCR alpha or beta chain, to relative recombinant expression vector, host cells, pharmaceutical composition and to a method of detecting a hematological malignant cell, a solid tumor cell or an infected cell.

Claims

1. A T Cell Receptor (TCR) comprising at least one of an alpha chain and a beta chain; wherein the alpha chain comprises a transmembrane region comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:14, SEQ ID NO:15, OR SEQ ID NO:16; and wherein the beta chain comprises a transmembrane region comprising SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, OR SEQ ID NO:20, wherein said transmembrane region is characterized by mutations in the amino acid positions 8 and 12 with an hydrophobic amino acid residue, and in position 15 with a polar amino acid residue.

2. The T Cell Receptor (TCR) alpha or beta chain according to claim 1, wherein the hydrophobic amino acid residue is phenylalanine and the polar amino acid residue is serine or threonine.

3. The T Cell Receptor (TCR) alpha chain according to claim 1, further comprising the amino acid methionine in position 2.

4. The T Cell Receptor (TCR) alpha or beta chain according to claim 1, wherein the polar aminoacid is serine.

5. (canceled)

6. (canceled)

7. (canceled)

8. (canceled)

9. (canceled)

10. (canceled)

11. The T Cell Receptor (TCR) according to claim 1, wherein the TCR is specific for an antigen selected from the group consisting of: a tumor cell antigen, a tumor cell associated antigen, and a pathogenic agent.

12. The T Cell Receptor (TCR) according to claim 11 wherein the tumor cell antigen or the tumor cell associated antigen is selected from an antigen of a hematological malignancy or of a solid tumor.

13. The T Cell Receptor (TCR) according to claim 11 wherein the antigen is selected from the group consisting of: influenza virus, measles and respiratory syncytial virus, dengue virus, human immunodeficiency virus, human hepatitis virus, herpes virus, papilloma virus, Plasmodium falciparum protozoa, or a mycobacteria.

14. The T Cell Receptor (TCR) according to claim 1, further comprising associated with a detectable label, a therapeutic agent, a PK modifying moiety or a combination thereof.

15. A TCR complex comprising at least two TCRs according to claim 1.

16. A nucleic acid coding for the T Cell Receptor (TCR) alpha and/or beta chain according to claim 1.

17. A recombinant expression vector comprising the nucleic acid according to claim 16, wherein said vector is a retroviral or lentiviral vector.

18. A host cell comprising the nucleic acid claim 16.

19. A method to generate cells expressing a T Cell Receptor (TCR), the method comprising the following steps: activating a population of lymphocytes obtained from peripheral blood of a subject; isolating the T cells from said population; transducing or transfecting the isolated T cells with a nucleic acid coding for a TCR comprising at least one of an alpha chain and a beta chain; wherein the alpha chain comprises a transmembrane region comprising SEQ ID NO:1, SEQ ID NO:2 SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16; and wherein the beta chain comprises a transmembrane region comprising SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:17 SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20, wherein said transmembrane region is characterized by mutations in the amino acid positions 8 and 12 with an hydrophobic amino acid residue, and in position 15 with a polar amino acid residue.

20. A cell expressing the T Cell Receptor (TCR) prepared according to the method recited in claim 19.

21. A pharmaceutical composition comprising the nucleic acid according to claim 16, and further comprising a pharmaceutically acceptable vehicle and/or adjuvant.

22. (canceled)

23. (canceled)

24. (canceled)

25. A method for the treatment and/or prevention of a hematological tumor, a solid tumor or an infective disease comprising administering to a subject the T Cell Receptor (TCR) of claim 1.

26. A method of detecting at least one of a hematological malignant cell, a solid tumor cell or an infected cell, the method comprising: providing a T Cell Receptor (TCR) comprising at least one of an alpha chain and a beta chain; wherein the alpha chain comprises a transmembrane region comprising SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:14, SEQ ID NO:15, or SEQ ID NO:16; wherein the beta chain comprises a transmembrane region comprising SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, or SEQ ID NO:20, wherein said transmembrane region is characterized by mutations in the amino acid positions 8 and 12 with an hydrophobic amino acid residue, and in position 15 with a polar amino acid residue; contacting a sample comprising the hematological malignant cell, solid tumor cell or the infected cell with the TCR, thereby forming a complex; and detecting the complex, wherein detection of the complex is indicative of the presence of an hematological malignancy, a solid tumor or an infective disease.

27. The T Cell Receptor (TCR) according to claim 11, wherein the TCR is specific for pathogenic agent derived from a virus, bacteria, protozoa, or parasite.

28. The TCR according to claim 12, wherein the tumor cell antigen is selected from a multiple myeloma, melanoma, lung tumor, endometrial tumor, glioma, lymphoma, leukemia, or prostate tumor.

29. A host cell according to claim 18, wherein said host cell is a T lymphocyte.

Description

[0149] The present invention will be described by non-limitative examples with reference to the following figures:

[0150] FIG. 1. Membrane CD3 expression of 5417 cells obtainable as described in (8) after transfection (A) of wt (SEQ ID NO:1) and wt (SEQ ID NO:3) chains or (B) mu (SEQ ID NO:2) and mu (SEQ ID NO:4) chains. The transfected chains correspond to the TCR specific for HIV Reverse Transcriptase (HIV-RT) 248-262 peptide. The figure represents a cytofluorimetric analysis of the fluorescence intensity of the 5417 cells transfected and labeled with antibody anti-CD3 conjugated to FITC 145-2c11 (eBioscience cat 11-0031-82). Expression of the correctly associated receptor induces membrane localization of the CD3 chain in hybridoma cells 5417. Numbers represents the mean of fluorescence intensity values.

[0151] FIG. 2. Membrane CD3 expression of 5417 cells after transfection of awt (SEQ ID NO:1)/mu (SEQ ID NO:4) (A), or mu (SEQ ID NO:2)wt (SEQ ID NO:3) (B). Mispairing of the two TCR chains does not induce membrane localization of CD3 on T cell surface nor the staining of 5417 cells with the specific antibody. Numbers represents the mean of fluorescence intensity values.

[0152] FIG. 3. Mean of fluorescence intensity of CD3 expression of 5417 cells transfected with the different TCR and combinations (mean of 3 experiments). awtbwt: SEQ ID NO:1/SEQ ID NO:3; amubmu: SEQ ID NO:2/SEQ ID NO:4; awtbmu: SEQ ID NO:1/SEQ ID NO:4; amubwt: SEQ ID NO:2/SEQ ID NO:3. Mean fluorescence intensity is reported on the Y-axis.

[0153] FIG. 4. IL-2 production for several independent T cell 5417 hybridomas transfected with awt (SEQ ID NO:1) bwt (SEQ ID NO:3) TCR, amu (SEQ ID NO:2) bmu (SEQ ID NO:4) TCR, awt (SEQ ID NO:1) bmu (SEQ ID NO:4) TCR or amu (SEQ ID NO:2) bwt (SEQ ID NO:3) TCR, when stimulated with specific antigen HIV reverse transcriptase (RT) (248-262) peptide. IL-2 secreted was measured by ELISA (Biolegend, see Materials and Methods). The histogram shows how the 54z17 hybridoma reconstituted with the amu bmu chains is able to transduce the signal after specific TCR engagement and lead to the production of IL-2 to the same extent as the 5417 reconstituted with the awt bwt TCR. The 5417 hybridomas reconstituted with awt bmu chains or amu bwt (chains produce a significant smaller amount of IL-2.

[0154] FIG. 5. Cytofluorimetric analysis showing the expression of the mutated TCR through retroviral infection using a monoclonal antibody anti-V13 PercP-coniugated clone MP12-3 eBioscience cat 46-5797-80 (specific for the transfected beta chain). The figure shows TCR expression (visualized through antibody anti beta chain (anti-V13 PercP-coniugated clone MP12-3 eBioscience cat 46-5797-80) in murine splenocytes non-transfected or transfected with a retrovirus encoding the mutated alpha (SEQ ID NO:2) and mutated beta (SEQ ID NO:4) chains object of the present invention. The anti-V13 positivity seen in the non-transfected sample reflects the background value of said chain expression in the set of a wild type mouse. Numbers represent the percentage of cells labeled by the specific antibody. FSC-A: Forward Scatter-Area.

[0155] FIG. 6. Cytotoxic activity of murine T cells (Effector, E) transfected with a retroviral vector encoding the TCR specific for the gp100 antigen and comprising the transmembrane modifications object of the present invention (alpha chain: SEQ ID NO: 2; beta chain: SEQ ID NO: 4). EL4 cells (ATCC Number: TIB-39, (11)) were used as target cells (Target, T), conjugated with calcein and pre-incubated with the antigenic gp100 peptide. The light gray graph represents the response against target cells pre-incubated with the antigenic gp100 peptide while the dark gray graph shows the control cytotoxicity against target cells not pre-incubated with the gp100 peptide.

[0156] FIG. 7. FRET analysis on mouse splenocytes infected with TCR OT-I (Charles River C57BL/6-Tg (TcraTcrb)1100Mjb/CrlC) which recognizes the OVA.sub.257-264 (SIINKFEL) peptide. Splenocytes were transduced with wild type or with the TCR comprising the transmembrane modification of SEQ ID:2 and SEQ ID:4. A) Mean +/SD of FRET signals on splenocytes infected with TCR wt or TCR mutated is shown (average of 10 cells) B) FRET efficiency values are reported at single cell level.

[0157] FIG. 8. FLIM (Fluorescence Lifetime Imaging Microscopy) analysis illustrating the half-life of fluorescence signals following interactions of V 2 and V 5 antibody labelled with a donor/acceptor dye pair. Cells were analyzed at confocal microscope using FLIM and the software package SymphoTime (PicoQuant) was used to process FRET data. A) Donor lifetime revealed pixel by pixel: FRET is expressed as color scale. B) Differences in FRET efficiencies between the mutant and wild type are reported in the histogram. The lifetime of the donor will decrease in the presence of the acceptor. The lifetime (nanoseconds) fitted to the distribution model is reported on Y-axis.

[0158] FIG. 9. Functional activity of CD8+ T lymphocytes isolated from the spleen and transduced with wild type or mutated TCR OT-I which specifically recognizes the OVA.sub.257-264 peptide SIINFEKL. Production of IFN (A) by CD8 T cells co-cultured with B16 melanoma cells expressing the ovalbumin protein (T/B16-OVA) and (B) by CD8 T cells co-cultured with antigen presenting cells pre-pulsed with OVA.sub.257-264 peptide (T/apc+OVA) at the concentrations of 10 M, 2 M and 0.4 M. The IFN concentrations are calculated by interpolation of the experimental optical density values on a standard calibration curve. The standard calibration curve is obtained correlating known IFN concentrations and optical density of the colorimetric assay. Negative concentration values are obtained if the experimental optical density is lower than the calibrator (negative value means zero).

[0159] FIG. 10. Expression in Jurkat J76 cell line (TCR defective). The percentage of CD3 positive cells measured 24 hours after the infection with retrovirus encoding the mutant TCR (comprising mutated alpha chain: SEQ ID. NO: 15 and mutated beta chain: SEQ ID NO:18) specific for the human Ny-Esol antigen (left bar) and the mutant plus I/M TCR (comprising mutated alpha chain: SEQ ID. NO: 16 and mutated beta chain: SEQ ID NO:18) specific for the human Ny-Esol antigen (right bar) is reported. The experiment has been performed four times. *=p<0.05.

[0160] FIG. 11. Molecular modeling of the transmembrane region of mutated human TCR. The aminoacids of the FXXXFXXS (aa 1 to 8 of SEQ ID No: 30) motif are reported. The Lysine aminoacid responsible for the interaction with the epsilon-delta CD3 dimer, the Arginin interacting with the zeta-zeta dimer and the Methionine introduced instead of the Isoleucin to induce a better TCR expression.

DETAILED DESCRIPTION OF THE INVENTION

[0161] Materials and Methods

[0162] Hybrid TCRs Generation and Cloning

[0163] Cloning of TCR alpha and beta chains was performed as previously described [8]. The mutated TCR alpha and beta chains have been obtained by introducing the mutation by overlap extension PCR using the primers listed below.

TABLE-US-00002 1mCcSSTCRF: (SEQIDNO:5) 5GGATCCAATATTCAGAACCCAGAACCTGCTGTG3 2CaTCRmuR: (SEQIDNO:6) 5CAGCGTCATGAGCAGGCTAAATCCAAATACTTTCAGAAAGAGGATTC GG3 3CaTCRmuF: (SEQIDNO:7) 5CCGAATCCTCTTTCTGAAAGTATTTGGATTTAGCCTGCTCATGACGC TG3 4mCaNotITCRR: (SEQIDNO:8) 5CTGCAGGCGGCCGCGTGAGGAGGACGGAC3 5mCbetaEco0109f: (SEQIDNO:9) 5 TCTAGAGGACCTGAGAAATGTG3 6mCbetaXba: (SEQIDNO:10) 5GGTCGACTCTAGAACTAGTGGATCC3 7tcrbmutf: (SEQIDNO:11) 5 ATCCTATTCGGGAAGGAAGGCCTTCCTATATTCT3 8tcrmur: (SEQIDNO:12) 5 GCACAGAATATAGGAAGGCCTTCCCGAATAGGAT3

[0164] Primers 1 2, 3 and 4 were used for alpha chain amplification and primers 5,6,7 and 8 for beta chain amplification.

[0165] Experiments on hybridoma cells have been performed as previously described [8].

[0166] Human TCR alpha and beta chains were obtained by GeneART gene synthesis service (Termo Fisher Inc.).

[0167] The transfection of isolated T cells from murine splenocytes was done as previously described by using retroviral vectors encoding a T receptor specific for the pMel melanoma antigen [9]. The starting vector is described in [12] and was mutated as above described.

[0168] Cells

[0169] The murine T hybridoma .sup..sup. transfected with human CD4 and murine chain (T5417) has been previously described [8]. Cells were maintained in DMEM supplemented with 10% FCS, 25U/mL penicillin G, 25 g/mL streptomycin and 0.05 M -Mercaptoethanol. The 293T cell line, originally referred as 293tsA1609neo (Lenti-X 293T Cell Line 632180 clontech) is a highly transfectable derivative of human embryonic kidney 293 cells, and contains the SV40 T-antigen. Cells were cultured in DMEM supplemented with 10% FCS, 25 U/mL penicillin G and 25 ug/mL streptomycin.

[0170] Murine lymphocytes were cultured in RPMI 1640 supplemented with 10% fetal bovine serum, 2 mmol/L L-glutamine, 50 U/mL penicillin, 50 mg/mL streptomycin, 0.05 M -Mercaptoethanol, 1 mM sodium pyruvate and 20 IU/mL rhIL-2. Murine RMA-S is an antigen processing-defective cell line, obtained from a Rauscher virus-induced tumor [25]. The cells express only a low level of cell surface major histocompatibility complex (MHC) class I molecules, which are supposed to be devoid of internally derived antigenic peptides. Cells were maintained in RPMI 1640 supplemented with 10% FCS, 25U/mL penicillin G and 25 g/mL streptomycin.

[0171] EBV cells (L-cell lines used as Antigen presenting cells produced by Epstein Barr virus infection of B cell from a healty donor as MHC matching Antigen presenting cells) were maintained in DMEM supplemented with 10% FCS, 25 U/ml penicillin G, 25 g/ml streptomy cin.

[0172] Construction of Retroviral Vectors

[0173] The sequence encoding for the wild type and mutated alpha and beta chains of the invention (OVA specific TCR, gp100 specific TCR, and NY-ESO1 specific TCR) were produced by classical PCR reaction or by gene synthesis and introduced by digestion using the BglII-BamHI restriction enzymes in pMSGV backbone [26].

[0174] -Retrovirus Production

[0175] -Retrovirus was obtained by transfecting Human Embrionic Kidney (HEK) 293T, which stably express the SV40 Large T antigen with Lipofectamine 2000 reagent in DMEM medium (Gibco).

[0176] One day prior transfection HEK293T cells were seeded at 3.510.sup.6 cells into a 10 cm plate with 10 mL of complete medium and incubated at 37 C., 5% CO.sub.2.

[0177] 9 ug of plasmid coding for wild type or mutated TCRs of the invention (MSGV-OVA TCR wild type or mutated, MSGV-gp100 TCR wild type or mutated, MSGV-NY-ESO1 TCR wild type or mutated), 6 ug of plasmid encoding retroviral packaging system (pECOTROPIC Vector), 3 ug of plasmid coding for the protein VSVG to mediate viral entry through lipid binding and plasma membrane fusion and 30 uL of lipofectamine 2000 were used for co-transfection. 4-6 hours after transfection cell culture are supplemented with fresh complete growth medium and incubated at 37 C., 5% CO.sub.2.

[0178] 48 hours after the cell culture supernatant is collected, filtrated using 0.45 m polysulphonate filter to remove cellular debris and concentrated by ultracentrifugation in SW28 rotor at 16500 rpm 1 h 30 min 4 C. Retroviral pellet is suspended in PBS and used for cell infection or stored at 80 C.

[0179] Transfection of Hybridoma Cell Line.

[0180] T 5417 (58.sup..sup. previously transfected with human CD4 and the murine chain) were suspended at 210.sup.7 cells/ml in DMEM 20% FCS. About 20 g of expression vector encoding the wild type or mutated TCR b chain and 100 g of expression vector were encoding the TCR a chain were added to 1 10.sup.7 cells/ml in a Gene Plus cuvette (Biorad, Richmond, Calif.) and electroporated at 250 V, 500 pf. After 48 h of incubation at 37 C., the cells were plated at 210.sup.4 cells/well in flat-bottom 96-well plates and placed in selective medium containing 400 nM MTX (Sigma) and 1.65 M puromycin (Sigma).

[0181] Transduction of Primary Murine T Cells.

[0182] Mice were sacrificed, spleen were explanted and disaggregated. Red cells were lysed using 1 mL of Red blood cell Lysing buffer (Sigma) and incubated 5 min at RT. Cells were washed and suspended at 110.sup.6cells/mL. Splenocytes were activated using 10 ug/mL of anti-mouse CD32c11 antibody coated on plate and 4 ug/mL of anti-mouse CD28 antibody (Miltenyi Biotec Inc.). After 6 hours 20 units/well of human recombinant IL-2 were added to the culture. 2 days after activation CD8+ T cells were isolated and infected with 20 ul of retrovirus encoding mutated or wild type TCR. Cells were spinoculated 99 min a 2000 rpm a RT and 100 units/well of human recombinant IL-2 were added to the culture. Percentage of transduced cells was evaluated through FACS staining 48 hours after transduction.

[0183] Transduction of Jurkat 76 T Cells.

[0184] To infect the Jurkat J76 (TCR deficient cell line [24]) with retrovirus encoding wild type or mutated TCRs specific for NY ESO1 antigen, 48 hours after the transfection retroviral supernatant has been collected and filtered by using 0,45micron filter. 10m1 of filtered viral supernatant have been used to culture 500.000 Jurkat cells. The day after the infection cells have been spinned down and resuspended in 4 mL of RPMI 10% FCS medium (FIG. 11).

[0185] Flow Cytometry

[0186] To evaluate the expression of the TCR specific for the HIV reverse transcriptase (RT) (248-262) peptide on hybridoma cells T5417, FITC-conjugated monoclonal antibody against murine CD3 chain was used. Results are presented in FIG. 1 and FIG. 2. OVA.sub.257-264 (SIINKFEL, (SEQ ID No: 32))-TCR transduced CD8+T cells were stained with FITC-conjugated monoclonal antibody against the variable region of the specific murine chain V2 (eBioscience, San Diego, Calif.) and APC-conjugated monoclonal antibody against the variable region of the specific murine chain V5 (eBioscience, San Diego, Calif.). PerC-P conjugated anti-mouse Vb13.1 (Beckman Coulter, Miami, Fla.) was used to detect CD8+T cells transduced with TCR specific for KVPRNQDWL peptide (gp 100.sub.25-33) (results are reported in FIG. 5). All the staining were performed according to manufacturer instructions. Cells were analyzed using a FACS CANTO flow cytometer and FACSDIVA software.

[0187] FRET (Fluorescence Resonance Energy Transfer)

[0188] For FRET acceptor photo bleaching, we used monoclonal antibody (Va2 BMS14-5812-82 eBioscience) specific for the murine variable region V2 conjugated with ALEXAfluor 568, as donor, and monoclonal antibody (139502 Biolegend) specific for the murine variable region V5conjugated with ALEXAfluor 647, as acceptor. To perform FRET on primary murine T cells, such cells were seeded on coverslips. Coverslips were treated 20 min with 100 ul 1 poly-L-Lysine opportunely diluted with sterile PBS, and washed with 2 mL of PBS and air dry for 10 min in order to favor the adhesion. Primary murine T cells, activated as described above, were plated at 310.sup.6 cells/mL in complete medium on treated coverslip and incubated over night at 37 C., 5% CO.sub.2. The day after, medium was removed and cells were fixed by incubation for 10 min at RT in 4% paraformaldehyde, and added of 1 Hoechst dye (Sigma) (fluorescent stain that specific binds to A-T rich DNA regions). Cells were then washed 5 min with PBS and incubated 20 min at RT with blocking solution (1 PBS, 0.5% BSA, 50 mM NH.sub.4Cl). Subsequently cells were incubated 2 hours at RT with monoclonal antibody specific for the murine variable region V2 and monoclonal antibody specific for the murine variable region V5, diluted 1:10 in blocking solution. Cells were washed with sterile water, coverslips were air dried and sealed with mowiol mounting solution. Cells were analyzed by using confocal microscopy by using P-FRET software package (ImageJ Plugins) to process FRET data.

[0189] FLIM: Time-Resolved FRET Analysis

[0190] To perform FLIM on primary murine T cells, such cells were treated as in FRET. Splenocytes transduced with wild type or mutated TCR and stained with monoclonal antibody specific for the murine variable region V2 conjugated with CF568, as donor, and monoclonal antibody specific for the murine variable region V5 conjugated with CF647, as acceptor were analyzed at confocal microscope using FLIM (Fluorescence Lifetime Imaging Microscopy) and the software package SymphoTime (PicoQuant) was used to process FRET data.

[0191] Cytokine Release Assay

[0192] The ability of T5417 hybridoma cells to produce IL-2, when stimulated with the specific antigen HIV reverse transcriptase (RT) (248-262) peptide, was tested in cytokine release assays (FIG. 4). In these assay 210.sup.4 hybridoma cells were co-cultured with 110.sup.5EBV cells pre-incubated overnight with 1 ug/mL or 0.1 ug/mL of synthetic antigen, in RPMI medium in a final volume of 0.2 mL in duplicate wells of a 96-well flat-bottom microplate. Culture supernatants were harvested 18-24 hours after the initiation of co-culture and assayed for IL-2 by ELISA (Biolegend).

[0193] TCR-engineered CD8+ T cells were tested for antigen-specific reactivity in cytokine release assays using antigen presenting cells (irradiated syngenic splenocytes) loaded with synthetic peptide or tumor cells expressing the antigen. In these assays, effector cells (110.sup.5) were co-cultured with equal number of target cells in RPMI complete growth medium in a final volume of 0.2 mL in duplicate wells of a 96-well flat-bottom microplate. Culture supernatants were harvested 18-24 hours after the initiation of co-culture and assayed for IFN-g by ELISA (Biolegend).

[0194] Cytotoxicity (Calcein Release Assay)

[0195] Effector cell-mediated cytotoxic activity was evaluated by the standard Calcein-AM release cytotoxicity assay (FIG. 6). Briefly, target cell lines were pulsed for 2 hours with synthetic antigen gp100 (Kawakami Y et al J. Immunol., 154:3961-3968, 1995; Primm Srl, Milan, Italy) and labeled with 15 M Calcein-AM (C1359 Sigma) for 30 min at 37 C. and washed twice. Calcein AM is a non-fluorescent, hydrophobic compound that easily permeates intact, live cells. The hydrolysis of Calcein AM by intracellular esterases produces Calcein, a hydrophilic, strongly fluorescent compound that is well-retained in the cell cytoplasm. After cell lysis Calcein is released in the cell culture supernatant and can be detected) for 30 min at 37 C. and washed twice. Effector cells were incubated with 510.sup.3 target cells, at the indicated E:T ratios, for 5 h at 37 C. in 200 l of complete medium. After short centrifugation, 75 l of cell culture supernatant was harvested and transferred in a new plate and the Calcein release was measured by fluorescent plate reader at 490 nm excitation. The percentage of specific cytotoxicity was calculated as 100(cpm experimental releasecpm spontaneous release)/(cpm maximum releasecpm spontaneous release). Maximum release was obtained by target cells cultured in medium plus 2% Triton X100. Spontaneous release was always 20%. All experimental points were performed in triplicate.

[0196] Analysis of Signal Transduction in Jurkat T Cells

[0197] To evaluate ERK phosphorylation, J76 cells infected with retrovirus encoding for TCR-Ny-Eso wild type or TCR-Ny-Eso mutated in TM region were stimulated with 1:25 diluted Ny-Eso tetramer conjugated to streptavidin-PE (Life technologies S866). Briefly 110.sup.5 cells/for time point were stimulated with tetramer at 37 C. with 1000 rpm shaking for 0, 60, 120, 180, 300, 600 and fixed with Phosflow Fix buffer (BD Phosflow Fix Buffer 1 cat.557870, BD

[0198] Bioscience). Afterwards cells were permeabilized with Phosflow Perm Buffer (BD PhosflowFix Perm II cat.558052, BD Bioscience) and stained for 1 hour at 37 C. in the dark with antiP-Erk Alexa-Fluor 647 conjugated antibody (Phospho-p44/42 MAPK (Erk1/2) clone E10 cat.4375, Cell Signaling Technology). Cells were washed and analyzed by using a FACS CANTO 2 flow cytometer.

EXAMPLES

[0199] Description of Wild Type and Mutant TCR Chains

[0200] Genetically modified TCRs whose transmembrane regions contain three or four substituted amino acid residues in the alpha chain and three in the beta chain were obtained as described in methods. Below, the mutated amino acid residues are highlighted in bold and shown in the amino acidic sequence context of mutated and wild type transmembrane regions of the TCR components (TM, Trans Membrane):

TABLE-US-00003 Musmusculus: VMGLRILLLKVAGFNLLMTLRLW wildtypeTMalpha(SEQIDNO:1) VMGLRILFLKVFGFSLLMTLRLW mutatedTMalpha(SEQIDNO:2) TILYEILLGKATLYAVLVSTLVV wildtypeTMbeta(SEQIDNO:3) TILYEILFGKAFLYSVLVSTLVV mutatedTMbeta(SEQIDNO:4) TILYEILLGKATLYAVLVSGLVL wildtypeTMbeta(SEQIDNO:19) TILYEILFGKAFLYSVLVSGLVL mutatedTMbeta(SEQIDNO:20) HomoSapiens: VIGFRILLLKVAGFNLLMTLRL wildtypeTMalpha(SEQIDNO:14) VIGFRILFLKVFGFSLLMTLRL mutatedTMalpha(SEQIDNO:15) VMGFRILFLKVFGFSLLMTLRL mutatedTMalpha(SEQIDNO:16) TILYEILLGKATLYAVLVSALVL wildtypeTMbeta(SEQIDNO:17) TILYEILFGKAFLYSVLVSALVL mutatedTMbeta(SEQIDNO:18) MusMusculus wildtypeTMalpha(SEQIDNO:1),nucleotidesequence(SEQIDNO:21) gtgatgggcctgagaatcctgctgctgaaggtggccggcttcaacctgctgatgaccct gaggctgtgg mutatedTMalpha(SEQIDNO:2),nucleotidesequence(SEQIDNO:22) gtgatgggcctgagaatcctgTtCctgaaggtgTTcggcttcaGcctgctgatgaccct gaggctgtgg wildtypeTMbeta(SEQIDNO:3),nucleotidesequence(SEQIDNO:23) Accatcctgtacgagatcctgctgggcaaggccacactgtacgccgtgctggtgtccgg cctggtgctg mutatedTMbeta(SEQIDNO:4),nucleotidesequence(SEQIDNO:24) accatcctgtacgagatcctgTTCggcaaggccTTCctgtacTCTgtgctggtgtccgg cctggtgctg HomoSapiens: wildtypeTMalpha(SEQIDNO:14),nucleotidesequence(SEQIDNO:25) gtgattgggttccgaatcctcctcctgaaagtggccgggtttaatctgctcatgacgct gcggctg mutatedTMalpha(SEQIDNO:15),nucleotidesequence(SEQIDNO:26) gtgattgggttccgaatcctcTTTctgaaagtgTTTgggtttTCCctgctcatgacgct gcggctg mutatedTMalpha(SEQIDNO:16),nucleotidesequence(SEQIDNO:27) gtgATGgggttccgaatcctcTTTctgaaagtgTTTgggtttTCCctgctcatgacgct gcggctg wildtypeTMbeta(SEQIDNO:17),nucleotidesequence(SEQIDNO:28) accatcctctatgagatcttgctagggaaggccaccttgtatgccgtgctggtcagtgc cctcgtgctg mutatedtypeTMbeta(SEQIDNO:18),nucleotidesequence(SEQIDNO:29) accatcctctatgagatcttgTTTgggaaggccTTTttgtatTCCgtgctggtcagtgc cctcgtgctg

[0201] Since the transmembrane regions of alpha and beta TCR chains have conserved motifs (13) the mutations described above may be inserted in any pair of TCR chains.

[0202] Transfections in a Hybridoma Cell Line Deprived of Endogenous TCR

[0203] As a proof of principle, the above mutations were introduced into the TCR alpha and beta chain specific for the HIV reverse transcriptase (RT) (248-262) peptide that has been previously described by the inventors' laboratory [8] and has been reconstituted into the T cell hybridoma 5417 (Blank U, Boitel B, Mege D, Ermonval M, Acuto O (1993) Eur J. Immunol 23:3057). Experiments are illustrated in FIGS. 1-4.

[0204] The TCR complex is assembled in the endoplasmic reticulum in a series of defined steps, in which the early and correct association of the TCR and TCR chains is crucial. Correctly paired complexes are then exported to the surface of the cell in association with the CD3 , , and chains.

[0205] The 5417 T cell hybridoma is devoid of endogenous TCR and coding genes, and does not express CD3 proteins on the cell surface. Upon transfection of TCR and chain coding plasmids, TCR chains associate and induce CD3 expression on T cell surface.

[0206] The described TCR chains mutated into the transmembrane region are correctly associated after transfection in 5417 T cell hybridoma, as demonstrated by antiCD3E antibody staining of transfected cell surface and cytofluorimetric analysis (FIG. 1).

[0207] Furthermore, as seen in FIGS. 2 and 3, mutated chains cannot associate with endogenous wild type chains, then mixed dimers are not formed. Indeed transfection of wild-type alpha chain and mutated beta chain or transfection of mutated alpha chain and wt beta chain generate TCRs that do not express the CD3 chain on T cell surface (FIGS. 2, 3).

[0208] Transfection-Mediated IL-2 Production

[0209] The mutant TCR chains do not interfere with the correct signal transduction after TCR engagement, as demonstrated by ELISA for the IL-2 production after T cell activation by RT 248-262 peptide (FIG. 4).

[0210] Transduction of Isolated T-Cells from Murine Splenocytes

[0211] T cells isolated from murine splenocytes were transduced by using retroviral vectors properly engineered and encoding a TCR specific for the melanoma antigen pMel (see material and methods) comprising the mutated chains as described above. The transduced TCR expression was assayed through cytofluorimetric analysis (FIG. 5). The percentage of Vb13 positive cells in the untransduced splenocytes (6.4%) correspond to the normal TCR variable repertoire, and the increase in this percentage up to 25% in the transduced cells means that the cells have been successfully infected and express the specific therapeutic TCR. The cytotoxic activity of the transduced cells against target cells loaded with the gp100.sub.25-33 peptide KVPRNQDWL (SEQ ID NO: 13) corresponding to the antigenic determinant pMel was measured through calcein release assay (FIG. 6). FIG. 6 shows the specific cytotoxic activity arising from the transduction with the TCR.

[0212] Fret Analysis was Performed on Splenocytes Infected with TCR OT-I which Recognizes the OVA 257-263 (SIINKFEL, SEQ ID NO: 32) Peptide.

[0213] FRET is a photo physical process involving a non-radioactive transfer of energy from an initially excited donor to a fluorescent acceptor, which in turns emits light at longer wavelength (Clegg R M, Murchie A I, Zechel A, Carlberg C, Diekmann S, Lilley D M. Biochemistry. 1992 May 26;31(20):4846-56). One of the main limit of this method is the spectral bleed-through contamination resulting from fluorescence overlap between the donor and the acceptor. To overcome this limit, in the present study, FRET analysis was performed by using acceptor photo bleaching technique. This represents a good tool to measure protein-protein interaction, without the problem that the acceptor emission bleed-through into the donor channel. The emission separation is achieved by choosing an appropriate optical band-pass filter, which transmits only the specific part of a fluorophore spectrum. Splenocytes transduced with wild type or mutated TCR were stained with monoclonal antibody specific for the murine variable region V2 conjugated with CF568, as donor, and monoclonal antibody specific for the murine variable region V5 conjugated with CF647, as acceptor. The data shown in FIG. 7 demonstrate a higher FRET SIGNAL with splenocytes infected with mutated TCR according to the invention, comprising SEQ ID NO:2 in the alpha chain and SEQ ID NO: 4 in the beta chain. The correct pairing of mutated alpha and beta chains was also assayed by FLIM analysis. The results illustrated in FIG. 8 confirm the FRET data and exclude that FRET signals were caused by the formation of homodimers.

[0214] Functional Activity of Transduced Splenocytes

[0215] Splenocytes transduced with wild type or mutated TCRs were also analyzed for their ability to recognize target cells. In particular the IFN production by transduced splenocytes cocultured with antigen presenting cells pre-pulsed with the OVA peptide was assayed. The results illustrated in FIG. 9 show the higher IFN production by CD8+ splenocytes transduced with the retroviral vector encoding for the mutated TCR in comparison to CD8+ T cells transduced with the wt TCR. Moreover, the specificity of the transduced splenocytes was also assayed towards B16 melanoma cells expressing the ovalbumin protein. As shown in FIG. 8 only CD8+ T cells transduced with the mutated TCR were able to produce IFN when cocultured with Ovalbumin expressing B16 melanoma cells. These results demonstrate that the mutations introduced in TM regions of alpha and beta chains confer an improved functional activity of the transduced TCR specificity as a result of an ameliorated pairing ability of alpha and beta mutated TCR chains.

[0216] Results

[0217] The invention described herein provides an efficient strategy to induce the correct formation of heterodimeric alpha and beta chains of TCR while excluding the formation of unwanted mixed heterodimers or non-functional homodimeric TCRs. The inventors accomplished this by introducing specific mutations in the transmembrane regions of TCR alpha and beta chains, mimicking a key motif that has been demonstrated to possess a number of interesting structural implications in the Ig TMD dimer assembly and, in turn, in the function of BCR.

[0218] To this purpose, using molecular modelling the inventors identified three residues in the transmembrane regions of TCR alpha and beta chains which, when replaced with two hydrophobic (phenylalanine) residues and one polar (serine or threonine) could mimic the motif described for the immunoglobulin heavy chains. In addition, on the basis of sequence alignment and 3D modelling of mouse and human transmembrane regions mutated as above, the authors identified single residue functionalities not involved in the assembly of mutated TCR pairing chains but candidate for optimal interaction with CD3 complex molecule (FIG. 11). It was demonstrated that the introduction of an I/M substitution in the human alpha chain significantly improved its expression on the cell surface (FIG. 10). The experiment in FIG. 10 clearly demonstrates that the percentage of CD3 positive cells measured 24 hours after the infection with retrovirus encoding the mutant TCR comprising in the mutated alpha chain the additional I/M mutation is significantly higher than the percentage of CD3 positive cells measured in the experiment with the mutated alpha chain not comprising the I/M mutation.

[0219] The introduced phenylalanine residues stabilize two pairs of inter-chain hydrophobic interactions strengthened by an H bond connecting the serine residues. The introduction of reciprocal mutations that sustain the steric and electrostatic environment within the constant domain of TM regions modified complementarity such that almost exclusively the exogenous

[0220] TCRs chains pair together. The hydrophobic phenylalanine residues and the polar serine residue have to be introduced into both TCR chains to provide the inter-helical interactions. Mutant chains are unable to associate with endogenous wild type chains, thereby the formation of hybrid TCRs is avoided.

[0221] Since it is known that both alpha and beta TCR chains are necessary to associate with the CD3 complex the inventors hypothesized that unwanted homodimers cannot be exported to the cell surface and therefore would not interfere with the present procedure The presence of homodimers has never been reported, probably because the TCR CD3 complex is expressed on the surface upon correct folding, and this happens only when the heterodimer is associated to TCR.

[0222] As a consequence, the inventors reasoned that, once the designed mutations were appropriately introduced into TCR-chains-expressing vectors, it could be possible to monitor if and when the correct association of functionally active TCR complexes was achieved. For this purpose it was used a previously described system based on transfections in hybridoma T cells deprived of endogenous TCR chains followed by antibody staining of transfected cell surfaces and cytofluorimetric analysis [8].

[0223] More specifically, by using all possible pairwise combinations of equal amounts of wild type and/or mutated alpha and/or mutated beta chain vector DNA, it was possible to: [0224] Compare mock transfections with transfections of wild type alpha and beta chains in homo or hetero combinations to obtain information on correctness of the procedure and baseline and reference values for the other experiments. Baseline values correspond to CD3 expression in negative samples (mean of fluorescence intensity about 200). Reference value is the CD3 expression with wt TCR. [0225] Transfect mutated alpha and beta chains to ascertain the ability to form correct heterodimers. Furthermore functional TCR formation can be assessed in the appropriate cellular background by monitoring IL-2 production after TCR activation. [0226] Transfect mutant alpha alone or mutant beta alone to monitor unwanted homodimers formation. [0227] Transfect wild type and mutant chains of opposite alpha/beta types to monitor unwanted mixed WT-Mutant heterodimers.

[0228] Experiment design and results output are summarized in the following Table 1.

TABLE-US-00004 TABLE 1 Output of the expected results of transfection experiment Alpha WT Alpha Mut Beta WT Beta Mut Alpha WT Provides Baseline values Alpha MUT Assessment of Assessment of unwanted mixed unwanted (non- (non-functional) functional) homodimers homodimers Beta WT Provides Assessment of Provides Baseline Reference values unwanted mixed values heterodimeric TCRs Beta Mut Assessment of Assessment of Assessment of Assessment of unwanted mixed correct TCR unwanted unwanted heterodimeric formation mixed (non- homodimers TCRs functional) homodimers

[0229] The efficacy of the present methodology was further demonstrated by the analysis of the functional activity of isolated T cells from splenocytes of C57BL/6 mice (Charles River, Lecco, Italy) and transduced with a retroviral vector encoding for the mutated TCR chains.

[0230] Further proofs of concept were collected on the functional activity of mutated TCR according to the invention. In particular, using FRET analysis the inventors demonstrated the preferential pairing of mutated TCR. These results were confirmed by FLIM analysis, which show at single cell level the consistency of the preferential pairing of alpha and beta mutated chains in respect to wild type chains.

[0231] Moreover, the functional activity of mouse splenocytes transduced with the mutated chains and co-cultured with target cells displaying an antigen specifically recognized by the transduced TCR was analyzed in vitro by measuring IFN production.

REFERENCES

[0232] 1) Kochenderfer J N and Rosenberg S A (2013). Nat Rev Clin Oncol 5: 267-76

[0233] 2) Bendle G M, et al. (2010) Nat Med 5: 565-70

[0234] 3) Merhavi-Shoham E et al. (2012). Semin Cancer Biol 22(1):14-22

[0235] 4) Haga-Friedman A, Horovitz-Fried M, Cohen C J (2012) J Immunol 188(11):5538-46

[0236] 5) O'Shea E, Lumb K, Kim P. (1993) Current Biology 3(10):658-667

[0237] 6) Chang H C et al. (1994) Proc Natl Acad Sci U S A 91(24):11408-12.

[0238] 7) Varriale S, et al. (2010) Mol Phylogenet Evol 57: 1238-44

[0239] 8) Caivano A et al. (2011) J Immunol Methods 255(1-2):125-34.

[0240] 9) Kerkar S P et al. (2011) J Immunother 34(4): 343-52

[0241] 10) Paul W E, Fundamental Immunology Lippincot Raven publisher

[0242] 11) Sartorius, R., et al. (2008) J of Immunol 180:3719-3728.

[0243] 12) Yang Sl, et al. (2008) Gene Ther. November; 15(21):1411-23.

[0244] 13) Kerry S. Campbell et al. (1994) Sem Immunol (6):393-410.

[0245] 14) Schodin B. A., Tsomides T. J., Kranz D. M. (1996). Immunity 5 137-146

[0246] 15) Uckert, W., Schumacher T. N. (2009) Cancer Immunol. Immunither. 58: 809-822

[0247] 16) Varela-Rohena, A., Molloy P. E., Dunn S. M. et al (2008) Nat. Med. 14:1390-1395.

[0248] 17) Sartorius R, et al. (2011) Eur. J. Immunol. 41 (9):2573-84.

[0249] 18) Cohen C J et al. (2007) Cancer Res; 67:3898-903.

[0250] 19) Sommermeyer D., Uckert W. (2010) J. Immunol. 184:6223-31.

[0251] 20) Sebestyen Z., Schooten E., Sals T., et al. (2008) J. Immunol. 180: 7736-7746.

[0252] 21) Chung S et al Proc Natl Acad Sci USA (1994), 91:12654-8.

[0253] 22) Okamoto S et al. (2009) Cancer Res; 69:9003-11.

[0254] 23) Bendle G M et al., (2010) Nat Med;16(5):565-70.

[0255] 24) Heemskerk, M. H et al (2003) Blood 102:3530-3540.

[0256] 25) Pascolo, S et al. (1997) J. Exp. Med. 185 (12) 2043-2051.

[0257] 26) Kerkar S P, et al. (2011) J Immunother. May; 34(4):343-52.