METHOD FOR PREPARING A GENE KNOCK-OUT CANINE WITH SOMATIC CELL CLONING TECHNOLOGY

Abstract

The present invention relates to a method for preparing a gene knock-out canine with use of somatic cell cloning technology, in particular relates to a method for preparing a gene knock-out canine with use of somatic cell cloning technology using a fusion liquid of low osmotic pressure together with autologous embryo transplanting.

Claims

1. A somatic cell cloning method of a gene knock-out canine, comprising the following steps: (1) preparing a targeting gene knock-out somatic cell as a nuclear donor; (2) preparing an enucleated oocyte from a receptor female canine; (3) introducing a gene knock-out somatic cell into cytoplasm of the enucleated oocyte and constructing a cloned embryo; (4) activating the cloned embryo; (5) transplanting the cloned embryo obtained in step (4) to the receptor female canine; wherein the enucleated oocyte is obtained from the embryo flushed fallopian tube of a receptor female canine of which only one of fallopian tubes has been embryo flushed, and, in step (5), the cloned embryo is transplanted into the fallopian tube of the receptor female canine, which is not embryo flushed.

2. The method according to claim 1, wherein in step (2) for preparing the enucleated oocyte from the receptor female canine, a female canine having a keratinocyte ratio above 80-90% and a progesterone level up to about 4-7 ng/mL is used as a receptor female canine under ovulatory period.

3. The method according to claim 2, wherein after 72 h-120 h of ovulation, single side embryo flushing is carried out to obtain a matured oocyte, then enucleating the matured oocyte.

4. The method according to claim 1, wherein the targeting gene knock-out somatic cell is a somatic cell of a gene knock-out canine obtained by knocking-out an endogenous gene of a canine oosperm with the use of gene knock-out technology, and the somatic cell is a gene knock-out somatic cell whose targeting gene is completely silenced via identification.

5. The method according to claim 1, wherein the targeting gene knock-out somatic cell is a gene knock-out somatic cell obtained by knocking-out an endogenous gene of a canine somatic cell with the use of gene knock-out technology, and selecting the gene knock-out somatic cell, whose targeting gene is completely silenced via identification.

6. The method according to claim 1, wherein the gene knock-out technology of the targeting gene knock-out is selected from clustered regularly interspaced short palindromic repeat sequences technology (CRISPR/Cas9), Zinc finger nuclease technology (ZFN), transcriptional activator effector nuclease technology (TALENs) and homologous recombination technology.

7. The method according to claim 1, wherein in step (3), the gene knock-out somatic cell is introduced into the cytoplasm of the enucleated oocyte through electrofusion with use of a fusion liquid having an osmotic pressure of 200 mOSM-280 mOSM.

8. The method according to claim 7, wherein in step (3), the gene knock-out somatic cell is introduced into the cytoplasm of the enucleated oocyte through electrofusion with use of a fusion liquid having an osmotic pressure of 240 mOSM.

9. The method according to claim 7, wherein the fusion liquid is composed of 0.2-0.28M mannitol, 0.1 mM MgSO4, 0.5 mM Hepes and 0.05% BSA.

10. The method according to claim 1, wherein in step (3), the gene knock-out somatic cell is introduced into the cytoplasm of the enucleated oocyte through electrofusion under a voltage of 2-4 kv/cm.

11. The method according to claim 1, wherein the somatic cell is from the following tissues or organs: fetal tissue, skin, muscle, ear, breast, fallopian tube, ovary, blood, urine, fat, marrow, blood vessel and endothelium of the lumen.

12. The method according to claim 11, wherein the somatic cell is selected from fetal fibroblast, skin cell, epithelial cell, ear cell, fibroblast, endothelial cell, muscle cell, breast cell, fallopian tube cell, ovary cell, cumulus cell, nerve cell and osteoblast.

13. The method according to claim 1, wherein the method comprises the following steps: (1) preparing an APOE gene knock-out somatic cell as a nuclear donor; (2) preparing an enucleated oocyte from a receptor female canine; (3) introducing a gene knock-out somatic cell into the cytoplasm of the enucleated oocyte and constructing a cloned embryo; (4) activating the cloned embryo; (5) transplanting the cloned embryo obtained in step (4) into the receptor female canine; wherein APOE gene Exon3 of the APOE gene knock-out somatic cell comprises the following sequence: TABLE-US-00015 (SEQIDNO:1) cctggaccagggaggct; the enucleated oocyte is obtained from the embryo flushed fallopian tube of a receptor female canine of which only one of fallopian tubes has been embryo flushed, and, in step (5), the cloned embryo is transplanted into the fallopian tube of the receptor female canine, which is not embryo flushed.

14. The method according to claim 13, wherein the APOE gene Exon3 of the APOE gene knock-out somatic cell comprises the following sequence: TABLE-US-00016 (SEQIDNO:2) ctggagcgcgagctggagccgaaggtccagcaggagccctggaccaggga ggctctgggaggc.

15. The method according to claim 13, wherein the APOE gene Exon3 of the APOE gene knock-out somatic cell comprises the following sequence: TABLE-US-00017 (SEQIDNO:3) gatgctgggccgatgtgcagccggagccggagctggagcgcgagctggag ccgaaggtccagcaggagccctggaccagggaggctctgggaggeggcgc tggcccgcttctgggattacctgcgctgggtgcagacgctgtctgaccag gtgcaagagggcgtgctcaacacccaggtcacccaggaactgac.

16. The method according to claim 13, wherein the APOE gene knock-out somatic cell is ear fibroblast BGD-APOEKO-EF0 of the APOE gene knock-out beagle canine, which is deposited in China General Microbiological Culture Collection Center (CGMCC) on Mar. 1, 2017 with a CGMCC deposit No. 13804.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0054] FIG. 1 shows a sequence alignment of the characteristic sequence of APOE gene from ear tissue and tail tissue of two gene knock-out canines numbered 161207 and 170111 compared with wild type canine.

[0055] FIG. 2 shows a comparison of gene sequence peaks of ear tissue and tail tissue of the APOE gene knock-out canine-Apple numbered 161207 to those of the wild type canine numbered 161206.

[0056] FIG. 3 shows a sequence alignment of the APOE gene knock-out canine, i.e., the somatic cell donor canine, numbered 161207 to APOE gene knock-out cloning canines numbered 170502 (Long Long), 170610 and 170611, respectively.

[0057] FIG. 4 shows a comparison photograph of the APOE gene knock-out canine-Apple (FIG. 4A) numbered 161207 to the cloned canine Long Long (FIG. 4B) numbered 170502, 30 days after birth.

DETAILED DESCRIPTION OF THE INVENTION

[0058] Technical solutions of the present invention are further described in below through combining examples and drawings of the Description. These examples are for illustrating rather than setting limit to the scopes of protection of the present invention.

EXAMPLES

[0059] (1) Preparing an APOE Gene Knock-Out Canine

Preparing an APOE gene knock-out canine comprises the following steps:

[0060] (1) determining a targeting site sequence directed to a sequence of an exon based on the canine APOE gene sequence;

[0061] (2) synthesizing sgRNA sequence and the complementary sequence thereof according to the targeting site sequence determined in step (1), then the synthesized sequence is connected to skeleton vector to construct a sgRNA targeting vector;

[0062] (3) in vitro transcription of sgRNA targeting vector to obtain mRNA of sgRNA, and in vitro transcription of CRISPR/Cas9 to obtain mRNA;

[0063] (4) mixing mRNA of sgRNA and mRNA of CRISPR/Cas9 obtained in step (3) and then intracytoplasmic injection thereof into a fertilized ovum of the canine; and

[0064] (5) transplanting the fertilized ovum of the canine into the less bleeding side of fallopian tubes of a female canine of which both fallopian tubes have been embryo flushed.

[0065] The targeting site sequence can be determined directed to exon2 (Exon2: SEQ ID NO: 4), exon3 (Exon3: SEQ ID NO: 5) or exon4 (Exon4: SEQ ID NO: 6) of the APOE gene sequence. The targeting site sequence in the present example is the following sequence determined directed to exon3 (Exon3: SEQ ID NO: 5):

TABLE-US-00004 (SEQIDNO:7) 5-CCGGGTGGCAGACTGGCCAGCCC-3.

[0066] The sgRNA sequence and the complementary sequence synthesized in step (2) of the present example are:

TABLE-US-00005 sgRNAsequence: (SEQIDNO:8) ataGGGCTGGCCAGTCTGCCACCgt; and sgRNAcomplementarysequence: (SEQIDNO:9) taaaacGGTGGCAGACTGGCCAGCC.

[0067] The embryo transplanting has been carried out totally 13 times, transplanted to 13 receptors, and totally 13 baby canines are born (see the following Table 1), wherein the APOE gene mutating type of the male canine named Apple (161207) is that a fragment of 34 bp was deleted and a fragment of 17 bp was inserted at the same time, the canine is APOE gene homozygous double knock-out canine, the APOE protein starts mutation from the 37.sup.th amino acid, and the translation is terminated at the 63.sup.th amino acid (please refer to FIG. 1). FIG. 1 shows a result of APOE gene knock-out from ear tissue and tail tissue of two gene knock-out canines numbered 161207 and 170111 respectively compared with the wild canine. It can be seen that the ear tissue and tail tissue of the gene knock-out canine named Apple numbered 161207 have the featured sequence:

TABLE-US-00006 (SEQIDNO:1) cctggaccagggaggc.
FIG. 2 shows a comparison of gene sequence peaks of ear tissue and tail tissue of the APOE gene knock-out canine-Apple numbered 161207 to those of the wild canine numbered 161206. It is seen that ear tissue and tail tissue of the APOE gene knock-out canine-Apple numbered 161207 also possess the featured sequence:

TABLE-US-00007 TABLE 1 Result of Embryo Transplanting Numbers of Numbers Numbers of Gene Receptor Fertilized Ovum of Knock-Out Canine No. as Transplanted Offspring Canine FRA1115 8 0 0 FRA1121 4 0 0 FRA1126 5 0 0 FRA1118 1 0 0 FRA1124 5 4 1 FRA1123 6 1 0 FRA1129 7 1 0 FRA1024 8 0 0 FRA1130 6 2 0 FRA1139 2 1 0 FRA1137 2 6 1 FRA1140 8 0 0 FRA1146 3 1 0 Total 65 13 2

TABLE-US-00008 (SEQIDNO:1) cctggaccagggaggct

[0068] Blood lipid detection of APOE gene knock-out canine:

[0069] At three month old, blood is collected from the APOE gene knock-out canine-Apple (161207), and is centrifugated for separating serum. The contents of total cholesterol, triglyceride, high-density lipoprotein and low-density lipoprotein in serum were measured. The results show that compared with control canines (numbered 161205 and 161206, respectively), the contents of total cholesterol, triglyceride, high density lipoprotein and low density lipoprotein in serum of APOE gene knock-out canine are apparently higher than those for the control group (Table 2). It can be seen that the knocking-out of APOE gene causes abnormal metabolism of lipids in the gene knock-out canine, leading to significant increase of blood lipid, which further verifies that the present invention indeed obtains the APOE gene knock-out canine.

TABLE-US-00009 TABLE 2 Blood lipid detection result of APOE gene knock-out canine Canine No. 161207(APOE-/-) 161205(WT) 161206(WT) Total cholesterol 22.92 7.225 8.25 (mmol/L) Triglyceride (mmol/L) 2.25 1.505 0.86 High-density lipoprotein 8.80 5.535 6.08 (mmol/L) Low density lipoprotein 13.10 1.15 1.78 (mmol/L)

[0070] (2) Preparing a Somatic Cell of APOE Gene Knock-Out Canine

[0071] The Beagle canine-Apple (161207) prepared in the above (1) is the first APOE gene knock-out canine in the world (the fibroblast BGD-APOEKO-EF0 having all the genetic information thereof is deposited in China General Microbiological Culture Collection Center (CGMCC) on Mar. 1, 2017 with a CGMCC deposit No. 13804) prepared by Beijing Sinogene Biotechnology Co. Ltd. When taking skin tissues, using a shaving knife to shave fur around ear edge tissue of the canine to be collected, sterilizing with ethyl alcohol of 75%, scissoring about 1 cm.sup.2 of ear edge tissue of the canine with a sterilized scissor, putting thereof into a DMEM basic medium containing 100 IU/ml penicillin+100 IU/ml streptomycin, and taking it back to laboratory within 12 hrs.

[0072] The tissue block is first washed three times or more with PBS, and then washed 3 times with DMEM medium containing 5 double resistant (penicillin and streptomycin), fat tissue is removed carefully with an ophthalmic scissor for exposing dermal tissue. The skin tissue is transferred into another sterile culture container, and is cut with a scalpel into tissue blocks sized about 1 mm.sup.2. The tissue blocks are transferred to the bottom of the culture container with a ophthalmic forceps, spread out evenly with the tip of the gun, and then the culture container is turned over with addition of DMEM culture liquid containing FBS of 20% and 5 double resistant, and cultured in an incubator with 37 C., 5% CO.sub.2 and 100% humidity. After 7-8 hours, turning over the container, when the tissue blocks are adherent such that they are immersed completely by the medium for further culturing, the culture liquid is changed every 48 hours.

[0073] (3) Oestrous Identification of a Female Canine

[0074] In the present example, altogether 16 donor and receptor canines of oocytes are used, and oestrous identification is carried out through vagina smear and serum progesterone detection. Vagina smear is carried out every day for female canines entering the oestrous period, which includes inserting a saline infiltrated cotton rod of 5 cm long into vagina, smearing the sample onto a glass slide, after stained with Giemsa dye, and counting keratinization degree of the vagina epithelial cell under a microscope. When the keratinization degree is 80-90%, it is considered to be in the ovulatory period. When detecting the progesterone, 3 mL blood is collected and centrifugated for separating serum, a progesterone detecting instrument is used to detect progesterone content. When the progesterone value reaches 4-7 ng/mL, it is considered to be in the ovulatory period, after 72-120 hours of ovulation, matured oocytes are taken through flushing.

[0075] (4) Obtaining Matured Oocytes

[0076] First, 0.1 ml Quanmianbao (QFM mixture) is used to induce anesthesia of female canines, then isoflurane and ventilator are used to maintain anesthesia. The uterine tube conjunct area of ovary and uterus is exposed, a metal injecting needle having a round front end is inserted into the fallopian tube umbrella from the rupture of the ovarian bursa, and then the needle tube is fixed; an injecting needle is inserted into a fallopian tube at the uterine tube conjunct area, flushing the fallopian tube with TCM199 medium containing 10% FBS, a plastic tube of 3 cm long is punctured inside the uterus, fixed, and then flushing the ovum with embryo flushing liquid from the uterine tube conjunct area. The embryo flushing can be carried out at a reversed direction, but the needle tube at the end for receiving the embryo flushing liquid should have a diameter greater than that of the needle tube for inputting embryo flushing liquid. Female canines selected as receptors are subjected to embryo flushing at only one side of the fallopian tubes, the other side is reserved for embryo transplanting. Female canines are for reviving treatment at once when the embryo flushing is terminated, and is anesthesia again at the time of embryo transplanting. Other donor canines that only provide oocyte are subject to embryo flushing at both sides of the fallopian tubes, the obtained oocyte are used for somatic cell nucleus transplanting.

[0077] (5) Oocyte Ennucleation

[0078] The in vovo or in vitro collected matured oocyte is put into a DPBS solution containing 0.1% hyaluronidase, blowing and beating repeatedly with a pipette on a hot stage of 37 C. to remove cumulus cell. To observe under an inverted microscope by amplifying 200 times to select matured oocyte containing the first polar body.

[0079] The selected oocyte is put into HEPES buffered CR2aa microoperating liquid containing 10% FBS and 5 g/ml cytochalasin B, incubated 30 min to soften the cytoskeleton, then the first polar body, adjacent cytoplasm (less than 5%) and oocyte nucleus are removed with a microscopy injecting needle, then the enucleated oocyte is reserved in SOF medium. The first polar body and cytoplasm sucked out by the microscopy injecting needle are put into Hochest 33342 solution for staining, then observing whether the sucked cytoplasm contains cell nucleus under a fluorescent microscope and judging the enucleating efficiency. If the enucleating efficiency is above 90%, somatic cell injection can be carried out, otherwise, oocyte is stained with Hochest 33342, UV irradiated under fluorescent microscope to clearly remove the indicated cell nucleus.

[0080] (6) Nuclear Injection, Fusion and Activation of the Enucleated Oocyte

[0081] The enucleated oocyte is placed in a CR2aa microoperating liquid without CB, and then the selected donor cell is injected between zona pellucid and cytoplasm of the oocyte, the zona pellucid is point pressed slightly by the injecting needle such that the somatic cell and oocyte membrane bond closely for constructing reconstructed embryo. The reconstructed embryo is put into a fusion liquid (containing 0.24M mannitol, 0.1 mM MgSO4, 0.5 mM Hepes and 0.05% BSA) having an osmotic pressure of 240 mOSM, then is placed between paralleled electrodes of the fusion groove for electrofusion using ECM2001 (BTX) under a voltage of 3-3.6 kv/cm, pulsing two times, and under a condition of a pulsing interval of 10 s. After 30 min of fusion, using a stereomicroscope to observe the fusion of cytoplasm of oocyte and donor cell, and count the fusion efficiency. The reconstructed embryo identified as fusion is activated with a 10 mol/L ionomycin for 4 min, further activated with mSOF containing 2 mmol/L 6-DMAP for 4 hours, after the activating, embryo transplanting is under preparation. See the following Table 3, it can be seen that during embryo fusion, using a fusion liquid having an osmotic pressure of 24 mOsm can maintain a fusion ratio of above 70%; while the fusion ratio is only about 50% with a commonly used fusion liquid having an osmotic pressure (300 mOsm) in the prior art.

TABLE-US-00010 TABLE 3 Influence of fusion liquid osmotic pressure on fusion ratio Fusion Liquid Osmotic Times of Electro Number of Fusion Pressure (mOsm) shock to embryo Fusion Embryo ratio 240 61 45 73% 300 43 7 53.4%

[0082] (7) Embryo Transplanting

[0083] After anaesthesia in the receptor canines, the abdominal wall that was not embryo flushed is selected and the ovary tissue that was not embryo flushed is exposed, and the uterus and ovary are pulled out. The cloned embryo is sucked into an embryo transplanting tube; the embryo transplanting tube is inserted from umbrella portion of the fallopian tube for transplanting the embryo into the receptor. Referring to Table 4, B ultrasonic examination is carried out after 25 days of embryo transplanting, the embryo transplanting result shows that using autologous/allogenic embryo transplanting significantly increases pregnant rate. The present experiment uses totally 4 transplanting receptors, of which 2 are pregnant and altogether 3 cloned canines are born.

TABLE-US-00011 TABLE 4 Summary of embryo transplanting No. of No. of the Donor Born No. of Canines No. of Cloned Number and Receptor (Including Transplanted Baby Name of the Cloned Canine receptors) Embryo Canines Baby Canines NTR1217 9 21 1 170502(Long Long) NTR1243 2 7 2 170610 170611 NTR1252 2 9 0 NTR1256 3 7 0 In Total 16 44 3

[0084] (8) Microsatellite Identification of the Cloned Canines

[0085] In order to determine whether the born cloned baby canines and the somatic cell donor canine-Apple (numbered: 161207) have the same genetic information, and determine the genetic relationship with the embryo transplanting receptor female canine, the method of microsatellite identification is used to identify the genetic relationship of the above three. 14 microsatellite sites are selected, and are: PEZ2, PEZ3, PEZ5, PEZ6, PEZ8, PEZ12, PEZ15, PEZ20, PEZ21, FH2011, FH2054, FH2079, FH2132, FH2611 and VWFX. This identification was implemented by DNA laboratory of Nanchang Patrol Dog Base of Ministry of Public Security.

[0086] In the first identification, the submitted sample from Apple numbered 161207 is used as the sample No. 1, the cloned baby canine Long Long numbered 170502 delivered by the receptor canine NTR1217 is used as the sample No. 2, and the receptor canine NTR1217 is used as the sample No. 3; the identity between sample No. 2 and sample No. 1 is identified, and the parenthood between the sample No. 2 and the sample No. 3 is identified.

[0087] Using a sampler to take two parts from each sample as parallel controls, and a canine STR fluorescent detecting kit is used for PCR amplification. The amplification product is subjected to electrophoresis and typing with use of AB131030 genetic analyzer.

[0088] STR polymorphism testing result: upon comparison, the STR typing of canine sample No. 2 and the canine sample No. 1 is consistent; and the canine sample No. 2 and the canine sample No. 3 do not match at multi-locus including PEZ2, FH2054, FH213 and PEZ15.

[0089] In the second identification, the submitted sample of Apple numbered 161207 is used as the sample No. 2, the cloned baby canine numbered 170610 delivered by the receptor canine NTR1243 is used as the sample No. 3, the cloned baby canine numbered 170611 delivered by the receptor canine NTR1243 is used as the sample No. 4, and the receptor canine NTR1243 is used as the sample No. 1; identifying the identity of the sample No. 1, the sample No. 3, the sample No. 4 and the sample No. 2, and the parenthood between the sample No. 3 and the sample No. 1.

[0090] Using a sampler to take two parts from each sample as parallel controls, and a canine STR fluorescent detecting kit is used for PCR amplification. The amplification product is subjected to electrophoresis and typing with use of AB131030 genetic analyzer.

[0091] STR polymorphism testing result: upon comparison, the locus data of samples No. 3 and No. 4, and the sample No. 2 are matched; and samples No. 3 and No. 4, and the sample No. 1 do not match at multi-locus including PEZ12, PEZ15, etc.

[0092] The identification result shows that the cloned canine Long Long numbered 170502, the cloned canine numbered 170610, the cloned canine numbered 170611 and the cell donor Apple numbered 161207 have consistent typing at all microsatellite sites, but are not matched with the receptor canines NTR1217 and NTR1243 for embryo transplanting at sides including PEZ2, PEZ5, PEZ6, PEZ8, PEZ12, PEZ15, PEZ20, FH2011, FH2054, FH2079, FH2132, FH2611 and VWFX (referring to the following Table 5), proving that the cloned canine Long Long numbered 170502, the cloned canine numbered 170610 and the cloned canine numbered 170611 are the cloned canines of the cell donor canine Apple numbered 161207. FIG. 4 is a comparison picture of the APOE gene knock-out canine-Apple (FIG. 4A) numbered 161207 to the cloned canine Long Long (FIG. 4B) numbered 170502, 30 days after birth.

TABLE-US-00012 TABLE 5 the microsatellite identification result of the cloned canines Canine No. NTR1217 NTR1243 161207 170502 170610 170611 (embryo (embryo Microsatelite (Apple, (Long Long, (cloned (cloned transplanting transplanted site donor canine) cloned canine) canine) canine) receptor) receptor) PEZ2 171/171 171/171 171/171 171/171 183/183 159/183 PEZ3 185/185 185/185 185/185 185/185 185/185 185/185 PEZ5 262/266 262/266 262/266 262/266 262/262 262/262 PEZ6 263/263 263/263 263/263 263/263 263/267 PEZ8 344/349 344/349 344/349 344/349 340/349 344/351 PEZ12 296/308 296/308 296/308 296/308 296/308 298/308 PEZ15 178/186 178/186 178/186 178/186 182/192 193/193 PEZ20 120/124 120/124 120/124 120/124 120/120 120/128 PEZ21 132/132 132/132 132/132 132/132 132/132 132/132 FH2011 215/215 215/215 215/215 215/215 215/223 215/215 FH2054 130/130 130/130 130/130 130/130 126/138 122/126 FH2079 263/263 263/263 263/263 263/263 275/275 275/275 FH2132 282/298 282/298 282/298 282/298 290/330 282/300 FH2611 236/244 236/244 236/244 236/244 236/238 236/236 VWFX 186/192 186/192 186/192 186/192 192/192 186/192

[0093] (9) APOE Gene Knock-Out Identification of the Cloned Canines

[0094] In order to determine whether the cloned baby canines are APOE gene knock-out canines, i.e., the same as the somatic cell donor canine-Apple (numbered 161207). The tail tissues of the cloned canine Long Long numbered 170502, and the cloned canine numbered 170610 and 170611 respectively are used for identification. After the tissue block is fragmented in a centrifugation tube, protease K is added for water bath at 56 C. and cleavage for 1-3 h. Then 700 l of Genomic Lysis Buffer sucked with a pipette is added to the cleavage system, mixing homogeneously through turning upside down, and then 10,000 g centrifugation for 1 min. The supernatant was sucked to a purifying column with a pipette, 10,000 g, standing for 1 min at room temperature. A new collection tube was replaced, and 200 l DNA Pre-Wash Buffer was added to the centrifugation column, 10,000 g, followed by standing for 1 min at room temperature, centrifuging for 1 min, and discarding wasted liquid. 400 l g-DNA Wash Buffer was added to the centrifugation column, 10,000 g, standing for 1 min at room temperature, centrifuging for 1 min, and discarding the wasted liquid. The purifying column and the collecting tube are re-centrifugated, 10,000 g, centrifuging for 2 min. The purifying column was placed in a newly replaced 1.5 ml centrifugation tube, 50 l Elution Buffer was added to elute DNA, followed by standing for 2 min at room temperature, and then 12,000 rpm, centrifuging for 1 min. The obtained solution is canine genomic DNA.

[0095] The canine genomic DNA was used as a template to carry out PCR, and the primers are as follows:

TABLE-US-00013 (SEQIDNO:10) F:5-CATTGTTGTCAGGCAGGTAGC-3; (SEQIDNO:11) R:5-GAAGGGTGCGAGGGATTGA-3.

[0096] After amplification, a DNA fragment of total 660 bp at the upstream and downstream of the recognition and cleavage targeting site of sgRNA. The target fragment obtained by PCR amplification was subjected to DNA sequencing, and aligned with the canine APOE gene sequence provided by the NCBI database to determine the mutation type of the APOE gene. The result shows that the cloned canine Long Long numbered 170502 and the cloned canines numbered 170610 and 170611 respectively have consistent APOE gene mutating type with the somatic cell donor canine named Apple and numbered 161207 (referring to Table 6 and FIG. 3 and FIG. 4).

TABLE-US-00014 TABLE6 Alignmentofthegenemutatingsequencesfortheclonedcanines GeneMutating GeneType TargetingSequence Type wildtype AGCTGGAGCCAGAGGCCGGGTGGCAGACTGGCCAGCCCTG GGAGGCGGCGCTG 161207(Apple) AGC-------------------- Deleting34bp, CCTGGACCAGGGAGGCT----------CTGGGAGGCGGCGCTG Adding17bp 17050(Long AGC-------------------- Deleting34bp, Long) CCTGGACCAGGGAGGCT----------CTGGGAGGCGGCGCTG Adding17bp 170610 AGC-------------------- Deleting34bp, CCTGGACCAGGGAGGCT----------CTGGGAGGCGGCGCTG Adding17bp 170611 AGC-------------------- Deleting34bp, CCTGGACCAGGGAGGCT----------CTGGGAGGCGGCGCTG Adding17bp

[0097] It can be seen from the above result that preparing gene knock-out canines with somatic cell nucleus transplanting technology and using somatic cell identified to be gene knock-out as nuclear donor, all the offspring cloning canines are gene knock-out, having a knock-out efficiency of up to 100%. The mutating type can be determined by identifying the donor cell, and the gene knock-out effect is stable without existence of any chimera by selecting the somatic cell, whose targeting gene is completely silenced, for cloning.