A NITRILASE MUTANT AND APPLICATION THEREOF IN THE SYNTHESIS OF 1-CYANOCYCLOHEXYL ACETIC ACID

20220372531 · 2022-11-24

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides a nitrilase mutant and application thereof in the synthesis of 1-cyanocyclohexyl acetic acid, the nitrilase mutant is obtained by mutating one or two of the amino acids at position 180 and 205 of the amino acid sequence shown in SEQ ID No. 2. In the present invention, by semi-rational design and protein molecular modification, the specific enzyme activity of the nitrilase double mutant AcN-G180D/A205C was increased by up to 1.6 folds, and the conversion rate>99%. And the reaction time was shortened to a quarter of the original using the recombinant Escherichia coli containing the nitrilase mutant to hydrolyze 1-cyanocyclohexylacetonitrile at high temperature (50° C.). Therefore, the mutants obtained by the present invention have a good application prospect in efficiently catalyzing 1-cyanocyclohexylacetonitrile to synthesize gabapentin intermediate, 1-cyanocyclohexyl acetic acid.

    Claims

    1.custom-character A nitrilase mutant, wherein the mutant is obtained by mutating one or two of the amino acids at position 180 and 205 of the amino acid sequence shown in SEQ ID No. 2.

    2.custom-character The nitrilase mutant as claimed in claim 1, wherein the mutant is obtained by: (1) mutating glycine at position 180 of the amino acid sequence shown in SEQ ID No. 2 into aspartic acid; (2) mutating glycine at position 180 of the amino acid sequence shown in SEQ ID No. 2 into phenylalanine; (3) mutating alanine at position 205 of the amino acid sequence shown in SEQ ID No. 2 into cysteine; or (4) mutating glycine at position 180 and alanine at position 205 of the amino acid sequence shown in SEQ ID No. 2 into aspartic acid and cysteine, respectively.

    3.custom-character An encoding gene of the nitrilase mutant as claimed in claim 1.

    4.custom-character A recombinant genetically engineered strain transformed by the encoding gene of the nitrilase mutant as claimed in claim 3.

    5. An application of the nitrilase mutant as claimed in claim 1 in catalyzing 1-cyanocyclohexylacetonitrile to prepare 1-cyanocyclohexyl acetic acid.

    6. The application as claimed in claim 5, wherein the application is carried out as follows: use wet cells, wet cell-immobilized cells or a purified nitrilase as a catalyst, 1-cyanocyclohexylacetonitrile as a substrate, and a pH4.0-10.5, 200 M phosphate buffer as a reaction medium, carry out the reaction in a constant temperature water bath at 20-60° C. and 600 rpm, after the reaction is completed, subject the reaction solution to separation and purification to obtain 1-cyanocyclohexyl acetic acid; in which, the wet wells are obtained by fermentation culture of a genetically engineered strain containing the nitrilase mutant, the purified nitrilase is obtained by subjecting the wet cells to ultrasonic breaking and then extraction.

    7. The application as claimed in claim 5, wherein the final concentration of the substrate calculated by the volume of the reaction system is 5-1000 mM, the amount of the purified nitrilase calculated by the volume of the reaction medium is 0.1-3 mg/mL, and the specific enzyme activity is 160˜170 U/g; and when using the wet cells or the wet cell-immobilized cells as the catalyst, its amount calculated by the weight of the wet cells per unit volume of the buffer is 10-100 g/L.

    8. The application as claimed in claim 5, wherein the wet cells are prepared according to the following method: the genetically engineered strain containing the nitrilase mutant is inoculated into LB medium, cultured at 37° C. for 10-12 hours, the resulting inoculum is inoculated to LB medium containing kanamycin with the final concentration of 50 mg/L and 1% incubating volume and cultured at 37° C.; when OD.sub.600 of the culture medium reaches 0.6-0.8, isopropyl-β-D-thiogalactopyranoside is added with the final concentration of 0.1 mM, and the bacteria solution is subjected to induced expression at 28° C. for 10 hours; the wet cells are harvested by centrifugation and washed with normal saline twice, thereby obtaining the wet cells.

    9.custom-character The application as claimed in claim 5, wherein the purified nitrilase is prepared according to the following method: the wet cells of the genetically engineering strain containing the nitrilase mutant are resuspended with a pH 7.0, 100 mM NaH.sub.2PO.sub.4-Na.sub.2HPO.sub.4 buffer and ultrasonic broken under the conditions of 400 W, 20 min, 1 s breaking and 1 s pause, the broken product is subjected to centrifugation, and the resulting supernatant is taken as a crude enzyme solution; the crude enzyme solution is applied onto the Ni-NTA column at a flow rate of 1 mL/min which has been washed with a binding buffer, the weakly adsorbed protein impurities are eluted with an equilibrium buffer at a flow rate of 2 mL/min; then the target protein is eluted with a protein elution buffer at a flow rate of 2 mL/min and collected; finally, the obtained target protein is dialyzed with a 20 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer as the dialysate, and the retention is the purified nitrilase; wherein the binding buffer is a pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing NaCl with the final concentration of 300 mM, the equilibrium buffer is a pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing NaCl and imidazole with the final concentrations of 300 mM and 50 mM, the elution buffer is a pH 8.0, 50 mM NaH.sub.2PO.sub.4 buffer containing NaCl and imidazole with the final concentrations of 300 mM and 500 mM.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0019] FIG. 1 is a histogram of enzyme activity of the different mutants.

    [0020] FIG. 2 is an SDS-PAGE of the nitrilase E. coli BL21(DE3)/pET-28b(+)-AcN and its mutant transformants E. coli BL21(DE3)/pET-28b(+)-AcN-G180D, E. coli BL21(DE3)/pET-28b(+)-AcN-G180F, E. coli BL21(DE3)/pET-28b(+)-AcN-A205C and the double mutant E. coli BL21(DE3)/pET-28b(+)-SDS-PAGE of AcN-G180D/A205C, wherein lane 1 is AcN crude enzyme solution, lane 2 is G180D/A205C crude enzyme solution, lane 3 is AcN purified enzyme solution, lane 4 is G180D/A205C purified enzyme solution, lane 5 It is G180D crude enzyme solution, lane 6 is G180F crude enzyme solution, lane 7 is A205C crude enzyme solution, lane 8 is G180D purified enzyme solution, lane 9 is G180F purified enzyme solution, and lane 10 is A205C purified enzyme solution.

    [0021] FIG. 3 is a comparison curve diagram of enzyme activity of the nitrilase and its mutants.

    [0022] FIG. 4 is a curve diagram of the optimal temperature of the nitrilase double mutant E. coli BL21(DE3)/pET-28b(+)-AcN-G180D/A205C.

    [0023] FIG. 5 is a curve diagram of the optimal pH of the nitrilase double mutant E. coli BL21(DE3)/pET-28b(+)-AcN-G180D/A205C.

    [0024] FIG. 6 is the reaction process of nitrilase AcN-F168V and its double mutant.

    SPECIFIC EMBODIMENT

    [0025] The present invention is further illustrated below with specific examples, but protection scope of the present invention is not limited to these examples:

    Example 1: Site-Directed Mutation and Screening

    [0026] 1. Selecting Mutation Sites

    [0027] The present invention used site-directed mutation technology to carry out site-directed mutation at position 168 of the encoding gene of the nitrilase (GenBank Accession no.: AHW42593.1) derived from A. facilis CCTCC NO: M 029044 to obtain E. coli BL21(DE3)/pET-28b(+)-AcN-F168V (referring to Zhang XH, et al. Activity improvement of a regioselective nitrilase from Acidovorax facilis and its application in the production of 1-(cyanocyclohexyl) acetic acid[J]. Process Biochemistry, 2014.). Based on this, The present invention mainly aimed at the amino acid site on “A surface” as the mutation site. After successful site-directed mutation by whole-plasmid PCR, the expression vector containing the target gene was transferred into the Escherichia coli host. The positive mutants were screened out by enzyme activity detection method after induced expression, and subjected to second detection to identify the mutants with increased enzyme activity, thereby obtaining mutant proteins which has self-assembly tendency and can efficiently catalyze regioselective hydrolysis of dinitrile to produce monocyanocarboxylic acid compound.

    [0028] 2. Single Mutation

    [0029] The plasmid pET-28b(+)-AcN-F168V containing the nitrilase gene AcN-F168V (the nucleotide sequence shown in SEQ ID No.1, and the amino acid sequence shown in SEQ ID No.2) derived from A. facilis CCTCC NO:M 029044 was used as a template, and the site-directed mutation was carried out by whole-plasmid amplification. The PCR system (50 μL) was as follows: 0.5-20 ng of the template, 10-15 pmol of each primer (G180-f and A205-f, whose sequences is seen in in table 1), 5×PrimeSTAR Buffer (Mg2+ plus), 0.2 mM dNTP, and 1.25 U PrimeSTAR HS DNA Polymerase. The PCR program was as follows: (1) pre-denaturation at 98° C. for 3 min; (2) denaturation at 98° C. for 10 s; (3) anneal at 55° C. for 5 s; (4) extension at 72° C. for 6.5 min, wherein steps (2)˜(4) were cycled 30 times; and (5) finally, extension at 72° C. for 5 min, preservation at 4° C. The PCR product was identified by agarose gel electrophoresis, digested with DpnI, and then introduced into the host strain E. coli BL21 (DE3) which was then plated on a LB plate containing 50 μg/mL kanamycin to obtain monoclones. A total of 23 single mutants obtained by the site-directed mutation were subjected to enzyme activity test, the method of the enzyme activity test was the same as that in example 4, and the result of the enzyme activity is shown in FIG. 1. Finally, the mutation transformants E. coli BL21(DE3)/pET-28b(+)-AcN-G180F (written as G180F), E. coli BL21(DE3)/pET-28b(+)-AcN-G180D (written as G180D) and E. coli BL21(DE3)/pET-28b(+)-AcN-A205C (written as A205C) with increased enzyme activity were screened out.

    TABLE-US-00001 TABLE 1 primer design table Substi- Mutant Sequences tution G180F 5’ ATGTACTCCCTGTTTGAACAGGTACAC3 ’ GGT to TTT G180L 5’ ATGTACTCCCTGCTTGAACAGGTACAC3 ’ GGT to CTT G180I 5’ ATGTACTCCCTGATTGAACAGGTACAC3 ’ GGT to ATT G180V 5’ ATGTACTCCCTGGTTGAACAGGTACAC3 ’ GGT to GTT G180Y 5’ ATGTACTCCCTGTATGAACAGGTACAC3 ’ GGT to TAT G180H 5’ ATGTACTCCCTGCATGAACAGGTACAC3 ’ GGT to CAT G180N 5’ ATGTACTCCCTGAATTAACAGGTACAC3 ’ GGT to AAT G180D 5’ ATGTACTCCCTGGATGAACAGGTACAC3 ’ GGT to GAT G180C 5’ ATGTACTCCCTGTGTGAACAGGTACAC3 ’ GGT to TGT G180R 5’ ATGTACTCCCTGCGTGAACAGGTACAC3 ’ GGT to CGT G180S 5’ ATGTACTCCCTGAGTGAACAGGTACAC3 ’ GGT to AGT A205F 5’ ACCTCCATCGAGTTCAATGCGACCGTA3 ’ GCT to TTC A205L 5’ ACCTCCATCGAGTTGAATGCGACCGTA3 ’ GCT to TTG A205I 5’ ACCTCCATCGAGATAAATGCGACCGTA3 ’ GCT to ATA A205V 5’ ACCTCCATCGAGGTTAATGCGACCGTA3 ’ GCT to GTT A205Y 5’ ACCTCCATCGAGTATAATGCGACCGTA3 ’ GCT to TAT A205H 5’ ACCTCCATCGAGCATAATGCGACCGTA3 ’ GCT to CAT A205N 5’ ACCTCCATCGAGAATAATGCGACCGTA3 ’ GCT to AAT A205D 5’ ACCTCCATCGAGGATAATGCGACCGTA3 ’ GCT to GAT A205C 5’ ACCTCCATCGAGTGTAATGCGACCGTA3 ’ GCT to TGT A205R 5’ ACCTCCATCGAGCGTAATGCGACCGTA3 ’ GCT to CGT A205S 5’ ACCTCCATCGAGTCTAATGCGACCGTA3 ’ GCT to TCT A205G 5’ ACCTCCATCGAGGGTAATGCGACCGTA3 ’ GCT to GGT

    [0030] 3. Combinatorial Mutation

    [0031] The plasmid pET-28b(+)-AcN-G180D containing the mutation transformant G180D (the nucleotide sequence shown in SEQ ID No.3) was used as a template, and site-directed mutation was carried out by whole-plasmid amplification. The PCR system was the same as that in the single mutation system. The PCR product was identified by agarose gel electrophoresis, digested with DpnI, introduced into the host strain E. coli BL21 (DE3) and then plated on a LB plate containing 50 μg/mL kanamycin, thereby obtaining the double mutation transformant which is the combinatorial mutant E. coli BL21(DE3)/pET-28b(+)-AcN-G180D/A205C (written as G180D/A205C).

    Example 2: Expression of the Nitrilase Mutant

    [0032] The plasmid pET-28b(+)-AcN-F168V containing the nitrilase gene AcN-F168V(shown in SEQ ID No.1) of Acidovorax facilis CCTCC NO:M 029044 was constructed. The constructed expression vector pET-28b(+)-AcN-F168V was transferred into E. coli BL21 (DE3) for overexpression. The plasmids were subjected to site-directed saturation mutation and recombination with expression vector pET-28b(+), and then the recombinant plasmids were transformed into E. coli BL21 (DE3) for constructing the mutants, E. coli BL21(DE3)/pET-28b(+)-AcN-G180F, E. coli BL21(DE3)/pET-28b(+)-AcN-G180D, E. coli BL21(DE3)/pET-28b(+)-AcN-A205C, the combinatorial mutant E. coli BL21(DE3)/pET-28b(+)-AcN-G180D/A205C and the original strain E. coli BL21(DE3)/pET-28b(+)-AcN-F168V (according to Zhang X H, et al. Activity improvement of a regioselective nitrilase from Acidovorax facilis and its application in the production of 1-(cyanocyclohexyl) acetic acid[J]. Process Biochemistry, 2014.). The obtained strains were respectively inoculated to LB medium and cultured at 37° C. for 10-12 h, the resulting inocula were respectively inoculated to LB medium containing kanamycin (with the final concentration of 50 mg/L) with 1% incubating volume, amplified and cultured at 37° C. and 150 rpm. When OD600 of the culture medium reached 0.6-0.8, isopropyl-β-D-thiogalactopyranoside (IPTG) was added with the final concentration of 0.1 mM to carry out induced expression at 28° C. for 10 hours. The wet cells were harvested by centrifugation and washed with normal saline twice. The immobilized cells were obtained by subjecting the wet cells to immobilization (according to the immobilization method in CN107177576A), and the purified nitrilase was obtained by subjecting the wet cells to ultrasonic breaking and then purification (according to the purification process in example 3).

    Example 3: Purification of the Nitrilase and its Mutants

    [0033] (1) Binding buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH 8.0) was added to the wet cells obtained in example 2, the cells were resuspended, ultrasonic broken (400 W, 20 min, 1 s breaking, 1 s pause) and centrifuged (8000 rpm, 15 min). The supernatant was a crude enzyme solution for separation and purification.

    [0034] (2) After pre-filling a 10 mL Ni-NTA affinity column, a binding buffer(50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH 8.0) was used to wash the column at a flow rate of 2 mL/min.

    [0035] (3) After the Ni-NTA column was washed with 8-10 column volume, the obtained crude enzyme solution was applied onto the Ni-NTA column at a flow rate of 1 mL/min, and the target protein bound to the column. After loading, a large amount of unbound protein impurities which did not bind to the resin would be directly removed.

    [0036] (4) The weakly adsorbed protein impurities were eluted with an equilibrium buffer(50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 50 mM imidazole, pH 8.0) at a flow rate of 2 mL/min.

    [0037] (5) The target protein was eluted with a protein elution buffer(50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 500 mM imidazole, pH 8.0) at a flow rate of 2 mL/min and collected.

    [0038] (6) The collected target protein was dialyzed (the MWCO of the dialysis bag is 30KDa) with a 20 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer as the dialysate, and the retention was the purified nitrilase.

    [0039] (7) The purified proteins were analyzed by SDS-PAGE, and the results of protein electrophoresis are shown in FIG. 2.

    Example 4 Activity Determination of the Nitrilases

    [0040] The activity of the purified nitrilases from example 3 was determined. A reaction system (10 mL) for nitrilase activity assay was as follows: a 100 mM, pH 7.0 sodium dihydrogen phosphate-disodium hydrogen phosphate buffer, 200 mM 1-cyanocyclohexylacetonitrile, and 30 mg of the purified nitrilase. The reaction solution was preheated at 45° C. for 10 min and then reacted at 150 rpm for 10 min. 500 μL of the supernatant was sampled, and 500 μL of 2 M HCl was added to terminate the reaction, and the conversion rate of 1-cyanocyclohexyl acetic acid was determined by liquid chromatography (Agilent) external standard method. The column was J&K Scientific C18-H column (4.6×250 mm, 5 μm, 120A), and the mobile phase was a buffer (0.58 g/L diammonium phosphate, 1.8375 g/L sodium perchlorate, pH was adjusted to 1.8 by perchloric acid, the solvent is deionized water and acetonitrile in a ratio of 76:24 (v/v), the flow rate was 1 mL/min, the ultraviolet detection wavelength was 215 nm, and the column temperature was 40° C. The results of relative enzyme activity of each mutant are shown in FIG. 3.

    [0041] Enzyme activity definition (U): the amount of enzyme required to catalyze the formation of 1 μmol of 1-cyanocyclohexyl acetic acid per minute at 45° C., in a pH 7.0, 100 mM sodium dihydrogen phosphate-disodium hydrogen phosphate buffer was defined as 1 U.

    Example 5: Determination of Kinetic Parameters of the Nitrilase and its Mutants

    [0042] The kinetic parameters of the purified protein in example 3 were determined, using 1-cyanocyclohexylacetonitrile as the substrate and the pure enzyme solutions of AcN-F168V, G180D, A205C, G180F, and G180D/A205C as the catalyst.

    [0043] 10 mL of the reaction system was as follows: the purified enzyme solution(165 U/g) was diluted 10 times with a pH 7.0, 20 mM phosphate buffer and the final concentration of the purified nitrilase was 0.2 mg/mL. The resulting enzyme solution was put into a reaction container, added with the substrate at final concentrations of 6.75-40.49 mM (6.75, 13.50, 20.24, 26.99, 33.74 and 40.49 mM, respectively) and added with a pH 7.0, 20 mM phosphate buffer as the reaction medium up to 10 mL, the reaction solution was reacted at 45° C. and 600 rpm for 5 min, 500 μL of the sample was taken out, 500 μL of 2 M HCl was added to terminate the reaction, and the concentration of 1-cyanocyclohexyl acetic acid in the reaction solution was determined by HPLC (The detection and analysis conditions are the same as that in example 4).

    [0044] Collected test data was used to conduct nonlinear fitting by Origin, thereby obtaining the K.sub.m value and K.sub.cat value of the nitrilase E. coli BL21(DE3)/pET-28b(+)-AcN-F168V and its combinatorial mutants E. coli BL21(DE3)/pET-28b(+)-AcN-G180D, E. coli BL21(DE3)/pET-28b(+)-AcN-G180F, E. coli BL21(DE3)/pET-28b(+)-AcN-A205C and E. coli BL21(DE3)/pET-28b(+)-AcN-G180D/A205C as shown in table 2. It can be found that the K.sub.cat of the double mutants is significantly improved compared with that of AcN, which indicates that the activity of the modified nitrilase is indeed increased, and their K.sub.m reflects a slight decrease in the affinity of the modified enzyme to the substrate.

    TABLE-US-00002 TABLE 2 Kinetic parameters of the nitrilase mutants Enzyme K.sub.m[mM] V.sub.max[mmolmg.sup.−1min.sup.−1] K.sub.cat[s.sup.−1] K.sub.cat/K.sub.m[mM.sup.−1h.sup.−1] AcN-F168V 16.25 ± 5.37  1.53 ± 0.19 5573s.sup.−1 342.95 G180D 3.21 ± 1.41 1.98 ± 0.13 6624s.sup.−1 2063.55 G180F 5.88 ± 1.58 2.35 ± 0.14 7612s.sup.−1 1294.56 A205C 3.40 ± 0.78  1.63 ± 0.059 8317s.sup.−1 2446.18 G180D/A205C 19.65 ± 7.40  4.78 ± 0.73 24139s.sup.−1  1228.45

    Example 6: Determination of Optimal Temperature of Nitrilase and its Mutants

    [0045] The optimal temperature of the purified protein in example 3 were determined, using 1-cyanocyclohexylacetonitrile as the substrate and the pure enzyme solution of nitrilase AcN-F168V (whose specific enzyme activity was 104 U/g calculated by the weight of the wet cells) or the nitrilase combinatorial mutant G180D/A205C (whose specific enzyme activity was 165 U/g calculated by the weight of the wet cells) as the catalyst.

    [0046] 10 mL of the reaction system was as follows: the collected purified nitrilase (165 U/g) was diluted 10 times with a pH 7.0, 20 mM phosphate buffer and the final concentration of the purified nitrilase was 0.2 mg/mL. The resulting enzyme solution was put into a reaction container, added with the substrate at a final concentration of 200 mM and added with a pH 7.0, 20 mM phosphate buffer as the reaction medium up to 10 mL, the reaction solution was reacted at 600 rpm for 10 min, the reaction temperature is 20-60° C.(20, 25, 30, 35, 40, 45, 50, 55 and 60° C., respectively), 500 μL of the sample was taken out, 500 μL of 2 M HCl was added to terminate the reaction, and the concentration of 1-cyanocyclohexyl acetic acid in the reaction solution was determined by HPLC. The results are shown in FIG. 4, and the optimal temperature of the double mutant is 50° C. Under the same conditions, the optimal temperature of the nitrilase AcN-F168V is 50° C.

    Example 7: Determination of the Optimal pH of the Nitrilase and its Mutants

    [0047] The optimal temperature of the purified protein in example 3 were determined, using 1-cyanocyclohexylacetonitrile as the substrate and the pure enzyme solution of nitrilase AcN-F168V (whose specific enzyme activity was 104 U/g calculated by the weight of the wet cells) or the nitrilase combinatorial mutant G180D/A205C (whose specific enzyme activity was 165 U/g calculated by the weight of the wet cells) as the catalyst.

    [0048] 10 mL of the reaction system was as follows: the purified enzyme solution of G180D/A205C (165 U/g) was diluted 10 times with a pH 7.0, 20 mM phosphate buffer and the final concentration of the purified nitrilase was 0.2 mg/mL. The resulting enzyme solution was put into a reaction container, added with the substrate at a final concentration of 200 mM and added with a 100 mM phosphate buffer as the reaction medium up to 10 mL, and the pH of the phosphate buffer was 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10 and 10.5, respectively. The reaction solution was reacted at 45° C. and 600 rpm for 10 min, 500 μL of the sample was taken out, 500 μL of 2 M HCl was added to terminate the reaction, and the concentration of 1-cyanocyclohexyl acetic acid in the reaction solution was determined by HPLC. The results are shown in FIG. 5, and the optimal pH of the double mutant is 8.5. Under the same conditions, the optimal pH of the nitrilase AcN-F168V is 7.

    Example 8: Converting 200 mM Cyanocyclohexylacetonitrile by the Nitrilase and its Mutants

    [0049] The reaction process of the purified nitrilase and its mutants in example 3 were determined, using 1-cyanocyclohexylacetonitrile as the substrate and the pure enzyme solution of the nitrilase AcN-F168V (whose specific enzyme activity was 104 U/g calculated by the weight of the wet cells) or the nitrilase combinatorial mutant G180D/A205C (whose specific enzyme activity was 165 U/g calculated by the weight of the wet cells) as the catalyst.

    [0050] 10 mL of the reaction system was as follows: the collected purified enzyme solution was diluted 10 times with a pH 7.0, 20 mM phosphate buffer and the final concentration of the purified nitrilase was 0.2 mg/mL. The resulting enzyme solution was put into a reaction container, added with the substrate at a final concentration of 200 mM, and added with a pH 7.0, 20 mM phosphate buffer as the reaction medium up to 10 mL, the reaction solution was reacted at 45° C. and 600 rpm, 500 μL of the sample was taken out at different time, 500 μL of 2 M HCl was added to terminate the reaction, and the concentration of 1-cyanocyclohexyl acetic acid in the reaction solution was determined by HPLC. The reaction process of the nitrilase AcN-F168V and its mutant is shown in FIG. 6, and the conversion rate was over 99%. As shown in FIG. 6, the double mutant G180D/A205C could completely hydrolyze the substrate within 60 min, which is shorter than the nitrilase AcN-F168V.