Recombinant Ranavirus, Methods of Production, and Its Use as a Human Vaccine Vector
20190032080 ยท 2019-01-31
Inventors
Cpc classification
C12N2710/00051
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C12N2710/00043
CHEMISTRY; METALLURGY
International classification
Abstract
A vaccine vector comprising an attenuated, recombinant ranavirus that has at least one foreign expression element is disclosed. In other contemplated embodiments, a vaccine vector comprising a virus, wherein the virus is engineered to express at least two vaccine antigens is disclosed. In addition, methods of delivering human antigens to a mammal are disclosed that include: providing a non-mammalian virus, engineering a recombinant virus that can express at least one foreign molecule by modifying the non-mammalian virus, and using the recombinant ranavirus to deliver human antigens to a mammal.
Claims
1. A vaccine vector comprising an attenuated, recombinant ranavirus that has at least one foreign expression element.
2. The vaccine vector of claim 1, wherein the expression element expresses at least one foreign protein.
3. The vaccine vector of claim 1, wherein the expression element expresses at least two vaccine antigens.
4. The vaccine vector of claim 1, wherein the expression element expresses at least one virus-like particle.
5. A vaccine vector comprising a virus, wherein the virus is engineered to express at least two vaccine antigens.
6. The vaccine vector of claim 5, wherein the virus is an attenuated recombinant ranavirus.
7. A use of the vaccine vector of claim 1 to reduce the occurrence of mammalian respiratory disease.
8. A use of the vaccine vector of claim 5 to reduce the occurrence of mammalian respiratory disease.
9. A method of delivering human antigens to a mammal, comprising: providing a non-mammalian virus, engineering a recombinant virus that can express at least one foreign molecule by modifying the non-mammalian virus, and using the recombinant ranavirus to deliver human antigens to a mammal.
10. The method of claim 9, wherein the non-mammalian virus comprises an amphibian virus.
11. The method of claim 10, wherein the amphibian virus comprises Ambystoma tigrinum virus.
12. The method of claim 9, wherein the at least one foreign molecule comprises at least one foreign protein, at least two vaccine antigens, at least one virus-like particle, or a combination thereof.
13. The method of claim 9, wherein engineering a recombinant virus comprises: generating a recombination cassette, wherein the cassette contains homologous sequences flanking a screenable and selectable reporter gene driven by a promoter, infecting at least one cell with the attenuated non-mammalian virus, transfecting the at least one cell with the recombination cassette to form a combination of the at least one cell and the non-mammalian virus, harvesting a modified combination of the at least one cell and the attenuated non-mammalian virus, and selecting from the modified combination the recombinant virus deleted of the target open reading frame or ORF by serial passaging in cells treated with selection specific components.
14. The use of the method of claim 9 to reduce the occurrence of mammalian respiratory disease.
15. The use of the method of claim 13 to reduce the occurrence of mammalian respiratory disease.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
SUMMARY OF THE SUBJECT MATTER
[0014] A vaccine vector comprising an attenuated, recombinant ranavirus that has at least one foreign expression element is disclosed. In other contemplated embodiments, a vaccine vector comprising a virus, wherein the virus is engineered to express at least two vaccine antigens is disclosed.
[0015] In addition, methods of delivering human antigens to a mammal are disclosed that include: providing a non-mammalian virus, engineering a recombinant virus that can express at least one foreign molecule by modifying the non-mammalian virus, and using the recombinant ranavirus to deliver human antigens to a mammal.
[0016] In contemplated embodiments, engineering a recombinant virus includes: generating a recombination cassette, wherein the cassette contains homologous sequences flanking a screenable and selectable reporter gene driven by a promoter, infecting at least one cell with the attenuated non-mammalian virus, transfecting the at least one cell with the recombination cassette to form a combination of the at least one cell and the non-mammalian virus, harvesting a modified combination of the at least one cell and the attenuated non-mammalian virus; and selecting from the modified combination the recombinant virus deleted of the target open reading frame or ORF by serial passaging in cells treated with selection specific components.
DETAILED DESCRIPTION
[0017] In view of earlier-presented information, the ideal vector for a human vaccine is a large DNA virus that can be engineered to express multiple vaccine antigens. Importantly, this virus should not productively infect human cells. Instead, it needs to enter human cells, produce the vaccine antigens but not form a new virus, which is called abortive replication. The best place to find such a viral vaccine vector is to look in animals that are very distantly related to humans.
[0018] Specifically, a contemplated vaccine vector comprises an attenuated, recombinant ranavirus that has at least one foreign expression element. Contemplated recombinant, attenuated viruses are unique in that they have been deleted of pathogenesis genes and those genes are replaced with expression constructs, for example and including mammalian promoter elements driving expression of at least one antigen.
[0019] As used herein, the term attenuated with respect to a virus or vaccine vector means a vaccine created by reducing the virulence of a pathogen, but still keeping it viable (or live). Attenuation takes an infectious agent and alters it so that it becomes harmless or less virulent. These vaccines are in contrast to those produced by killing the virus (inactivated vaccine). An attenuated virus may be used to make a vaccine that is capable of stimulating an immune response and creating immunity in a patient, but not of causing illness in that same patient. In contemplated embodiments, viruses have been deleted of pathogenesis genes. There are currently 4 loci/genes in the contemplated virus that can be deleted and foreign material inserted; however, in other contemplated embodiments, other loci or genes or numbers of loci or genes can be deleted and foreign material inserted. In some contemplated embodiments, in place of the pathogenesis gene(s), a mammalian virus promoter element and a human translation enhancement element have been inserted that drive expression of a foreign antigen.
[0020] In contemplated embodiments, the at least one foreign expression element expresses at least one foreign protein, at least two vaccine antigens, at least one virus-like particle or a combination thereof.
[0021] In some contemplated embodiments, a vaccine vector comprises a virus, wherein the virus is engineered to express at least two vaccine antigens. In some of these contemplated embodiments, the virus is an attenuated recombinant ranavirus.
[0022] In addition, methods of delivering human antigens to a mammal are disclosed that include: providing a non-mammalian virus, engineering a recombinant virus that can express at least one foreign molecule by modifying the non-mammalian virus, and using the recombinant ranavirus to deliver human antigens to a mammal.
[0023] In contemplated embodiments, engineering a recombinant virus includes: generating a recombination cassette, wherein the cassette contains homologous sequences flanking a screenable and selectable reporter gene driven by a promoter, infecting at least one cell with the attenuated non-mammalian virus, transfecting the at least one cell with the recombination cassette to form a combination of the at least one cell and the wild-type non-mammalian virus, harvesting a modified combination of the at least one cell and the attenuated non-mammalian virus; and selecting from the modified combination the recombinant virus deleted of the target open reading frame or ORF by serial passaging in cells treated with selection specific components.
[0024] As disclosed herein, contemplated vaccine vectors can be used to reduce the occurrence of mammalian respiratory disease and/or related diseases or conditions.
[0025] All animals, including cold-blooded amphibians, are host to viruses, including salamanders. Salamander models have been used in other research related to human conditions. For example, Del Priore et al. looked at salamander research to find a connection between retinal cell apoptosis and increasing age. (Lucian V. Del Priore, Ya-Hui Kuo and Tongalp H. Tezel, Age-Related Changes in Human RPE Cell Density and Apoptosis Proportion In Situ, Investigative Ophthalmology & Visual Science, October 2002, Vol. 43, 3312-3318 citing Townes-Anderson E, Colantonio A, St Jules RS. Age-related Changes in the Tiger Salamander Retina, Exp Eye Res. 1998; 66:653-667) Wagner et al. used fish models, including aquatic salamanders to show that there is evidence of a stanniocalcin-like hormone in humans, specifically human kidneys. (Graham R. Wagern, Collete C. Guiraudon, Christine Milliken and D. Harold Copp, Immunological and Biological Evidence for a Stanniocalcin-like Hormone in Human Kidney, Proc. Natl. Acad. Sci. USA, 92 (1995).
[0026] As a basis for this research, Arizona salamanders were captured and, upon investigation, showed signs of illness. After significant examination and analysis, a new virus, now called Ambystoma tigrinum virus (ATV), was found. This virus is a member of the family Iridoviridaethe members of which are large DNA viruses that infect insects, amphibians, reptiles and fish.
[0027] Since this discovery, the researchers spent several years perfecting the technique for making recombinant ATVs (recATV) and other ranaviruses that express foreign proteins (recRanaV). For example, a recRanaV was created that expresses a protein (green fluorescent proteinGFP) that causes infected cells to glow green. In addition, a mouse model system was developed for RV infections and test compounds, and other agents to fight disease, are routinely tested in this model system.
[0028] The new recRanaV will be utilized, as disclosed herein, in mouse studies to prove that it can function as a vaccine vector. The recRanaV vector will be used as a human vaccine vector to deliver protective RV antigens.
[0029] Specifically, the data show that ATV intranasal infections of mice is non-pathogenic as all mice infected with virus did not show significant weight loss throughout the experiment or display any signs or symptoms of disease (
[0030]
[0031]
[0032]
[0033]
[0034]
Materials and Methods
[0035] The following materials and methods were used to obtain and collect the data presented herein.
[0036] Cells and Virus
[0037] Fathead minnow (FHM; ATCC CCL-42) cells were maintained in Minimum Essential Medium with Hank Salts (HMEM) (Gibco) supplemented with 5% fetal bovine serum (FBS) (Hyclone) and 0.1 mM nonessential amino acids and vitamins (Invitrogen). FHM cells were incubated at 20 to 22 C. in the presence of 5% CO.sub.2. LA4 mouse lung epithelial cells (kindly provided by Dr. Bianca Moth and the La Jolla Institute of Allergy and Immunology) were maintained in F12K medium supplemented with 15% FBS and incubated at 37 C. with 5% CO.sub.2. Wild-type Ambystoma tigrinum virus (wtATV), was originally isolated from tiger salamanders in Southern Arizona (Jancovich et al., 1997). Wild-type and mutant ATV were amplified and quantified in FHM cells. Briefly, viral amplification was performed in 100 mm dishes of FHM cells that were infected with virus at a multiplicity of infection of 0.01, rocked for 1 hr and then overlayed with HMEM with 5% FBS. Infected cells were monitored for cytopathic effects (CPE). Once CPE reached 95-100%, infected cells were harvested, concentrated by centrifugation at 1,000g for 10 min and the pellet of infected cells resuspended in 100 l of 10 mM Tris, pH 8.0. Virus was released by 3 cycles of freeze/thaw followed by centrifugation at 1,000g for 10 min to clarify cellular debris. The supernatant containing virus was quantified by plaque assay in FHM cells.
[0038] Generating Recombination Cassettes
[0039] Recombination cassettes to delete a target gene, or open reading frame (ORF) and insert a foreign antigen were generated by designing forward (for) and reverse (rev) primers to amplify the upstream (LA) and downstream (RA) flanking sequences of the gene to be deleted. Primers were designed to initially amplify a PCR product around 1,000 nt up- and downstream from the start and end of the target sequence, respectively. These primers (ORF#_LA_for_1k and ORF#_RA_rev_1k, respectively) were paired with primers designed immediately before the start (ORF#_LA_rev) and after the end (ORF#_RA_rev) of the target gene. An adapter sequence (AF; 5 GGTATAGGCGGAAGCGCC 3) was added to the 3 end of the LA reverse primer (AF_ORF#_LA_rev) and a second adapter (AR; 5 GAACAGAAACTGATTAGCGAAGAAGAC 3) was added to the 5 end of the RA forward primer (AR_ORF#_RA_for). Each of these primers were designed to have a predicted melting temperature around 60 C. Pairing the ORF#_LA_for_1k primer with the AF_ORF#_LA_rev and the AR_ORF#_RA_for with ORF#_RA_1k_rev generated approximately 1 kb of sequence of both the left and right flanking homologous sequences with adapters at the 3 end of the LA and the 5 end of the RA. Using primers AF-p for and AR-NeoR rev, which target the promoter (p)-green fluorescent protein (GFP)-neomycin resistance gene, which we will refer to as pGNR, was PCR amplified using a pcDNA3.1 vector containing the GNR construct as a template. For each PCR reaction, 50 ng of plasmid or 100 ng of viral DNA was added to the High Fidelity PCR Master Mix according to the manufacturer's instructions (Roche) and DNA was amplified with a single cycle of 94 C. for 2 minutes, followed by 25 cycles of 94 C. (30 seconds), 50 C. (for primer sets seq for/rev and 500_for/rev) or 55 C. (for primer set 1k_for/rev) (30 seconds), 72 C. (90 seconds) and a final cycle of 72 C. for 7 minutes. PCR products were visualized by 1% agarose gel electrophoresis and products were purified by Wizard SV Gel and PCR Clean-Up System (Promega) system as described by the manufacturer after excision from 0.7% agarose gel. Purified PCR products were quantified by Nanodrop spectrophotometry. At this point we have three purified PCR products for each ATV ORF: the LA, RA and pGNR.
[0040] To generate a recombination cassette by overlapping PCR, 50 ng of each PCR product (LA, RA and pGNR) was added to 45 l reaction (final volume) containing 1 iProof HF buffer, 200 M of each dNTP, and 0.02 U/l iProof DNA polymerase (BioRad). The recombination cassette assembly was initiated by a single cycle of 98 C. (30 seconds), followed by 7 cycles of 98 C. (10 seconds), 58 C. (28 minutes), 72 C. (150 seconds). After the completion of this program, 0.5 M of the ORF#_LA_1k_for and ORF#_RA_1k_rev were added along with another 0.02 U/l iProof DNA polymerase. The reaction was then returned to the thermocycler and a second program consisting of a single cycle of 98 C. (30 seconds), followed by 35 cycles of 98 C. (10 seconds), 55 C. (30 seconds), 72 C. (150 seconds) and a final cycle of 72 C. for 5 minutes was performed. PCR products were visualized and purified as described above. Purified recombination cassettes were then re-amplified using the ORF#_LA_500_for and ORF#_RA_500_rev primers using the High Fidelity PCR Master Mix as described above. PCR products were visualized and purified as described above and then cloned into pCR2.1-TOPO cloning vector as per the manufacturer's instructions (Thermo Fisher Scientific). Colonies were screened for the recombination cassette using the seq for/rev primer set for each ORF and correctly constructed recombination cassettes were confirmed by sequencing. The recombination cassette was PCR amplified from the plasmid, agarose gel purified and quantified as described above for use in generating a knockout virus.
[0041] Generating Knockout ATV
[0042] Approximately 50% confluent monolayers of FHM cells in 35 mm dishes were infected with wtATV at a MOI of 0.01 for 1 hour at room temperature. While the virus was attaching, 500 ng of the target ATV ORF recombination cassette that had been PCR amplified and purified was added to FuGene 6 transfection reagent according to the manufacturer's instructions (Promega). This solution was incubated at room temperature for 20 minutes. After 1 hour, the virus inoculum was removed and replaced with the DNA-FuGene 6 mixture. Cells were rocked with the transfection mixture for 1 hour at room temperature. After rocking, the infected/transfected cells were overlayed with 1HMEM medium containing 5% FBS and incubated for 48 hours. Infections were then harvested and subjected to three rounds of freeze-thaw to release virus from the cell. The sample was then clarified by centrifugation at 1,000g for 10 minutes and recombinant viruses were selected by multiple blind passages in confluent monolayers of FHM cells in the presence of 1 mg/mL G418 (i.e. neomycin). wtATV, which is sensitive to G418, was used as a control. The presence of a GFP expressing, neomycin resistant virus plaque was indicative of the generation of a recombinant ATV with a knock-out of the target gene. GFP-neomycin resistant virus was then plaque purified up to four times in the presence of 1 mg/ml G418, grown to high titers as described above and viral DNA was isolated as previously described (Jancovich and Jacobs, 2011). PCR confirmation of the ORF knock-out virus and sequencing around the ATV gene of interest was performed using the seq for/rev primer pair described above.
[0043] RT-PCR Analysis of Cellular Gene Expression
Total RNA from infected cells was extracted using Qiashredder columns followed by RNA isolation using the RNeasy kit as described by the manufacturer (Qiagen). RNA was quantified by spectrophotometric analysis and cDNA was synthesized from 1 g of total RNA using random primers and the SuperScript III Reverse Transcriptase (Invitrogen Life Technologies) as directed by the manufacture. Amplification of specific genes, including GNR, was performed. PCR reactions (50 l) were performed using the High Fidelity Taq Polymerase Master Mix kit (Roche Diagnostics). Reactions were incubated at 94 C. for 2 minutes followed by 25 cycles of 94 C. for 30 seconds, 55 C. for 30 seconds, and 72 C. for 90 seconds, and a final elongations cycle of 72 C. for 7 minutes. Amplified products were separated on a 1% agrose gel electrophoresis and visualized using a G:Box imaging platform (Syngene).
[0044] Cell Extractions and Western Blot Analysis
[0045] Infected cell lysates were collected in 1SDS sample buffer (50 mM Tris, pH 6.8; 2% SDS; 0.1% bromophenol blue; 10% glycerol; 100 mM betamercaptoethanol) before purification by Qiashredder collection column (Qiagen). Equal cell volumes of cellular extracts were subjected to SDS-PAGE on 12% polyacrylamide gels. Proteins were transferred to either a nitrocellulose membrane or a PVDF membrane at 100 volts for 60 minutes in 10 mM CAPS, pH 11.0, with 20% methanol and 14 mM 2-mercaptoethanal. The blot was blocked for 1 hour in 1TBS with milk (20 mM Tris-HCl [pH 7.8]; 180 mM NaCl; 3% nonfat dry milk). The blots were incubated overnight at 4 C. with primary antibodies at the appropriate dilution as outlined by the manufacturer (Abcam). Primary antibodies were removed, and the blot was washed three times with 1TBS containing milk for 30 minutes at room temperature. The blot was then probed with a 1:15,000 dilution of goat anti-rabbit or rabbit anti-mouse IgG-peroxidase conjugate antibody (Sigma) for 1 hour at room temperature. These secondary antibodies were then removed, and the blot was washed three times for 10 minutes each in 1TBS with milk and then washed three times for 5 minutes each in 1TBS without milk. The blot was visualized after treatment with the Super Signal Dura chemiluminescent kit according to the manufacturer's instructions using the G:Box imaging platform (Syngene). The relative intensity of proteins was quantified using the GeneTools analysis software (Syngene).
[0046] Mouse Safety Trial
[0047] BALB/c mice were infected intranasally with 100 l of wtATV at 10.sup.5, 10.sup.4 and 10.sup.3 viral particles. The health of the virus infected mice was assessed by monitoring their weight over a 5 week period. Mice were infected with a single dose of virus (i.e. no boost) and blood was harvested by cardiac puncture at 2 and 5 weeks post infection. Blood serum was isolated and used to assess antibody production in mice infected with virus. To detect a virus specific immune response, FHM cells were infected with wtATV at a MOI of 5 and virus and cells were harvested and proteins were isolated at 12 hours post infection. Proteins in the infected cell extracts were separated by SDS-PAGE before transfer to nitrocellulose. Western blots were performed as described above using mouse specific anti-IgM antibodies to detect a virus-induced immune response in the infected mouse.
[0048] Thus, specific embodiments of a recombinant ranavirus, along with methods of use of contemplated recombinant ranavirus as a human vaccine vector have been disclosed. It should be apparent, however, to those skilled in the art that many more modifications besides those already described are possible without departing from the inventive concepts herein. The inventive subject matter, therefore, is not to be restricted except in the spirit of the disclosure herein. Moreover, in interpreting the specification, all terms should be interpreted in the broadest possible manner consistent with the context. In particular, the terms comprises and comprising should be interpreted as referring to elements, components, or steps in a non-exclusive manner, indicating that the referenced elements, components, or steps may be present, or utilized, or combined with other elements, components, or steps that are not expressly referenced.