FPR2 RECEPTOR AGONIST APTAMERS AND USES THEREOF

Abstract

The present invention is related to FPR2 receptor agonist aptamers and uses thereof. The present invention is related to a nucleic acid aptamer that is able to specifically bind to the FPR2 receptor and activate said FPR2 receptor, comprising a nucleotide sequence with a sequence identity of at least 70% with the sequence SEQ ID NO. 1, SEQ ID NO. 2 or SEQ ID NO. 3.

Claims

1. A nucleic acid aptamer which is able to specifically bind to the FPR2 receptor and activate said FPR2 receptor, comprising a nucleotide sequence with a sequence identity of at least 70% with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

2. The aptamer according to claim 1, wherein the nucleotide sequence has a sequence identity of, at least 80, 90, 95, 96, 97, 98 or 99% with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

3. The aptamer according to claim 1, wherein the nucleotide sequence has a sequence identity of 100% with the sequence SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.

4. The aptamer according to claim 1, wherein the FPR2 receptor is the human FPR2 receptor.

5. The aptamer according to claim 1, wherein the nucleotide sequence nucleic acid is DNA.

6. A complex comprising an aptamer according to claim 1 and a functional group.

7. The complex according to claim 6, wherein the functional group is a detectable reagent, a drug or a nanoparticle.

8. A pharmaceutical composition comprising an aptamer according to claim 1, together with a pharmaceutically acceptable carrier, excipient or vehicle.

9-11. (canceled)

12. An In vitro method for the detection of the FPR2 receptor in an isolated biological sample from a subject comprising: (a) contacting said sample with an aptamer according to claim 1, (b) separating the aptamer which is not bound to the FPR2 receptor, and (c) detecting the presence of the aptamer which is bound to the FPR2 receptor present in the sample.

13. The method according to claim 12, wherein the detection is carried out by fluorescence.

14. An In vitro method to activate the FPR2 receptor in an isolated biological sample from a subject comprising contacting said sample comprising the FPR2 receptor with an aptamer according to claim 1, under suitable conditions to activate the FPR2 receptor.

15. The method according to claim 12, wherein the subject is a human.

16. The method according to any one of claim 12, wherein the isolated biological sample is blood, plasma, serum or cerebrospinal fluid.

17. A method for the treatment of a wound comprising administering to a subject in need thereof the aptamer according to claim 1.

18. A method for the treatment or prevention of diseases characterized by a decrease in the expression of the FPR2 receptor, or a decrease in the activation of the FPR2 receptor, or an absence of the natural ligand of the FPR2 receptor, or a low amount of the natural ligand of the FPR2 receptor with regard to the amount of natural ligand in a subject under normal health conditions or healthy, comprising administering to a subject in need thereof the aptamer according to claim 1.

19. The method according to claim 18, wherein the disease is selected from the group consisting of: cancer, an autoimmune disease, an inflammatory disease, a neurodegenerative disease, a cardiovascular disease, an infectious disease, an eye disease and an epithelial disease.

20. The method according to claim 19, wherein the epithelial disease is dystrophic epidermolysis bullosa.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0169] FIGS. 1A-1B. Generating a keratinocyte line stably expressing the FPR2 receptor A) The HaCaT keratinocyte line was stably transfected using a lentiviral vector containing an expression cassette for human FPR2 (transcript variant 1; Origene) fused with mGFP. FPR2-GFP expression on the membrane was checked by direct visualization using an inverted microscope with epifluorescence. B) The WKYMVm peptide (FPR2 agonist) significantly induced (***p<0.001) calcium response in the HaCaT-FPR2-GFP transfectants. Cells were marked with Fura-2 in Ca2+ medium and the fluorescence intensities at 340 and 380 nm were analyzed after 60 seconds of stimulation. The bar graph shows the mean±SD of 4 replicates per condition, n=4. This effect was totally reversed after adding EGTA to the medium.

[0170] FIG. 2. Obtaining aptamers for FPR2 using CELL-SELEX. The cells expressing the target protein are incubated in the presence of the aptamer population (initial RND40 population in the first cycle of SELEX or populations obtained after the different cycles). The bound aptamers are amplified by means of PCR, the complementary chain being removed, and are subjected to a new cycle of selection (positive selection) or incubated with the parental cells that do not express the target protein (negative selection). As many cycles of SELEX as necessary are carried out to obtain a population enriched in specific aptamers against the target molecule.

[0171] FIG. 3. Study of the affinity of aptamers against FPR2. The aptamers were incubated with HaCaT-FPR2-GFP or HaCaT cells and those that bind are amplified by means of quantitative PCR (qPCR). The aptamers that bind with higher affinity are recovered in greater quantity and, therefore, is further amplified by means of PCR, obtaining a lower Ct. The ApFP3.5a, ApFP3.8a and ApFP4.5b aptamers bind with the highest affinity to FPR2.

[0172] FIGS. 4A-4C. Secondary structures of aptamers against FPR2. A) ApFP3.5a aptamer; B) ApFP3.8a aptamer; and C) ApFP4.5b aptamer. The prediction of the secondary structures of the aptamers was carried out by means of bioinformatic analysis of the sequences thereof using the following programs: mFold (http://unafold.rna.albany.edu), RNAfold (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi) and QGRS Mapper (http://bioinformatics.ramapo.edu/QGRS/analyze.php).

[0173] FIG. 5. Colocalization of aptamers against the FPR2 receptor (dark grey) and the protein (light grey).

[0174] FIG. 6. FPR2 aptamers operate as receptor agonists, inhibiting forskolin-mediated cAMP production in 293 cells. A) 293 cells stably expressing FPR2-GFP were transiently transfected with CRE-luciferase and Renilla-luciferase reporter constructs. Twenty-four (24) hours after transfection, the indicated stimuli were added for 4 hours. The bar graph represents normalized luciferase activity versus Renilla activity for each condition, which is proportional to the amount of cAMP produced. The means were calculated using three biological replicates per condition, n=3. Error bars represent the standard deviation, S.D. A representative experiment is shown. Statistical significance (*) was determined using Student's t test (p<0.05).

[0175] FIGS. 7A-7B. FPR2 aptamers increase keratinocyte migration in a similar manner to the LL37 agonist peptide. The pro-healing activity of PRF2 agonists was evaluated in an in vitro healing assay using the stable line of HaCaT-FPR2-GFP keratinocytes. Data represent the mean±SD of 4-6 independent fields. Statistical significance (*) was determined using Student's t test (p<0.05). The panels on the right show representative field images in each condition. The arrows show the direction of migration.

[0176] FIGS. 8A-8B. FPR2 aptamers induce CXCR2 internalization and inhibition of its mRNA expression in THP-1 cells, in a similar manner to the LL37 agonist peptide. A) FPR2 aptamers, like the LL37 agonist peptide, are able to induce the internalization of the CXCR2 receptor in THP-1 cells. Visualization of the receptor was carried out by means of immunofluorescence using a specific antibody against CXCR2 in permeabilized cells. B) Aptamers against FPR2, like the LL37 agonist peptide, significantly inhibit (*p<0.05; **p<0.005) CXCR2 mRNA expression.

[0177] FIGS. 9A-9C. The FP4.5bF aptamer has prohealing activity in a humanized skin mouse model

[0178] A) Schematic representation of the healing test in the humanized skin mouse model. B) Histological evaluation of healing on day 6. The photographs show representative sections of H&E-stained skin tissue. In mice treated with the ApFP4.5b aptamer, a greater re-epithelialization of the wound area (greater length of the migratory epithelial tongue) is observed in treated mice compared to control mice. C) The wounds analyzed for each treatment are represented as a function of the percentage of re-epithelialization at day 6 after the wound. Each symbol represents an individual mouse. The re-epithelialization percentage means are represented. Error bars represent the standard deviation. Statistical significance (*) was determined using Student's t test (p<0.05).

EXAMPLES

[0179] The invention is illustrated below by means of assays conducted by the inventors, that demonstrate the effectiveness of the product of the invention.

[0180] In the present invention, specific aptamers have been generated by means of the Cell-SELEX technique against the rhodopsin-like GPCR receptor (GPCRA) FPR2, for which cell lines have been generated that express this receptor ectopically.

[0181] I. Materials and Methods

[0182] Aptamer Library

[0183] The inventors used the RND40 aptamer library to carry out the selection of specific aptamers against FPR2, supplied by IBA GmbH (Goettingen, Germany). The initial RND40 library is theoretically made up of 10.sup.24 single-stranded DNA oligonucleotides (ssDNA) with fixed sequence at the ends, of 18 nucleotides each wherein the respective primers hybridize for amplification by means of PCR, and a central region of 40 bases of random sequence. In the selections carried out, 10.sup.13 oligonucleotides from this library have been used.

[0184] Cells

[0185] The FPR2 receptor expressed in HaCaT (HaCaT-FPR2-GFP) cells is used as a target. The HaCaT human keratinocyte line, as well as line 293, were grown in DMEM culture medium with Glutamax (Gibco-BRL, Gaithersburg, Md.), supplemented with 10% foetal bovine serum, at 37° C. in a 5% CO.sub.2 atmosphere. For the generation of stable FPR2 transfectants in these cell lines, lentiviral transduction was carried out using a vector (pLenti-C-mGFP, Origene (Rockville, Md.)) containing the gene encoding FPR2 fused to the green fluorescent protein GFP under the control of the CMV promoter.

[0186] Selection with HaCaT-FPR2-GFP/HaCaT Cells

[0187] For each selection round, between 8×10.sup.5 and 10×10.sup.5 HaCaT-FPR2-GFP cells were sown in triplicate in P6 plate wells, 24 hours before the selection assay and incubated at 37° C., 5% CO.sub.2. Next, 1 nmol of aptamers from the RND40 library (or from the population isolated in the previous selection round) was added to 100 μl PBS, previously denatured at 95° C. for 10 minutes followed by incubation at 4° C. for 10 minutes, 300 μl of DMEM medium (Dulbecco's modified Eagle's medium) supplemented with 10% foetal bovine serum was added, 100 U/ml penicillin, 100 μg/ml streptomycin and 25 μg/I amphotericin and applied on the cells. After 1 hour of incubation at 37° C., 5% CO.sub.2, the culture medium with unbound aptamers was removed, cells were washed 2 times with PBS and recovered in 500 μl of PBS by centrifugation at 1500 rpm. The cells were centrifuged to remove the supernatant and the aptamers attached to the cells were amplified by means of PCR to prepare a sufficient amount for the next selection round.

[0188] The counter-selection on HaCaT cells of the RND40 aptamer library was carried out in the previous preparation of the initial RND40 population and every 3 selection rounds, with the isolated population from the previous selection round. To that end, between 8×10.sup.5 and 10×10.sup.5 HaCaT cells were sown in triplicate in P6 plate wells, 24 hours before the selection assay and incubated at 37° C., 5% CO.sub.2. Next, 1 nmol of aptamers from the RND40 library (or from the population isolated in the previous selection round) was added to 100 μl PBS, previously denatured at 95° C. for 10 minutes followed by incubation at 4° C. for 10 minutes, 300 μl of DMEM medium (Dulbecco's modified Eagle's medium) supplemented with 10% foetal bovine serum was added, 100 U/ml penicillin, 100 μg/ml streptomycin and 25 μg/l amphotericin and applied on the cells. After 1 hour of incubation at 37° C., 5% CO.sub.2, the culture medium with unbound aptamers was removed to be used in selection rounds on HaCaT-FPR2-GFP cells.

[0189] Amplification of Selected Aptamers

[0190] The selected aptamers were resuspended in a volume of 20 μl of distilled water and amplified by means of PCR using the primers, which will correspond to the sequences F3 (GCGGATGAAGACTGGTGT (SEQ ID NO: 9)) and R3 (GTTGCTCGTATTTAGGGC (SEQ ID NO: 10)) under the conditions of 0.8 μM/F3 primer: 0.8 μM/R3 primer: 200 mM dNTPs, 2 mM MgCl.sub.2, 10 U Taq polimerase (Biotools, Spain) in a final volume of 200 μl following the following amplification program: 2 minutes at 95° C.; 15 cycles of 30 seconds at 95° C., 30 seconds at 56° C. and 30 seconds at 72° C.; and finally 5 minutes at 72° C.

[0191] Characterization of Selected Aptamers

[0192] The selected aptamers were identified after 3 and 4 selection rounds by cloning the aptamer population in a plasmid in order to obtain individual aptamers, and subsequent Sanger sequencing.

[0193] The most represented sequences were chemically synthesized by means of IBA GmbH (Goettingen, Germany) and the affinity, the subcellular location and the activity of each of the aptamers was studied.

[0194] The nucleotide sequences of the selected aptamers are as follows:

TABLE-US-00001 ApFP3.5a aptamer (SEQ ID NO: 1) GCGGATGAAGACTGGTGTGGGCGGGGGTCTTAGGCTGTACGGGGCTGTTC AGGTGCTTGCCCTAAATACGAGCAAC ApFP3.8a aptamer (SEQ ID NO: 2) GCGGATGAAGACTGGTGTGGGGATCAGGAACTCTGAAATGGCAGTCTATG TTTCAATGGCCCTAAATACGAGCAAC ApFP4.5b aptamer (SEQ ID NO: 3) GCGGATGAAGACTGGTGTTGTGGCGCTTCGGGCCTGTCCCTTTATATCCG TAGATTGAGCCCTAAATACGAGCAAC

[0195] Luciferase Assay to Assess cAMP Production

[0196] 293 cells stably expressing the FPR2-GFP receptor were sown in 96 well plates in complete medium (8.8×10.sup.5 cells per p96 plate). The next day, they were transiently transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, Calif.) together with the pCRE-Luc reporter constructs (encoding the cAMP CRE and the Luc gene for the response element, encoding firefly luciferase), and pSV40-RL (containing an SV40 promoter and the gene encoding Renilla luciferase). Twenty-four (24) hours after transfection, cells were well stimulated with forskolin (20 μM), an activator of adenylate cyclase, either with the LL37 peptide (5 μM)+forskolin (20 μM) or with two concentrations of the ApFP4.5b aptamer (100 μM or 1 μM)+forskolin (20 μM) for 4 hours. For quantifying the luminescent signal, the Dual-Glo® Luciferase Assay System kit (Promega, Madison, Wis.) was used, following the indications of the producer. The Luc measurements were normalized against the Renilla measurements.

[0197] In Vitro Migration Tests

[0198] Cells were grown to confluence in 6-well culture plates. At that time the cells were serum starved for 24 hours. The aptamers and the LL37 peptide were tested at concentrations of 100 nM in an in vitro healing assay, where they are added after removing the cells that cover half of the surface of each well. To assess the migration, photographs were taken at different times (t=0 hours-2 days-4 days-6 days) after the generation of the wound. Photographs taken on days 4 and 6 after injury were overlaid using Adobe Photoshop software (Adobe Systems, Berkeley, Calif.). Migration areas were measured using Image J software (NIH Image, Bethesda, Md.).

[0199] CXCR2 Internalization Assays

[0200] THP-1 cells grown on coverslips were treated with the LL37 peptide (5 uM) and with the FPR2 aptamers (5 μM), and the CXCR2 expression was analyzed by immunofluorescence after 5 hours of treatment. Cells were washed with PBS1× and fixed with 2% paraformaldehyde for 15 minutes. Subsequently, the cells were permeabilized by incubating with 0.01% saponin for 30 minutes, and non-specific binding sites were locked by incubation with 10% horse serum and 0.01% saponin diluted in PBS1x for 30 minutes. Cells were incubated with a polyclonal antibody generated against human CXCR2 in rabbit (Abcam) for 1 hour at 4° C. After washing, cells were incubated with a secondary antibody against Alexa Fluor 488-conjugated rabbit (Molecular Probes) for 30 minutes. After washing, the samples were mounted for viewing using an Axioplan 2 fluorescence microscope (Zeiss, Jena, Germany).

[0201] Inhibition of CXCR2 mRNA Expression by qPCR

[0202] The total RNA of the THP-1 cells treated or not with the LL37 (5 μM) peptide or with the specific FPR2 (1 μM) aptamers was extracted using the miRNeasy Mini Kit (Qiagen, Hilden, Germany). The cDNA generation was obtained using the “high capacity reverse transcription system” kit (Applied Biosystems, Foster City, Calif.). The products of the RT reaction were used for their amplification by means of quantitative PCR, using specific oligonucleotides, the Power Sybr Green PCR master mix (Applied Biosystems) and the following amplification conditions: 10 minutes at 95° C., followed by 40 cycles of 15 seconds at 95° C. and 1 minute at 60° C. The Tata binding protein (TBP) and Ubiquitin C (UBC) reference genes were used for the normalization procedures. Simultaneous triplicate reactions were carried out for both the target genes and the reference genes for each template cDNA analysed. The 2-ACT method was used to calculate the relative expression of each target gene (Livak K J, Schmittgen T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001 December; 25(4):402-8.)

[0203] In Vivo Healing Tests

[0204] Healing experiments were carried out on the humanized skin mouse model as previously described (Escamez et al., 2004, J invest Dermatol. 123(6): 1182-91). For this, NMRI nu (Rj: NMRI-Foxn1.sup.nu/nu) immunodeficient mice 6 to 8 weeks old were used, that were orthotopically transplanted with equivalents of bioengineered human skin consisting of a fibrin matrix containing fibroblasts as a dermal component and keratinocytes as part of the epidermal component (Del Rio M, et al. 2002. Hum Gene Ther., 13(8):959-68). 10-12 weeks after transplantation, excisional wounds were made in the regenerated human skin using 2 mm biopsy punches. The administration of the treatments was carried out through the implantation of osmotic pumps (Alzet, Cupertino, Calif.) subcutaneously. The ApFP4.5b aptamer dose was 10 μM in all mice. The tissues were collected 6 days after wound generation, they were fixed in formalin and processed for subsequent histological analysis. The samples were fully sectioned using a microtome and the tissue architecture was subsequently determined in 1 out of 10 sections by means of haematoxylin-eosin staining, following standard histological methods. The re-epithelialization percentage was determined by means of microscopy using a grating to measure the proportion of each wound that had been covered by neoepidermis in relation to the total length of the wound. Thus, this percentage was calculated by the formula 100x [(wound diameter-epidermal gap)/wound diameter]. The epidermal gap is the distance between the two epithelial tongues. Thus, the center of the wound was determined in each sample, and the different re-epithelialization percentages between the different samples were compared.

[0205] II. Results

[0206] Assays for Binding the Aptamers to FPR2 Expressed in Cells.

[0207] In order to analyses the ability of the identified aptamers to bind to the FPR2 protein expressed in HaCaT cells, 20 pmol of each of the aptamers identified above were added to a culture of HaCaT-FPR2-GFP cells sown at 20,000 cells/well in 96-well microtiter plates at a density of 2×10.sup.4 cell/well, 2 days before the start of the assay. After incubation for 30 minutes at 37° C., 5% CO2, the cells were washed, aptamers were recovered with 150 mM imidazole dissolved in PBS with 1 mM MgCl.sub.2, and qPCR was carried out to determine Ct values. In these experiments, a lower Ct value indicates a greater amount of aptamer bound to the cells. The results obtained show that the ApFP3.5a, ApFP3.8a and ApFP4.5b aptamers (FIG. 3) are the ones that bind with the highest affinity, the usefulness thereof in the detection of the protein FPR2 being demonstrated. The sequences and secondary structures of these aptamers are shown in FIGS. 4A-4B.

[0208] Subcellular Localization by Means of Aptacytochemistry.

[0209] Cells expressing the FPR2 receptor fused to green fluorescent protein were incubated in the presence of aptamers marked with AlexaFluor 700 ApFP3.5a, ApFP3.8a and ApFP4.5b in selection buffer for 1 hour at room temperature. Subsequently, cells were washed three times with PBS. Lastly, cells were mounted on glass slides using a glycerol buffer containing p-phenylenediamine and a 1/750 dilution of Dapi for nuclear staining. Controls were made by omitting the aptamer. The subcellular location of the aptamers was evaluated by means of fluorescence microscopy. The results show that there is a colocalization of the aptamers with the protein (FIG. 5).

[0210] Functionality of the Selected Aptamers Against FPR2.

[0211] In these assays, different approaches were used. First, a typical GPCR assay (CRE-luciferase reporter activity assay) was carried out, using a stable transfectant of the FPR2 receptor generated in the 293 cell line by means of lentiviral transduction (FIG. 6). This line was transiently transfected with two reporter constructs (CRE-luciferase and Renilla-luciferase). The LL37 peptide, FPR2 receptor agonist, enables the Gi subunit receptor coupling resulting in the inhibition of forskolin-mediated cAMP production. FPR2-specific aptamers are also able to inhibit forskolin-mediated cAMP production in a manner similar to LL37 (Table 1). These results reveal the ability of the identified aptamers to activate the FPR2 receptor.

TABLE-US-00002 TABLE 1 The table indicates the percentages of inhibition of forskolin- mediated cAMP production. Values indicate the mean ± SEM of the data obtained from 3-6 independent experiments. Inhibition (%) of forskolin- mediated cAMP production LL37 (5 μM)   46 ± 7.5 Ap.FP3.5aF (1 μM) 30.7 ± 7.3 Ap.FP3.8aF (1 μM) 38.8 ± 9   Ap.FP4.5bF (1 μM) 25.5 ± 2.8

[0212] Utility of Selected Aptamers in Healing.

[0213] In an in vitro healing test the three specific aptamers against FPR2 are able to activate the migration of the HaCaT human keratinocyte line stably expressing FPR2, as well as the LL37 peptide (FIGS. 7A-7B). Specific FPR2 aptamers are also able to act as functional CXCR2 ligands, since they induce receptor internalization in the THP-1 human monocyte line, as well as the inhibition of CXCR2 mRNA expression in this line, in a similar manner to what occurs when the LL37 peptide is used as an agonist (FIGS. 8A-8B). Likewise, in vivo assays were carried out with the ApFP4.5b aptamer, that was able to exert pro-healing actions, inducing an improvement in the re-epithelialization process. The tests were carried out using a humanized skin mouse model, wherein excisional wounds were generated. Treatments were administered subcutaneously using osmotic pumps (FIGS. 9A-9C). FIGS. 9A-9C show how in mice treated with the ApFP4.5b aptamer a greater re-epithelialization of the wound area is observed (greater length of the migratory epithelial tongue) in treated mice compared to control mice, demonstrating the effect of the aptamer on healing and demonstrating the usefulness of the aptamer in the treatment of epithelial wounds.