TREATMENT/PREVENTION OF DISEASE BY LINC COMPLEX INHIBITION
20220370570 · 2022-11-24
Inventors
- Colin Lawson STEWART (Singaore, SG)
- Roshni SINGARAJA (Singapore, SG)
- Brian BURKE (Singapore, SG)
- Yin Loon LEE (Singapore, SG)
- Yann Chong TAN (Singapore, SG)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C07K14/78
CHEMISTRY; METALLURGY
A61K48/0058
HUMAN NECESSITIES
A01K2217/15
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
A61K38/465
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61P9/10
HUMAN NECESSITIES
A61K48/005
HUMAN NECESSITIES
A01K2217/206
HUMAN NECESSITIES
C12N2830/008
CHEMISTRY; METALLURGY
International classification
A61K48/00
HUMAN NECESSITIES
A61P9/10
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Methods for the treatment and prevention of laminopathies and diseases characterised by hyperlipidemia through LING complex inhibition are disclosed. In particular, LING complex disruption by expression of dominant-negative LING complex proteins alleviates pathophysiology in Lmna mutation-associated muscular dystrophy, progeria, and dilated cardiomyopathy. In addition, LING complex disruption by expression of dominant-negative LING complex proteins also alleviates pathophysiology in mouse models of atherosclerosis and familial hypercholesterolemia.
Claims
1. A LINC complex inhibitor for use in a method of treating or preventing a laminopathy.
2. Use of a LINC complex inhibitor in the manufacture of a medicament for use in a method of treating or preventing a laminopathy.
3. A method of treating or preventing a laminopathy, comprising administering a therapeutically or prophylactically effective amount of a LINC complex inhibitor to a subject.
4. The LINC complex inhibitor for use according to claim 1, the use according to claim 2, or the method according to claim 3, wherein the laminopathy is characterised by one or more of myopathy, cardiomyopathy, dilated cardiomyopathy, muscular dystrophy, cardiac muscular dystrophy, skeletal muscular dystrophy, progeria, neuropathy, lipoatrophy, skeletal dysplasia, lipodystrophy, leukodystrophy or dermopathy.
5. The LINC complex inhibitor for use, the use or the method according to any one of claims 1 to 4, wherein the laminopathy is associated with mutation to LMNA.
6. The LINC complex inhibitor for use, the use or the method according to any one of claims 1 to 5, wherein the laminopathy is selected from: Hutchinson-Gilford Progeria Syndrome; Dilated Cardiomyopathy; Muscular Dystrophy, Congenital, Lmna-Related; Emery-Dreifuss Muscular Dystrophy 2, Autosomal Dominant; Muscular Dystrophy; Mandibuloacral Dysplasia with Type a Lipodystrophy; Cardiomyopathy, Dilated, 1a; Charcot-Marie-Tooth Disease; Limb-Girdle Muscular Dystrophy; Cardiomyopathy, Dilated, with Hypergonadotropic Hypogonadism; Emery-Dreifuss Muscular Dystrophy 3, Autosomal Recessive; Lipodystrophy, Familial Partial, Type 2; Emery-Dreifuss Muscular Dystrophy; Charcot-Marie-Tooth Disease, Axonal, Type 2b1; Heart-Hand Syndrome, Slovenian Type; Aging; Familial Partial Lipodystrophy; Restrictive Dermopathy, Lethal; Arrhythmogenic Right Ventricular Cardiomyopathy; Tooth Disease; Heart Disease; Werner Syndrome; Hypertrophic Cardiomyopathy; Left Ventricular Noncompaction; Atrioventricular Block; Calcinosis; Acroosteolysis; Autosomal Dominant Limb-Girdle Muscular Dystrophy; Diabetes Mellitus, Noninsulin-Dependent; Osteoporosis; Atrial Fibrillation; Atrial Standstill 1; Acanthosis Nigricans; Cardiac Conduction Defect; Catecholaminergic Polymorphic Ventricular Tachycardia; Mandibular Hypoplasia, Deafness, Progeroid Features, and Lipodystrophy Syndrome; Sick Sinus Syndrome; Pelger-Huet Anomaly; Charcot-Marie-Tooth Disease, Axonal, Type 2e; Congenital Generalized Lipodystrophy; Restrictive Cardiomyopathy; Congenital Fiber-Type Disproportion; Lipodystrophy, Congenital Generalized, Type 1; Myofibrillar Myopathy; Lipodystrophy, Familial Partial, Type 1; Axonal Neuropathy; Atypical Werner Syndrome; Ovarian Cystadenoma; Fanconi Anemia, Complementation Group a; Body Mass Index Quantitative Trait Locus 11; Skin Disease; Rigid Spine Muscular Dystrophy 1; Neuromuscular Disease; Hallermann-Streiff Syndrome; Bethlem Myopathy 1; Acquired Generalized Lipodystrophy; Cardiomyopathy, Dilated, 1e; Lipodystrophy, Congenital Generalized, Type 4; Undifferentiated Pleomorphic Sarcoma; Lipodystrophy, Familial Partial, Type 3; Muscular Dystrophy, Congenital Merosin-Deficient, 1a; Proximal Spinal Muscular Atrophy; Muscular Dystrophy-Dystroglycanopathy, Type B, 5; Muscular Dystrophy, Congenital, 1 b; Reynolds Syndrome; Wiedemann-Rautenstrauch Syndrome; Emery-Dreifuss Muscular Dystrophy 1, X-Linked; Lipodystrophy, Congenital Generalized, Type 2; Monogenic Diabetes; Cardiomyopathy, Dilated, 1 d; Myopathy, Proximal, and Ophthalmoplegia; Muscle Tissue Disease; Lipodystrophy, Familial Partial, Type 4; Cardiomyopathy, Dilated, 1 h; Second-Degree Atrioventricular Block; Median Neuropathy; Intrinsic Cardiomyopathy; Prolapse of Female Genital Organ; Complete Generalized Lipodystrophy; Rigid Spine Muscular Dystrophy; Emerinopathy; Ulnar Nerve Lesion; Limb-Girdle Muscular Dystrophy Type 1b; Lmna-Related Dilated Cardiomyopathy; Pelvic Muscle Wasting; Generalized Lipodystrophy-Associated Progeroid Syndrome; Muscular Disease; Cardiomyopathy, Dilated, 1 b; Autosomal Genetic Disease; Familial Isolated Arrhythmogenic Ventricular Dysplasia, Right Dominant Form; Familial Isolated Arrhythmogenic Ventricular Dysplasia, Biventricular Form; Familial Isolated Arrhythmogenic Ventricular Dysplasia, Left Dominant Form; Lmna-Related Cardiocutaneous Progeria Syndrome; and Autosomal Semi-Dominant Severe Lipodystrophic Laminopathy.
7. A LINC complex inhibitor for use in a method of treating or preventing a disease characterised by hyperlipidemia.
8. Use of a LINC complex inhibitor in the manufacture of a medicament for use in a method of treating or preventing a disease characterised by hyperlipidemia.
9. A method of treating or preventing a disease characterised by hyperlipidemia, comprising administering a therapeutically or prophylactically effective amount of a LINC complex inhibitor to a subject.
10. The LINC complex inhibitor for use according to claim 7, the use according to claim 8, or the method according to claim 9, wherein the disease characterised by hyperlipidemia is selected from atherosclerosis, cardiovascular disease, stroke and a familial hyperlipidemia.
11. The LINC complex inhibitor for use, the use or the method according to any one of claims 1 to 10, wherein the LINC complex inhibitor is capable of binding to a LINC complex, a LINC complex protein or an interaction partner for a LINC complex protein, or wherein the LINC complex inhibitor is capable of reducing expression of a LINC complex protein.
12. The LINC complex inhibitor for use, the use or the method according to claim 11, wherein the LINC complex inhibitor is capable of inhibiting interaction between a LINC complex protein and an interaction partner for a LINC complex protein.
13. The LINC complex inhibitor for use, the use or the method according to any one of claim 11 or claim 12, wherein the LINC complex inhibitor is a peptide/polypeptide, nucleic acid or small molecule.
14. The LINC complex inhibitor for use, the use or the method according to claim 11, wherein the LINC complex inhibitor is capable of modifying a gene encoding a LINC complex protein to reduce its expression.
15. The LINC complex inhibitor for use, the use or the method according to claim 14, wherein the LINC complex inhibitor comprises a site-specific nuclease (SSN) targeting a gene encoding a LINC complex protein.
16. The LINC complex inhibitor for use, the use or the method according to claim 11, wherein the LINC complex inhibitor is an inhibitory nucleic acid capable of reducing expression of a LINC complex protein by RNA interference (RNAi).
17. The LINC complex inhibitor for use, the use or the method according to any one of claims 11 to 16, wherein the method comprises administering nucleic acid encoding the LINC complex inhibitor, or nucleic acid encoding factors required for production of the LINC complex inhibitor, to the subject.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0379] Embodiments and experiments illustrating the principles of the invention will now be discussed with reference to the accompanying figures.
[0380]
[0381]
[0382]
[0383]
[0384]
[0385]
[0386]
[0387]
[0388]
[0389]
[0390]
[0391]
[0392]
[0393]
[0394]
[0395]
[0396]
[0397]
[0398]
[0399]
[0400]
[0401]
[0402]
[0403]
[0404]
[0405]
[0406]
[0407]
[0408]
[0409]
[0410]
[0411]
[0412]
[0413]
[0414]
[0415]
[0416]
[0417]
[0418]
[0419]
[0420]
[0421]
[0422]
[0423]
[0424]
[0425]
[0426]
[0427]
[0428]
[0429]
[0430]
[0431]
[0432]
[0433]
[0434]
[0435]
[0436]
EXAMPLES
[0437] In the following examples, the inventors demonstrate that LINC complex disruption ameliorates the laminopathy associated with mutations to the gene encoding lamins A/C, including knockout mutations, missense mutations, and progerin-associated mutations. The inventors also show that LINC complex inhibition can ameliorate the symptoms of diseases characterised by hyperlipidemia. The inventors show that LINC complex disruption reduces the symptoms of atherosclerosis.
Example 1: Materials and Methods
[0438] Mice were maintained at the A*STAR Biological Resource Centre facility and the NUS Animal Facility in accordance with the guidelines of the Institutional Animal Care and Use Committee for each facility. The Lmna.sup.Flx/Flx mice were generated and characterized as previously described [A. S. Wang, et al., Differentiation; research in biological diversity, (2015); I. Solovei et al., Cell 152: 584-598 (2013)](
[0439] To test for the insertion of loxP sites and conditional deleted allele, genotyping was performed with a duplex PCR protocol with the following primers were used:
TABLE-US-00003 (SEQ ID NO: 16) FLX/FLX-F1: 5′-CCAGCTTACAGAGCACCGAGCT-3′ (SEQ ID NO: 17) FLX/FLX-F2: 5′-TCCTTGCAGTCCCTCTTGCATC-3′ (SEQ ID NO: 18) FLX/FLX-R1: 5′-AGGCACCATTGTCACAGGGTC-3′
[0440] To test for Sun1 deletion, the following primers were used:
TABLE-US-00004 (SEQ ID NO: 19) Sun1-F: 5′-GGC AAG TGG ATC TCT TGT GAA TTC TTG AC- 3′ (SEQ ID NO: 20) Sun1-R: 5′-GTA GCA CCC ACC TTG GTG AGC TGG TAC-3′ (SEQ ID NO: 21) Sun1-E8: 5′-AGC CAC ATA ACC ACC TGG AG-3′
[0441] To test for the MyHC transgene, the following primers were used:
TABLE-US-00005 (SEQ ID NO: 22) MyHC-tF: 5′-ATG ACA GAC AGA TCC CTC CTA TCT CC-3′ (SEQ ID NO: 23) MyHC-tR: 5′-CTC ATC ACT CGT TGC ATC ATC GAC-3′ (SEQ ID NO: 24) MyHC-F: 5′-CAA ATG TTG CTT GTC TGG TG-3′ (SEQ ID NO: 25) MyHC-R: 5′-GTC AGT CGA GTG CAC AGT TT-3′
[0442] To test for the presence of mcm transgene, the following primers were used:
TABLE-US-00006 (SEQ ID NO: 26) mcm-3798t: 5′-AGG TGG ACC TGA TCA TGG AG-3′ (SEQ ID NO: 27) mcm-8346t: 5′-ATA CCG GAG ATC ATG CAA GC-3′ (SEQ ID NO: 28) mcm-7338: 5′-CTA GGC CAC AGA ATT GAA AGA TCT-3′ (SEQ ID NO: 29) mcm-7339: 5′-GTA GGT GGA AAT TCT AGC ATC ATC C-3′
1.1 Tamoxifen Injection and Tissue Collection
[0443] Young mice (14 days old) and adult mice (3-5 months old) were injected once with 40 mg/kg of Tamoxifen (Sigma) dissolved in Corn Oil (Sigma). Mice were sacrificed by CO.sub.2 euthanasia or anesthetised with a gaseous mixture of 1.5% Isoflurane (BioMac) and 1.5LO.sub.2 at various time points after tamoxifen injection. Cardiac arrest was induced by injection of 15% KCl, followed by flushing with PBS to remove blood. Hearts for paraffin embedding were additionally flushed with 4% paraformaldehyde (PFA), left in 4% paraformaldehyde (PFA) overnight, dehydrated in 70% ethanol for at least 24 hr and embedded in paraffin. Hearts for cryosection were embedded in tragacanth gum (Sigma), frozen in isopentane (BDH-AnalaR) cooled in liquid N.sub.2, cut 9 μm sections by cryostat (Leica CM3050), collected onto charged slides and stored at −20° C. for histological and immunofluorescence staining. Hearts for protein and RNA extraction were snap frozen in liquid N2 and stored for further processing.
1.2 Cardiomyocyte Isolation
[0444] Cardiomyocyte isolation was carried out as per standard protocol [M. Ackers-Johnson et al., Circulation Research 119: 909 (2016)]. Briefly, mice were anaesthetised with isoflurane (100% O.sub.2 at 0.5 L/min, isoflurane atomiser dial at 4%). Mice hearts were stopped with 15% KCl, descending aorta was cut and hearts were flushed with 7 mL of EDTA buffer into the right ventricle. Ascending aorta was clamped using Reynolds forceps, the entire heart removed and placed in a 60 mm dish containing fresh EDTA buffer. Hearts were digested by sequential injections of 10 mL EDTA buffer, 3 mL Perfusion buffer and 30-50 mL Collagenase buffer into the left ventricle. Forceps were used to gently pull the digested heart into smaller pieces ˜1 mm and gentle trituration. Enzymatic activity was inhibited by addition of 5 ml of Stop buffer. Cell suspension was passed through a 100 um filter, and four sequential rounds of gravity settling to enrich for myocytes, ultimately obtaining a highly pure myocyte fraction. The myocyte pellet was snap frozen in liquid N.sub.2 and stored a −80° C. until further processing.
1.3 Histological and Immunofluorescence Microscopy
[0445] For histological studies, sections (9 μm) were stained with standard Hematoxylin and Eosin for cell morphology, Masson's trichrome stain to detect collagen and TUNEL assay to detect apoptotic nuclei. Images were obtained on a Zeiss Axio Imager Microscope. For immunofluorescence on frozen heart sections, sections were warmed to room temperature, rehydrated with PBS, blocked with M.O.M block (Vector Shields) and donkey serum (Sigma-Aldrich), incubated with primary antibodies overnight at 4° C. The slides were then washed in PBS and incubated with secondary antibodies and Hoechst dye (Sigma-Aldrich) for 60 mins, washed with PBS and mounted in Prolong-Gold Anti-fade reagent (Invitrogen). Primary antibodies: LMNA/C N-18 (goat, 1:50, Santa Cruz), Sun1 monoclonal (mouse, neat, from B. Burke), PCM-1 (rabbit, 1:200, Sigma) and sarcomere-α-actinin (mouse, 1:100, abcam); Secondary antibodies were: Alexa Fluor 488, 568 and 647 (1:250, Invitrogen). For isolated cardiomyocyte immunofluorescence, myocytes were stained in suspension and spun down gently for each solution change then plated on glass slides for imaging with a Zeiss LSM510 inverted confocal microscope.
1.4 Western Analysis for LMNA, SUN1, Ha-Tag and GFP.
[0446] Whole Hearts and Quadriceps muscles were homogenized in RIPA lysis buffer and spun at 13,200 g, 10 min, 4° C. Total cell lysates were electrophoresed and transferred to PVDF membrane and blocked with Odyssey Blocking Buffer (Li-Cor Biosciences). The membrane was incubated with primary antibodies for 2 h at room temperature. After which, membrane was washed in TBST washing solution and incubated in Odyssey IRDye secondary antibodies for 1 h before visualization on the Odyssey Infrared Imaging System (Li-Cor Biosciences). The primary antibodies used for detection of LMNA/C (Rabbit, Cell Signalling) that is specific to an epitope in the first 50 amino acids in LMNA, Sun1 monoclonal (mouse, 1:500, Burke) and control beta-tubulin (rabbit, 1:1000, Abcam).
1.5 Active Force Measurement of Cardiac Papillary Muscle.
[0447] Mouse papillary muscle from mouse left ventricle was prepared according to the methods described before [C. N. Toepfer, et al., J Physiol 594: 5237-5254 (2016)]. Briefly, explanted mouse heart was immediately rinsed with oxygenated ice-cold Krebs-Henseleit solution with 12 unit/mL heparin sodium (EDQM) and 30 mM 2,3-Butanedione monoxime_(BDM, Sigma) and excess blood was removed. After that, the heart was transferred to ice-cold Krebs-Henseleit solution in a glass petri-dish under a dissection microscope with a cooling stage. Cylindrical papillary (200-300 μm in diameter and 1.5-2 mm in length) were excised from the left ventricle. T-shaped aluminium clips with a hole were crimped onto the ends of a papillary preparation and the prepared papillary chunks were fixed using pins onto a glass petri-dish with a layer of PDMS sylgard 184 (Dow Corning). Papillary preparations were immersed in a 2% Triton X-100 solution at 4° C. overnight.
[0448] Force measurement was performed as previously described [C. Toepfer et al., J Biol Chem 288: 13446-13454 (2013)]. The T-shaped aluminium clips at the ends of the papillary preparations were attached to the hooks of a force transducer (AE801, HJK Sensoren+Systeme) and servo-motor in the experimental rig and were glued with shellac in ethanol (Sigma) to minimize the movement during the experiment. Papillary contraction force was measured at 20° C. The max contraction force was measured in activing solution (100 mM TES, 6.5 Mm MgCl2, 25 mM Ca-EGTA, 5.7 mM Na2ATP, 20 mM Glutathione, 21.5 mM sodium creatine phosphate, pH=7.1, Ionic strength is 150 mmol/L) with 32 μmol/L free Ca2+. The data were collected and processed from the force transducer and DAQ data acquisition device (National Instrument) using a customized software programmed by LabVIEW 2013 (National instrument). At least 5 fibres were tested in each mouse, and at least 3 mice were tested for each experimental group.
1.6 AAV9-DN-Sun1 and AAV9-GFP Virus
[0449] The DN-Sun1 (SS-HA-Sun1L-KDEL) and GFP (SS-GFP-KDEL) vectors were as described [M. Crisp et al., J Cell Biol. 172: 41-53 (2006)]. Briefly, almost the entire lumenal domain of Sun1 was tagged at its NH.sub.2 terminus with HA (HA-Sun1 L). To introduce the HA-Sun1 L as a soluble form into the lumen of the ER and PNS, signal sequence and signal peptidase cleavage site of human serum albumin was fused onto the NH.sub.2 terminus of HA-Sun1 L to yield SS-HA-Sun1 L. To prevent its secretion, a KDEL tetrapeptide was fused to the COOH terminus of SS-HA-Sun1 L to form the final SS-HA-Sun1 L-KDEL. The HA-Sun1 L region was replaced with GFP sequence to generate the SS-GFP-KDEL. The DN-Sun1 and GFP fragments were amplified with the primers listed below (same forward primer was used for both fragments) and ligated into pENN-AAV-cTnT-PI-eGFP plasmid (kind gift from Dr J. Jian), digested with NcoI and KpnI, to produce Penn-AAV-cTnT-Sun1DN (
TABLE-US-00007 aavSun1 F: (SEQ ID NO: 30) 5′-CgagaattcacgcgggccgccATGAAGTGGGTAACCTTTATTTC-3′ aavSun1 R: (SEQ ID NO: 31) 5′-CgggtcgactctagaggtaccttaCTACAACTCATCTTTCTGGATG- 3′ aavGFP Sun R: (SEQ ID NO: 32) 5′-CgggtcgactctagaggtacttaCTACAACTCATCTTTGGATCC-3′
[0450] All restriction enzymes were purchased from NEB. PCR reactions were conducted using Q5® Hot Start High-Fidelity 2× Master Mix (NEB, M0494L). Ligations were conducted using isothermal assembly with NEBuilder® HiFi DNA Assembly Master Mix (NEB, E2621 L). Primers used for constructing the plasmids were ordered from IDT.
[0451] AAV Viruses were produced as per standard protocol [H. Wakimoto, et al., in Current Protocols in Molecular Biology. (John Wiley & Sons, Inc., 2001)]. Materials supplied by R. Foo: pAAV2/9—the trans-plasmid encoding AAV replicase and capsid gene (SEQ ID NO:2; available from University of Pennsylvania Penn Vector Core); pAdDeltaF6—the adenoviral helper plasmid (SEQ ID NO:1) (available from University of Pennsylvania Penn Vector Core); QIAGEN Plasmid Maxi Kit; HEK293T cells (ATCC); Transfection reagent (polyethylenimine e.g., Polysciences). AAV-DJ capsid was obtained from Cell Biolabs, Inc. The pAAV2/9, AAV-DJ, pAdDeltaF6, DN-Sun1 and GFP plasmids were purified using a QIAGEN Plasmid Maxi Kit. HEK293T cells were transfected with the virus combination of pAAV2/9, pAdDeltaF6 and either DN-Sun1 or GFP plasmids. Cells were collected and virus purified by lodixanol gradient ultracentrifugation.
[0452] The following timeline was used for infection of the mouse hearts. Mice were genotyped at 10 days postnatally. They were then subjected to 1 IP injection of Tmx (40 mg/kg of mouse weight) at 14 days postnatally, followed by a concentration of 5×10{circumflex over ( )}10 vg/g AAV9-DN-Sun1 or AAV9-GFP virus injected into the thoracic cavity at 15 days postnatally. Adult mice (3-5 months old) were injected IP with a single dose of Tmx (40 mg/kg of mouse weight), followed by injection of AAV at a concentration of 5×10{circumflex over ( )}10 vg/g AAV9-DN-Sun1 or AAV9-GFP virus into the thoracic cavity. Young and adult mice were anesthetised with a gaseous mixture of 1.5% Isoflurane (BioMac) and 1.5 L O.sub.2 before virus injections.
1.7 Plasmid Construction and Generation of Cas9 mRNA and sgRNAs
[0453] pX330 was obtained from Addgene (#42230, Cambridge, Mass., USA). The 20 nt Sun1 and Syne1 single guide RNA (sgRNA) sequences were designed with the help of CRISPR Design Tool (crispr.genome-engineering.org). A region of the gene of interest was submitted to the tool to identify suitable target sites. Since off-target mutations are possible in CRISPR/Cas9-mediated targeted mutagenesis in the mouse, the CRISPR Design Tool is able to experimentally assess off-target genomic modifications for each gRNA target sites and provide computationally predicted off-target sites for each intended target, ranking the target sequence according to quantitative specificity analysis on the effects of base-pairing mismatch identity, position and distribution. Complimentary oligonucleotides containing the gRNA target sequences were annealed and cloned into the BbsI site of pX330. Guide RNA sequences were as follows:
TABLE-US-00008 (SEQ ID NO: 33) 5′-GCACAATAGCCTCGGATGTCG-3′ for SunΔSUN, (SEQ ID NO: 34) 5′-CCGTTGGTATATCTGAGCAT-3′ for Syne1-stop, (SEQ ID NO: 35) 5′-GGTTATGGCCGATAGGTGCAT-3′ for Tyrosinase4a
[0454] These plasmids (pSun1ΔSUN, pSyne1-stop and pTyrosinase4a) were then sequenced to verify correct insertion of the target sequences. For in vitro transcription, PCR was performed to generate the appropriate transcription templates using a common reverse primer (AAAAGCACCGACTCGGTGCC-3′; SEQ ID NO:36) and gRNA-specific forward primers that encoded the T7 promoter sequence as follows:
TABLE-US-00009 Sun1ΔSUN: (SEQ ID NO: 37) 5′-TTAATACGACTCACTATAGCACAATAGCCTCGGATGTCG-3′ Syne1-stop: (SEQ ID NO: 38) 5′-TTAATACGACTCACTATAGCCGTTGGTATATCTGAGCAT-3′ Tyrosinase4a: (SEQ ID NO: 39) 5′-TTAATACGACTCACTATAGGTTATGGCCGATAGGTGCAT-3′
[0455] The gRNA PCR products were then subjected to agarose gel electrophoresis (1.5% agarose) to confirm successful PCR, gel purified and used as templates for in vitro transcription using the MEGAshortscript T7 kit (Life Technologies). The gRNAs were purified using MEGAclear kit (Life Technologies) and eluted in RNase-free water. A sample of purified gRNAs were then subjected to agarose gel electrophoresis for quality checks before injecting into zygotes.
1.8 Generation of Mutant Mice Using CRISPR/Cas9
[0456] 3 to 4 weeks old C57BL/6N females were superovulated with Pregnant Mare Serum gonadotropin (Calbiochem, 36722, 51U/ml). 48 hours later, the females were injected with human chorionic gonadotropin (Sigma, CG10, 5 IU/ml) and were mated with C57BL6 males. The following day, fertilized 0.5 dpc embryos were collected from the oviducts. Cas9 mRNA (Sigma, CAS9MRNA, 100 ng/ul), Tyrosinase4a gRNA (50 ng/ul) and gene-specific gRNA (50 ng/ul) were co-injected into the cytoplasm of the embryos in M2 medium (EmbryoMax® Sigma) using a microinjection system (Nikon). Syne1-stop sgRNA were used to derive Syne1 C′T mutant mice and Sun1ΔSUN sgRNA were used to derive Sun1ΔSUN mutant mice. The injected zygotes were cultured in KSOM with amino acids (EmbryoMax® Sigma) in an incubator maintained at 37° C. with 5% CO.sub.2 and 5% O.sub.2 for 2 hours before implanting into 0.5 dpc pseudopregnant C3H-ICR females.
1.9 DNA Extraction for Genotyping of CRISPR/Cas9 Mice
[0457] Mouse tails were clipped and each placed in a 1.5 ml Eppendorf tube. 80 μl of lysis buffer (25 mM NaOH, 0.2 mM EDTA, pH 12) was dispensed into the tube and heated at 95° C. for 60 minutes. After heating, the buffer was neutralized with an equal volume of 40 mM Tris-HCl, pH 5. For certain applications, DNA was extracted and purified from mouse tails using DNeasy Blood and Tissue Kit (QIAGEN).
1.10 Genotyping of CRISPR/Cas9 Mice
[0458] CRISPR modified mutant mice were genotyped by PCR followed by gel electrophoresis using a high resolution agarose (2% MetaPhor agarose, Lonza).
Primers for Syne1CT′Δ8 Mice were:
TABLE-US-00010 (SEQ ID NO: 40) Forward: 5′-TGCTCCTGCTGCTGCTTATT-3′ (SEQ ID NO: 41) Reverse: 5′- ACATGGTGGAGCATTTGTCTCC -3′
Primers for Sun1 CRISPR Mice were:
TABLE-US-00011 (SEQ ID NO: 42) Forward: 5′-TGACCTTGAGCTGAAACTGC-3′ (SEQ ID NO: 43) Reverse: 5′-TCAGAACACTGGCACACACA-3′
[0459] Lmna mutant mice were genotyped as described in Example 1. To determine sequence of CRISPR-induced mutations, PCR products from mouse tail DNA were subjected to TOPO cloning (Zero Blunt™ TOPO™ PCR Cloning Kit, 450245, Thermo Fisher Scientific). Plasmid DNA from at least 10 bacterial colonies were isolated using a mini-prep kit (QIAGEN, QIAprepSpin, Miniprep Kit) and sent for Sanger sequencing.
1.11 Derivation of Myoblasts, Fibroblasts and Cell Culture for CRISPR/Cas9 Study
[0460] To isolate myoblasts, limbs were obtained from euthanized mice and muscles were dissected from bone. Tissue digestion was performed by incubating the muscle tissues in enzyme solution consisting of equal volumes of dispase II (Roche, cat. 04942078001) at a concentration of 2.4 U/ml and 1% collagenase II (GIBCO® Invitrogen, cat 17101-015) in a 37° C. water bath for 30 minutes, with occasional mixing at 10 minutes interval. After 30 minutes, enzyme solution was neutralized in D10 media (Dulbeco's Modified Eagle Medium (DMEM) with 10% fetal bovine serum). Mixture is then filtered through 70 μm sterile filter (BD Falcon™, cat 352350) and 40 μm sterile filter (BD Falcon™, cat 352340). The suspension was then centrifuged, supernatant removed and subsequently resuspended in F10 media (GIBCO® Invitrogen, cat. 11550043) supplemented with 10 μg/ml bFGF (GIBCO®, cat PHG0264) and plated in 100 mm plates. Mouse adult fibroblasts were allowed to settle for 2 to 3 hours before collecting the supernatant (with floating myoblasts) and replated into 60 mm plates coated with 0.15% Gelatin (Sigma, cat G1393). D10 media was added to the 100 mm plates with MAFs. To terminally differentiate myoblasts to myotubes, the media was changed to DMEM supplemented with 2% horse serum (Thermo Fisher Scientific GIBCO®, cat 16050122).
1.12 Immunoblotting for CRISPR/Cas9 Study
[0461] Whole cell lysates were generated using the Lysis-M kit solution (cOmplete; Roche). Cells were washed in ice-cold PBS and lysed with Roche Lysis M buffer, and centrifuged at 14,000 g for 10 minutes to remove cell debris. To extract protein from tissue sample, small slices of tissue were rapidly placed into Lysing Matrix D tubes (MP Biomedicals), and snap frozen in liquid nitrogen. After snap freezing, the tubes were either stored at −80° C. or used directly for protein analysis. Protein extraction buffer (50 mM Tris (pH7.4), 500 mM NaCl, 0.4% SDS, 5 mM EDTA (pH7.4), 1× Protease inhibitor (cOmplete™ EDTA-free Protease Inhibitor cocktail, Cat no. 04693159001, Roche), 2% Triton, 1 mM Dithiothreitol, in distilled water) was added to tissues, which were then homogenized using the FastPrep™-24 Instrument (MP Biomedicals). Samples were then centrifuged at 14,000 g for 10 minutes to remove cell debris. Protein concentration was quantified using bicinchoninic acid (BCA) protein kit (Bio-Rad) before loading protein samples onto a polyacrylamide gel to ensure equal amounts were being analyzed. All protein samples were resolved by SDS-PAGE gel analysis and transferred onto polyvinylidene fluoride (PVDF) membrane (Millipore) by wet transfer for 48 hours at 20V at 4° C. Membranes were blocked in TBS containing 0.1% Tween 20 (TBST) supplemented 5% milk powder (Anlene) for 1 hour at room temperature. Western Blot analysis was performed using primary antibodies diluted in 5% milk powder (diluted in TBST). Membranes were incubated for 2 hours at room temperature or overnight at 4° C. For secondary antibodies, horseradish-peroxidase (HRP) (Invitrogen) conjugated antibodies were used for chemiluminescent imaging. The membranes were incubated for 1 hour at room temperature with the secondary antibodies. For immunoblots visualized by chemiluminescence, membranes were incubated in ECL substrate (Pierce) for 1 minute before being exposed to a chemiluminescence sensitive film (Thermo Scientific) and subsequently processed.
1.13 Immunofluorescence for CRISPR/Cas9 Study
[0462] Cells were grown in 8-well slides (Ibidi) and fixed in ice-cold methanol for 15 minutes at −20° C. They were then rinsed in PBS twice and permeabilized and blocked with 0.1% Triton X, 3% BSA in PBS for 15 minutes at room temperature. The fixed and permeabilized cells were then rinsed in PBS three times. Samples were then incubated with primary antibodies (Table 2) for 2 hours at room temperature or overnight at 4° C. Samples were then washed with PBS three times and subsequently incubated with secondary antibodies (Life Technologies) and DAPI (Life Technologies) for 1 hour at room temperature. After three washes in PBS, cells were mounted in Anti-fade (1% DABCO, 90% Glycerol, 10% PBS) and inspected using a Zeiss 510 Meta Confocal microscope or Axiovert 200 inverted epifluorescence microscope (Zeiss). Images were recorded and analysed using Zeiss ZEN, Metamorph or Image J (NIH) software.
TABLE-US-00012 TABLE 2 Antibodies used for immunofluorescence study. Antibody Type and Source Concentration Akap450, Polyclonal, Sigma 1:500 HPA-026109 MF20 Monoclonal, DSHB 1:25 Nesp1 Monoclonal, Glenn Morris 1:1000 (MANNES1A) (Western) 1:50 (IF) Nesp1-C'T Monoclonal, Brian Burke Undiluted supernatant LaminA, ab8984 Monoclonal, Abcam 1:200 LaminA, SSD Monoclonal, Brian Burke 1:200 Pcm-1, Polyclonal, Sigma 1:100 HPA-023374 Pcnt, ab4448 Polyclonal, Abeam 1:100 Sun1-9F10 Monoclonal, Brian Burke 1:200 Sun2-3.1E Monoclonal, Brian Burke 1:500 Nesprin-2 Polyclonal, MyBiosource.com 1:500
1.14 Mouse Genetics
[0463] Lmna mice and tamoxifen injection were described in Example 1. To obtain Lmna.sup.Δ/Δ:Syne1.sup.C′TΔ8/C′TΔ8 and Lmna.sup.Flx/Flxmcm:Syne1.sup.C′TΔ8/C′TA8 double mutant mice, Lmna.sup.Δ/+ or LmnaFlx/Flxmcm mice were intercrossed with Syne1.sup.C′TΔ8/C′TΔ8 mice. In the Syne2 mouse model, a IRES-β-gal neomycin selectable cassette (PgkNeo) flanked by loxP sites was inserted into the Syne2 gene, resulting in deletion of part of exon 102 and all of exons 103-104. The neomycin cassette was subsequently removed by crossing with Cre recombinase mice. Syne1.sup.C′TΔ8/+ or Syne1.sup.C′TΔ8/C′TΔ8 mice were crossed with Syne2.sup.+/− or Syne2.sup.−/− - mice to obtain mice with mutant Syne1 and Syne2 alleles, which were intercrossed to obtain double mutant mice. Kaplan-Meier method was used to draw the survival curves.
1.15 Human Guide RNA Sequences
[0464] Potential guide RNA sequences to disrupt human SYNE1 KASH domain or SUN1 SUN domain were determined using CRISPR tool in Benchling software (Benchling Inc. USA) and are shown in Table 3.
TABLE-US-00013 TABLE 3 Potential guide RNA sequences to target final exons in human SYNE1 (Nesprin-1) or SUN1 genes Gene CRISPR SEQ Name ENSEMBLgene ID Chromosome Position Strand Sequence PAM enzyme ID NO: SYNE1 ENSG00000131018 6 515330 − TCGTGTATCTGAGCATGGGG TGGAAT saCas9 44 SYNE1 ENSG00000131018 6 515335 − GCCATTCGTGTATCTGAGCA TGGGGT saCas9 45 SYNE1 ENSG00000131018 6 515340 + TCCACCCCATGCTCAGATAC ACGAAT saCas9 46 SYNE1 ENSG00000131018 6 515320 − GAGCATGGGGTGGAATGACC GGG spCas9 47 SYNE1 ENSG00000131018 6 515321 − TGAGCATGGGGTGGAATGAC CGG spCas9 48 SYNE1 ENSG00000131018 6 515330 − TCGTGTATCTGAGCATGGGG TGG spCas9 49 SYNE1 ENSG00000131018 6 515333 − CATTCGTGTATCTGAGCATG GGG spCas9 50 SYNE1 ENSG00000131018 6 515334 − CCATTCGTGTATCTGAGCAT GGG spCas9 51 SYNE1 ENSG00000131018 6 515335 − GCCATTCGTGTATCTGAGCA TGG spCas9 52 SYNE1 ENSG00000131018 6 515345 + CCCATGCTCAGATACACGAA TGG spCas9 53 SYNE1 ENSG00000131018 6 515333 + CCCGGTCATTCCACCCCATG TTTG Cpf1 54 SUN1 ENSG00000164828 7 873276 + TTTTTCTAACTGGGGCCATC CTGAGT saCas9 55 SUN1 ENSG00000164828 7 873285 − CCGATACAGACAGGTATACT CAGGAT saCas9 56 SUN1 ENSG00000164828 7 873266 + AACTTCGGATTTTTTCTAAC TGG spCas9 57 SUN1 ENSG00000164828 7 873267 + ACTTCGGATTTTTTCTAACT GGG spCas9 58 SUN1 ENSG00000164828 7 873268 + CTTCGGATTTTTTCTAACTG GGG spCas9 59 SUN1 ENSG00000164828 7 873280 − ACAGACAGGTATACTCAGGA TGG spCas9 60 SUN1 ENSG00000164828 7 873296 + CTGAGTATACCTGTCTGTAT CGG spCas9 61 SUN1 ENSG00000164828 7 873281 + TTCTAACTGGGGCCATCCTG TTTT Cpf1 62 SUN1 ENSG00000164828 7 873282 + TCTAACTGGGGCCATCCTGA TTTT Cpf1 63 SUN1 ENSG00000164828 7 873283 + CTAACTGGGGCCATCCTGAG TTTT Cpf1 64 SUN1 ENSG00000164828 7 873284 + TAACTGGGGCCATCCTGAGT TTTC Cpf1 65 PAM, protospacer adjacent motif; saCas9, Staphylococcus aureus Cas9; spCas9, Streptococcus pyogenes Cas9; Cpf1, CRISPR from Prevotella and Francisella 1.
1.16 Statistical Analysis
[0465] All statistical analysis was performed using Graphpad Prism software.
Example 2: Cardiomyocyte Specific Loss of Lmna Results in the Rapid Onset of Heart Failure
[0466] To further define the interaction between Sun1 and Lmna in postnatal pathology in mice, we specifically ablated the Lmna gene in different tissues by using a conditional Lmna.sup.Flx/Flx line of mice (
Example 3: Deletion of Sun1 Ameliorates Cardiac Pathology Induced by Lmna Loss
[0467] Mice with Lmna mutations show a significant increase in longevity and health in the absence of Sun1 [C. Y. Chen et al., Cell 149: 565-577 (2012)]. As described, induced deletion of Lmna in cardiomyocytes (Lmna.sup.Flx/Flx:mcm+Tmx) results in death within 1 month post Cre induction (
[0468] As a model for ventricular muscle mechanics we measured the active force in cardiac papillary muscle. The active force was significantly reduced by 66% in Lmna.sup.Flx/Flx:mcm:Sun1.sup.+/++Tmx papillary muscle (P=0.0028) compared to Lmna.sup.Flx/Flx:mcm Sun1.sup.+/++CTL. In the absence of SUN1, Lmna.sup.Flx/Flx:mcm Sun1.sup.−/−+Tmx cardiac papillary active force was maintained at levels not significantly different from those of controls (
[0469] Echocardiograms performed before and after Cre induction revealed progressive worsening of cardiac contractility in the Lmna.sup.Flx/Flx:mcm Sun.sup.+/++Tmx mice compared to Lmna.sup.Flx/Flx:mcm Sun1.sup.−/−+Tmx mice (
[0470] PCR analysis of the aged Lmna.sup.Flx/Flx:mcm Sun1.sup.−/−+Tmx hearts 12-14 months after Tmx injection confirmed the sustained deletion of Lmna gene (
Example 4: Loss of SUN1 Extends Longevity of Lmna Missense Mutants
[0471] As most cases of LMNA induced DCM result from missense mutations, we determined what effect loss of SUN1 had on the longevity and cardiac function of a previously described Lmna mutant mouse line carrying the N195K missense mutation that dies from DCM [L. C. Mounkes, et al., Hum Mol Genet 14: 2167-2180 (2005)], with this mutation having been identified in 2 unrelated patients diagnosed with AD-EDMD [D. Fatkin et al., N Engl J Med 341: 1715-1724 (1999); J. P. van Tintelen et al., Am Heart J 154: 1130-1139 (2007)]. Here too, we found that the absence of SUN1 significantly extended the lifespan of this mutant mouse line with improved cardiac function (
[0472] Echocardiograms performed before and after Cre induction revealed progressive worsening of cardiac contractility in the Lmna.sup.N195K/Flx:mcm Sun1.sup.+/+ mice compared to Lmna.sup.N195K/Flx:mcm Sun1.sup.−/− mice (
Example 5: AAV9 Mediated Transduction and Expression of a DNSun1 Prolongs the Lifespan of the Lmna.SUP.Flx/Flx:mcm.+Tmx Mice
[0473] The above results demonstrated that genetically ablating SUN1's functions or reducing SUN1 levels could be of therapeutic value in treating DCM. We then tested whether this was due to the complete ablation of SUN1's functions to overcome its toxic over-abundance versus leaving its levels untouched and specifically disrupting its LINC complex-associated role in tethering KASH-domain proteins in the ONM, thereby tethering the nucleus to components of the cytoskeleton. To distinguish between these 2 possibilities, Adenovirus Associated Virus (AAV) was utilized to transduce and express, specifically in cardiomyocytes, a dominant negative SUN1 minigene whose protein product would compete with both SUN1- and SUN2-KASH binding in the cardiomyocyte perinuclear space [M. Crisp et al., J Cell Biol 172: 41-53 (2006)]. A schematic representation of an AAV viral capsid and its genomic payload is shown in
[0474] A region corresponding to the entire lumenal domain of the Sun1 gene was tagged at its N terminus with an HA (HA-Sun1L) epitope. To localize the resulting protein product to the endoplasmic reticulum (ER) and perinuclear space (between the INM and ONM—PNS), the signal sequence and signal peptidase cleavage site of human serum albumin was fused to the N terminus of HA-Sun1 L to yield SS-HA-Sun1 L. To prevent the miniprotein's secretion, a KDEL tetrapeptide was linked to the C-terminus of SS-HA-Sun1 L, forming SS-HA-Sun1 L-KDEL (
[0475] To verify that the DN-Sun1 functioned in cardiomyocytes (CM) we initially transduced human CMs derived from PS stem cells using the AAV-DJ system [D. Grimm, et al., J Virol. 82(12):5887-911 (2008)] that provides for a higher infectivity rate in cultured cells than the AAV9 serotype used to transduce the DN-Sun1, under transcriptional control of the cTnT promoter, in the mouse hearts. The DN-Sun1 was effective at displacing Nesprin-1 from the nuclear envelopes in the CMs that were expressing the DN-Sun1 as shown in
[0476] We used AAV (serotype 9) to transduce and express the DN-Sun1 minigene in the hearts of postnatal mice by intrathoracic injection. The procedure is summarized in
[0477] Immunofluorescence analysis revealed that a larger percentage of cardiomyocytes were expressing GFP with 5×10{circumflex over ( )}10 vg/g of AAV9-GFP compared to the levels resulting from a 10-fold lower dose of viral particles (5×10{circumflex over ( )}9 AAV9-GFP) (
[0478] The Lmna.sup.Flx/Flx:mcm+Tmx mice, injected with AAV9-GFP control, lived an average of 34.5 days after Tmx, whereas Lmna.sup.Flx/Flx:mcm+Tmx mice injected with AA9-DNSun1 (5×10{circumflex over ( )}10 vg/g of mouse) lived significantly longer with the majority surviving at least 100 days after Tmx, before their termination for analysis (P=0.0002) (
Example 6: Disruption of the LINC Complex in Mice Using CRISPR/Cas9
[0479] Mice harboring a variety of Lmna mutations, both global and cardiac-specific, show a significant increase in longevity and health in the absence of Sun1 [(Chen et al., Cell 149: 565-577 (2012) and Examples 2-4]. Prior to the findings described in Examples 2-5, the mechanism of this rescue was unclear, but was speculated to be due to the toxic effects of excess Sun1 in Lmna mutants [Chen et al., Cell 149: 565-577 (2012)]. AAV-mediated expression of a dominant negative LINC-complex-disrupting transgene ameliorates the pathology associated with Lmna mutation [Example 5]. The findings in Examples 2-5 are consistent with the idea that LINC complex function, rather than excess Sun1, is the molecular driver of Lmna pathology. This was surprising, as genetic disruption of the LINC complex via loss of Sun1 and Sun2 [K. Lei et al., Proc Natl Acad Sci USA 106: 10207-10212 (2009)], or cardiac-specific disruption of Nesprin-1 and Nesprin-2 [Banerjee et al., PLOS Genet 10(2): e1004114 (2014)], in mice, resulted in various pathologies.
[0480] To develop alternative means of disrupting the LINC complex in vivo, the possibility of using CRISPR/Cas9 genome editing to disable the SUN and KASH domains of the proteins constituting the LINC complex was examined. As both the SUN domain and the KASH domain are located at the C-termini of their respective proteins, we hypothesized that a CRISPR guide RNA targeted to the 3′ end of the genes encoding SUN or KASH domain proteins would result in a premature stop codon following CRISPR-induced non-homologous end joining. This would result in a truncated protein with its C-terminal SUN or KASH domain mutated. The truncated protein would be expressed and membrane-localized, but unable to interact with its cognate LINC complex partners. In Example 2, we found that loss of Sun2 did not ameliorate Lmna-associated pathologies. Thus we chose to target the Sun1 SUN domain using CRISPR as Sun1 appears to be the dominant SUN domain protein mediating Lmna pathology. Of the KASH domain proteins, only Nesprin-1, Nesprin-2 and Nesprin-3 are broadly expressed [H. F. Horn, Current topics in developmental biology 109: 287-321 (2014)). Nesprin-1 and Nesprin-2 are close paralogues that are functionally redundant. They interact with the actin and microtubule cytoskeleton, whereas Nesprin-3 appears to interact specifically with intermediate filaments [Kim et al., Biol. Chem. 396: 295-310 (2015)]. As we already had Nesprin-2 and Nesprin-3 mutant mouse strains derived by conventional gene targeting available in the laboratory, we chose to target the KASH domain of Nesprin-1 using CRISPR to test the possibility of using CRISPR/Cas9 in vivo for treatment of laminopathies. The Sun1 gene and the Syne1 gene encoding Nesprin-1 protein were directly targeted in vivo by microinjecting C57/B16 mouse zygotes with Cas9 mRNA and gRNA targeting the SUN1 (5′-GCACAATAGCCTCGGATGTCG-3′; SEQ ID NO:66) or KASH1 (5′-CCGTTGGTATATCTGAGCAT-3′ SEQ ID NO:67) domains, followed by implantation into surrogate mothers. Note the SUN1 gRNA targeted Sun1 upstream of the SUN domain so as to ablate the SUN domain. A gRNA (5′-GGTTATGGCCGATAGGTGCAT-3′; SEQ ID NO:68) targeting the tyrosinase gene was co-injected—progeny that had undergone CRISPR genome editing would have white or mosaic coat color resulting from tyrosinase disruption. These pups were genotyped to confirm successful gene disruption and used as founder animals to establish Sun1 or Nesprin-1 mutant colonies.
6.1 Characterization of Mutant Mice
[0481] Following Sanger sequencing of founder animals and F1 progeny, we focused on characterizing Sun1 mutant alleles (
[0482] Immunofluorescence staining revealed loss of Sun1 protein (
[0483] The Syne1 C′TΔ8 allele is predicted to produce a protein where the final 11 amino acids in the wildtype sequence (SEQ ID NO:77) are mutated and are followed by an additional 50 amino acids encoded by an alternate reading frame (
[0484] Immunofluorescence analysis of mouse adult fibroblasts (MAFs) derived from 12 week old mice revealed that Nesprin-1 was mis-localized from the nuclear envelope to the cytoplasm in the Syne1 C′TΔ8 MAFs (
[0485] Similar to one previously reported Nesprin-1 mouse model [Zhang et al., Development 134(5): 901-8 (2007)], and in contrast to two other models [Puckelwartz et al., Hum Mol Genet 18: 607-620 (2009); Zhang et al., Hum Mol Genet 19: 329-341 (2010)], the disrupted KASH domain of Nesprin-1 results in no overt phenotypic differences between the Syne1 wildtype (VVT) and Syne1C′TΔ8 mutant (
[0486] In order to probe the role of other KASH domain proteins in Lmna pathology, mice mutant for Syne2, encoding Nesprin-2, were generated by conventional gene targeting (
6.2 Disruption of Nesprin-1 KASH Domain Ameliorates Lmna Pathologies
[0487] Even though Nesprin-1 was still expressed, Nesprin-1-containing LINC complexes would not be formed in Syne1.sup.C′TΔ8/C′TΔ8 cells and animals. Since AAV-mediated disruption of the LINC complex using dominant negative Sun1 in vivo rescues Lmna pathologies (Example 5), we reasoned that the “KASH-less” Nesprin-1 mutant allele we generated might also rescue Lmna pathology. To test this hypothesis, mice heterozygous for a Lmna null (Lmna.sup.Δ/Δ) allele (Example 1) were intercrossed with Syne1C′TΔ8 mice to obtain Lmna.sup.Δ/Δ:Syne1.sup.C′TΔ8/C′TΔ8 double mutant mice. While Lmna.sup.Δ/Δ mice lived for 15-17 days, Lmna.sup.Δ/Δ:Syne1.sup.C′TΔ8/C′TΔ8 double mutant mice lived for up to 42 days (
Example 7: Method for Screening Small Molecules that Block SUN-KASH Interactions
[0488] Crystallographic studies of human SUN2 reveal that the SUN domain is assembled as a clover-like trimeric structure [Sosa et al., Cell 149(5): 1035-47 (2012)]. Trimerization is mediated by a triple-helical coiled-coil, with an estimated length of 40-45 nm. This is sufficient to bridge the perinuclear space (PNS), allowing SUN and KASH domains to directly interact [Sosa et al., Cell 149(5): 1035-47 (2012)]. The KASH binding site is formed primarily within a groove formed at the interface between adjacent SUN domains (
[0489] An in vitro screen can be set up employing recombinant SUN and KASH domains or KASH peptide, for which methods of production have been previously published [Sosa et al., Cell 149(5): 1035-47 (2012)]. One such screen involves an assay technique analogous to an enzyme-linked immunosorbent assay (
[0490] Alternatively, fluorescence anisotropy or polarization can be used to screen for small molecule inhibitors of SUN-KASH interactions in vitro [Lea, W. A., and Simeonov, A. Expert Opin Drug Discov 6: 17-32 (2011)]. This assay also employs recombinant SUN and KASH domains. The KASH domain is fluorescently labeled; for example a chemically synthesized KASH peptide could be readily functionalized with a fluorescein moiety. Fluorescence anisotropy of the interacting KASH domain interacting with SUN domain can be measured using standard equipment such as a plate reader. A small molecule inhibitor that disrupts the SUN-KASH interaction can be readily detected as the fluorescence anisotropy of the fluorescent KASH will change if it is not bound to SUN.
[0491] As is typical in drug screening campaigns, the compounds which successfully pass the in vitro primary screen will then be subjected to cell-based secondary screens (
Example 8: Discussion
[0492] DCM caused by LMNA is regarded as being aggressive, and often leads to premature death or cardiac transplantation [M. Pasotti et al., J Am Coll Cardiol 52: 1250-1260 (2008); M. R. Taylor et al., J Am Coll Cardiol 41: 771-780 (2003)]. By 60 years, 55% of LMNA mutation carriers die of cardiovascular failure or receive a heart transplant, compared with 11% of patients with idiopathic cardiomyopathy. Attempts to ameliorate DCM by fitting a pacemaker have been at best of transient benefit. Consequently it is necessary develop new therapeutic avenues to treat DCM caused by LMNA mutations.
[0493] The majority of LMNA mutations causing DCM are dominant negative missense. Treatment by conventional gene therapy to repair each mutation would be daunting and removal of the mutated allele, leaving the patient hemizygous for the remaining normal WT allele may also result in heart failure [G. Bonne et al., Nature genetics 21: 285-288 (1999)]. Various other routes downstream of the Lamin gene have been explored for potential therapeutic intervention, and have included mTOR inhibition with rapamycin/rapalogues [J. C. Choi et al., Science translational medicine 4: 144ra102 (2012); F. J. Ramos et al., Science translational medicine 4: 144ra103 (2012)] and inhibition of the MEK1/2 kinase pathway [W. Wu, et al., Circulation 123: 53-61 (2011)]. Both avenues, resulted in improved ventricular function and increased longevity (10-40%) but the extent and long-term efficacy was significantly less than that we observed with the loss of Sun1.
[0494] The molecular mechanisms underlying the varied phenotypes of the laminopathies are still not well understood, though two alternative hypotheses have been proposed to explain the tissue-specific pathologies. The first “gene regulation hypothesis” proposes that LMNA mutations/loss disrupt the equilibrium of various molecular pathways due to the mutations altering interactions with NE proteins and chromatin, which in turn alter gene expression. Evidence in support of this hypothesis comes from studies reporting changes in signalling pathways including the AKT-MTOR pathway [J. C. Choi et al., Science translational medicine 4: 144ra102 (2012)], WNT/β-catenin pathway [L. Hernandez et al., Dev Cell 19: 413-425 (2010); C. Le Dour et al., Hum Mol Genet 26: 333-343 (2017)], TGF-β/Smad [J. H. Van Berlo et al., Hum Mol Genet 14: 2839-2849 (2005); T. V. Cohen et al., Hum Mol Genet 22: 2852-2869 (2013)], MAP Kinase pathway [A. Brull, et al., Front Physiol 9: 1533 (2018)] and the ERK1/2—CTGF/CCN2 pathway [M. Chatzifrangkeskou et al., Hum Mol Genet 25: 2220-2233 (2016)]. While these changes have been documented, none has clearly established whether these changes are not a secondary compensatory effect of a diseased tissue. Sun1 also fits into this rubric of disrupted expression levels as Sun1 protein, but not mRNA, is upregulated in laminopathies, leading to the proposal that laminopathy phenotypes are caused by toxicity from excess Sun1 [C. Y. Chen et al., Cell 149: 565-577 (2012)].
[0495] The second hypothesis suggested Lmna loss or mutation leads to increased nuclear fragility. As a result mechanical stress and tension forces transmitted via the LINC complex from the cytoplasm to the NE causes damage to the NE [J. Lammerding et al., J Clin Invest 113: 370-378 (2004)]. This hypothesis is similar to that proposed for Duchenne muscular dystrophy (DMD), where loss of dystrophin increases the fragility of the muscle cell membrane and when tension-stress forces are applied during muscle contraction this results muscle cell rupture and death [D. J. Blake, et al., Physiol Rev 82: 291-329 (2002)]. Lmna mutant fibroblasts show nuclear deformation, defective mechanotransduction, and reduced viability when subjected to mechanical strain, together with increased nuclear rupture at low and moderate pressures when compared to NMD [Popp, M. W., and Maquat, L. E. Cell 165: 1319-1322 (2016)]. In contracting mouse cardiomyocytes, mechanical stress and tension forces caused by 500-600 contractions per minute are transmitted to the NE via the LINC complex, resulting in nuclear distortion, damage and eventual death/loss as described in
[0496] We attempted to distinguish the tension-stress hypothesis from the expression level hypothesis in cardiomyocytes, using a DN-Sun1 construct to compete with endogenous Sun1 and Sun2 proteins for KASH-domain-binding and so unlink the LINC complex without directly altering Sun1 levels (
[0497] In addition, using CRISPR/Cas9 in mice, we generated a Syne1 mutant allele (C′TΔ8) that gave rise to a truncated Nesprin-1 protein with a disrupted, non-functional, KASH domain. Mice lacking Lmna globally or in the heart have a shortened lifespan, but the presence of a homozygous Syne1.sup.C′TΔ8/C′TΔ8 mutation resulted in significant lifespan extension. Loss of Sun1 or AAV-mediated disruption of the LINC complex by dominant negative transgenes in vivo resulted in similar rescue of Lmna pathology (Example 2-5), while Sun2 and Nesprin-2 mutations did not. Taken together, these data suggest that LINC complexes comprised of Sun1 and Nesprin-1 drive the pathology in Lmna mutant cells and animals.
[0498] There have been a number of reports on the use of AAV to deliver CRISPR/Cas components in vivo for treating diseases. Our results predict that AAV-mediated CRISPR/Cas, such as CRISPR/Cas9, delivery to target the Nesprin-1 KASH domain in disease-affected tissue can be used to treat laminopathies, including dilated cardiomyopathy. For instance, cardiotropic AAVs (e.g. AAV9) can be used to deliver transgene cassette(s) containing a cardiac-specific promoter (e.g. cTnT) driving Cas endonuclease enzyme expression and an appropriate promoter (e.g. U6) driving gRNA expression to treat LMNA DCM. Since the packaging capacity of AAV is limited to 4.7 kb, a smaller Cas9 derived from Staphylococcus aureus (saCas9) rather than the larger, more commonly used, Streptococcus pyogenes Cas9 may be preferred. Alternatively, other CRISPR enzymes such as Cpf1, which is small enough for AAV packaging and has a more commonly found protospacer adjacent motif (PAM) than saCas9, could be used [Zetsche, B., et al., Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell 163, 759-771 (2015)].
[0499] Guide RNAs would target the 3′ region of the Nesprin-1 gene encoding the KASH domain (Table 3). While we have targeted the region adjacent to the stop codon, in principle any gene region encoding the KASH domain could be targeted as indels generated by CRISPR would likely result in frameshift mutations that disable the KASH domain. However, as the final 4 amino acids in the KASH domain are known to be absolutely required for SUN domain interaction and hence LINC complex formation [Sosa et al., Cell 149(5):1035-47 (2012)], it is prudent to select gRNA in the vicinity of the stop codon as even indels that do not result in a frameshift could still mutate the relevant KASH amino acids required for the SUN-KASH interaction. Furthermore, it should be noted that because the Syne1 gene encoding Nesprin-1 is very large and has multiple splice isoforms and alternative start sites, guide RNAs targeted outside the KASH domain, while giving rise to some mutant Nesprin-1 isoforms, may not perturb expression of other isoforms of Nesprin-1 protein, including KASH-containing isoforms. This would result in formation of functional or partially functional Nesprin-1/Sun1 LINC complexes that would still be able to drive pathology in Lmna mutants.
[0500] We did not further investigate the Sun1 mutant mice generated in this study as instead of mice with Sun1 lacking the SUN domain, we essentially obtained Sun1 null mice, which have already been well characterized. We suspect that inducing CRISPR mutation in Sun1 resulted in nonsense-mediated decay (NMD) of Sun1 transcript. Occurrence of a premature termination codon (PTC) 50-55 nucleotides upstream of a exon-exon junction is a trigger for NMD [Popp, M. W., and Maquat, L. E. Cell 165: 1319-1322 (2016)]. Also, PTCs occurring in the middle of a transcript are more likely to result in NMD [Eberle et al., PLOS Biology 6: e92 (2008); Reber et al., MBoC 29: 75-83 (2018)]. In the Sun1_plus4 mutant, the PTC is more than 55 nucleotides upstream of the exon-exon junction and is likely to trigger NMD. For the Sun1A7 mutant, the PTC is less than 50 nucleotides from the exon-exon junction. However for both mutants, since we targeted upstream of the sizeable SUN domain, the PTCs are roughly 2/3 of the way along the length of the transcript, and hence also likely to trigger NMD. In order to specifically disrupt the SUN domain in Sun1 without inducing a null mutation, we can adopt a similar strategy as for Nesprin-1—directing the guide RNA at the very 3′ end of the coding region of the transcript (Table 3). Earlier work demonstrated that mutation of a tyrosine residue to phenylalanine at the C-terminus of SUN2 (Y707F) abolished KASH binding [Sosa et al., Cell 149(5):1035-47 (2012)]. This critical tyrosine residue is conserved in SUN1 (Y812 in Uniprot E9PHI4) and present in the final coding exon of the SUN1 transcript. Selection of a gRNA 5′ proximal to the codon for Y812 would produce indel mutations that cause a frameshift mutation that would mutate Y812 and disrupt KASH binding. As the gRNA would be in the final coding exon, the likelihood of triggering NMD would be low. One can thus envision a CRISPR/Cas9-based strategy to treat laminopathies by targeting a critical residue required for KASH-binding in the SUN1 SUN domain. AAVs could be used to deliver CRISPR enzyme and gRNA targeting SUN1 in appropriate disease tissue, such as the heart. Incapacitation of SUN1 KASH binding would then ameliorate the deleterious effects of Lmna mutations.
[0501] From these results we propose that the loss of or mutations within Lmna causes instability in the CM nuclei due to loss or incorrect assembly of the nuclear lamina. This makes the nuclei susceptible to the tension/stress forces exerted via the LINC complex from the contractile sarcomeres of the CMs. In the absence of SUN1, or following mutation of Nesprin-1 KASH domain, the untethered LINC complexes exert less tensional force on the CM nuclei, enabling survival of the lamin deficient cardiomyocyte.
[0502] These results provide an opportunity to use the AAV-mediated delivery of DN-Sun, DN-KASH, or direct mutation of endogenous SUN or KASH proteins as potential therapeutics for laminopathy-related DCM in patients. The AAV system, as a therapeutic delivery route in patients is established and has been approved by the FDA for treating some diseases. It is becoming more widely used with multiple on-going clinical trials, including the introduction into patients with heart disease. Our results show that disrupting the LINC complex in CMs could be effective at preventing heart failure for an extended period.
Example 9: References to Examples 1 to 8
[0503] 1. M. Ackers-Johnson et al., A Simplified, Langendorff-Free Method for Concomitant Isolation of Viable Cardiac Myocytes and Nonmyocytes From the Adult Mouse Heart. Circulation Research 119: 909 (2016). [0504] 2. R. Agah et al., Gene recombination in postmitotic cells. Targeted expression of Cre recombinase provokes cardiac-restricted, site-specific rearrangement in adult ventricular muscle in vivo. The Journal of clinical investigation 100: 169-179 (1997). [0505] 3. S. G. Alam et al., The mammalian LINC complex regulates genome transcriptional responses to substrate rigidity. Scientific reports 6: 38063 (2016). [0506] 4. A. T. Bertrand et al., DeIK32-lamin A/C has abnormal location and induces incomplete tissue maturation and severe metabolic defects leading to premature death. Hum Mol Genet 21: 1037-1048 (2012). [0507] 5. D. J. Blake, A. Weir, S. E. Newey, K. E. Davies, Function and genetics of dystrophin and dystrophin-related proteins in muscle. Physiol Rev 82: 291-329 (2002). [0508] 6. G. Bonne et al., Mutations in the gene encoding lamin A/C cause autosomal dominant Emery-Dreifuss muscular dystrophy. Nature genetics 21: 285-288 (1999). [0509] 7. A. Brull, B. Morales Rodriguez, G. Bonne, A. Muchir, A. T. Bertrand, The Pathogenesis and Therapies of Striated Muscle Laminopathies. Front Physiol 9: 1533 (2018). [0510] 8. A. Buchwalter, M. W. Hetzer, Nucleolar expansion and elevated protein translation in premature aging. Nature communications 8: 328 (2017). [0511] 9. B. Burke, C. L. Stewart, The nuclear lamins: flexibility in function. Nat Rev Mol Cell Biol 14: 13-24 (2013). [0512] 10. G. Captur et al., Lamin and the heart. Heart 104: 468-479 (2018). [0513] 11. M. Chatzifrangkeskou et al., ERK1/2 directly acts on CTGF/CCN2 expression to mediate myocardial fibrosis in cardiomyopathy caused by mutations in the lamin A/C gene. Hum Mol Genet 25: 2220-2233 (2016). [0514] 12. C. Y. Chen et al., Accumulation of the inner nuclear envelope protein Sun1 is pathogenic in progeric and dystrophic laminopathies. Cell 149: 565-577 (2012). [0515] 13. Y. H. Chi et al., Requirement for Sun1 in the expression of meiotic reproductive genes and piRNA. Development 136: 965-973 (2009). [0516] 14. J. C. Choi et al., Temsirolimus activates autophagy and ameliorates cardiomyopathy caused by lamin A/C gene mutation. Science translational medicine 4: 144ra102 (2012). [0517] 15. M. Crisp et al., Coupling of the nucleus and cytoplasm: role of the LINC complex. J Cell Biol 172: 41-53 (2006). [0518] 16. T. V. Cohen et al., Defective skeletal muscle growth in lamin A/C-deficient mice is rescued by loss of Lap2alpha. Hum Mol Genet 22: 2852-2869 (2013). [0519] 17. W. N. de Vries et al., Expression of Cre recombinase in mouse oocytes: a means to study maternal effect genes. Genesis 26: 110-112 (2000). [0520] 18. Eberle, A. B., Stalder, L., Mathys, H., Orozco, R. Z., and Muhlemann, O. Posttranscriptional Gene Regulation by Spatial Rearrangement of the 3′ Untranslated Region. PLOS Biology 6: e92 (2008). [0521] 19. D. Fatkin et al., Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N Engl J Med 341: 1715-1724 (1999). [0522] 20. Gimpel, P., et al., Nesprin-1α-Dependent Microtubule Nucleation from the Nuclear Envelope via Akap450 Is Necessary for Nuclear Positioning in Muscle Cells. Curr. Biol. 27: 2999-3009.e9. (2017). [0523] 21. F. Haque et al., Mammalian SUN protein interaction networks at the inner nuclear membrane and their role in laminopathy disease processes. J Biol Chem 285: 3487-3498 (2010). [0524] 22. L. Hernandez et al., Functional coupling between the extracellular matrix and nuclear lamina by Wnt signaling in progeria. Dev Cell 19: 413-425 (2010). [0525] 23. R. E. Hershberger, A. Morales, in GeneReviews®, M. P. Adam et al., Eds. (Seattle (Wash.), 1993). [0526] 24. R. E. Hershberger, D. J. Hedges, A. Morales, Dilated cardiomyopathy: the complexity of a diverse genetic architecture. Nat Rev Cardiol 10: 531-547 (2013). [0527] 25. D. S. Herman et al., Truncations of titin causing dilated cardiomyopathy. N Engl J Med 366: 619-628 (2012). [0528] 26. H. F. Horn, LINC complex proteins in development and disease. Current topics in developmental biology 109: 287-321 (2014). [0529] 27. J. L. Jefferies, J. A. Towbin, Dilated cardiomyopathy. Lancet 375: 752-762 (2010). [0530] 28. Kim, D. I., Birendra, K. C., and Roux, K. J. (2015). Making the LINC: SUN and KASH protein interactions. Biol. Chem. 396: 295-310. [0531] 29. T. J. Kirby, J. Lammerding, Emerging views of the nucleus as a cellular mechanosensor. Nature cell biology 20: 373-381 (2018). [0532] 30. J. Lammerding et al., Lamin A/C deficiency causes defective nuclear mechanics and mechanotransduction. The Journal of clinical investigation 113: 370-378 (2004). [0533] 31. J. Lammerding et al., Abnormal nuclear shape and impaired mechanotransduction in emerin-deficient cells. J Cell Biol 170: 781-791 (2005). [0534] 32. J. Lammerding et al., Lamins A and C but not lamin B1 regulate nuclear mechanics. J Biol Chem 281: 25768-25780 (2006). [0535] 33. Lea, W. A., and Simeonov, A. Fluorescence Polarization Assays in Small Molecule Screening. Expert Opin Drug Discov 6: 17-32 (2011). [0536] 34. C. Le Dour et al., Decreased WNT/beta-catenin signalling contributes to the pathogenesis of dilated cardiomyopathy caused by mutations in the lamin a/C gene. Hum Mol Genet 26: 333-343 (2017). [0537] 35. K. Lei et al., SUN1 and SUN2 play critical but partially redundant roles in anchoring nuclei in skeletal muscle cells in mice. Proc Natl Acad Sci USA 106: 10207-10212 (2009). [0538] 36. Lepourcelet et al., Small-molecule antagonists of the oncogenic Tcf/beta-catenin protein complex. Cancer Cell. 5(1): 91-102 (2004). [0539] 37. C. J. Malone, W. D. Fixsen, H. R. Horvitz, M. Han, UNC-84 localizes to the nuclear envelope and is required for nuclear migration and anchoring during C. elegans development. Development 126: 3171-3181 (1999). [0540] 38. L. C. Mounkes, S. V. Kozlov, J. N. Rottman, C. L. Stewart, Expression of an LMNA-N195K variant of A-type lamins results in cardiac conduction defects and death in mice. Hum Mol Genet 14: 2167-2180 (2005). [0541] 39. M. D. Muzumdar, B. Tasic, K. Miyamichi, L. Li, L. Luo, A global double-fluorescent Cre reporter mouse. Genesis 45: 593-605 (2007). [0542] 40. V. Nikolova et al., Defects in nuclear structure and function promote dilated cardiomyopathy in lamin A/C-deficient mice. The Journal of clinical investigation 113: 357-369 (2004). [0543] 41. M. Pasotti et al., Long-term outcome and risk stratification in dilated cardiolaminopathies. J Am Coll Cardiol 52: 1250-1260 (2008). [0544] 42. Popp, M. W., and Maquat, L. E. Leveraging Rules of Nonsense-Mediated mRNA Decay for Genome Engineering and Personalized Medicine. Cell 165: 1319-1322 (2016). [0545] 43. K. M. Prasad, Y. Xu, Z. Yang, S. T. Acton, B. A. French, Robust cardiomyocyte-specific gene expression following systemic injection of AAV: in vivo gene delivery follows a Poisson distribution. Gene Ther 18: 43-52 (2011). [0546] 44. Puckelwartz, M. J., et al., Disruption of nesprin-1 produces an Emery Dreifuss muscular dystrophy-like phenotype in mice. Hum Mol Genet 18: 607-620 (2009). [0547] 45. Ran F A, et al., Genome engineering using the CRISPR-Cas9 system. Nat. Protoc 8: 2281-2308 (2013); [0548] 46. Ran F A, et al., Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154: 1380-1389 (2013) [0549] 47. F. J. Ramos et al., Rapamycin reverses elevated mTORC1 signaling in lamin A/C-deficient mice, rescues cardiac and skeletal muscle function, and extends survival. Science translational medicine 4: 144ra103 (2012). [0550] 48. Reber, S., et al., CRISPR-Trap: a clean approach for the generation of gene knockouts and gene replacements in human cells. MBoC 29: 75-83 (2018). [0551] 49. T. Sieprath et al., Sustained accumulation of prelamin A and depletion of lamin A/C both cause oxidative stress and mitochondrial dysfunction but induce different cell fates. Nucleus 6: 236-246 (2015). [0552] 50. D. S. Sohal et al., Temporally regulated and tissue-specific gene manipulations in the adult and embryonic heart using a tamoxifen-inducible Cre protein. Circ Res 89: 20-25 (2001). [0553] 51. I. Solovei et al., LBR and lamin A/C sequentially tether peripheral heterochromatin and inversely regulate differentiation. Cell 152: 584-598 (2013). [0554] 52. Sosa B A, Rothballer A, Kutay U, Schwartz T U, LINC complexes form by binding of three KASH peptides to domain interfaces of trimeric SUN proteins. Cell 149(5): 1035-47 (2012). [0555] 53. C. L. Stewart, S. Kozlov, L. G. Fong, S. G. Young, Mouse models of the laminopathies. Exp Cell Res 313: 2144-2156 (2007). [0556] 54. C. Stewart and B. Burke, RNAi-based therapies for cardiomyopathies, muscular dystrophies and laminopathies. WO2013/158046. [0557] 55. T. Sullivan et al., Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J Cell Biol 147: 913-920 (1999). [0558] 56. E. C. Tapley, D. A. Starr, Connecting the nucleus to the cytoskeleton by SUN-KASH bridges across the nuclear envelope. Curr Opin Cell Biol 25, 57-62 (2013). [0559] 57. U. Tayal, S. Prasad, S. A. Cook, Genetics and genomics of dilated cardiomyopathy and systolic heart failure. Genome Med 9: 20 (2017). [0560] 58. M. R. Taylor et al., Natural history of dilated cardiomyopathy due to lamin A/C gene mutations. J Am Coll Cardiol 41: 771-780 (2003). [0561] 59. C. Toepfer et al., Myosin regulatory light chain (RLC) phosphorylation change as a modulator of cardiac muscle contraction in disease. J Biol Chem 288: 13446-13454 (2013). [0562] 60. C. N. Toepfer, T. G. West, M. A. Ferenczi, Revisiting Frank-Starling: regulatory light chain phosphorylation alters the rate of force redevelopment (ktr) in a length-dependent fashion. J Physiol 594: 5237-5254 (2016). [0563] 61. J. H. Van Berlo et al., A-type lamins are essential for TGF-beta1 induced PP2A to dephosphorylate transcription factors. Hum Mol Genet 14: 2839-2849 (2005). [0564] 62. B. van Steensel, A. S. Belmont, Lamina-Associated Domains: Links with Chromosome Architecture, Heterochromatin, and Gene Repression. Cell 169: 780-791 (2017). [0565] 63. J. P. van Tintelen et al., High yield of LMNA mutations in patients with dilated cardiomyopathy and/or conduction disease referred to cardiogenetics outpatient clinics. Am Heart J 154: 1130-1139 (2007). [0566] 64. H. Wakimoto, J. G. Seidman, R. S. Y. Foo, J. Jiang, in Current Protocols in Molecular Biology. (John Wiley & Sons, Inc., 2001). [0567] 65. A. S. Wang, S. V. Kozlov, C. L. Stewart, H. F. Horn, Tissue specific loss of A-type lamins in the gastrointestinal epithelium can enhance polyp size. Differentiation 89: 11-21 (2015). [0568] 66. H. J. Worman, C. Ostlund, Y. Wang, Diseases of the nuclear envelope. Cold Spring Harbor perspectives in biology 2: a000760 (2010). [0569] 67. W. Wu, A. Muchir, J. Shan, G. Bonne, H. J. Worman, Mitogen-activated protein kinase inhibitors improve heart function and prevent fibrosis in cardiomyopathy caused by mutation in lamin A/C gene. Circulation 123: 53-61 (2011). [0570] 68. Zetsche, B., et al., Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell 163, 759-771 (2015). [0571] 69. Zhang, J., Felder, A., Liu, Y., Guo, L. T., Lange, S., Dalton, N. D., Gu, Y., Peterson, K. L., Mizisin, A. P., Shelton, G. D., et al. (2010). Nesprin 1 is critical for nuclear positioning and anchorage. Hum Mol Genet 19: 329-341. [0572] 70. Zhang, X., Xu, R., Zhu, B., Yang, X., Ding, X., Duan, S., Xu, T., Zhuang, Y., and Han, M. (2007). Syne-1 and Syne-2 play crucial roles in myonuclear anchorage and motor neuron innervation. Development 134: 901-908. [0573] 71. C. Zincarelli, S. Soltys, G. Rengo, J. E. Rabinowitz, Analysis of AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection. Mol Ther 16: 1073-1080 (2008).
Example 10: LINC Complex Disruption Via Loss of Sun1 Extends Longevity in a Model of Lmna Mutation-Associated Muscular Dystrophy
[0574] All experiments were approved by the Biomedical Sciences Institute (BMSI) Singapore Institutional Animal Care Committee. The generation of the Lmna.sup.Flx/Flx mice and MLC-Cre mice is described in (Wang et al., Differentiation. (2015) 89(1-2):11-21 and Mourkioti et al., Genesis. (2008) 46(8):424-30, respectively. Lmna.sup.Flx/Flx mice were crossed to MLC-Cre mice to obtain Lmna.sup.Flx/+; MLC-Cre mice, which were then crossed with Lmna.sup.Flx/+ mice to generate experimental cohorts of Lmna.sup.Flx/Flx; MLC-Cre, Lmna.sup.Flx/Flx and Lmna.sup.+/+; MLC-Cre mice. Lmna.sup.Flx/+; MLC-Cre mice were crossed with Sun1.sup.−/− mice to obtain Lmna.sup.Flx/+; MLC-Cre; Sun1.sup.+/− mice, which were intercrossed to obtain Lmna.sup.Flx/Flx; MLC-Cre; Sun1.sup.+/− mice. Lmna.sup.Flx/Flx; MLC-Cre; Sun1.sup.+/− mice were intercrossed to generate experimental cohorts of Lmna.sup.Flx/Flx; MLC-Cre; Sun1.sup.+/+, Lmna.sup.Flx/Flx; MLC-Cre; Sun1.sup.+/− and Lmna.sup.Flx/Flx; MLC-Cre; Sun1.sup.−/− mice. The survival rate of the various genotypes was analyzed by the Kaplan-Meier method, and statistical comparison was performed by log-rank test.
[0575] Example 2 and
[0576] In order to establish a mouse model for Lmna muscular dystrophy, Lmna.sup.Flx/Flx mice were crossed with mice harbouring a Cre transgene under the control of the myosin light chain promoter (MLC-Cre), generating mice with constitutive deletion of Lmna in skeletal muscle. These mice survived for an average of 18 days after birth (
[0577] To determine if LINC complex disruption suppresses lethality in this mouse model of Lmna muscular dystrophy, as it does for Lmna dilated cardiomyopathy, Lmna.sup.Flx/Flx; MLC-Cre mice were derived on a Sun1.sup.+/− heterozygous or Sun1.sup.−/− homozygous background. LINC complex disruption mediated by loss of one copy of Sun1 extended the lifespan of the mice from 18 to 24 days, while more severe disruption via loss of both copies of Sun1 extended lifespan of the mice from 18 to 35 days (
Example 11: LINC Complex Disruption Via Loss of Sun1 Extends Longevity in a Model of Hutchinson-Gilford Progeria
[0578] In order to generate a knock-in mouse model of Hutchinson-Gilford Progeria syndrome without extraneous sequence, CRISPR-Cas9-mediated homology-directed repair of the Lmna gene locus was carried out using plasmid-encoded Cas9 enzyme and guide RNA, and an oligo template for homologous recombination.
[0579] To generate Lmna.sup.G609G-CR mice, C57BL/6 female mice were used as embryo donors and foster mothers. 3-8 week old C57BL/6 female mice superovulated by injecting pregnant mare serum gonadotrophin followed 48 h later by human chorionic gonadotropin and mated to C57BL/6 stud males. Fertilized embryos were collected from oviducts and the pronuclei injected with the pX330 plasmid encoding Cas9 and a guide RNA (gRNA) targeting the Lmna gene (5 ng/μl), and an oligo for homology-directed repair of the Lmna gene (5 ng/μl). The gRNA sequence is: AGGAGATGGATCCGCCCACC (SEQ ID NO:109) and the repair oligo sequence for inducing Lmna-G609G progeria mutation is shown in SEQ ID NO:110. Injected embryos were transferred on the same day to recipient dames (on average 15 zygotes/female).
[0580] Founder animals were identified by genotyping PCR followed by Sanger sequencing. Genotyping primers were as follows:
TABLE-US-00014 Lmna GT up: (SEQ ID NO: 111) 5′- CCACAGGTCTCCCAAGTCCCCATC-3′ Lmna GT down: (SEQ ID NO: 112) 5′- TCCTCTCCCTCCCTGACCCCAAA-3′
[0581] Lmna.sup.G609G-CR/+; Sun1.sup.+/− mice were intercrossed to generate experimental cohorts of Lmna.sup.G069G-CR/G069G-CR; Sun1.sup.+/+Lmna.sup.G069G-CR/G069G-CR; Sun1.sup.+/−Lmna.sup.G069G-CR/G069G-CR; Sun1.sup.−/−, Lmna.sup.G069G-CR/+; Sun1.sup.−/−, Lmna.sup.G069G-CR/+; Sun1.sup.+/+, Lmna.sup.+/+; Sun1.sup.+/+ and Lmna.sup.+/+; Sun1.sup.−/− mice. The survival rate of the various genotypes was analyzed by the Kaplan-Meier method, and statistical comparison was performed by log-rank test.
[0582] Similar to previously established Lmna-G609G mice, mice heterozygous for the Lmna.sup.G609G-CR allele survived for 290 days, while mice homozygous for the mutant allele survived for 116 days (
[0583] To determine if LINC complex disruption suppresses lethality in this novel knock-in model of HGPS, as it does for Lmna dilated cardiomyopathy, we derived Lmna.sup.G609G-CR mice in a Sun1 mutant background. Lmna.sup.G609G-CR/G609G-CR mice on a Sun1.sup.−/− heterozygous mutant background survived for an average of 152 days, while Lmna.sup.G609G-CR/G609G-CR mice on a Sun1.sup.−/− heterozygous mutant background survived for 174 days (
Example 12: LINC Complex Disruption by Expression of Dominant-Negative LINC Complex Proteins Alleviates Pathophysiology in Lmna Mutation-Associated Muscular Dystrophy and Lmna Mutation-Associated Progeria
[0584] Mice having mouse models of Lmna mutation-associated muscular dystrophy and Lmna mutation-associated progeria are administered with nucleic acid encoding dominant-negative Sun1, Sun2, or KASH1-5.
[0585] The mouse models of Lmna mutation-associated muscular dystrophy include the Lmna knockout model described in Example 10, and Lmna point mutant models such as Lmna-H222P and Lmna-N195K.
[0586] The mouse models of Lmna mutation-associated progeria include the Lmna-G609G model described in Example 11.
[0587] The nucleic acids are delivered using adeno-associated virus, adenovirus or lentivirus vectors, or nanoparticles.
[0588] Mice having Lmna mutation-associated muscular dystrophy treated with a LINC complex inhibitor have an extended lifespan as compared to untreated mice, or mice treated with vehicle only.
[0589] Mice having Lmna mutation-associated progeria treated with a LINC complex inhibitor have an extended lifespan as compared to untreated mice, or mice treated with vehicle only.
Example 13: Gene Editing of LINC Complex Components Alleviates Pathophysiology in Lmna Mutation-Associated Muscular Dystrophy and Lmna Mutation-Associated Progeria
[0590] Mice having mouse models of Lmna mutation-associated muscular dystrophy and Lmna mutation-associated progeria are administered with nucleic acid encoding gene editing systems (including CRISPR/Cas9 systems) for disrupting LINC complex components.
[0591] The gene editing systems target an exon of a SUN domain-containing protein encoding a SUN domain, or target an exon of a KASH domain-containing protein encoding a KASH domain.
[0592] The mouse models of Lmna mutation-associated muscular dystrophy include the Lmna knockout model described in Example 10, and Lmna point mutant models such as Lmna-H222P and Lmna-N195K. The mouse models of Lmna mutation-associated progeria include the Lmna-G609G model described in Example 11.
[0593] The nucleic acids are delivered using adeno-associated virus, adenovirus or lentivirus vectors, or nanoparticles.
[0594] Mice having Lmna mutation-associated muscular dystrophy treated with a LINC complex inhibitor have an extended lifespan as compared to untreated mice, or mice treated with vehicle only.
[0595] Mice having Lmna mutation-associated progeria treated with a LINC complex inhibitor have an extended lifespan as compared to untreated mice, or mice treated with vehicle only.
Example 14: RNAi-Mediated Knockdown of LINC Complex Component Expression Alleviates Pathophysiology in Lmna Mutation-Associated Muscular Dystrophy and Lmna Mutation-Associated Progeria
[0596] Mice having mouse models of Lmna mutation-associated muscular dystrophy and Lmna mutation-associated progeria are administered with nucleic acid encoding shRNA or siRNA targeting LINC complex components.
[0597] The shRNA/siRNA target a SUN domain-containing protein or a KASH domain-containing protein. The mouse models of Lmna mutation-associated muscular dystrophy include the Lmna knockout model described in Example 10, and Lmna point mutant models such as Lmna-H222P and Lmna-N195K.
[0598] The mouse models of Lmna mutation-associated progeria include the Lmna-G609G model described in Example 11.
[0599] The nucleic acids are delivered using adeno-associated virus, adenovirus or lentivirus vectors, or nanoparticles.
[0600] Mice having Lmna mutation-associated muscular dystrophy treated with a LINC complex inhibitor have an extended lifespan as compared to untreated mice, or mice treated with vehicle only.
[0601] Mice having Lmna mutation-associated progeria treated with a LINC complex inhibitor have an extended lifespan as compared to untreated mice, or mice treated with vehicle only.
Example 15: LINC Complex Disruption Using Small Molecule Drugs Alleviates Pathophysiology in Lmna Mutation-Associated Muscular Dystrophy and Lmna Mutation-Associated Progeria
[0602] Mice having mouse models of Lmna mutation-associated muscular dystrophy and Lmna mutation-associated progeria are administered with small molecule inhibitors of interaction between SUN and KASH domains.
[0603] The mouse models of Lmna mutation-associated muscular dystrophy include the Lmna knockout model described in Example 10, and Lmna point mutant models such as Lmna-H222P and Lmna-N195K.
[0604] The mouse models of Lmna mutation-associated progeria include the Lmna-G609G model described in Example 11.
[0605] The small molecule inhibitors inhibit association between a KASH domain and a SUN domain, and are identified e.g. as described in Example 7.
[0606] Mice having Lmna mutation-associated muscular dystrophy treated with a LINC complex inhibitor have an extended lifespan as compared to untreated mice, or mice treated with vehicle only.
[0607] Mice having Lmna mutation-associated progeria treated with a LINC complex inhibitor have an extended lifespan as compared to untreated mice, or mice treated with vehicle only.
Example 16: LINC Complex Disruption Using Small Molecule Drugs Alleviates Pathophysiology in Lmna Mutation-Associated Dilated Cardiomyopathy
[0608] Mice having mouse models of Lmna mutation-associated dilated cardiomyopathy are administered with small molecule inhibitors of interaction between SUN and KASH domains.
[0609] The mouse models of Lmna mutation-associated dilated cardiomyopathy include the Lmna knockout model described in Example 10, and Lmna point mutant models such as Lmna-H222P and Lmna-N195K.
[0610] The small molecule inhibitors inhibit association between a KASH domain and a SUN domain, and are identified e.g. as described in Example 7.
[0611] Mice having Lmna mutation-associated dilated cardiomyopathy treated with a LINC complex inhibitor have an extended lifespan and/or improved cardiac function (e.g. increased myocardial contractility, increased ejection fraction and/or increased fractional shortening) as compared to untreated mice, or mice treated with vehicle only.
Example 17: RNAi-Mediated Knockdown of LINC Complex Component Expression Alleviates Pathophysiology in Lmna Mutation-Associated Dilated Cardiomyopathy
[0612] Mice having mouse models of Lmna mutation-associated dilated cardiomyopathy are administered with small molecule inhibitors of interaction between SUN and KASH domains.
[0613] The shRNA/siRNA target a SUN domain-containing protein or a KASH domain-containing protein.
[0614] The mouse models of Lmna mutation-associated dilated cardiomyopathy include the Lmna knockout model described in Example 10, and Lmna point mutant models such as Lmna-H222P and Lmna-N195K.
[0615] The nucleic acids are delivered using adeno-associated virus, adenovirus or lentivirus vectors, or nanoparticles.
[0616] Mice having Lmna mutation-associated dilated cardiomyopathy treated with a LINC complex inhibitor have an extended lifespan and/or improved cardiac function (e.g. increased myocardial contractility, increased ejection fraction and/or increased fractional shortening) as compared to untreated mice, or mice treated with vehicle only.
Example 18: LINC Complex Disruption Via Loss of Sun1 Alleviates Atherosclerosis in Ldlr.SUP.−/− .Mutant Mice
18.1 Materials and Methods
[0617] Sun1.sup.−/−; Ldlr.sup.−/− mice and Western-type diet model of atherosclerosis
[0618] All experiments were approved by the Biomedical Sciences Institute (BMSI) Singapore Institutional Animal Care Committee. Sun1.sup.−/− mice and their generation is described in Chi et al., Development (2009) 136(6):965-73. Ldlr.sup.−/− mice (C57BL/6JInv, Jackson Laboratory) were crossed to Sun1.sup.+/− mice to generate Sun1.sup.+/−; Ldlr.sup.+/− mice, which were then intercrossed to generate Sun1.sup.+/−; Ldlr.sup.−/− mice. These Sun1.sup.+/+; Ldlr.sup.−/− mice were then intercrossed to generate the experimental cohorts of Sun1.sup.−/−; Ldlr.sup.−/− and Sun1.sup.+/+; Ldlr.sup.−/− mice.
[0619] Male experimental mice on a 12 h light-dark cycle were maintained on chow diet (1324_modified, Altromin GmbH & Co.) until 12 weeks of age, followed by a western type diet (WTD; D12079B, Research Diets, NJ) for 15 weeks. The mice had free access to food and water except during a 4-5 h fasting period prior to blood sample collection. Mice were anesthetized at 27 weeks (100 mg/kg ketamine hydrochloride/10 mg/kg xylazine i.p.), bled retro-orbitally, perfused transcardially with 1×PBS, and hearts fixed in 4% paraformaldehyde (Sigma) and embedded in paraffin. The aortic arch and thoracic aorta were also dissected and fixed in 4% paraformaldehyde.
Plasma Lipid Quantification
[0620] Plasma HDL cholesterol (HDLc) and total cholesterol were measured using the Infinity cholesterol kit (401-25P, Sigma), following manufacturer's instructions. For HDLc quantification, 20 μl of plasma was mixed with an equal volume of 20% polyethylene glycol made in 0.2M glycine. The mix was vortexed immediately, incubated at room temperature for 5 minutes, centrifuged at 14,000 rpm for 6 minutes, and 10 μl of the supernatant quantified by Infinity cholesterol kit. Non-HDLc was quantified by subtracting HDLc from the total cholesterol values for each mouse.
Aortic Sinus Atherosclerotic Lesion Analyses
[0621] Paraformaldehyde fixed hearts were dehydrated and embedded in paraffin following standard protocols. Serial cross sections (5 μm-thick) were obtained throughout the entire aortic root for histological analyses as described.sup.26,27. Briefly, aortic cross-sections were stained with hematoxylin-phloxine-saffron and atherosclerotic lesion area was analyzed in 4 cross-sections/mouse. Aperio Imagescope (Leica Biosystems, USA) and ImageJ were used for morphometric quantification of lesion number, area and severity according to the American Heart Association (Stary et al., Arterioscler Thromb Vasc Biol. 1994; 14:840-856; Stary et al., Arterioscler Thromb Vasc Biol. 1995; 15:1512-1531) classification. MAC-3 (550292, BD-Pharmigen, USA) antibody was used to determine lesional macrophage content.
Aortic Arch En Face Lesion Analyses
[0622] Paraformaldehyde fixed aortas were cleaned by removing adventitial tissues using saline to keep the tissue moist during the cleaning. The aortas were opened longitudinally to the iliac bifurcation and pinned out flat on the surface of black wax with 0.2-mm steel pins (Fine Science Tools #26002-20). Aortas were then stained en face with oil red O solution (Sigma Aldrich #1516) for 30 min at room temperature and washed four times with PBS. ImageJ was used for the quantification of the lesion area.
Statistical Analyses
[0623] Data were analyzed using Student's T-tests. Values of p<0.05 were considered to represent significant differences between groups. Results are shown as mean±SEM.
18.2 Results
[0624] Lower Atherosclerotic Lesion Area in the Aortic Arches of Sun1.sup.−/−; Ldlr.sup.−/− Mice
[0625] To determine the impact of Sun1 deletion on atherosclerotic lesion development, Sun1.sup.−/− mice generated on the WTD fed Ldlr.sup.−/− mouse background were utilized (Breslow et al., Science 1996; 272:685-688). Atherosclerotic lesions were analyzed after 15 weeks of WTD administration, in en face sections of mice aortas stained with Oil Red O, which stains neutral lipids (
[0626] A significant decrease in percentage lesion area was observed in the Sun1.sup.−/−; Ldlr.sup.−/− mice (Sun1.sup.−/−; Ldlr.sup.−/−: 16.33±2.01, Sun.sup.+/+; Ldlr.sup.−/−: 23.88±1.60% lesion area, p=0.013) (
[0627] These data show that inhibition of Sun1 significantly reduces atherosclerotic lesion size in mice.
Lower Atherosclerotic Lesion Area in the Aortic Sinus of Sun1.sup.−/−; Ldlr.sup.−/− Mice
[0628] Since atherosclerotic lesion area in the aortic arches was significantly decreased, the inventors next assessed lesion area in the aortic sinus of the mice. Previous studies characterizing the sites of atherosclerotic lesions in the Ldlr.sup.−/− mice have shown unequivocally that the earliest lesions form at the aortic sinus, and lesions are seen as early as after 4 weeks of high fat diet feeding (Ma et al., PLoS ONE. 2012:7(4):e35835; Paigen et al., Atherosclerosis. 1987:68:231-240). Indeed, initiation timing of lesions at different locations in the Ldlr.sup.−/− mice were rank-ordered as aortic sinus>innominate artery>thoracic aorta>abdominal aorta (Ma et al., PLoS ONE. 2012:7(4):e35835).
[0629] Hematoxylin phloxine saffron (HPS) stained sections (
[0630] The inventors next classified each individual lesion as mild to severe using the American Heart Association criteria for lesion severity (Stary et al., Arterioscler Thromb Vasc Biol. 1994; 14:840-856; Stary et al., Arterioscler Thromb Vasc Biol. 1995; 15:1512-1531). A significant 26% decrease in the number of severe lesions (class IV and V) was observed in the Sun1.sup.−/−; Ldlr.sup.−/− mice (Sun1.sup.−/−; Ldlr.sup.−/−: 7.75±1.01, Sun.sup.+/+; Ldlr.sup.−/−: 10.56±0.73, lesion #, p=0.037) (
[0631] Together, these data show that inhibition of Sun1 significantly decreases atherosclerotic lesion size, and prevents the progression of lesions from mild to severe.
Lower Atherosclerotic Lesion Complexity in Sun1.sup.−/−; Ldlr.sup.−/− Mice
[0632] Since a significantly lower lesion area, and a significant decrease in advanced lesions were observed in the Sun1.sup.−/−; Ldlr.sup.−/− mice, the inventors next assessed lesion complexity by assessing macrophage infiltration (
Plasma Lipid Levels were Unchanged in the Sun1.sup.−/−; Ldlr.sup.−/− Mice
[0633] The results show that mice with Sun1 inhibition are protected against atherosclerotic lesion progression, displaying smaller lesion area, and less advanced and complex lesions.
[0634] To exclude that the smaller lesions in the Sun1.sup.−/−; Ldlr.sup.−/− mice resulted from the Sun1.sup.−/−; Ldlr.sup.−/− mice being smaller compared to their wildtype littermates, body weights of the mice were assessed. No changes were observed in body weights in the Sun1.sup.−/−; Ldlr.sup.−/− mice (Sun1.sup.−/−; Ldlr.sup.−/−: 39.54±2.01, Sun.sup.+/+; Ldlr.sup.−/−: 41.98±2.31, g, p=0.45) (
[0635] The inventors next analysed the plasma lipid composition of the mice, in order to determine if an alteration in plasma lipid levels contributed to the protection against atherosclerosis in these mice. No changes in total cholesterol were observed in Sun1.sup.−/−; Ldlr.sup.−/− mice (Sun1.sup.−/−; Ldlr.sup.−/−: 1075±69, Sun.sup.+/+; Ldlr.sup.−/−: 1182±59, mg/dL, p=0.25) (
[0636] These data suggest that protection against atherosclerosis observed in the Sun1.sup.−/−; Ldlr.sup.−/− mice was not a consequence of alterations in plasma lipid levels.
Example 19: LINC Complex Disruption by Expression of Dominant-Negative LINC Complex Proteins Alleviates Pathophysiology in Mouse Models of Atherosclerosis and Familial Hypercholesterolemia
[0637] Mice having mouse models of atherosclerosis and familial hypercholesterolemia are administered with nucleic acid encoding dominant-negative Sun1, Sun2, or KASH1-5.
[0638] A mouse model of atherosclerosis and familial hypercholesterolemia is establish by feeding Ldlr.sup.−/− mice a Western-type diet as described in Example 18.
[0639] The nucleic acids are delivered using adeno-associated virus, adenovirus or lentivirus vectors, or nanoparticles.
[0640] Mice treated with a LINC complex inhibitor have smaller, less advanced and less complex atherosclerotic lesions as compared to untreated mice, or mice treated with vehicle only.
Example 20: Gene Editing of LINC Complex Components Alleviates Pathophysiology in Mouse Models of Atherosclerosis and Familial Hypercholesterolemia
[0641] Mice having mouse models of atherosclerosis and familial hypercholesterolemia are administered with nucleic acid encoding gene editing systems (including CRISPR/Cas9 systems) for disrupting LINC complex components.
[0642] The gene editing systems target an exon of a SUN domain-containing protein encoding a SUN domain, or target an exon of a KASH domain-containing protein encoding a KASH domain.
[0643] A mouse model of atherosclerosis and familial hypercholesterolemia is establish by feeding Ldlr.sup.−/− mice a Western-type diet as described in Example 18.
[0644] The nucleic acids are delivered using adeno-associated virus, adenovirus or lentivirus vectors, or nanoparticles.
[0645] Mice treated with a LINC complex inhibitor have smaller, less advanced and less complex atherosclerotic lesions as compared to untreated mice, or mice treated with vehicle only.
Example 21: LINC Complex Disruption Using Small Molecule Drugs Alleviates Pathophysiology in Mouse Models of Atherosclerosis and Familial Hypercholesterolemia
[0646] Mice having mouse models of atherosclerosis and familial hypercholesterolemia are administered with small molecule inhibitors of interaction between SUN and KASH domains.
[0647] A mouse model of atherosclerosis and familial hypercholesterolemia is establish by feeding Ldlr.sup.−/− mice a Western-type diet as described in Example 18.
[0648] The small molecule inhibitors inhibit association between a KASH domain and a SUN domain, and are identified e.g. as described in Example 7.
[0649] Mice treated with a LINC complex inhibitor have smaller, less advanced and less complex atherosclerotic lesions as compared to untreated mice, or mice treated with vehicle only.
Example 22: RNAi-Mediated Knockdown of LINC Complex Component Expression Alleviates Pathophysiology in Mouse Models of Atherosclerosis and Familial Hypercholesterolemia
[0650] Mice having mouse models of atherosclerosis and familial hypercholesterolemia are administered with nucleic acid encoding shRNA or siRNA targeting LINC complex components.
[0651] A mouse model of atherosclerosis and familial hypercholesterolemia is establish by feeding Ldlr.sup.−/− mice a Western-type diet as described in Example 18.
[0652] The shRNA/siRNA target a SUN domain-containing protein or a KASH domain-containing protein.
[0653] The nucleic acids are delivered using adeno-associated virus, adenovirus or lentivirus vectors, or nanoparticles.
[0654] Mice treated with a LINC complex inhibitor have smaller, less advanced and less complex atherosclerotic lesions as compared to untreated mice, or mice treated with vehicle only.
Example 23: AAV9 Mediated Transduction and Expression of a DNSun1 Prolongs the Lifespan and Improves Cardiac Function of Lmna.SUP.Flx/Flx.:Mcm+Tmx Mice
[0655] In further experiments, the inventors investaged the effects of treatment of mice having cardiomyocyte-specific deletion of Lmna with AAV9-vectored dominant-negative human SUN1 protein expressed under the control of a cardiomyocyte-specific promoter.
23.1 Materials and Methods
Molecular Cloning of Humanized SUN1 Dominant Negative Transgene
[0656] The following sequence was obtained as a gBlock from IDT:
TABLE-US-00015 (SEQ ID NO: 117) 5′-tat agg cta gcG GCA CAA TGA AGT GGG TAA CCT TTA TTT CCC TTC TTT TTC TCT TTA GCT CGG CCT ATT CCA GGG GTG TGT TTC GTC GAG ATG GGC CCt ccg gag gtG AAC AAA AAC TCA TCT CAG AAG AGG ATC Tca ccg gtg gaG ATG AGG GCT GGG AAG CCA GAG-3′
[0657] The gBlock contains the following sequence features: NheI restriction enzyme (RE) site, human serum albumin signal sequence, ApaI and BspEI RE sites, Myc epitope tag, AgeI RE site, and sequence complementary to the start of the lumenal domain of human SUN2. Primers of sequence 5′-TAT AGG CTA GCG GCA CAA TG-3′ (SEQ ID NO:118) and 5′-CTC TGG CTT CCC AGC CCT CA-3′ (SEQ ID NO: 119) were used to PCR amplify the gBlock to form a megaprimer. The megaprimer and a reverse primer encoding the KDEL sequence and the C-terminus of SUN2 (5′-CCG GGT CGA CCT ACA ACT CAT CTT TGT GGG CGG GCT CCC CAT GCA C-3′ (SEQ ID NO:120)) were used to amplify SUN2 lumenal domain from a SUN2 cDNA clone (AM392760). The PCR product and pENN-AAV-cTnT-EGFP-RBG (UPEnn Vector Core, Philadelphia, Pa.) were digested with NheI and SalI and ligated to obtain pAAV-cTnT-Myc-SUN2DN.
[0658] To obtain SUN1 dominant negative construct, 5′-TCT CAC CGG TGG AGA TGA CCC CCA GGA CGT GTT TAA AC-3′ (SEQ ID NO:121) and 5′-CCG GGT CGA CCT ACA ACT CAT CTT TCT TGA CAG GTT CGC CAT GAA CTC-3′ (SEQ ID NO:122) were used to PCR amplify human SUN1 lumenal domain from a cDNA clone (Loo et al., ELife (2019) 8; 1-25). The SUN1 PCR product and pAAV-cTnT-Myc-huSUN2DN were digested with AgeI and SalI, and ligated to obtain pAAV-cTnT-Myc-huSUN1DN, the nucleotide sequence of which is shown in SEQ ID NO:125.
Production of AAV for Humanized SUN1 Dominant Negative Experiments
[0659] 293T cells were cultured in 15 cm dishes or T-flasks before being seeded into a 10-chamber CelISTACK (Corning Inc., Corning, N.Y., USA). pAAV2/9 (gift of James M. Wilson, UPEnn Vector Core, Philadelphia, Pa.), pHelper (Part No. 340202, Cellbiolabs, Inc., San Diego, Calif., USA) and plasmids containing the transgenes (pENN-AAV-cTnT-EGFP-RBG and pAAV-cTnT-Myc-SUN1DN) were co-transfected into the cells using PEI Max (Polysciences, Warrington, Pa., USA). 4 days after transfection, cell pellets and cell culture supernatant were harvested. Supernatant was clarified by filtration and applied by gravity flow to −1 ml POROS™ CaptureSelect™ AAV9 Affinity Resin (Thermo Fisher Scientific, Waltham, Mass., USA). Cells were resuspended in lysis buffer (phosphate buffered saline, 200 mM NaCl, 0.001% Pluronic F-68), lysed by 4-5 rounds of freeze/thaw, sonicated, and treated with benzonase to shear and digest DNA. Cell debris was pelleted by centrifugation, and cell lysate collected and filtered through 0.45 μm syringe filters. Filtered lysates were then applied to AAV9 affinity resin by gravity flow. Following washing in wash buffer (phosphate buffered saline, 500 mM NaCl), AAV9 virions were eluted using 100 mM glycine, pH 2.5, and collected into microfuge tubes containing 1/10.sup.th volume of 1M Tris, pH 8. Following 2 rounds of buffer exchange into PBS containing 0.01% Pluronic F-68 and concentration via Amicon® Ultra 100 kDA concentrators (Merck KGaA, Darmstadt, Germany), ˜1 ml solution containing AAV virions was filtered through 0.22 μm 4 mm Millex syringe filter units (Merck KGaA, Darmstadt, Germany) and stored in 4° C. or −80° C. For the quantification of viral genomes, dye-based quantitative real-time PCR was performed using primers 5′-acagtctcgaacttaagctgca-3′ (SEQ ID NO:123) and 5′-gtctcgacaagcccagtttcta-3′ (SEQ ID NO:124), PacI-digested and PCR-purified pENN-AAV-cTnT-EGFP-RBG (for the generation of a standard curve), and PerfeCTa SYBR Green FastMix Low ROX qPCR mastermix (Quanta BioSciences, Beverly, Mass., USA).
In Vivo Gene Delivery
[0660] AAV transduction was performed by retro-orbital injection. For evaluation of the cardiac function only male animals were used. The experimental design was as follows: On postnatal day 10 mice were genotyped. To induce deletion of the Lmna gene in cardiomyocytes tamoxifen was administered by intra-peritoneal injection on postnatal day 14 to all animals (40 mg/kg). On postnatal day 15, animals were injected intravenously with AAV9-huSUN1 DN or AAV9-GFP (2×10{circumflex over ( )}10 vg/g, 5 μl/g) into the retro-orbital sinus using an insulin syringe. For the dose-response experiment, mice were administered with 2×10{circumflex over ( )}10 viral genome/g bodyweight (‘standard dose’), or 5×10{circumflex over ( )}10 viral genome/g bodyweight (‘high dose’). Animals were selected randomly. TMX and AAV9 injections were performed under anaesthesia using 1.5% Isoflurane mixed with oxygen. The AAV9 working solution was prepared freshly prior to administration. Depending on the concentration of viral genomes the respective AAV9 stock solutions were diluted with PBS containing 0.001% Pluronic F-68.
23.2 Results
[0661] AAV9 was used to introduce and express a dominant negative human SUN1 minigene expressed specifically in cardiomyocytes under the control of the chicken cardiac troponin promotor (
[0662] Lmna.sup.flx/flx Mcm mice were administered with a single IP injection of tamoxifen (40 mg/kg) at postnatal day 14 to induce Lmna deletion in cardiomyocytes (
[0663] Administration of the AAV9-vectored huSUN1DN minigene to the tamoxifen-treated Lmna.sup.flx/flx Mcm mice (therefore having cardiomyocyte-specific deletion of Lmna) mice approximately doubled their lifespan (66 days) as compared to their AAV9-GFP-treated counterparts (36 days)—see
[0664] Echocardiogram analysis revealed that treatment of AAV9-huSUN1 DN was also associated with improved cardiac function (FS, GLS, EF) at day 28 after tamoxifen treatment of the Lmna.sup.flx/flx Mcm mice, as compared to treatment with AAV9-GFP (
[0665] No differences in lifespan or cardiac function were observed between Lmna.sup.flx/flx WT mice treated with AAV9-huSUN1DN or AAV9-GFP (
[0666] In further experiments, the inventors investigated whether the improvement in survival and cardiac function observed in AAV9-huSUN1 DN-treated mice mice having cardiomyocyte-specific deletion of Lmna could be increased further by administration of a larger dose of AAV9-huSUN1DN.
[0667] Briefly, Lmna.sup.flx/flx Mcm mice were administered with a single IP injection of tamoxifen (40 mg/kg) at postnatal day 14 to induce Lmna deletion in cardiomyocytes, and at postnatal day 15, AAV9-huSUN1 DN was administered at (i) 2×10{circumflex over ( )}10 viral genome/g bodyweight, or (ii) 5×10{circumflex over ( )}10 viral genome/g bodyweight, by retro-orbital injection.
[0668] Mice having cardiomyocyte-specific deletion of Lmna and administered with 5×10{circumflex over ( )}10 viral genome/g bodyweight of AAV9-huSUN1DN had improved survival (lifespan ˜200 days) as compared to their counterparts treated with AAV9-huSUN1DN at a dose of 2×10{circumflex over ( )}10 viral genome/g bodyweight (
[0669] Echocardiogram analysis revealed that mice having cardiomyocyte-specific deletion of Lmna and administered with 5×10{circumflex over ( )}10 viral genome/g bodyweight of AAV9-huSUN1DN also had improved cardiac function as compared to their counterparts treated with AAV9-huSUN1 DN at a dose of 2×10{circumflex over ( )}10 viral genome/g bodyweight, with a delay to the decline in cardiac function (
[0670] The results indicate dose-dependent effects for AAV9-huSUN1 DN treatment on improvement of lifespan and the cardiac function in mice having cardiomyocyte-specific deletion of Lmna.
[0671] Overall, the results of this Example establish AA9-vectored huSUN1DN as a promising therapy for the treatment of LMNA mutation-associated dilated cardiomyopathy.