Kits comprising plus-sense single stranded RNA viral vectors and methods for producing polypeptides using the kits
10190128 · 2019-01-29
Assignee
- FRAUNHOFER-GESELLSCHAFT ZUR FÖRDERUNG DER ANGEWANDTEN FORSCHUNG E.V. (München, DE)
- Rheinisch-Westfälische Technische Hochschule Aachen (Aachen, DE)
Inventors
Cpc classification
C12N2770/40043
CHEMISTRY; METALLURGY
C12N2770/00043
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to kits comprising plus-sense single stranded RNA viral vectors, as well as mixtures of these vectors and uses thereof, and methods for producing in a plant, or plant tissue, or plant cell simultaneously two or more polypeptides using the kits and vectors.
Claims
1. A kit comprising a) a first plus-sense single stranded ribonucleic acid (RNA) viral vector, and b) a second plus-sense single stranded RNA viral vector, wherein (i) the first plus-sense single-stranded viral vector and the second plus-sense single-stranded viral vector are derived from different plant viruses, and (ii) the coat protein open reading frame (ORF) of the virus from which the first vector is derived is completely deleted in the first plus-sense single stranded RNA viral vector, and (iii) the coat protein ORF of the virus from which the second vector is derived is completely deleted in the second plus-sense single stranded RNA viral vector, and (iv) the first plus-sense single stranded RNA viral vector comprises a functional coat protein ORF of the virus from which the second plus-sense single-stranded viral vector is derived, and (v) the second plus-sense single stranded RNA viral vector comprises a functional coat protein ORF of the virus from which the first plus- sense single-stranded viral vector is derived, and (vi) the first plus-sense single-stranded viral vector and the second plus-sense single-stranded viral vector comprise an RNA replicon which is able to replicate in plant cells, and wherein the virus from which the first plus-sense single-stranded viral vector is derived is a Potexvirus, and the virus from which the second plus-sense single-stranded viral vector is derived is a Tobamovirus.
2. The kit according to claim 1, wherein a) the functional coat protein ORF of the virus from which the second plus-sense single- stranded viral vector is derived is inserted at the location from which the coat protein ORF of the first plus-sense single-stranded viral vector is deleted, and/or b) the functional coat protein ORF of the virus from which the first plus-sense single- stranded viral vector is derived is inserted at the location from which the coat protein ORF of the second plus-sense single-stranded viral vector is deleted.
3. The kit according to claim 1, wherein the first plus-sense single-stranded viral vector comprises a functional heterologous ORF in addition to the functional coat protein ORF or the second plus-sense single-stranded viral vector comprises a functional heterologous ORF in addition to the functional coat protein ORF.
4. The kit according to claim 1, wherein the kit further comprises at least one additional plus-sense single stranded RNA viral vector, wherein (i) the at least one additional plus-sense single-stranded viral vector comprises at least one functional heterologous ORF, and (ii) the at least one additional plus-sense single-stranded viral vector is derived from a Potexvirus.
5. The kit according to claim 4, wherein the at least one additional plus-sense single stranded RNA viral vector is devoid of a functional movement protein ORF(s) of the Potexvirus.
6. A mixture comprising: a) at least one first plus-sense single stranded RNA viral vector, b) at least one second plus-sense single stranded RNA viral vector, and, optionally, c) at least one third plus-sense single stranded RNA viral vector, wherein (i) the first plus-sense single-stranded viral vector and the second plus-sense single-stranded viral vector are derived from different plant viruses, and (ii) the coat protein ORF of the virus from which the first vector is derived is completely deleted in the first plus-sense single stranded RNA viral vector, and (iii) the coat protein ORF of the virus from which the second vector is derived is completely deleted in the second plus-sense single stranded RNA viral vector, and (iv) the first plus-sense single stranded RNA viral vector comprises a functional coat protein ORF of the virus from which the second plus-sense single-stranded viral vector is derived, and (v) the second plus-sense single stranded RNA viral vector comprises a functional coat protein ORF of the virus from which the first plus-sense single-stranded viral vector is derived, and (vi) the first plus-sense single-stranded viral vector and the second plus-sense single-stranded viral vector comprise an RNA replicon which is able to replicate in plant cells, and wherein the virus from which the first plus-sense single-stranded viral vector is derived is a Potexvirus, the virus from which the second plus-sense single-stranded viral vector is derived is a Tobamovirus, and the at least one third plus-sense single-stranded viral vector is derived from a Potexvirus.
7. The mixture according to claim 6, comprising (i) the at least one first plus-sense single stranded RNA viral vector, and (ii) the at least one second plus-sense single stranded RNA viral vector, and (iii) the at least one third plus-sense single stranded RNA viral vector.
8. A plant or plant cell comprising at least one first plus-sense single stranded RNA viral vector and at least one second plus-sense single stranded RNA viral vector, and, optionally, at least one third plus-sense single stranded RNA viral vector(s), wherein (i)the first plus-sense single-stranded viral vector and the second plus-sense single-stranded viral vector are derived from different plant viruses, and (ii) the coat protein ORF of the virus from which the first vector is derived is completely deleted in the first plus-sense single stranded RNA viral vector, and (iii) the coat protein ORF of the virus from which the second vector is derived is completely deleted in the second plus-sense single stranded RNA viral vector, and (iv) the first plus-sense single stranded RNA viral vector comprises a functional coat protein ORF of the virus from which the second plus-sense single-stranded viral vector is derived, and (v) the second plus-sense single stranded RNA viral vector comprises a functional coat protein ORF of the virus from which the first plus-sense single-stranded viral vector is derived, and (vi) the first plus-sense single-stranded viral vector and the second plus-sense single-stranded viral vector comprise an RNA replicon which is able to replicate in plant cells, and wherein the virus from which the first plus-sense single-stranded viral vector is derived is a Potexvirus, and the virus from which the second plus-sense single-stranded viral vector is derived is a Tobamovirus, and the at least one third plus-sense single-stranded viral vector is derived from a Potexvirus.
9. The plant according to claim 8, wherein more than one plant cell in more than one tissue of the plant comprises the at least one first plus-sense single stranded RNA viral vector and the at least one second plus-sense single stranded RNA vector, and, optionally, the at least one third plus-sense single stranded RNA viral vector(s).
10. A method for producing in a plant, or-plant tissue, or plant cell a heterooligomeric polypeptide and/or two or more polypeptides, comprising providing to at least one plant cell a)at least one first plus-sense single stranded RNA viral vector, and b)at least one second plus-sense single stranded RNA viral vector, and c)optionally, at least one third plus-sense single stranded RNA viral vector, wherein (i)the first plus-sense single-stranded viral vector and the second plus-sense single-stranded viral vector are derived from different plant viruses, and (ii) the coat protein ORF of the virus from which the first vector is derived is completely deleted in the first plus-sense single stranded RNA viral vector, and (iii) the coat protein ORF of the virus from which the second vector is derived is completely deleted in the second plus-sense single stranded RNA viral vector, and (iv) the first plus-sense single stranded RNA viral vector comprises a functional coat protein ORF of the virus from which the second plus-sense single-stranded viral vector is derived, and (v) the second plus-sense single stranded RNA viral vector comprises a functional coat protein ORF of the virus from which the first plus-sense single-stranded viral vector is derived, and (vi) the first plus-sense single-stranded viral vector and the second plus-sense single-stranded viral vector comprise an RNA replicon which is able to replicate in plant cells, and (vii) the at least one plus-sense single stranded RNA viral vector and the at least one second plus-sense single stranded RNA viral vector comprise different heterologous ORFs, and wherein the virus from which the first plus-sense single-stranded viral vector is derived is a Potexvirus, and the virus from which the second plus-sense single-stranded viral vector is derived is a Tobamovirus, and the at least one third plus-sense single-stranded viral vector is derived from a Potexvirus.
11. The method of claim 10, a) further comprising isolating the heterooligomeric polypeptide and/or two or more polypeptides from the plant, plant tissue, or plant cell, and/or b) wherein systemic infection of the plant is achieved, and/or c)wherein the heterooligomeric polypeptide is an immunoglobulin.
12. The kit according to claim 1, wherein the first plus-sense single-stranded viral vector comprises a functional heterologous ORF in addition to the functional coat protein ORF and the second plus-sense single-stranded viral vector comprises a functional heterologous ORF in addition to the functional coat protein ORF.
13. The kit according to claim 1, wherein the first plus-sense single-stranded viral vector does not comprise a functional heterologous ORF in addition to the functional coat protein ORF and the second plus-sense single-stranded viral vector does not comprise a functional heterologous ORF in addition to the functional coat protein ORF.
14. The kit according to claim 1, wherein the first plus-sense single-stranded viral vector does not comprise a functional heterologous ORF in addition to the functional coat protein ORF or the second plus-sense single-stranded viral vector does not comprise a functional heterologous ORF in addition to the functional coat protein ORF.
15. The kit according to claim 4, wherein the at least one additional plus-sense single stranded RNA viral vector: a) comprises the features of the first plus-sense single-stranded viral vector, and b) does not comprise an endogenous coat protein ORF, and c) comprises at least one functional heterologous ORF that is not present in the first or second plus-sense single-stranded viral vector.
16. The kit according to claim 4, wherein the at least one additional plus-sense single stranded RNA viral vector: a) comprises the features of the first plus-sense single-stranded viral vector, and b) does not comprise an endogenous coat protein ORF, and c) comprises a functional heterologous coat protein ORF, and d) comprises at least one functional heterologous ORF that is not present in the first or second plus-sense single-stranded viral vector.
17. The kit according to claim 5, wherein the functional heterologous ORF(s) of the at least one additional plus-sense single stranded RNA viral vector is different from the functional heterologous ORF of the first or second plus-sense single-stranded viral vector.
18. The kit according to claim 5, wherein the at least one additional plus-sense single stranded RNA viral vector comprises a coat protein, a functional movement protein(s), and an RNA-dependent RNA Polymerase of the virus from which the second plus-sense single-stranded viral vector is derived.
19. The kit according to claim 4, wherein the at least additional plus-sense single stranded RNA viral vector comprises one functional heterologous ORF.
20. The kit according to claim 5, wherein the functional movement protein ORF of the virus from which the at least one additional plus-sense single-stranded viral vector is derived is completely deleted.
21. The kit according to claim 1, wherein a) said Potexvirus is potato virus x (PVX) or b) said Tobamovirus is tobacco mosaic virus (TMV).
22. The kit according to claim 4, wherein said Potexvirus is PVX.
23. The kit according to claim 4, wherein the coat protein ORF of the virus from which the at least one additional plus-sense single-stranded viral vector is derived is completely deleted in the at least one additional plus-sense single stranded RNA viral vector.
24. The kit according to claim 4, wherein the first plus-sense single stranded RNA viral vector is PVX, the second plus-sense single stranded RNA viral vector is TMV, and the at least one additional plus-sense single stranded RNA viral vector is PVX.
25. The kit according to claim 21, wherein a) said Potexvirus is PVX, and b) said Tobamovirus is TMV.
26. The mixture according to claim 6, wherein (i) the at least one third plus-sense single-stranded viral vector(s) comprise(s) at least one functional heterologous ORF, and (ii) the coat protein ORF of the virus from which the at least one third plus-sense single-stranded viral vector(s) is derived is completely deleted in the at least one third plus-sense single stranded RNA viral vector(s).
27. The mixture according to claim 6, wherein a) said Potexvirus is PVX, and/or b) said Tobamovirus is TMV.
28. The plant or plant cell according to claim 8, wherein (i) the at least one third plus-sense single-stranded viral vector(s) comprise(s) at least one functional heterologous ORF, and (ii) the coat protein ORF of the virus from which the at least one third plus-sense single-stranded viral vector(s) is derived is completely deleted in the at least one third plus-sense single stranded RNA viral vector(s).
29. The plant according to claim 8, wherein more than one plant cell in more than one tissue of the plant comprises the heterologous polypeptides encoded by the ORFs of at least two different third plus-sense single stranded RNA viral vector(s).
30. The plant or plant cell according to claim 8, wherein a) said Potexvirus is PVX, and/or b) said Tobamovirus is TMV.
31. The method of claim 10, wherein (i) the at least one third plus-sense single-stranded viral vector(s) comprise(s) at least one functional heterologous ORF, and (ii) the coat protein ORF of the virus from which the at least one third plus-sense single-stranded viral vector(s) is derived is completely deleted in the at least one third plus-sense single stranded RNA viral vector(s), and further wherein a) at least two third plus-sense single stranded RNA viral vectors are provided to at least one plant cell if the first plus-sense single stranded RNA viral vector and the second plus-sense single stranded RNA viral vector do not comprise a functional heterologous ORF, and b) wherein at least two of the viral vectors according to (a) to (c) comprise different heterologous ORFs.
32. The method of claim 10, wherein a) said Potexvirus is PVX, and/or b) said Tobamovirus is TMV.
33. The method of claim 10, wherein the heterooligomeric polypeptide is an antibody or antibody fragment.
Description
FIGURE LEGEND
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
EXAMPLES
Example 1
Generation of Vectors and Co-expression of Several Heterologous Proteins with Complementing Viral Vectors
(16) The complementation vectors were generated with help of the gene splicing by overlap extension (SOE) PCR method. For the construction of a PVX with the coat protein of TMV three PCR products were created. In PCR1 the mCherry gene was inserted into the PVX genome (PVX-mCherry) and the subgenomic promoter of the PVX coat protein was amplified with primers mCherry-ClaI and SOE-TMVCP rv including an overlapping sequence for the fusion. PCR2 amplified a part of the subgenomic promoter and the ORF of the TMV coat protein from the vector pJL24 (US 2010/0071085 A1) with primers SOE-TMVCP fw and SOE-TMVCP2 rv including two overlapping sequences, the 5-end complementary to PCR product 1 and the 3-end complementary to PCR product 3. With PCR 3 the 3 part of the PVX genome including parts of the plasmid backbone was created with primers SOE-TMVCP2-fw and M13 universe from the vector PVX-mCherry. In a fourth PCR lacking primers all PCR products were fused due to the overlapping sequences and again amplified in PCR 5 with the primers mCherry-ClaI and M13 universe. The final PCR product was then cut with ClaI and SalI and ligated into the PVX vector which was cut with the same enzymes and dephosporylated with a calf intestinal phosphatase (CIP). The PVX vector also consists of the plasmid backbone of the binary pTRAc vector (Mclean, 2007, J Gen Virol 88, 1460-1469). The PVX genome of the UK3 strain is integrated between left border and right border of the T-DNA. The subgenomic promoter of the coat protein is duplicated and a multiple cloning site with the restriction enzymes NheI, ClaI and SmaI is integrated (pPVX201 Patent WO96/12027). In the final vector construct pPVX-mCherry-CP.sub.TMV codes for the potexviral RNA-dependent RNA-polymerase and the triple gene block proteins, as well as the heterologous genes for the fluorescent protein mCherry and the coat protein of TMV. The subgenomic promoters for the expression of mCherry and the TMV coat protein are the duplicated sg promoters of the PVX coat protein.
(17) TABLE-US-00001 TABLE1 DNAoligomersusedforconstructionof complementationvectors primername primersequence(5-3) M13universe GTTGTAAAACGACGGCCAGT (SEQIDNo.1) mCherry-ClaI TAGCATCGATATGGTGAGCAAG (SEQIDNo.2) PacI-GFP-TMV TCATTAATTAAATGGCTAGC (SEQIDNo.3) SOE2-CPfw AGTACGTTTTAATCAATATGTCAGCACCAGCTAG CAC(SEQIDNo.4) SOE2-CP-rv TGCTAGCTGGTGCTGACATATTGATTAAAACGTA CTC(SEQIDNo.5) SOE2-CP- AATAGCGGCCGCTATGGTGGTGGTAG NotI-rv (SEQIDNo.6) SOE-TMVCP- ATTGATACTCGAAAGATGCCTTATACAATC fw (SEQIDNo.7) SOE-TMVCP- ATTGTATAAGGCATCTTTCGAGTATCAATG rv (SEQIDNo.8) SOE-TMVCP2- AACTCCGGCTACTTAACTACGTCTACATAAC fw (SEQIDNo.9) SOE-TMVCP2- AGACGTAGTTAAGTAGCCGGAGTTG rv (SEQIDNo.10)
(18) For the construction of a TMV vector two PCR products were created. In PCR 1 the sequence of the green fluorescent protein was amplified adding a PacI restriction site at the 5-end and a part of coat protein subgenomic promoter of TMV with the primers PacI-GFP-TMV and SOE2-CP rv (Table 1) on the plasmid pJL24. In the second PCR the coat protein sequence of PVX was amplified with the primers SOE2-CP fw and SOE2-CP-NotI creating a construct with a part of the subgenomic promoter of TMV at the 5-end and a NotI restriction site at the 3-end. The two PCR products were fused in a third PCR without primers and amplified in a fourth PCR with the primers PacI-GFP-TMV and SOE2-CP NotI. The final PCR product was cut with the enzymes PacI and NotI and purified over an agarose gel. The target vector pTRBOG (US 2010/0071085 A1) was treated with the same restriction enzymes and dephosphorylated with CIP. The PCR fragment was ligated into the TMV vector and resulted in the plasmid pTMV-GFP-CP.sub.PVX.
(19) For the construction of PVX vectors with complete coat protein fusions existing PVX vectors with an N-terminal mBanana coat protein fusions with the 2A sequence were used. The PVX-mBanana-2A-CP for example is a PVX vector compatible for Agroinfection. The backbone of the plasmid is the binary pTRAc vector. The PVX genome of the UK3 strain is integrated between left border and right border of the T-DNA. The chosen vectors have a coat protein fusion of different fluorescent proteins with the 2A sequence of the Food and Mouth Disease Virus (FMDV), e.g. the yellow fluorescent protein mBanana. The 3 part of the PVX genome was amplified with a PCR and the restriction site BspEI which is also at the beginning of the 2A sequence in the fusion vectors was added to the 5 part with the primers 2ADelCPfw (5-AATCCGGATAACTACGTCTACATAACCG-3 (SEQ ID No. 11)) and M13 universe (5-GTTGTAAAACGACGGCCAGT-3 (SEQ ID No. 1)). The primer M13 universe binds inside the vector backbone outside the PVX genome and the primer 2ADelCpfw binds directly downstream of the coat protein coding sequence and adds the BspEI site. The product was subcloned into the pCR2.1-Topo vector (Lifetechnologies, Carlsbad, USA) amplified in E. coli SCS110 to create non methylated plasmid DNA. The pCR2.1 vector was cut with BspEI and XhoI. The target vectors with the coat protein fusions were treated with the same enzymes so the 2A sequence and the 3-end of the PVX genome was deleted. The 3-end without the complete coat protein sequence was then ligated into the PVX genome and confirmed by sequencing.
(20) In the present invention a plant virus expression system with novel containment features was developed. In this system two different viral vectors complement a defective function of each other, by reciprocal coat protein exchange. By these means no viral vector alone can systemically infect a plant. In this example a TMV vector with GFP as functional heterologous ORF and the coat protein of PVX (representing the second vector) and a PVX vector with mCherry as functional heterologous ORF and the CP of TMV (representing the first vector) and a PVX vector with mBanana as functional heterologous ORF and with a complete deletion of the CP (representing a third vector) were created.
(21) The viral vectors were transformed into Agrobacterium tumefaciens strain GV3101:pMP90RK for PVX based vectors, and GV2260 for TMV based vectors. The Agrobacteria were grown at 26 C. in YEB media (0.5% beef extract, 0.1% yeast extract, 0.5% peptone, 0.5% sucrose, 2 mM MgSO4) with the antibiotics carbenicillin (100 mg/1), rifampicin (50 mg/1) and kanamycin (50 mg/l for GV3101 and 25 mg/l for GV2260). After 24 hours the cultures were supplemented with 10 M MES (pH5.6), 10 M glucose and 20 M acetosyringone and incubated for another day. The cultures were then set to an OD.sub.600=1 with 2infiltration media (100 g/l sucrose, 3.6 g/l glucose, 8.6 g/l Murashige and Skoog (MS) salts, pH 5.6), supplemented with 200 M acetosyringone and incubated for 30 minutes at room temperature. For co-inoculation of two or more different constructs the cultures were mixed so each culture would have an OD.sub.600 of 1. The mixtures were inoculated into ca. 4 weeks old N. benthamiana leaves with a syringe without needle. The plants were further incubated in a phytochamber with constant light (25000-30000 lux) at 26 C. for 12 h and 12 h 20 C. in the dark.
(22) The plants were monitored each day under the specific conditions for the chosen fluorescent protein (Table 2). For GFP visualization a handheld UV lamp (7000 W, Novodirect, Kehl/Rhein, Germany), for mCherry a green LCD lamp (KL2500, Leica, Wetzlar, Germany) and for mBanana a high intensity blue LED lamp (Optimax450 Spectroline, Spectronics corporation, New York, USA) was used. Pictures were taken with a Nikon Coolpix 5400 camera (Nikon Deutschland, Dusseldorf, Germany).
(23) TABLE-US-00002 TABLE 2 Excitation Emission Fluorescent maximum Excitation maximum protein (nm) method (nm) GFP 395/475 UV lamp (260 nm) 508 mCherry 587 green lamp (515 nm) 610 mBanana 540 Blue lamp (450 nm) 553
(24) In
(25) After 26 dpi the plants were systemically infected with the two or even three different viral vectors. This demonstrates the ability of the viral vectors to complement each others innate coat protein deficiencies and secondly support systemic movement of further defective viral vectors.
(26) In
(27) For the isolation of total soluble proteins the leaves were harvested at different time points and homogenized with two volumes PBS (pH 7.4). Insoluble plant parts were separated during centrifugation at 13000 rpm for 10 min at 4 C. The total amount of soluble proteins was measured with a Bradford assay using RotiQuant reagent (Roth, Karlsruhe, Germany).
(28) For the quantification of fluorescence isolated total soluble protein was used. 50 g of total protein were diluted in 100 l of PBS and fluorescence profiles were measured in a microtiter plate reader (ELISA-Reader Infinite M200, TECAN Group Ltd, Mnnedorf, Switzerland). Fluorescent proteins were also visualized in SDS gels before Coomassie Brilliant Blue staining.
(29) For protein analysis discontinuous SDS-PAGE and Western blotting was used. The plant sap was supplemented with 5 reducing sample buffer (62.5 mM Tris-HCl pH 6.8, 30% glycin, 4% SDS, 10% 2-mercaptoethanol, 0.05% bromophenol blue) and directly loaded on the gels for visualization of fluorescence in the gels or boiled for 5-10 minutes for Western blotting. The probes were then loaded onto a 12% SDS gel and after electrophoresis either stained with Coomassie Brilliant Blue or blotted on a nitrocellulose membrane for Western blot analysis. The membranes were blocked for 1 h with 5% skimmed milk in PBS and then incubated with a polyclonal antibody against the coat protein of PVX (DSMZ, Braunschweig, Germany) or TMV (Bioreba A G, Reinach, Switzerland) for at least 2 h at room temperature. As secondary antibody a monoclonal alkaline phosphatase-conjugated goat anti-rabbit antibody (Dianova, Hamburg, Germany) was used and the signal was visualized with nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyphosphate p-toluidine salt (NBT/BCIP) (Roth, Karlsruhe, Germany).
(30) In SDS-PAGEs the successful co-expression of the heterologous proteins was confirmed again (
(31) These data confirm the lack of the own coat protein in the viruses and the expression of the foreign coat protein as well as a heterologous complementation of the coat protein function in co-infections.
(32) To confirm the co-expression of mCherry and mBanana by two different PVX based vectors in the same cells, the infected leaves were analyzed with the fluorescence microscope Biorevo BZ-9000 (Keyence, Neu-Isenburg, Germany). The leaves infected with the complementing pair showed a clear co-expression of mCherry and GFP in the same cells (
(33) We further analyzed if also a second TMV vector with a deficient CP gene can co-infect the plants with our complementing pair. However, the infection only showed a co-expression of two different PVX-based vectors in infected leaves (
(34) These findings were confirmed in SDS-PAGE and Western blot analysis (
(35) In summary we could confirm the co-expression of the complementing pair with an additional PVX-based vector lacking the coat protein, whereas a second TMV vector was not able to co-infect the plants with the complementing pair. With these vectors we are the first to show a co-expression of two viral vectors based on the same RNA virus in systemic infected leaves.
(36) The capability of coat protein complementation enabling systemic movement and the simultaneous production of recombinant proteins and at the same time ensuring a biosafety containment clearly show the benefit of the invention.
Example 2
Protein Production with Movement-deficient PVX Vectors
(37) For the expression of two or more recombinant proteins with viral vectors derived from one virus species, Potato Virus X (PVX) vectors were constructed which are lacking the coat protein. In these vectors the entire coat protein open reading frame was deleted, in contrast to known vectors were a part of the C-terminal coding region of the coat protein was preserved.
(38) The viral vectors were transformed into Agrobacterium tumefaciens strain GV3101:pMP90RK and grown at 26 C. in YEB media (0.5% beef extract, 0.1% yeast extract, 0.5% peptone, 0.5% sucrose, 2 mM MgSO.sub.4) with the antibiotics carbenicillin (100 mg/1), rifampicin (50 mg/1) and kanamycin (50 mg/1). After 24 hours the cultures were supplemented with 10 M MES (pH5.6), 10 M glucose and 20 M acetosyringone and incubated for another day. The cultures were then set to an OD.sub.600=1 with 2infiltration media (100 g/l sucrose, 3.6 g/l glucose, 8.6 g/l Murashige and Skoog (MS) salts, pH 5.6), supplemented with 200 M acetosyringone and incubated for 30 minutes at room temperature. For co-inoculation of two or more different constructs the cultures were mixed so each culture would have an OD.sub.600 of 1. The mixtures were inoculated into ca. 4 weeks old N. benthamiana leaves with a syringe without needle. The plants were further incubated in a phytochamber with constant light (25000-30000 lux) at 26 C. for 12 h and 12 h 20 C. in the dark.
(39) The plants were monitored each day under the specific conditions for the chosen fluorescent protein (Table 3). For GFP visualization a handheld UV lamp (7000 W, Novodirect, Kehl/Rhein, Germany), for mCherry a green LCD lamp (KL2500, Leica, Wetzlar, Germany) was used. Pictures were taken with a Nikon Coolpix 5400 camera (Nikon Deutschland, Dusseldorf, Germany).
(40) TABLE-US-00003 TABLE 3 excitation emission fluorescent maximum used excitation maximum obser- protein (nm) method (nm) vation GFP 395/475 UV lamp (260 nm) 508 mCherry 587 green lamp (515 nm) 610 red filter
(41) The results clearly show that the C-terminal coding region of the coat protein is not strictly required for the replication of the PVX vector. GFP and mCherry are produced in the inoculated plant cells (
(42) At 4 days post inoculation a good co-expression of both fluorescent proteins was visible and the expression reached the best co-expression levels at 6 dpi for this enzyme combination (
(43) For the isolation of total soluble proteins the leaves were harvested at different time points and homogenized with two volumes PBS (pH 7.4). Insoluble plant parts were separated during centrifugation at 13000 rpm for 10 min at 4 C. The total amount of soluble proteins was measured with a Bradford assay using RotiQuant reagent (Roth, Karlsruhe, Germany).
(44) For the quantification of fluorescence isolated total soluble protein was used. 50 g of total proteins were diluted in 100 l of PBS and fluorescence profiles were measured in a microtiter plate reader (ELISA-Reader Infinite M200, TECAN Group Ltd, Mnnedorf, Switzerland). Fluorescent proteins were also visualized in SDS gels before Coomassie Brilliant Blue staining.
(45) For protein analysis discontinuous SDS-PAGE and Western blotting was used (Laemmli, 1970). The plant sap was supplemented with 5 reducing sample buffer (62.5 mM Tris-HCl pH 6.8, 30% glycin, 4% SDS, 10% 2-mercaptoethanol, 0.05% bromophenol blue) and directly loaded on the gels for visualization of fluorescence in the gels or boiled for 5-10 minutes for Western blotting. The probes were then loaded onto a 12% SDS gel and after electrophoresis either stained with Coomassie Brilliant Blue or blotted on a nitrocellulose membrane for Western blot analysis. The membranes were blocked for 1 h with 5% skimmed milk in PBS and then incubated with a polyclonal antibody against the coat protein of PVX (DSMZ, Braunschweig, Germany) for at least 2 h at room temperature. As second antibody a monoclonal alkaline phosphatase-conjugated goat anti-rabbit antibody (Dianova, Hamburg, Germany) was used and the signal was visualized with nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyphosphate p-toluidine salt (NBT/BCIP) (Roth, Karlsruhe, Germany).
(46) With SDS-PAGE and Western blot analysis it could be proven, that the PVX vectors express no coat protein (data not shown). Although former publications indicate the demand for the C-terminal coding region of the coat protein for the replication of the PVX vector, here it could be shown that the coat protein coding sequence can be completely deleted. On the contrary a good co-expression of two different and potentially more PVXCP vectors could be shown.
(47) To confirm the co-expression of two different PVX based vectors in the same cells the infected leaves were analyzed with the fluorescence microscope Biorevo BZ-9000 (Keyence, Neu-Isenburg, Germany). The pictures confirmed no signals for the non-infected N. benthamiana plant (
(48) In summary, we could confirm the co-expression of different PVX-based vectors lacking its CP in agroinfiltrated leaves. This findings show that PVX vectors are capable of co-infections after knockout of CP functions. This is in contrast to the aforementioned known PVX-based vectors and also to TMV-based vectors, which are not capable of co-infections even after deletion of the MP and CP genes in the vectors (Julve et al., 2013).
(49) Due to the coat protein deletion, containment is ensured. Moreover, the present invention overcomes the incompatibility of two or more vectors in one cell and therefore allows simultaneous expression of two or more heterologous ORFs located on different viral vectors in the same plant cells.
LITERATURE
(50) Fedorkin, O. N., Merits, A., Lucchesi, J., Solovyev, A. G., Saarma, M., Morozov, S. Y., Makinen, K., 2000. Complementation of the movement-deficient mutations in potato virus X: potyvirus coat protein mediates cell-to-cell trafficking of C-terminal truncation but not deletion mutant of potexvirus coat protein. Virology 270, 31-42. Julve, J. M., Gandia, A., Fernandez-Del-Carmen, A., Sarrion-Perdigones, A., Castelijns, B., Granell, A., Orzaez, D., 2013. A coat-independent superinfection exclusion rapidly imposed in Nicotiana benthamiana cells by tobacco mosaic virus is not prevented by depletion of the movement protein. Plant Mol Biol 81, 553-564. Komarova, T. V., Skulachev, M. V., Zvereva, A. S., Schwartz, A. M., Dorokhov, Y. L., Atabekov, J. G., 2006. New viral vector for efficient production of target proteins in plants. Biochemistry (Mosc) 71, 846-850. Laemmli, U. K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685.