BRASSICA PLANTS WITH MODIFIED SEED OIL COMPOSITION
20190024106 ยท 2019-01-24
Inventors
Cpc classification
C12N15/8261
CHEMISTRY; METALLURGY
C12N15/8247
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to Brassica plants comprising mutant FAD2 genes, FAD2 nucleic acid sequences and proteins, as well as methods for generating and identifying said plants and alleles, which can be used to plants with increased levels of C18:1 in the seed oil. The invention further relates to combining the mutant FAD2 alleles with mutant FAD3 alleles to increase the levels of C18:1 and reduce the levels of C18:3 in the seed oil.
Claims
1. A Brassica napus plant, or a cell, part, seed or progeny thereof, comprising a FAD2-A1, a FAD2-A2, a FAD2-C1 and a FAD2-C2 gene, wherein said plant comprises knock-out fad2 alleles of the FAD2-A1 and of the FAD2-C2 genes, and wherein the fad2 alleles of said FAD2-C1 gene encode a functional FAD2 protein.
2. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 1, wherein the fad2 alleles of said FAD2-C1 gene are wild-type alleles.
3. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 1, wherein the fad2 alleles of the FAD2-A2 gene are knock-out fad2 alleles.
4. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 1, wherein said knock-out fad2 allele of said FAD2-A1 gene is a fad2 allele encoding a protein in which the His at a position corresponding to position 109 of SEQ ID NO: 6 is substituted with another amino acid, and wherein said knock-out fad2 allele of said FAD2-C2 allele is a fad2 allele comprising a stop codon mutation in the codon encoding the Trp at a position corresponding to position 190 of SEQ ID NO: 15.
5. (canceled)
6. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 4, which is derivable or obtainable from: a. seed comprising HIOL101 having been deposited at NCIMB under accession number NCIMB 42376; or b. seed comprising HIOL109 having been deposited at NCIMB under accession number NCIMB 42375.
7. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 1 which is homozygous for any one of the knock-out fad2 alleles.
8. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 1, said plant further comprising at least a knock-out fad3 allele of at least one FAD3 gene.
9. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 8, said plant further comprising knock-out fad3 alleles of five FAD3 genes.
10. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 8, wherein said at least one FAD3 gene is: a. a FAD3-A1 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 37, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 39, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 38; b. a FAD3-A2 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 40, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 42, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 41; c. a FAD3-A3 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 43, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 45, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 44; d. a FAD3-C1 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 46, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 48, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 47; and/or e. a FAD3-C2 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 49, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 51, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 50.
11. (canceled)
12. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 1, which has increased levels of C18:1 in the seed oil and which maintains normal agronomic development.
13. (canceled)
14. The Brassica napus plant, or a cell, part, seed or progeny thereof, according to claim 8, which has increased levels of C18:1 and decreased levels of C18:3 in the seed oil.
15. Oil from the seeds according to claim 1.
16. A method for increasing the levels of C18:1 in seed oil while maintaining normal agronomic development, said method comprising introducing a knock-out fad2 allele of a FAD2 A1 gene and a knock-out fad2 allele of a FAD2-C2 gene into a Brassica napus plant, and selecting a Brassica napus plant comprising said knock-out fad2 allele of said FAD2-A1 gene, and said knock-out fad2 allele of said FAD2-C2 gene, which further contains a FAD2-C1 gene of which the fad2 alleles encode a functional FAD2 protein.
17. (canceled)
18. A method according to claim 16 for increasing the levels of C18:1 and decreasing the levels of C18:3 in seed oil while maintaining normal agronomic development, said method further comprising introducing a knock-out fad3 allele of a FAD3-A1 gene, a knock-out fad3 allele of a FAD3-A2 gene, a knock-out fad3 allele of a FAD3-A3 gene, a knock-out fad3 allele of a FAD3-C1 gene, and a knock-out fad3 allele of a FAD3-C2 gene, into a Brassica napus plant, and selecting a Brassica napus plant comprising said knock-out fad3 allele of said FAD3-A1 gene, said knock-out fad3 allele of said FAD3-A2 gene, said knock-out fad3 allele of said FAD3-A3 gene, said knock-out fad3 allele of said FAD3-C1 gene, and said knock-out fad3 allele of said FAD3-C2 gene.
19. (canceled)
20. A method to determine the presence or absence of a knock-out fad2 allele in a biological sample, comprising providing genomic DNA from said biological sample, and analyzing said DNA for the presence of at least one molecular marker, wherein the at least one molecular marker is linked to said knock-out fad2 allele.
21. A kit for the detection of a knock-out fad2 allele in Brassica DNA samples, wherein said kit comprises one or more PCR primer pairs, which are able to amplify a DNA marker linked to said knock-out fad2 allele.
22. A method for determining the zygosity status of a knock-out fad2 allele in a plant, or a cell, part, seed or progeny thereof, comprising determining the presence of a knock-out and/or a corresponding wild type FAD2 specific region in the genomic DNA of said plant, or a cell, part, seed or progeny thereof.
23. A method for combining at least one knock-out fad2 allele of a FAD2 A1 gene, with at least one knock-out fad2 allele of a FAD2-C2 gene in a single Brassica napus plant, said method comprising a. crossing a first plant comprising one or more selected knockout fad2 alleles with a second plant comprising one or more other selected knockout fad2 alleles; b. collecting seeds from the cross, and, optionally, identifying a plant comprising at least one knock-out fad2 allele of a FAD2-A1 gene and at least one knock-out fad2 allele of a FAD2-C2 gene; and, optionally repeating steps a. and b. until a plant comprising at least one knock-out fad2 allele of a FAD2-A1 gene and at least one knock-out fad2 allele of a FAD2-C2 gene, is obtained.
24. (canceled)
25. A knock-out fad2 allele of a FAD2 gene, wherein the knock-out fad2 allele is a mutated version of the native FAD2 gene, wherein the native FAD2 gene is: a. a FAD2-A1 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 4, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 5, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 6; or b. a FAD2-C2 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 13, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 14, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 15.
26. The knock-out fad2 allele of claim 25, wherein the knock-out fad2 allele is: a. a mutant allele of said FAD2-A1 gene comprising a C to T substitution at a position corresponding to position 2371 of SEQ ID NO: 4; or b. a mutant allele of said FAD2-C2 gene comprising a G to A substitution at a position corresponding to position 2327 of SEQ ID NO: 52.
27. A method for producing oil, comprising harvesting seeds from the plants according to claim 1 and extracting the oil from said seeds.
28. A method of producing food, feed, or an industrial product comprising preparing the food, feed or industrial product from the plant or part thereof according to claim 1.
29. (canceled)
30. (canceled)
31. A method to produce a Brassica napus plant comprising an increased level of C18:1 in the seed oil and which maintains normal agronomic development, said method comprising sowing seeds according to claim 1 and growing plants from said seeds.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0021]
[0022]
GENERAL DEFINITIONS
[0023] A FAD2 gene or FAD2 allele, as used herein, is a gene or allele comprising a sequence having at least 60% sequence identity to the coding sequence of the FAD2 gene of Arabidopsis thaliana, accession number At3G12120, as depicted in SEQ ID NO: 2, nts 177-1328.
[0024] A FAD2 gene or FAD2 allele can, but does not need to encode a functional FAD2 protein. Functionality of the FAD2 protein can be tested, for example, by complementation of the Arabidopsis fad2-1 mutant as described by Okuley et al., 1994, Plant Cell 6: 147, or by expression and activity analysis in yeast as described by Peyou-Ndi et al., Arch Biochem Biophys 376:399. FAD2 genes or FAD2 alleles encompass, but are not limited to, BnFAD2-A1, BnFAD2-A2, BnFAD2-C1, BnFAD2-C2, BrFAD1-1, BrFAD2-2, BoFAD2-1 and BoFAD2-2 genes or alleles.
[0025] A knock-out fad2 gene or knock-out fad2 allele as used herein is a fad2 gene or a fad2 allele which encodes no functional FAD2 protein, or which encodes a FAD2 protein with reduced activity. Said knock-out fad2 gene can encode a FAD2 protein with reduced functionality, or be a full knock-out fad2 gene, encoding no functional FAD2 protein. Said knock-out fad2 gene or knock-out fad2 allele can be a mutant fad2 allele or a mutant fad2 gene, which may encode no functional FAD2 protein, or which may encode a mutant FAD2 protein with reduced activity. The gene or allele may also be referred to as an inactivated gene or allele. A knock-out fad2 gene or allele can be a wild-type FAD2 gene, i.e. a wild-type FAD2 gene which encodes no functional FAD2 protein, or which encodes a FAD2 protein with reduced activity, or can be a mutant fad2 gene or allele.
[0026] A full knock-out or null fad2 allele, as used herein, refers to a fad2 allele, which encodes a FAD2 protein having no biological activity as compared to a functional FAD2 protein (such as, for example, the wild-type BnFAD2-A1 protein of SEQ ID NO: 6, or the wild-type BnFAD2-C1 protein of SEQ ID NO: 9), or no detectable biological activity in a yeast assay as described by Peyou-Ndi et al., Arch Biochem Biophys 376:399, or which encodes no protein at all. Such a full knock-out fad2 allele is, for example, a wild-type fad2 allele, which comprises one or more mutations in its nucleic acid sequence, for example, one or more non-sense or mis-sense mutations. In particular, such a full knock-out fad2 allele is a wild-type fad2 allele, which comprises a mutation that preferably result in the production of a FAD2 protein lacking at least one functional domain, such as at least one of the three Histidine boxes, or at least one of the five transmembrane or membrane-associated domains (TM domains), or the ER retrieval motif, such that the biological activity of the FAD2 protein is completely abolished, or whereby the mutation(s) preferably result in no production of a FAD2 protein.
[0027] A functional FAD2 gene or functional FAD2 allele as used herein is a FAD2 gene or a FAD2 allele which encodes a functional FAD2 protein.
[0028] A mutant fad2 gene or mutant fad2 allele as used herein refers to any fad2 gene or fad2 allele which is not found in plants in the natural population or breeding population, but which is produced by human intervention such as mutagenesis or gene targeting. A mutant fad2 allele comprises knock-out fad2 alleles, and functional FAD2 alleles. A mutantfad2 allele can also be referred to as an induced mutantfad2 allele.
[0029] Functional FAD2 protein is a FAD2 protein which has at least 10%, or at least 15%, or at least 20%, or at least 25%, or at least 30%, or at least 50%, or at least 80% of the activity of the protein encoded by a reference Brassica napus FAD2-A1 or FAD2-C1 gene, as tested, for example, in yeast as described by by Peyou-Ndi et al., Arch Biochem Biophys 376:399, wherein the reference Brassica napus FAD2-A1 and FAD2-C1 gene encodes the protein with the amino acid sequence as depicted in SEQ ID No. 6 and SEQ ID No. 9, respectively. A functional FAD2 protein may be a FAD2 protein with full functionality, which can be 100% functionality of the reference Brassica napus FAD2-A1 and FAD2-C1 proteins. A functional FAD2 protein may also be a FAD2 protein with reduced functionality. The activity of a functional FAD2 protein should however not be completely abolished. For example, a functional FAD2 protein has detectable FAD2 activity in a yeast assay as described by Peyou-Ndi et al., Arch Biochem Biophys 376:399.
[0030] Biological activity of a FAD2 protein as used herein is delta-12 desaturation of oleic acid (C18:1) to form linoleic acid (C18:2). The biological activity of a FAD2 protein can, for example, be determined in a yeast assay as described by Peyou-Ndi et al., Arch Biochem Biophys 376:399.
[0031] A mutant FAD2 protein with reduced functionality is a FAD2 protein encoded by a mutant fad2 gene which has reduced activity or a reduction in the biological activity, or a significant reduction in the biological activity, as compared to the corresponding wild-type FAD2 protein encoded by the wild-type FAD2 gene, but not completely abolished. Said activity may be a reduced with at least 10%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 93%, or at least 95%, but wherein the activity is not completely abolished. For example, a mutant FAD2 protein with reduced functionality has detectable FAD2 activity in a yeast assay as described by Peyou-Ndi et al., Arch Biochem Biophys 376:399. A significant reduction in the biological activity of the FAD2 protein refers herein to a reduction in the delta-12 fatty acid desaturase activity, such that the levels of C18:1 in a plant are increased as compared to a plant expressing the corresponding wild type FAD2 protein.
[0032] The term nucleic acid sequence (or nucleic acid molecule) refers to a DNA or RNA molecule in single or double stranded form, particularly a DNA encoding a protein or protein fragment according to the invention. An endogenous nucleic acid sequence refers to a nucleic acid sequence within a plant cell, e.g. an endogenous allele of an FAD2 gene present within the nuclear genome of a Brassica cell. An isolated nucleic acid sequence is used to refer to a nucleic acid sequence that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.
[0033] The term gene means a DNA sequence comprising a region (transcribed region), which is transcribed into an RNA molecule (e.g. into a pre-mRNA, comprising intron sequences, which is then spliced into a mature mRNA, or directly into a mRNA without intron sequences) in a cell, operably linked to regulatory regions (e.g. a promoter). A gene may thus comprise several operably linked sequences, such as a promoter, a 5 leader sequence comprising e.g. sequences involved in translation initiation, a (protein) coding region (cDNA or genomic DNA) and a 3 non-translated sequence comprising e.g. transcription termination sites. Endogenous gene is used to differentiate from a foreign gene, transgene or chimeric gene, and refers to a gene from a plant of a certain plant genus, species or variety, which has not been introduced into that plant by transformation (i.e. it is not a transgene), but which is normally present in plants of that genus, species or variety, or which is introduced in that plant from plants of another plant genus, species or variety, in which it is normally present, by normal breeding techniques or by somatic hybridization, e.g., by protoplast fusion. Similarly, an endogenous allele of a gene is not introduced into a plant or plant tissue by plant transformation, but is, for example, generated by plant mutagenesis and/or selection or obtained by screening natural populations of plants.
[0034] Expression of a gene or gene expression refers to the process wherein a DNA region, which is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into an RNA molecule. The RNA molecule is then processed further (by post-transcriptional processes) within the cell, e.g. by RNA splicing and translation initiation and translation into an amino acid chain (polypeptide), and translation termination by translation stop codons. The term functionally expressed is used herein to indicate that a functional protein is produced; the term not functionally expressed to indicate that a protein with significantly reduced or no functionality (biological activity) is produced or that no protein is produced (see further below).
[0035] The terms protein or polypeptide are used interchangeably and refer to molecules consisting of a chain of amino acids, without reference to a specific mode of action, size, 3-dimensional structure or origin. A fragment or portion of a FAD2 protein may thus still be referred to as a protein. An isolated protein is used to refer to a protein that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell. Amino acids are the principal building blocks of proteins and enzymes. They are incorporated into proteins by transfer RNA according to the genetic code while messenger RNA is being decoded by ribosomes. During and after the final assembly of a protein, the amino acid content dictates the spatial and biochemical properties of the protein or enzyme. The amino acid backbone determines the primary sequence of a protein, but the nature of the side chains determines the protein's properties. Similar amino acids, as used herein, refers to amino acids that have similar amino acid side chains, i.e. amino acids that have polar, non-polar or practically neutral side chains. Non-similar amino acids, as used herein, refers to amino acids that have different amino acid side chains, for example an amino acid with a polar side chain is non-similar to an amino acid with a non-polar side chain. Polar side chains usually tend to be present on the surface of a protein where they can interact with the aqueous environment found in cells (hydrophilic amino acids). On the other hand, non-polar amino acids tend to reside within the center of the protein where they can interact with similar non-polar neighbors (hydrophobic amino acids). Examples of amino acids that have polar side chains are arginine, asparagine, aspartate, cysteine, glutamine, glutamate, histidine, lysine, serine, and threonine (all hydrophilic, except for cysteine which is hydrophobic). Examples of amino acids that have non-polar side chains are alanine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, and tryptophan (all hydrophobic, except for glycine which is neutral).
[0036] As used herein, the term allele(s) means any of one or more alternative forms of a gene at a particular locus. In a diploid (or amphidiploid) cell of an organism, alleles of a given gene are located at a specific location or locus (loci plural) on a chromosome. One allele is present on each chromosome of the pair of homologous chromosomes.
[0037] As used herein, the term homologous chromosomes means chromosomes that contain information for the same biological features and contain the same genes at the same loci but possibly different alleles of those genes. Homologous chromosomes are chromosomes that pair during meiosis. Non-homologous chromosomes, representing all the biological features of an organism, form a set, and the number of sets in a cell is called ploidy. Diploid organisms contain two sets of non-homologous chromosomes, wherein each homologous chromosome is inherited from a different parent. In amphidiploid species, essentially two sets of diploid genomes exist, whereby the chromosomes of the two genomes are referred to as homeologous chromosomes (and similarly, the loci or genes of the two genomes are referred to as homeologous loci or genes). A diploid, or amphidiploid, plant species may comprise a large number of different alleles at a particular locus.
[0038] As used herein, the term heterozygous means a genetic condition existing when two different alleles reside at a specific locus, but are positioned individually on corresponding pairs of homologous chromosomes in the cell. Conversely, as used herein, the term homozygous means a genetic condition existing when two identical alleles reside at a specific locus, but are positioned individually on corresponding pairs of homologous chromosomes in the cell.
[0039] As used herein, the term locus (loci plural) means a specific place or places or a site on a chromosome where for example a gene or genetic marker is found. For example, the FAD2-A1 locus and the FAD2-A2 locus refers to the position on a chromosome of the A genome where the FAD2-A1 gene (and two FAD2-A1 alleles) or the FAD2-A2 gene (and two FAD2-A2 alleles) may be found, such as the position on the chromosome of the A genome of the BnFAD2-A1 locus, the BnFAD2-A2 locus, the BrFAD2-1 locus, and the BnFAD2-2 locus, while theFAD2-C1 locus and the FAD2-C2 locus refers to the position on a chromosome of the C genome where the FAD2-C1 gene (and two FAD2-C1 alleles) or the BnFAD2-C2 gene (and two FAD2-C2 alleles) may be found, such as the position on the chromosome of the C genome of the BnFAD2-C1 locus, the BnFAD2-C2 locus, the BoFAD2-1 locus, and the BoFAD2-2 locus.
[0040] Wild type (also written wildtype or wild-type), as used herein, refers to a typical form of a plant or a gene as it most commonly occurs in nature. A wild type plant refers to a plant in the natural population or in a breeding population. A wild type allele refers to an allele of a gene occurring in wild-type plants.
[0041] Mutant as used herein refers to a form of a plant or a gene which is different from such plant or gene in the natural population, and which is produced by human intervention, e.g. by mutagenesis, and a mutant allele refers to an allele which is not found in plants in the natural population or breeding population, but which is produced by human intervention such as mutagenesis or gene targeting.
[0042] Whenever reference to a plant or plants according to the invention is made, it is understood that also plant parts (cells, tissues or organs, seed pods, seeds, severed parts such as roots, leaves, flowers, pollen, etc.), progeny of the plants which retain the distinguishing characteristics of the parents (especially the increased levels of C18:1), such as seed obtained by selfing or crossing, e.g. hybrid seed (obtained by crossing two inbred parental lines), hybrid plants and plant parts derived there from are encompassed herein, unless otherwise indicated.
[0043] Creating propagating material, as used herein, relates to any means know in the art to produce further plants, plant parts or seeds and includes inter alia vegetative reproduction methods (e.g. air or ground layering, division, (bud) grafting, micropropagation, stolons or runners, storage organs such as bulbs, corms, tubers and rhizomes, striking or cutting, twin-scaling), sexual reproduction (crossing with another plant) and asexual reproduction (e.g. apomixis, somatic hybridization).
[0044] A molecular assay (or test) refers herein to an assay that indicates (directly or indirectly) the presence or absence of one or more particular FAD2 alleles at one or more FAD2 loci (e.g. at one or both of the FAD2-A1, FAD2-A2, FAD2-C1 or FAD2-C2 loci). In one embodiment it allows one to determine whether a particular (wild type or mutant) FAD2 allele is homozygous or heterozygous at the locus in any individual plant.
[0045] Mutagenesis, as used herein, refers to the process in which plant cells (e.g., a plurality of Brassica seeds or other parts, such as pollen, etc.) are subjected to a technique which induces mutations in the DNA of the cells, such as contact with a mutagenic agent, such as a chemical substance (such as ethylmethylsulfonate (EMS), ethylnitrosourea (ENU), etc.) or ionizing radiation (neutrons (such as in fast neutron mutagenesis, etc.), alpha rays, gamma rays (such as that supplied by a Cobalt 60 source), X-rays, UV-radiation, etc.), T-DNA insertion mutagenesis (Azpiroz-Leehan et al. (1997) Trends Genet 13:152-156), transposon mutagenesis (McKenzie et al. (2002) Theor Appl Genet 105:23-33), or tissue culture mutagenesis (induction of somaclonal variations), or a combination of two or more of these. Thus, the desired mutagenesis of one or more FAD2 alleles may be accomplished by one of the above methods. While mutations created by irradiation are often large deletions or other gross lesions such as translocations or complex rearrangements, mutations created by chemical mutagens are often more discrete lesions such as point mutations. For example, EMS alkylates guanine bases, which results in base mispairing: an alkylated guanine will pair with a thymine base, resulting primarily in G/C to A/T transitions. Following mutagenesis, Brassica plants are regenerated from the treated cells using known techniques. For instance, the resulting Brassica seeds may be planted in accordance with conventional growing procedures and following self-pollination seed is formed on the plants. Alternatively, doubled haploid plantlets may be extracted to immediately form homozygous plants, for example as described by Coventry et al. (1988, Manual for Microspore Culture Technique for Brassica napus. Dep. Crop Sci. Techn. Bull. OAC Publication 0489. Univ. of Guelph, Guelph, Ontario, Canada). Additional seed that is formed as a result of such self-pollination in the present or a subsequent generation may be harvested and screened for the presence of mutant fad2 alleles. Several techniques are known to screen for specific mutant alleles, e.g., Deleteagene (Delete-a-gene; Li et al., 2001, Plant J 27: 235-242) uses polymerase chain reaction (PCR) assays to screen for deletion mutants generated by fast neutron mutagenesis, TILLING (targeted induced local lesions in genomes; McCallum et al., 2000, Nat Biotechnol 18:455-457) identifies EMS-induced point mutations, etc. Additional techniques to screen for the presence of specific mutant fad2 alleles are described in the Examples below.
[0046] The term gene targeting refers herein to directed gene modification that uses mechanisms such as homologous recombination, mismatch repair or site-directed mutagenesis. The method can be used to replace, insert and delete endogenous sequences or sequences previously introduced in plant cells. Methods for gene targeting can be found in, for example, WO 2006/105946 or WO2009/002150. Gene targeting can be used to create mutantfad2 alleles, such as knock-out fad2 alleles.
[0047] As used herein, the term non-naturally occurring or cultivated when used in reference to a plant, means a plant with a genome that has been modified by man. A transgenic plant, for example, is a non-naturally occurring plant that contains an exogenous nucleic acid molecule, e.g., a chimeric gene comprising a transcribed region which when transcribed yields a biologically active RNA molecule capable of reducing the expression of an endogenous gene, such as a FAD2 gene, and, therefore, has been genetically modified by man. In addition, a plant that contains a mutation in an endogenous gene, for example, a mutation in an endogenous FAD2 gene, (e.g. in a regulatory element or in the coding sequence) as a result of an exposure to a mutagenic agent is also considered a non-naturally plant, since it has been genetically modified by man. Furthermore, a plant of a particular species, such as Brassica napus, that contains a mutation in an endogenous gene, for example, in an endogenous FAD2 gene, that in nature does not occur in that particular plant species, as a result of, for example, directed breeding processes, such as marker-assisted breeding and selection or introgression, with a plant of the same or another species, such as Brassica juncea or rapa, of that plant is also considered a non-naturally occurring plant. In contrast, a plant containing only spontaneous or naturally occurring mutations, i.e. a plant that has not been genetically modified by man, is not a non-naturally occurring plant as defined herein and, therefore, is not encompassed within the invention. One skilled in the art understands that, while a non-naturally occurring plant typically has a nucleotide sequence that is altered as compared to a naturally occurring plant, a non-naturally occurring plant also can be genetically modified by man without altering its nucleotide sequence, for example, by modifying its methylation pattern.
[0048] The term ortholog of a gene or protein refers herein to the homologous gene or protein found in another species, which has the same function as the gene or protein, but is (usually) diverged in sequence from the time point on when the species harboring the genes diverged (i.e. the genes evolved from a common ancestor by speciation). Orthologs of the Brassica napus FAD2 genes may thus be identified in other plant species (e.g. Brassica juncea, etc.) based on both sequence comparisons (e.g. based on percentages sequence identity over the entire sequence or over specific domains) and/or functional analysis.
[0049] A variety is used herein in conformity with the UPOV convention and refers to a plant grouping within a single botanical taxon of the lowest known rank, which grouping can be defined by the expression of the characteristics resulting from a given genotype or combination of genotypes, can be distinguished from any other plant grouping by the expression of at least one of the said characteristics and is considered as a unit with regard to its suitability for being propagated unchanged (stable).
[0050] The term comprising is to be interpreted as specifying the presence of the stated parts, steps or components, but does not exclude the presence of one or more additional parts, steps or components. A plant comprising a certain trait may thus comprise additional traits.
[0051] It is understood that when referring to a word in the singular (e.g. plant or root), the plural is also included herein (e.g. a plurality of plants, a plurality of roots). Thus, reference to an element by the indefinite article a or an does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article a or an thus usually means at least one.
[0052] For the purpose of this invention, the sequence identity of two related nucleotide or amino acid sequences, expressed as a percentage, refers to the number of positions in the two optimally aligned sequences which have identical residues (100) divided by the number of positions compared. A gap, i.e., a position in an alignment where a residue is present in one sequence but not in the other, is regarded as a position with non-identical residues. The optimal alignment of two sequences is found by aligning the two sequences over the entire length according to the Needleman and Wunsch global alignment algorithm (Needleman and Wunsch, 1970, J Mol Biol 48(3):443-53) in The European Molecular Biology Open Software Suite (EMBOSS, Rice et al., 2000, Trends in Genetics 16(6): 276-277; see e.g. http://www.ebi.ac.uk/emboss/align/index.html) using default settings (gap opening penalty=10 (for nucleotides)/10 (for proteins) and gap extension penalty=0.5 (for nucleotides)/0.5 (for proteins)). For nucleotides the default scoring matrix used is EDNAFULL and for proteins the default scoring matrix is EBLOSUM62.
[0053] Substantially identical or essentially similar, as used herein, refers to sequences, which, when optimally aligned as defined above, share at least a certain minimal percentage of sequence identity (as defined further below).
[0054] Stringent hybridization conditions can be used to identify nucleotide sequences, which are substantially identical to a given nucleotide sequence. Stringent conditions are sequence dependent and will be different in different circumstances. Generally, stringent conditions are selected to be about 5 C. lower than the thermal melting point (T.sub.m) for the specific sequences at a defined ionic strength and pH. The T.sub.m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Typically stringent conditions will be chosen in which the salt concentration is about 0.02 molar at pH 7 and the temperature is at least 60 C. Lowering the salt concentration and/or increasing the temperature increases stringency. Stringent conditions for RNA-DNA hybridizations (Northern blots using a probe of e.g. 100 nt) are for example those which include at least one wash in 0.2SSC at 63 C. for 20 min, or equivalent conditions.
[0055] High stringency conditions can be provided, for example, by hybridization at 65 C. in an aqueous solution containing 6SSC (20SSC contains 3.0 M NaCl, 0.3 M Na-citrate, pH 7.0), 5Denhardt's (100Denhardt's contains 2% Ficoll, 2% Polyvinyl pyrollidone, 2% Bovine Serum Albumin), 0.5% sodium dodecyl sulphate (SDS), and 20 g/ml denaturated carrier DNA (single-stranded fish sperm DNA, with an average length of 120-3000 nucleotides) as non-specific competitor. Following hybridization, high stringency washing may be done in several steps, with a final wash (about 30 min) at the hybridization temperature in 0.2-0.1SSC, 0.1% SDS.
[0056] Moderate stringency conditions refers to conditions equivalent to hybridization in the above described solution but at about 60-62 C. Moderate stringency washing may be done at the hybridization temperature in 1SSC, 0.1% SDS.
[0057] Low stringency refers to conditions equivalent to hybridization in the above described solution at about 50-52 C. Low stringency washing may be done at the hybridization temperature in 2SSC, 0.1% SDS. See also Sambrook et al. (1989) and Sambrook and Russell (2001).
DETAILED DESCRIPTION
[0058] The current invention is based on the identification of two FAD2 genes in Brassica rapa and in Brassica oleracea, and of 4 FAD2 genes in Brassica napus, and of the role of the Brassica FAD2 gene products in fatty acid desaturation.
[0059] It is a first embodiment of the invention to provide a Brassica napus plant, or a cell, part, seed or progeny thereof, comprising a FAD2-A1, a FAD2-A2, a FAD2-C1 and a FAD2-C2 gene, wherein said plant comprises knock-out fad2 alleles of the FAD2-A1 and of the FAD2-C2 genes, and wherein the fad2 alleles of said FAD2-C1 gene encode a functional FAD2 protein. In a further embodiment, the fad2 alleles of the FAD2-C1 gene of said Brassica napus plant are wild-type alleles. In another embodiment, the fad2 alleles of the FAD2-A2 gene of said Brassica napus plant are knock-out fad2 alleles. In yet another embodiment, the knock-out fad2 allele of said FAD2-A1 gene is a fad2 allele encoding a protein in which the His at a position corresponding to position 109 of SEQ ID NO: 6 is substituted with another amino acid, and wherein said knock-out fad2 allele of said FAD2-C2 allele is a fad2 allele comprising a stop codon mutation in the codon encoding the Trp at a position corresponding to position 190 of SEQ ID NO: 15, whereas in yet another embodiment said knock-out fad2 allele of said FAD2-A1 gene comprises a sequence having at least 90% sequence identity to SEQ ID NO: 4 wherein the C at position 2371 is substituted with T; and said knock-out fad2 allele of said FAD2-C2 gene comprises a sequence having at least 90% sequence identity to SEQ ID NO: 13 wherein the G at position 2327 is substituted with A. In again another embodiment, the Brassica napus plant, or a cell, part, seed or progeny thereof according to the invention is derivable or obtainable from seeds selected from the group consisting of seed comprising HIOL101 having been deposited at NCIMB under accession number NCIMB 42376; and seed comprising HIOL109 having been deposited at NCIMB under accession number NCIMB 42375. In another aspect of the invention, said Brassica napus plant, or a cell, part, seed or progeny thereof, is homozygous for any one of the knock-out fad2 alleles.
[0060] In a further embodiment, the Brassica napus plant, or a cell, part, seed or progeny thereof, according to the invention, further comprises at least a knock-out fad3 allele of at least one FAD3 gene, such as knock-out fad3 alleles of five FAD3 genes. In another embodiment, said FAD3 genes are selected from the group consisting of: a) a FAD3-A1 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 37, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 39, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 38; b) a FAD3-A2 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 40, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 42, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 41; c) a FAD3-A3 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 43, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 45, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 44; d) a FAD3-C1 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 46, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 48, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 47; and e) a FAD3-C2 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 49, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 51, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 50. In yet a further embodiment, said fad3 alleles are a) a mutant allele of said FAD3-A1 gene comprises a G to A substitution at a position corresponding to position 2405 of SEQ ID NO: 37; b) a mutant allele of said FAD3-A2 gene comprises a G to A substitution at a position corresponding to position 3934 of SEQ ID NO: 40; c) a mutant allele of said FAD3-A3 gene comprises a G to A substitution at a position corresponding to position 2847 of SEQ ID NO: 43; d) a mutant allele of said FAD3-C1 gene comprises a G to A substitution at a position corresponding to position 2702 of SEQ ID NO: 46; and e) a mutant allele of said FAD3-C2 gene comprises a G to A substitution at a position corresponding to position 3909 of SEQ ID NO: 49.
[0061] A Brassica plant, as used herein, can be Brassica napus (AACC, 2n=38), Brassica juncea (AABB, 2n=36), Brassica carinata (BBCC, 2n=34), Brassica rapa (syn. B. campestris) (AA, 2n=20), Brassica oleracea (CC, 2n=18) or Brassica nigra (BB, 2n=16). Said Brassica plant can be a crop plant species cultivated as a crop.
Nucleic Acid Sequences According to the Invention
[0062] Provided are both wild type FAD2 nucleic acid sequences encoding functional FAD2 proteins and mutant fad2 nucleic acid sequences (comprising one or more mutations, preferably mutations which result in no or a significantly reduced biological activity of the encoded FAD2 protein or in no FAD2 protein being produced) of FAD2 genes from Brassica, especially from Brassica napus, Brassica rapa, and Brassica oleracea.
[0063] However, isolated FAD2 and fad2 nucleic acid sequences (e.g. isolated from the plant by cloning or made synthetically by DNA synthesis), as well as variants thereof and fragments of any of these are also provided herein, as these can be used to determine which sequence is present endogenously in a plant or plant part, whether the sequence encodes a functional, a non-functional or no protein (e.g. by expression in a recombinant host cell as described below) and for selection and transfer of specific alleles from one plant into another, in order to generate a plant having the desired combination of functional and mutant alleles.
[0064] Nucleic acid sequences of FAD2 A1, FAD2-C1, FAD2-A2, and FAD2-C2 have been isolated from Brassica napus, nucleic acid sequences of FAD2-1, and FAD2-2 have been isolated from Brassica oleracea and from Brassica rapa as depicted in the sequence listing. The wild type FAD2 sequences are depicted, while the mutant fad2 sequences of these sequences, and of sequences essentially similar to these, are described herein below and in the Examples, with reference to the wild type FAD2 sequences. The genomic FAD2 protein-encoding DNA from Brassica napus, Brassica oleracea, and Brassica rapa do comprise any introns. The coding sequences or cDNA sequences, of the Brassica FAD2 genes, not comprising the introns, are also depicted in the sequence listing.
[0065] A Brassica napus FAD2-A1 gene, BnFAD2-A1 gene, Brassica napus FAD2-A1 allele, BnFAD2-A1 allele or FAD2-A1 from Brassica napus, or variant nucleic acid sequences thereof as used herein refers to a gene, allele or a sequence having at least 90%, or at least 95%, or at least 98%, or at least 99%, or 100% sequence identity SEQ ID No. 4.
[0066] A Brassica napus FAD2-C1 gene, BnFAD2-C1 gene, Brassica napus FAD2-C1 allele, BnFAD2-C1 allele or FAD2-C1 from Brassica napus, or variant nucleic acid sequences thereof as used herein refers to a gene, allele or a sequence having at least 90%, or at least 95%, or at least 98%, or at least 99%, or 100% sequence identity SEQ ID No. 7.
[0067] A Brassica napus FAD2-A2 gene, BnFAD2-A2 gene, Brassica napus FAD2-A2 allele, BnFAD2-A2 allele or FAD2-A2 from Brassica napus, or variant nucleic acid sequences thereof as used herein refers to a gene, allele or a sequence having at least 90%, or at least 95%, or at least 98%, or at least 99%, or 100% sequence identity SEQ ID No. 10.
[0068] A Brassica napus FAD2-C2 gene, BnFAD2-C2 gene, Brassica napus FAD2-C2 allele, BnFAD2-C2 allele or FAD2-C2 from Brassica napus, or variant nucleic acid sequences thereof as used herein refers to a gene, allele or a sequence having at least 90%, or at least 95%, or at least 98%, or at least 99%, or 100% sequence identity SEQ ID No. 13.
[0069] A Brassica rapa FAD2-1 gene, BrFAD2-1 gene, Brassica rapa FAD2-1 allele, BrFAD2-1 allele or FAD2-1 from Brassica rapa, or variant nucleic acid sequences thereof as used herein refers to a gene, allele or a sequence having at least 90%, or at least 95%, or at least 98%, or at least 99%, or 100% sequence identity SEQ ID No. 16.
[0070] A Brassica rapa FAD2-2 gene, BrFAD2-2 gene, Brassica rapa FAD2-2 allele, BrFAD2-2 allele or FAD2-2 from Brassica rapa, or variant nucleic acid sequences thereof as used herein refers to a gene, allele or a sequence having at least 90%, or at least 95%, or at least 98%, or at least 99%, or 100% sequence identity SEQ ID No. 19.
[0071] A Brassica oleracea FAD2-1 gene, BoFAD2-1 gene, Brassica oleracea FAD2-1 allele, BoFAD2-1 allele or FAD2-1 from Brassica oleracea, or variant nucleic acid sequences thereof as used herein refers to a gene, allele or a sequence having at least 90%, or at least 95%, or at least 98%, or at least 99%, or 100% sequence identity SEQ ID No. 22.
[0072] A Brassica oleracea FAD2-2 gene, BoFAD2-2 gene, Brassica oleracea FAD2-2 allele, BoFAD2-2 allele or FAD2-2 from Brassica oleracea, or variant nucleic acid sequences thereof as used herein refers to a gene, allele or a sequence having at least 90%, or at least 95%, or at least 98%, or at least 99%, or 100% sequence identity SEQ ID No. 25.
[0073] A FAD2 A1 gene or a FAD2 A1 allele can be a BnFAD2-A1 gene or allele, or can be a BrFAD2-1 gene or allele.
[0074] A FAD2-C1 gene or a FAD2-C1 allele can be a BnFAD2-C1 gene or allele, or can be a BoFAD2-1 gene or allele.
[0075] A FAD2-A2 gene or a FAD2-A2 allele can be a BnFAD2-A2 gene or allele, or can be a BrFAD2-2 gene or allele.
[0076] A FAD2-C2 gene or a FAD2-C2 allele can be a BnFAD2-C2 gene or allele, or can be a BoFAD2-2 gene or allele.
[0077] Thus the invention provides both nucleic acid sequences encoding wild type, functional FAD2 proteins, including variants and fragments thereof (as defined further below), as well as mutant nucleic acid sequences of any of these, whereby the mutation in the nucleic acid sequence preferably results in one or more amino acids being inserted, deleted or substituted in comparison to the wild type FAD2 protein. Preferably the mutation(s) in the nucleic acid sequence result in one or more amino acid changes (i.e. in relation to the wild type amino acid sequence one or more amino acids are inserted, deleted and/or substituted) whereby the biological activity of the FAD2 protein is significantly reduced or completely abolished.
[0078] Functionality of the FAD2 protein can be tested, for example, by expression and activity analysis in yeast as described by Peyou-Ndi et al., Arch Biochem Biophys 376:399.
[0079] Both endogenous and isolated nucleic acid sequences are provided herein. Also provided are fragments of the FAD2 sequences and FAD2 variant nucleic acid sequences defined above, for use as primers or probes and as components of kits according to another aspect of the invention (see further below). A fragment of a FAD2 or fad2 nucleic acid sequence or variant thereof (as defined) may be of various lengths, such as at least 10, 12, 15, 18, 20, 50, 100, 200, 500, 600 contiguous nucleotides of the FAD2 or fad2 sequence (or of the variant sequence).
[0080] Wild-Type Nucleic Acid Sequences Encoding Wild-Type FAD2 Proteins
[0081] The nucleic acid sequences depicted in the sequence listing encode wild type FAD2 proteins from Brassica napus, from Brassica rapa, and from Brassica oleracea. Thus, these sequences are endogenous to the Brassica plants from which they were isolated.
[0082] Other Brassica crop species, varieties, breeding lines or wild accessions may be screened for other FAD2 alleles, encoding the same FAD2 proteins or variants thereof. For example, nucleic acid hybridization techniques (e.g. Southern blot analysis, using for example stringent hybridization conditions) or nucleic acid amplification-based techniques such as PCR techniques may be used to identify FAD2 alleles endogenous to other Brassica plants, such as various Brassica napus, Brassica rapa, or Brasssica oleracea varieties, lines or accessions. To screen such plants, plant organs or tissues for the presence of FAD2 alleles, the FAD2 nucleic acid sequences provided in the sequence listing, or variants or fragments of any of these, may be used. For example whole sequences or fragments may be used as probes or primers. For example specific or degenerate primers may be used to amplify nucleic acid sequences encoding FAD2 proteins from the genomic DNA of the plant, plant organ or tissue. These FAD2 nucleic acid sequences may be isolated and sequenced using standard molecular biology techniques. Bioinformatics analysis may then be used to characterize the allele(s), for example in order to determine which FAD2 allele the sequence corresponds to and which FAD2 protein or protein variant is encoded by the sequence.
[0083] In addition, it is understood that FAD2 nucleic acid sequences and variants thereof (or fragments of any of these) may be identified in silico, by screening nucleic acid databases for essentially similar sequences. Likewise, a nucleic acid sequence may be synthesized chemically. Fragments of nucleic acid molecules according to the invention are also provided, which are described further below.
[0084] Wild-type FAD2 nucleic acid sequences may encompass knock-out FAD2 nucleic acid sequences, such as the full knock-out BnFAD2-A2 and BrFAD2-2 nucleic acid sequence of SEQ ID NO: 10 and 19, respectively, as described herein, which contain a deletion in the coding sequence leading to a truncated protein of 136 amino acids (SEQ ID NO: 12 and 21, respectively) which lack the five TM domains, the three Histidine boxes, and the ER retrieval motif (see
[0085] Nucleic Acid Sequences Encoding Mutant FAD2 Proteins
[0086] Nucleic acid sequences comprising one or more nucleotide deletions, insertions or substitutions relative to the wild type nucleic acid sequences are another embodiment of the invention, as are fragments of such mutant nucleic acid molecules. Such mutant nucleic acid sequences (referred to as fad2 sequences) can be generated and/or identified using various known methods, as described further below. Again, such nucleic acid molecules are provided both in endogenous form and in isolated form. In one embodiment, the mutation(s) result in one or more changes (deletions, insertions and/or substitutions) in the amino acid sequence of the encoded FAD2 protein (i.e. it is not a silent mutation). In another embodiment, the mutation(s) in the nucleic acid sequence result in a significantly reduced or completely abolished biological activity of the encoded FAD2 protein relative to the wild type protein.
[0087] Basically, any mutation in the wild type FAD2 nucleic acid sequences which results in a FAD2 protein comprising at least one amino acid insertion, deletion and/or substitution relative to the wild type FAD2 protein can lead to significantly reduced or no biological activity. It is, however, understood that certain mutations in the FAD2 protein are more likely to result in a complete abolishment of the biological activity of the FAD2 protein, such as mutations whereby significant portions of conserved domains, such as one or more of the Histidine boxes are lacking, or whereby certain critical amino acid residues within these domains are lacking or substituted, preferably substituted by non-similar or non-conservative amino acids, while other mutations such as for example amino acid substitutions outside of the Histidine boxes or within the TM domain, are more likely to result in a reduction of the biological activity of the FAD2 protein without completely abolishing the biological activity of the encoded FAD2 protein.
[0088] The conserved first, second and third Histidine boxes are at a position corresponding to position 105-109, 141-145, and 314-319, respectively, of the Arabidopsis FAD2 protein of SEQ ID NO: 3. The conserved first, second, third, fourth and fifth TM domains are at a position corresponding to position 56-76, 117-137, 179-199, 225-245, and 252-272, respectively, of the Arabidopsis FAD2 protein of SEQ ID NO: 3. The conserved ER retrieval motif is at a position corresponding to position 379-383 of the Arabidopsis FAD2 protein of SEQ ID NO: 3.
[0089] Optimal alignment of the Arabidopsis FAD2 nucleic acids (SEQ ID NO: 1 and 2) and amino acid (SEQ ID NO: 3) sequences with Brassica FAD2 sequences of the present invention, allows to determine the positions of the corresponding conserved domains and amino acids in these Brassica sequences.
[0090] Thus, the conserved first Histidine box is at a position corresponding to position 105-109 of SEQ ID NO: 6, 9, 15, 18, 24 and 27; the conserved second Histidine box is at a position corresponding to position 141-145 of SEQ ID NO: 6, 9, 15, 18, 24 and 27; the conserved third Histidine box is at a position corresponding to position 316-320 of SEQ ID NO: 6, 9, 15, 18, and 24; the conserved first TM domain is at a position corresponding to position 56-76 of SEQ ID NO: 6, 9, 15, 18, 24 and 27; the conserved second TM domain is at a position corresponding to position 117-137 of SEQ ID NO: 6, 9, 15, 18, 24 and 27; the conserved third TM domain is at a position corresponding to position 179-199 of SEQ ID NO: 6, 9, 15, 18, 24 and 27; the conserved fourth TM domain is at a position corresponding to position 226-246 of SEQ ID NO: 6, 9, 15, 18, 24 and 27; the conserved fifth TM domain is at a position corresponding to position 253-273 of SEQ ID NO: 6, 9, 15, 18, 24 and 27; and the ER retrieval motif is at a position corresponding to position 380-384 of SEQ ID NO: 6, 9, 15, 18, and 24.
[0091] The present invention describes knockout fad2 alleles, which can be full knock-out alleles, in particular e.g. the HIOL101 allele, encoding a FAD2 protein in which the conserved Histidine (His, H) at position 5 of the first Histidine box (i.e. at a position corresponding to position 109 of SEQ ID NO: 3) is substituted with a Tyrosine; the HIOL103 allele, encoding a FAD2 protein which is truncated after the amino acid at a position corresponding to position 100 of SEQ ID NO: 3, and lacks the three Histidine boxes, the second, the third, the fourth and the fifth TM domain, and the ER retrieval motif; the HIOL111 allele, comprising a stopcodon mutation at a position corresponding to position 2057 of SEQ ID NO: 10, and the HIOL109 allele, encoding a FAD2 protein which is truncated after the amino acid at a position corresponding to position 189 of SEQ ID NO: 3, and lacks the third Histidine box, part of the third, and the complete fourth and fifth TM domain, and the ER retrieval motif.
[0092] Knockout fad2 alleles can thus be full knock-out fad2 alleles which encode a FAD2 protein of which at least one of the conserved Histidine boxes is completely or partially deleted, such as a fad2 allele encoding a truncated FAD2 protein of which at least the third Histidine box is deleted. Examples of such a fad2 allele is a fad2 allele containing a stop codon mutation upstream of the codon encoding the first amino acid of the third Histidine box (i.e. the amino acid corresponding to amino acid 315 of SEQ ID NO: 3, or to amino acid 316 of SEQ ID NO: 6, 9 or 15), such as a fad2 allele containing a stop codon mutation upstream of the codon at a position corresponding to position 2992 of SEQ ID NO: 4, or to position 3866 of SEQ ID NO: 7, or to position 2704 of SEQ ID NO: 13. Full knockout fad2 alleles can also be fad2 alleles which encode a FAD2 protein in which at least one amino acid in at least one of the conserved Histidine boxes is substituted with another amino acid, such as fad2 alleles encoding FAD2 proteins of which one or more of the amino acids at a position corresponding to position 105, 106, 107, 108, 109, 141, 142, 143, 144, 145, 315, 316, 317, 318 or 319 of SEQ ID NO: 3, or corresponding to position 105, 106, 107, 108, 109, 141, 142, 143, 144, 145, 316, 317, 318, 319 or 320 of SEQ ID NO: 6, 9, 15, 18 or 24, is substituted, preferably substituted with a non-conservative amino acid.
[0093] Full knockout fad2 alleles can also be alleles which do not produce FAD2 protein, such as fad2 alleles with deletions or mutations in the promoter region produce no FAD2 mRNA and no FAD2 protein, or alleles of which (part of) the FAD2 coding sequence is deleted.
[0094] The knock-out FAD2 genes may, thus, comprise one or more mutations, such as:
[0095] (a) a missense mutation, which is a change in the nucleic acid sequence that results in the substitution of an amino acid for another amino acid;
[0096] (b) a nonsense mutation or STOP codon mutation, which is a change in the nucleic acid sequence that results in the introduction of a premature STOP codon and thus the termination of translation (resulting in a truncated protein); plant genes contain the translation stop codons TGA (UGA in RNA), TAA (UAA in RNA) and TAG (UAG in RNA); thus any nucleotide substitution, insertion, deletion which results in one of these codons to be in the mature mRNA being translated (in the reading frame) will terminate translation;
[0097] (c) an insertion mutation of one or more amino acids, due to one or more codons having been added in the coding sequence of the nucleic acid;
[0098] (d) a deletion mutation of one or more amino acids, due to one or more codons having been deleted in the coding sequence of the nucleic acid;
[0099] (e) a frameshift mutation, resulting in the nucleic acid sequence being translated in a different frame downstream of the mutation. A frameshift mutation can have various causes, such as the insertion, deletion or duplication of one or more nucleotides;
[0100] (f) a splice site mutation, resulting in altered splicing, which results in an altered mRNA processing and may, consequently, in an altered encoded protein or the production of no protein.
[0101] Thus in one embodiment, nucleic acid sequences comprising one or more of any of the types of mutations described above are provided. In another embodiment, fad2 sequences comprising one or more stop codon (nonsense) mutations, one or more missense mutations, one or more frameshift mutations, and/or one or more splice site mutations are provided. Any of the above mutant nucleic acid sequences are provided per se (in isolated form), as are plants and plant parts comprising such sequences endogenously. In the tables herein below fad2 alleles are described comprising one or more mutations.
[0102] A nonsense mutation in a FAD2 allele, as used herein, is a mutation in a FAD2 allele whereby one or more translation stop codons are introduced into the coding DNA and the corresponding mRNA sequence of the corresponding wild type FAD2 allele. Translation stop codons are TGA (UGA in the mRNA), TAA (UAA) and TAG (UAG). Thus, any mutation (deletion, insertion or substitution) that leads to the generation of an in-frame stop codon in the coding sequence will result in termination of translation and truncation of the amino acid chain. In one embodiment, a knockout FAD2 allele is provided comprising a nonsense mutation wherein an in-frame stop codon is introduced in the FAD2 codon sequence by a single nucleotide substitution, such as the mutation of CAG to TAG, TGG to TAG, TGG to TGA, or CAA to TAA. In another embodiment, a knockout FAD2 allele is provided comprising a nonsense mutation wherein an in-frame stop codon is introduced in the FAD2 codon sequence by double nucleotide substitutions, such as the mutation of CAG to TAA, TGG to TAA, or CGG to TAG or TGA. In yet another embodiment, a knockout FAD2 allele is provided comprising a nonsense mutation wherein an in-frame stop codon is introduced in the FAD2 codon sequence by triple nucleotide substitutions, such as the mutation of CGG to TAA. The truncated protein lacks the amino acids encoded by the coding DNA downstream of the mutation (i.e. the C-terminal part of the FAD2 protein) and maintains the amino acids encoded by the coding DNA upstream of the mutation (i.e. the N-terminal part of the FAD2 protein).
[0103] A range of possible EMS stop codon mutations in the BnFAD2-A1, BnFAD2-C1, BnFAD2-C2, BoFAD2-1, and BrFAD2-genes are shown in Tables 1a-e, respectively.
TABLE-US-00001 TABLE1a possiblestopcodonmutationsinBnFAD2-A1 positionrelative positionreleative togenomicsequence WT toproteinsequence (SEQIDNO:4) codon AA (SEQIDNO:3) stopcodon 2068-2070 CAA Gln 8 TAA 2218-2220 TGG Trp 58 TAG,TGA,TAA 2302-2304 TGG Trp 86 TAG,TGA,TAA 2314-2316 TGG Trp 90 TAG,TGA,TAA 2323-2325 CAG Gln 93 TAG,TAA 2347-2349 TGG Trp 101 TAG,TGA,TAA 2392-2394 CAG Gln 116 TAG,TAA 2395-2397 TGG Trp 117 TAG,TGA,TAA 2455-2457 TGG Trp 137 TAG,TGA,TAA 2470-2472 CGA Arg 142 TGA,TAA 2545-2547 TGG Trp 167 TAG,TGA,TAA 2599-2601 CAG Gln 185 TAG,TAA 2614-2616 TGG Trp 190 TAG,TGA,TAA 2719-2721 CAG Gln 225 TAG,TAA 2785-2787 CAA Gln 247 TAA 2866-2868 CAG Gln 274 TAG,TAA 2908-2910 TGG Trp 288 TAG,TGA,TAA 2914-2916 TGG Trp 290 TAG,TGA,TAA 3082-3084 CAG Gln 346 TAG,TAA 3115-3117 TGG Trp 357 TAG,TGA,TAA 3157-3159 CAA Gln 371 TAA 3181-3183 TGG Trp 379 TAG,TGA,TAA
TABLE-US-00002 TABLE1b possiblestopcodonmutationsinBnFAD2-C1 positionrelative positionrelative togenomicsequence WT toproteinsequence (SEQIDNO:7) codon AA (SEQIDNO:9) stopcodon 2942-2944 CAA Gln 8 TAA 3092-3094 TGG Trp 58 TAG,TGA,TAA 3176-3178 TGG Trp 86 TAG,TGA,TAA 3188-3190 TGG Trp 90 TAG,TGA,TAA 3197-3199 CAA Gln 93 TAA 3221-3223 TGG Trp 101 TAG,TGA,TAA 3266-3268 CAG Gln 116 TAG,TAA 3269-3271 TGG Trp 117 TAG,TGA,TAA 3329-3331 TGG Trp 137 TAG,TGA,TAA 3344-3346 CGA Arg 142 TGA,TAA 3419-3421 TGG Trp 167 TAG,TGA,TAA 3473-3475 CAG Gln 185 TAG,TAA 3488-3490 TGG Trp 190 TAG,TGA,TAA 3593-3595 CAG Gln 225 TAG,TAA 3659-3661 CAG Gln 247 TAG,TAA 3740-3742 CAG Gln 274 TAG,TAA 3782-3784 TGG Trp 288 TAG,TGA,TAA 3788-3790 TGG Trp 290 TAG,TGA,TAA 3956-3958 CAG Gln 346 TAG,TAA 3989-3991 TGG Trp 357 TAG,TGA,TAA 4031-4033 CAA Gln 371 TAA 4055-4057 TGG Trp 379 TAG,TGA,TAA
TABLE-US-00003 TABLE1c possiblestopcodonmutationsinBnFAD2-C2 positionrelative positionrelative togenomicsequence WT toproteinsequence (SEQIDNO:13) codon AA (SEQIDNO:15) stopcodon 1780-1782 CAA Gln 8 TAA 2014-2016 TGG Trp 86 TAG,TGA,TAA 2026-2028 TGG Trp 90 TAG,TGA,TAA 2035-2037 CAA Gln 93 TAA 2059-2061 TGG Trp 101 TAG,TGA,TAA 2104-2106 CAG Gln 116 TAG,TAA 2107-2109 TGG Trp 117 TAG,TGA,TAA 2167-2169 TGG Trp 137 TAG,TGA,TAA 2182-2184 CGA Arg 142 TGA,TAA 2257-2259 TGG Trp 167 TAG,TGA,TAA 2311-2313 CAG Gln 185 TAG,TAA 2326-2328 TGG Trp 190 TAG,TGA,TAA 2431-2433 CAG Gln 225 TAG,TAA 2497-2499 CGA Arg 247 TGA,TAA 2578-2580 CAG Gln 274 TAG,TAA 2620-2622 TGG Trp 288 TAG,TGA,TAA 2626-2628 TGG Trp 290 TAG,TGA,TAA 2794-2796 CAG Gln 346 TAG,TAA 2827-2829 TGG Trp 357 TAG,TGA,TAA 2869-2871 CAA Gln 371 TAA 2893-2895 TGG Trp 379 TAG,TGA,TAA
TABLE-US-00004 TABLE1d possiblestopcodonmutationsinBrFAD2-1 positionrelative positionrelative togenomicsequence WT toproteinsequence (SEQIDNO:16) codon AA (SEQIDNO:18) stopcodon 2029-2031 CAA Gln 8 TAA 2179-2181 TGG Trp 58 TAG,TGA,TAA 2263-2265 TGG Trp 86 TAG,TGA,TAA 2275-2277 TGG Trp 90 TAG,TGA,TAA 2284-2286 CAG Gln 93 TAG,TAA 2308-2310 TGG Trp 101 TAG,TGA,TAA 2353-2355 CAG Gln 116 TAG,TAA 2356-2358 TGG Trp 117 TAG,TGA,TAA 2416-2418 TGG Trp 137 TAG,TGA,TAA 2431-2433 CGA Arg 142 TGA,TAA 2506-2508 TGG Trp 167 TAG,TGA,TAA 2560-2562 CAG Gln 185 TAG,TAA 2575-2577 TGG Trp 190 TAG,TGA,TAA 2680-2682 CAG Gln 225 TAG,TAA 2746-2748 CAA Gln 247 TAA 2827-2829 CAG Gln 274 TAG,TAA 2869-2871 TGG Trp 288 TAG,TGA,TAA 2875-2877 TGG Trp 290 TAG,TGA,TAA 3043-3045 CAG Gln 346 TAG,TAA 3076-3078 TGG Trp 357 TAG,TGA,TAA 3118-3120 CAA Gln 371 TAA 3142-3144 TGG Trp 379 TAG,TGA,TAA
TABLE-US-00005 TABLE1e possiblestopcodonmutationsinBoFAD2-1 positionrelative positionrelative togenomicsequence WT toproteinsequence (SEQIDNO:22) codon AA (SEQIDNO:24) stopcodon 2913-2915 CAA Gln 8 TAA 3063-3065 TGG Trp 58 TAG,TGA,TAA 3147-3149 TGG Trp 86 TAG,TGA,TAA 3159-3161 TGG Trp 90 TAG,TGA,TAA 3168-3170 CAA Gln 93 TAA 3192-3194 TGG Trp 101 TAG,TGA,TAA 3237-3239 CAG Gln 116 TAG,TAA 3240-3242 TGG Trp 117 TAG,TGA,TAA 3300-3302 TGG Trp 137 TAG,TGA,TAA 3315-3317 CGA Arg 142 TGA,TAA 3390-3392 TGG Trp 167 TAG,TGA,TAA 3444-3446 CAG Gln 185 TAG,TAA 3459-3461 TGG Trp 190 TAG,TGA,TAA 3564-3566 CAG Gln 225 TAG,TAA 3630-3632 CAG Gln 247 TAG,TAA 3711-3713 CAG Gln 274 TAG,TAA 3753-3755 TGG Trp 288 TAG,TGA,TAA 3759-3761 TGG Trp 290 TAG,TGA,TAA 3927-3929 CAG Gln 346 TAG,TAA 3960-3962 TGG Trp 357 TAG,TGA,TAA 4002-4004 CAA Gln 371 TAA 4026-4028 TGG Trp 379 TAG,TGA,TAA
[0104] Obviously, mutations are not limited to the ones shown in the above tables and it is understood that analogous STOP mutations may be present in fad2 alleles other than those depicted in the sequence listing and referred to in the tables above.
[0105] Not only stopcodon mutations, but also mutations resulting in an amino acid substitution may lead to proteins with reduced functionality or with no detectable activity.
[0106] A missense mutation in an FAD2 allele, as used herein, is any mutation (deletion, insertion or substitution) in a FAD2 allele whereby one or more codons are changed into the coding DNA and the corresponding mRNA sequence of the corresponding wild type FAD2 allele, resulting in the substitution of one or more amino acids in the wild type FAD2 protein for one or more other amino acids in the mutant FAD2 protein. In one embodiment, a full knockout mutant FAD2 allele is provided comprising a missense mutation resulting in a substitution of a Histidine (His) residue at position 109 of the FAD2 protein in SEQ ID NO: 6, or a sequence essentially similar thereto, in particular by a tyrosine (Tyr) residue, such as the HIOL101 allele (Table 2a).
[0107] In another embodiment, said knock-out fad2 gene in Brassica napus is selected from the group consisting of nucleic acids comprising: [0108] a C to T mutation at position 2371 of SEQ ID No. 4; [0109] a G to A mutation at position 3223 of SEQ ID No. 7; [0110] a C to T mutation at position 2057 of SEQ ID No. 10; [0111] a G to A mutation at position 2327 of SEQ ID No. 13
[0112] Wild-type and mutant FAD2 nucleic acid sequences from the A-genome as described herein, such as BnFAD2-A1, BnFAD2-A2, BrFAD2-1, and BrFAD2-2 are also suitable to use in other Brassica species comprising an A genome, such as Brassica juncea.
[0113] Wild-type and mutant FAD2 nucleic acid sequences from the C-genome as described herein, such as BnFAD2-C1, BnFAD2-C2, BoFAD2-1, and BoFAD2-2 are also suitable to use in other Brassica species comprising a C genome, such as Brassica carinata.
[0114] Amino Acid Sequences According to the Invention
[0115] Provided are both wild type FAD2 amino acid sequences and mutant FAD2 amino acid sequences (comprising one or more mutations, preferably mutations which result in a significantly reduced or no biological activity of the FAD2 protein) from Brassicaceae, particularly from Brassica species, especially from Brassica napus, Brassica rapa, and Brassica oleracea. In addition, mutagenesis methods can be used to generate mutations in wild type FAD2 alleles, thereby generating mutant alleles which can encode further mutant FAD2 proteins. In one embodiment the wild type and/or mutant FAD2 amino acid sequences are provided within a Brassica plant (i.e. endogenously). However, isolated FAD2 amino acid sequences (e.g. isolated from the plant or made synthetically), as well as variants thereof and fragments of any of these are also provided herein.
[0116] Amino acid sequences of FAD2-A1, FAD2-C1, FAD2-A1 and FAD2-C2 proteins from Brassica napus, FAD2-1 and FAD2-2 proteins from Brassica rapa, and FAD2-1 and FAD2-2 proteins from Brassica oleracea, have been isolated as depicted in the sequence listing. The wild type FAD2 sequences are depicted, while the mutant FAD2 sequences of these sequences, and of sequences essentially similar to these, are described herein below, with reference to the wild type FAD2 sequences.
[0117] Brassica napus FAD2-A1 amino acid sequences or BnFAD2-A1 amino acid sequences or variant amino acid sequences thereof according to the invention are amino acid sequences having at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 6. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD2 sequences provided in the sequence listing.
[0118] Brassica napus FAD2-C1 amino acid sequences or BnFAD2-C1 amino acid sequences or variant amino acid sequences thereof according to the invention are amino acid sequences having at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 9. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD2 sequences provided in the sequence listing.
[0119] Brassica napus FAD2-A2 amino acid sequences or BnFAD2-A2 amino acid sequences or variant amino acid sequences thereof according to the invention are amino acid sequences having at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 12. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD2 sequences provided in the sequence listing.
[0120] Brassica napus FAD2-C2 amino acid sequences or BnFAD2-C2 amino acid sequences or variant amino acid sequences thereof according to the invention are amino acid sequences having at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 15. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD2 sequences provided in the sequence listing.
[0121] Brassica rapa FAD2-1 amino acid sequences or BrFAD2-1 amino acid sequences or variant amino acid sequences thereof according to the invention are amino acid sequences having at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 18. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD2 sequences provided in the sequence listing.
[0122] Brassica rapa FAD2-2 amino acid sequences or BrFAD2-2 amino acid sequences or variant amino acid sequences thereof according to the invention are amino acid sequences having at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 21. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD2 sequences provided in the sequence listing.
[0123] Brassica oleracea FAD2-1 amino acid sequences or BoFAD2-1 amino acid sequences or variant amino acid sequences thereof according to the invention are amino acid sequences having at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 24. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD2 sequences provided in the sequence listing.
[0124] Brassica oleracea FAD2-2 amino acid sequences or BoFAD2-2 amino acid sequences or variant amino acid sequences thereof according to the invention are amino acid sequences having at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 27. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD2 sequences provided in the sequence listing.
[0125] A FAD2 A1 protein can be a BnFAD2-A1 protein, or can be a BrFAD2-1 protein.
[0126] A FAD2-C1 protein can be a BnFAD2-C1 protein, or can be a BoFAD2-1 protein.
[0127] A FAD2-A2 protein can be a BnFAD2-A2 protein, or can be a BrFAD2-2 protein.
[0128] A FAD2-C2 protein can be a BnFAD2-C2 protein, or can be a BoFAD2-2 protein.
[0129] Thus, the invention provides both amino acid sequences of wild type proteins, including variants and fragments thereof (as defined further below), as well as mutant amino acid sequences of any of these, whereby the mutation in the amino acid sequence preferably results in a significant reduction in or a complete abolishment of the biological activity of the FAD2 protein as compared to the biological activity of the corresponding wild type FAD2 protein.
[0130] Both endogenous and isolated amino acid sequences are provided herein. Also provided are fragments of the FAD2 amino acid sequences and FAD2 variant amino acid sequences defined above. A fragment of a FAD2 amino acid sequence or variant thereof (as defined) may be of various lengths, such as at least 10, 12, 15, 18, 20, 50, 100, 150, 175, 180 contiguous amino acids of the FAD2 sequence (or of the variant sequence).
[0131] Amino Acid Sequences of Wild-Type FAD2 Proteins
[0132] The amino acid sequences depicted in the sequence listing are wild type FAD2 proteins from Brassica napus. Thus, these sequences are endogenous to the Brassica napus plants from which they were isolated. Other Brassica, varieties, breeding lines or wild accessions may be screened for other functional FAD2 proteins with the same amino acid sequences or variants thereof, as described above.
[0133] In addition, it is understood that FAD2 amino acid sequences and variants thereof (or fragments of any of these) may be identified in silico, by screening amino acid databases for essentially similar sequences. Fragments of amino acid molecules according to the invention are also provided.
[0134] Wild-type FAD2 amino acid sequences may encompass amino acid sequences of non-functional FAD2 proteins, such as BnFAD2-A2 and BrFAD2-2 amino acid sequence of SEQ ID NO: 12 and 21, respectively, as described herein, are truncated proteins of 136 amino acids which lack the five TM domains, the three Histidine boxes, and the ER retrieval motif (see
[0135] Amino Acid Sequences of Mutant FAD2 Proteins
[0136] Amino acid sequences comprising one or more amino acid deletions, insertions or substitutions relative to the wild type amino acid sequences are another embodiment of the invention, as are fragments of such mutant amino acid molecules. Such mutant amino acid sequences can be generated and/or identified using various known methods, as described above. Again, such amino acid molecules are provided both in endogenous form and in isolated form.
[0137] In one embodiment, the mutation(s) in the amino acid sequence result in a significantly reduced or completely abolished biological activity of the FAD2 protein relative to the wild type protein. As described above, basically, any mutation which results in a protein comprising at least one amino acid insertion, deletion and/or substitution relative to the wild type protein can lead to significantly reduced or no biological activity.
[0138] Thus in one embodiment, mutant FAD2 proteins are provided comprising one or more deletion or insertion mutations, whereby the deletion(s) or insertion(s) result(s) in a mutant protein which has significantly reduced or no activity. Such mutant FAD2 proteins are FAD2 proteins wherein at least 1, at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 30, at least 50, at least 100, at least 150, at least 200, at least 250, or more amino acids are deleted, inserted or substituted as compared to the wild type FAD2 protein, whereby the deletion(s) or insertion(s) result(s) in a mutant protein which has significantly reduced or no activity.
[0139] In another embodiment, mutant FAD2 proteins are provided which are truncated whereby the truncation results in a mutant protein that has significantly reduced or no activity. Truncated FAD2 proteins with significantly reduced or no activity may be truncated FAD2 proteins lacking at least the third Histidine box, such as FAD2 proteins truncated at a position corresponding to position 315 of SEQ ID NO: 3, or at a position corresponding to position 316 of SEQ ID NO: 6, 9, 15, 18, or 24, or at any position upstream of a position corresponding to position 315 of SEQ ID NO: 3, or at a position corresponding to position 316 of SEQ ID NO: 6, 9, 15, 18, or 24.
[0140] In yet another embodiment, mutant FAD2 proteins are provided comprising one or more substitution mutations, whereby the substitution(s) result(s) in a mutant protein that has significantly reduced or no activity. FAD2 proteins with one or more substitution mutations with significantly reduced or no activity may be FAD2 proteins in which at least one amino acid in at least one of the conserved Histidine boxes is substituted with another amino acid, such as fad2 alleles encoding FAD2 proteins of which one or more of the amino acids at a position corresponding to position 105, 106, 107, 108, 109, 141, 142, 143, 144, 145, 315, 316, 317, 318 or 319 of SEQ ID NO: 3, or corresponding to position 105, 106, 107, 108, 109, 141, 142, 143, 144, 145, 316, 317, 318, 319 or 320 of SEQ ID NO: 6, 9, 15, 18 or 24, is substituted, preferably substituted with a non-conservative amino acid.
[0141] Examples of conservative amino acid substitutions are:
TABLE-US-00006 Conservative Conservative Residue Substitutions Residue Substitutions Ala Ser Leu Ile, Val Arg Lys Lys Arg, Gln Asn Gln, His Met Leu, Ile Asp Glu Phe Met, Leu, Tyr Gln Asn Ser Thr, Gly Cys Ser Thr Ser, Val Glu Asp Trp Tyr Gly Pro Tyr Trp, Phe His Asn, Gln Val Ile, Leu Ile Leu, Val
[0142] Non-conservative amino acids are thus amino acids other than the conservative amino acids.
[0143] In a further embodiment, said mutant FAD2 proteins from Brassica napus are selected from the group consisting of proteins comprising: [0144] a H to Y substitution at position 109 of SEQ ID No. 6; [0145] SEQ ID No. 9 truncated after the amino acid at position 100; [0146] SEQ ID No. 15 truncated after the amino acid at position 189.
[0147] FAD3 Sequences
[0148] Nucleic acid and amino acid sequences of FADS A1, FAD3-A2, FAD3-A3, FAD3-C1, and FAD3-C2 have been described in WO2011/060946 (incorporated herein by reference).
[0149] FAD3-A1 nucleic acid sequences or FAD3-A1 variant nucleic acid sequences according to the invention are nucleic acid sequences encoding an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 38 or nucleic acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 37 or SEQ ID NO: 39. These nucleic acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0150] FAD3-A2 nucleic acid sequences or FAD3-A2 variant nucleic acid sequences according to the invention are nucleic acid sequences encoding an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 41 or nucleic acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 40 or SEQ ID NO: 42. These nucleic acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0151] FADS A3 nucleic acid sequences or FADS A3 variant nucleic acid sequences according to the invention are nucleic acid sequences encoding an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 44 or nucleic acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 43 or SEQ ID NO: 45. These nucleic acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0152] FAD3-C1 nucleic acid sequences or FAD3-C1 variant nucleic acid sequences according to the invention are nucleic acid sequences encoding an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 47 or nucleic acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 46 or SEQ ID NO: 48 These nucleic acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0153] FAD3-C2 nucleic acid sequences or FAD3-C2 variant nucleic acid sequences according to the invention are nucleic acid sequences encoding an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 50 or nucleic acid sequences having at least 80%, at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% or 100% sequence identity with SEQ ID NO: 49 or SEQ ID NO: 51. These nucleic acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0154] FAD3-A1 amino acid sequences or FAD3-A1 variant amino acid sequences according to the invention are amino acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 38. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0155] FAD3-A2 amino acid sequences or FAD3-A2 variant amino acid sequences according to the invention are amino acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 41. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0156] FAD3-A3 amino acid sequences or FAD3-A3 variant amino acid sequences according to the invention are amino acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 44. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0157] FAD3-C1 amino acid sequences or FAD3-C1 variant amino acid sequences according to the invention are amino acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 47. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0158] FAD3-C2 amino acid sequences or FAD3-C2 variant amino acid sequences according to the invention are amino acid sequences having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 98%, 99% or 100% sequence identity with SEQ ID NO: 50. These amino acid sequences may also be referred to as being essentially similar or essentially identical to the FAD3 sequences provided in the sequence listing.
[0159] As used herein, a knock-out fad3 allele is a mutant allele directing a significantly reduced or no functional FAD3 expression, i.e. a significantly reduced amount of functional FAD3 protein or no functional FAD3 protein, in the cell in vivo.
[0160] Examples of knock-out fad3 alleles are described in WO2011/060946 (incorporated herein by reference), and encompass, for example, a knock-out fad2 allele comprising a G to A substitution at a position corresponding to position 2405 of SEQ ID NO: 37; a G to A substitution at a position corresponding to position 3934 of SEQ ID NO: 40; a G to A substitution at a position corresponding to position 2847 of SEQ ID NO: 43; a G to A substitution at a position corresponding to position 2702 of SEQ ID NO: 46; or a G to A substitution at a position corresponding to position 3909 of SEQ ID NO: 49.
[0161] In a further aspect, the Brassica napus plant, or a cell, part, seed or progeny thereof according to the invention has increased levels of C18:1 in the seed oil, such as a level of C18:1 in the seed oil of between about 73% to about 75%, and which maintains normal agronomic development. In another aspect, the Brassica napus plant or a cell, part, seed or progeny thereof, according to the invention, which comprises mutant fad2 alleles and mutant fad3 alleles, has increased levels of C18:1 and decreased levels of C18:3 in the seed oil. Also provided is oil from the seeds according to the invention.
[0162] Another aspect of the invention provides a method for increasing the levels of C18:1 in seed oil while maintaining normal agronomic development, said method comprising introducing a knock-out fad2 allele of a FAD2-A1 gene and a knock-out fad2 allele of a FAD2-C2 gene into a Brassica napus plant, and selecting a Brassica napus plant comprising said knock-out fad2 allele of said FAD2-A1 gene, and said knock-out fad2 allele of said FAD2-C2 gene, which further contains a FAD2-C1 gene of which the fad2 alleles encode a functional FAD2 protein. In a further embodiment, the Brassica plant produced by said method comprises knock-out fad2 alleles of the FAD2-A2 gene.
[0163] Another aspect of the invention provides a method for increasing the levels of C18:1 and decreasing the levels of C18:3 in seed oil while maintaining normal agronomic development, said method comprising introducing a knock-out fad2 allele of a FAD2 A1 gene and a knock-out fad2 allele of a FAD2-C2 gene, and a knock-out fad3 allele of a FAD3-A1 gene, a knock-out fad3 allele of a FAD3-A2 gene, a knock-out fad3 allele of a FAD3-A3 gene, a knock-out fad3 allele of a FAD3-C1 gene, and a knock-out fad3 allele of a FAD3-C2 gene, into a Brassica napus plant, and selecting a Brassica napus plant comprising said knock-out fad2 allele of said FAD2-A1 gene, and said knock-out fad2 allele of said FAD2-C2 gene, said knock-out fad3 allele of said FAD3-A1 gene, said knock-out fad3 allele of said FAD3-A2 gene, said knock-out fad3 allele of said FAD3-A3 gene, said knock-out fad3 allele of said FAD3-C1 gene, and said knock-out fad3 allele of said FAD3-C2 gene, which further contains a FAD2-C1 gene of which the fad2 alleles encode a functional FAD2 protein, and a FAD2-A2 gene of which the fad2 alleles are knock-out fad2 alleles.
[0164] In yet another embodiment, the method according to the invention comprises the step of selecting said Brassica napus plant comprising said knock-out fad2 allele of said FAD2-A1 gene and said knock-out fad2 allele of said FAD2-C2 gene by analyzing genomic DNA from said plant for the presence of at least one molecular marker, wherein at least one molecular marker is linked to said knock-out fad2 allele of said FAD2-A1 gene and wherein at least one molecular marker is linked to said knock-out fad2 allele of said FAD2-C2 gene and, optionally, wherein at least one molecular marker is linked to one or more fad2 alleles of said FAD2-A2 gene or of said FAD2-C1 gene, or to one or more fad3 alleles of said FAD3-A1 gene, said FAD3-A2 gene, said FAD3-A3 gene, said FAD3-C1 gene, or said FAD3-C2 gene.
[0165] C18:1, also referred to as oleic acid, cis-9-octadecenoic, 18:1, 18:1 (n-9), 9c-18:1 or 18:1cis .sup.9 as used herein, refers to a monounsaturated omega-9 fatty acid, with the IUPAC name (9Z)-Octadec-9-enoic acid.
[0166] Increasing the C18:1 levels or increased C18:1 levels in seed oil can be an increase of C18:1 levels with at least 2%, or at least 5%, or at least 8%, or at least 10%, or at least 12%. Said increase is an increase with respect to C18:1 levels as obtained in control plants.
[0167] C18:1 levels of of between about 73% to about 75% can, for example, be C18:1 levels of between 70 and 78%, or between 71 and 77%, or between 72 and 76%, or between 73 and 75%.
[0168] C18:3, also referred to as lonilenic acid or alpha-linolenic acid.
[0169] As used herein, a decreased level of C18:3 refers to a significant reduction in the amount of total alpha-linolenic acid (C18:3) present in the seed oil of a plant as compared to a control plant. The C18:3 seed oil content of said plants comprising decreased level of C18:3 is reduced to below 11% wt, 10% wt, 9% wt, 8% wt, 7.0 wt %, 6.0 wt %, 5.0 wt %, 4.0 wt %, 3.0 wt %, 2.5 wt %, 2.0 wt %, 1.5% wt, 1.0 wt %, 0.5 wt of the total seed oil content.
[0170] C18:1 and C18:3 levels in the seed oil can be measured as described herein, such as, for example, using the methods as described in Examples 4 and 5.
[0171] The control plant as used herein is generally a plant of the same species which has wild-type levels of FAD2 and/or FAD3. Wild-type levels of FAD2 as used herein refers to the typical levels of FAD2 protein in a plant as it most commonly occurs in nature, of which the FAD2 genes are wild-type FAD2 genes. Wild-type levels of FAD3 as used herein refers to the typical levels of FAD3 protein in a plant as it most commonly occurs in nature, of which the FAD3 genes are wild-type FAD3 genes.
[0172] Maintaining normal agronomic development as used herein refers to having agronomic parameters which are not significantly different from a control plant. Maintaining normal agronomic development can, for example, be maintaining yield, or having a yield which is not significantly different from a control plant. Maintaining normal agronomic development can also be having a vigor score which is not significantly different from a control plant. Maintaining normal agronomic development can also be having a score for establishment, vigor, flowering start, flowering end, plant height, maturity, or protein content, or any combination thereof, which is not significantly different from a control plant. Agronomic parameters can be determined, for example, as described herein in Examples 5 and 6.
[0173] A method to introduce a knock-out fad2 allele, may comprise the steps of treating seeds or plant material with a mutagenic chemical substance or with ionizing radiation; identifying plants with a mutated fad2 gene, wherein the FAD2 gene, prior to being mutated, encodes a polypeptide having at least 90% sequence identity to SEQ ID No. 6, to SEQ ID No. 9, to SEQ ID No. 15, SEQ ID NO: 18 or to SEQ ID No. 24; and selecting a plant with an increased level of C18:1 in the seeds compared to a plant in which the FAD2 gene is not mutated.
[0174] Said FAD2 gene, prior to being mutated, can be, for example, a FAD2 gene having at least 90% sequence identity, or at least 95% sequence identity, or at least 98% sequence identity or having 100% sequence identity to SEQ ID No. 4, to SEQ ID No. 7, to SEQ ID No. 13, SEQ ID NO: 16 or to SEQ ID No. 22, or can be a FAD2 gene of which the cDNA has at least 90% sequence identity, or at least 95% sequence identity, or at least 98% sequence identity or has 100% sequence identity to SEQ ID No. 5, to SEQ ID No. 8, to SEQ ID No. 14, SEQ ID NO: 17 or to SEQ ID No. 23.
[0175] Introducing said knock-out allele of FAD2 can also occur through introduction of a knock-out FAD2 allele from one plant into another, for example by crossing a plant comprising said knock-out FAD2 allele with a plant not comprising said knock-out FAD2 allele and identifying progeny plants comprising said knock-out FAD2 allele, optionally using one or more molecular markers.
[0176] Said knock-out fad2 alleles can be introduced into a Brassica napus plant comprising a FAD2-C1 gene of which the FAD2 alleles encode a functional FAD2 protein. Alternatively, both said knock-out fad2 alleles and said FAD2 alleles of said FAD2-C1 gene which encode a functional FAD2 protein can be introduced into a Brassica napus plant.
[0177] In a further embodiment, a method is provided to determine the presence or absence of a knock-out fad2 allele in a biological sample, comprising providing genomic DNA from said biological sample, and analyzing said DNA for the presence of at least one molecular marker, wherein the at least one molecular marker is linked to said knock-out fad2 allele.
[0178] Said genomic DNA can be provided by isolating genomic DNA from said biological sample. Isolating genomic DNA refers to isolating a biological sample comprising genomic DNA from, such as isolating part of a tissue, such as, for example part of a leaf Isolating genomic DNA from said biological sample can, but does not need to comprise, purification of genomic DNA from said sample.
[0179] Yet another embodiment provides a kit for the detection of a knock-out fad2 allele in Brassica DNA samples, wherein said kit comprises one or more PCR primer pairs, which are able to amplify a DNA marker linked to said knock-out fad2 allele.
[0180] Another embodiment provides a method for determining the zygosity status of a knock-out fad2 allele in a plant, or a cell, part, seed or progeny thereof, comprising determining the presence of a knock-out and/or a corresponding wild type FAD2 specific region in the genomic DNA of said plant, or a cell, part, seed or progeny thereof.
[0181] Said knock-out FAD2 allele can be transferred from one plant to another plant comprising the steps of: (a) identifying a first plant comprising at least one knock-out fad2 allele, (b) crossing the first plant with a second plant not comprising the at least one knock-out fad2 allele and collecting F1 hybrid seeds from the cross, (c) optionally, identifying F1 plants comprising the at least one knock-out fad2 allele, (d) backcrossing F1 plants comprising the at least one knock-out fad2 allele with the second plant not comprising the at least one knock-out fad2 allele for at least one generation (x) and collecting BCx seeds from the crosses, and (e) identifying in every generation BCx plants comprising the at least one knock-out fad2 allele by analyzing genomic DNA of said BCx plants for the presence of at least one molecular marker, wherein the at least one molecular marker is linked to said knock-out fad2 allele.
[0182] A molecular marker which is linked to said knock-out allele of a FAD2 gene or said mutant FAD2 allele can comprise on or more primers or probes that specifically detect said knock-out allele of said FAD2 gene as described herein below.
Methods According to the Invention
[0183] Methods are provided for generating and selecting Brarssica napus seed plants comprising a FAD2-A1, a FAD2-A2, a FAD2-C1 and a FAD2-C2 gene, and cells, parts, seeds and progeny thereof, having increased levels of C18:1 in the seeds, knock-out fad2 alleles of the FAD2-A1 and of the FAD2-C2 genes, and wherein the fad2 alleles of said FAD2-C1 gene encode a functional FAD2 protein, and to distinguish between the presence of knockout mutant fad2 alleles, and wild type FAD2 alleles in a plant or plant part having increased C18:1 levels in the seeds. Thus methods are provided (such as mutagenesis and/or marker assisted selection) for generating and/or identifying knockout fad2 alleles or seed plants or plant parts comprising such fad2 alleles and for combining a suitable number of knockout fad2 alleles and/or different types of knockout fad2 alleles in a single seed plant to alter the levels of C18:1 in the seeds of the plants while maintaining normal agronomic development.
[0184] Mutant fad2 alleles may be generated (for example induced by mutagenesis) and/or identified using a range of methods, which are conventional in the art, for example using nucleic acid amplification based methods to amplify part or all of the fad2 genomic or cDNA.
[0185] Following mutagenesis, plants are grown from the treated seeds, or regenerated from the treated cells using known techniques. For instance, mutagenized seeds may be planted in accordance with conventional growing procedures and following self-pollination seed is formed on the plants. Alternatively, doubled haploid plantlets may be extracted from treated microspore or pollen cells to immediately form homozygous plants, for example as described by Coventry et al. (1988, Manual for Microspore Culture Technique for Brassica napus. Dep. Crop Sci. Techn. Bull. OAC Publication 0489. Univ. of Guelph, Guelph, Ontario, Canada). Additional seed which is formed as a result of such self-pollination in the present or a subsequent generation may be harvested and screened for the presence of mutant FAD2 alleles, using techniques which are conventional in the art, for example nucleic acid amplification based techniques, such as polymerase chain reaction (PCR) based techniques (amplification of the fad2 alleles) or hybridization based techniques, e.g. Southern blot analysis, BAC library screening, and the like, and/or direct sequencing of fad2 alleles. To screen for the presence of point mutations (so called Single Nucleotide Polymorphisms or SNPs) in mutant FAD2 alleles, SNP detection methods conventional in the art can be used, for example oligoligation-based techniques, single base extension-based techniques or techniques based on differences in restriction sites, such as TILLING.
[0186] As described above, mutagenization (spontaneous as well as induced) of a specific wild-type FAD2 allele results in the presence of one or more deleted, inserted, or substituted nucleotides (hereinafter called mutation region) in the resulting mutant FAD2 allele. The mutant FAD2 allele can thus be characterized by the location and the configuration of the one or more deleted, inserted, or substituted nucleotides in the wild type FAD2 allele. The site in the wild type FAD2 allele where the one or more nucleotides have been inserted, deleted, or substituted, respectively, is herein also referred to as the mutation region or sequence. A 5 or 3 flanking region or sequence as used herein refers to a DNA region or sequence in the mutant (or the corresponding wild type) FAD2 allele of at least 20 bp, preferably at least 50 bp, at least 750 bp, at least 1500 bp, and up to 5000 bp of DNA different from the DNA containing the one or more deleted, inserted, or substituted nucleotides, preferably DNA from the mutant (or the corresponding wild type) FAD2 allele which is located either immediately upstream of and contiguous with (5 flanking region or sequence) or immediately downstream of and contiguous with (3 flanking region or sequence) the mutation region in the mutant FAD2 allele (or in the corresponding wild type FAD2 allele). A joining region as used herein refers to a DNA region in the mutant (or the corresponding wild type) FAD2 allele where the mutation region and the 5 or 3 flanking region are linked to each other. A sequence spanning the joining region between the mutation region and the 5 or 3 flanking region thus comprises a mutation sequence as well as the flanking sequence contiguous therewith.
[0187] The tools developed to identify a specific mutant FAD2 allele or the plant or plant material comprising a specific mutant FAD2 allele, or products which comprise plant material comprising a specific mutant FAD2 allele are based on the specific genomic characteristics of the specific mutant FAD2 allele as compared to the genomic characteristics of the corresponding wild type FAD2 allele, such as, a specific restriction map of the genomic region comprising the mutation region, molecular markers comprising primers and/or probes as described below, or the sequence of the flanking and/or mutation regions.
[0188] Once a specific mutant FAD2 allele has been sequenced, molecular markers, such as primers and probes can be developed which specifically recognize a sequence within the 5 flanking, 3 flanking and/or mutation regions of the mutant FAD2 allele in the nucleic acid (DNA or RNA) of a sample by way of a molecular biological technique. For instance an amplification method can be developed to identify the mutant FAD2 allele in biological samples (such as samples of plants, plant material or products comprising plant material). Such an amplification is based on at least two specific primers: one recognizing a sequence within the 5 or 3 flanking region of the mutant FAD2 allele and the other recognizing a sequence within the 3 or 5 flanking region of the mutant FAD2 allele, respectively; or one recognizing a sequence within the 5 or 3 flanking region of the mutant FAD2 allele and the other recognizing a sequence within the mutation region of the mutant FAD2 allele; or one recognizing a sequence within the 5 or 3 flanking region of the mutant FAD2 allele and the other recognizing a sequence spanning the joining region between the 3 or 5 flanking region and the mutation region of the specific mutant FAD2 allele (as described further below), respectively.
[0189] The primers preferably have a sequence of between 15 and 35 nucleotides which under optimized amplification conditions specifically recognize a sequence within the 5 or 3 flanking region, a sequence within the mutation region, or a sequence spanning the joining region between the 3 or 5 flanking and mutation regions of the specific mutant FAD2 allele, so that a specific fragment (mutant FAD2 specific fragment or discriminating amplicon) is amplified from a nucleic acid sample comprising the specific mutant FAD2 allele. This means that only the targeted mutant FAD2 allele, and no other sequence in the plant genome, is amplified under optimized amplification conditions.
[0190] PCR primers suitable for the invention may be the following: [0191] oligonucleotides ranging in length from 17 nt to about 200 nt, comprising a nucleotide sequence of at least 17 consecutive nucleotides, preferably 20 consecutive nucleotides selected from the 5 or 3 flanking sequence of a specific mutant FAD2 allele or the complement thereof (i.e., for example, the sequence 5 or 3 flanking the one or more nucleotides deleted, inserted or substituted in the mutant FAD2 alleles of the invention, such as the sequence 5 or 3 flanking the non-sense, mis-sense, frameshift or splice site mutations described above or the sequence 5 or 3 flanking the STOP codon mutations indicated in the above Tables or the substitution mutations indicated above or the complement thereof) (primers recognizing 5 flanking sequences); or [0192] oligonucleotides ranging in length from 17 nt to about 200 nt, comprising a nucleotide sequence of at least 17 consecutive nucleotides, preferably 20 nucleotides selected from the sequence of the mutation region of a specific mutant FAD2 allele or the complement thereof (i.e., for example, the sequence of nucleotides inserted or substituted in the FAD2 genes of the invention or the complement thereof) (primers recognizing mutation sequences).
[0193] The primers may of course be longer than the mentioned 17 consecutive nucleotides, and may e.g. be 18, 19, 20, 21, 30, 35, 50, 75, 100, 150, 200 nt long or even longer. The primers may entirely consist of nucleotide sequence selected from the mentioned nucleotide sequences of flanking and mutation sequences. However, the nucleotide sequence of the primers at their 5 end (i.e. outside of the 3-located 17 consecutive nucleotides) is less critical. Thus, the 5 sequence of the primers may consist of a nucleotide sequence selected from the flanking or mutation sequences, as appropriate, but may contain several (e.g. 1, 2, 5, 10) mismatches. The 5 sequence of the primers may even entirely consist of a nucleotide sequence unrelated to the flanking or mutation sequences, such as e.g. a nucleotide sequence representing restriction enzyme recognition sites. Such unrelated sequences or flanking DNA sequences with mismatches should preferably be no longer than 100, more preferably not longer than 50 or even 25 nucleotides.
[0194] Moreover, suitable primers may comprise or consist of a nucleotide sequence spanning the joining region between flanking and mutation sequences (i.e., for example, the joining region between a sequence 5 or 3 flanking one or more nucleotides deleted, inserted or substituted in the mutant FAD2 alleles of the invention and the sequence of the one or more nucleotides inserted or substituted or the sequence 3 or 5, respectively, flanking the one or more nucleotides deleted, such as the joining region between a sequence 5 or 3 flanking non-sense, missense, frameshift or splice site mutations in the FAD2 genes of the invention described above and the sequence of the non-sense, missense, frameshift or splice site mutations, or the joining region between a sequence 5 or 3 flanking a potential STOP codon mutation as indicated in the above Tables or the substitution mutations indicated above and the sequence of the potential STOP codon mutation or the substitution mutations, respectively), provided the nucleotide sequence is not derived exclusively from either the mutation region or flanking regions.
[0195] It will also be immediately clear to the skilled artisan that properly selected PCR primer pairs should also not comprise sequences complementary to each other.
[0196] For the purpose of the invention, the complement of a nucleotide sequence represented in SEQ ID No: X is the nucleotide sequence which can be derived from the represented nucleotide sequence by replacing the nucleotides through their complementary nucleotide according to Chargaff's rules (A.Math.T; G.Math.C) and reading the sequence in the 5 to 3 direction, i.e. in opposite direction of the represented nucleotide sequence.
[0197] Examples of primers suitable to identify specific mutant FAD2 alleles are described in the Examples.
[0198] As used herein, the nucleotide sequence of SEQ ID No. Z from position X to position Y indicates the nucleotide sequence including both nucleotide endpoints.
[0199] Preferably, the amplified fragment has a length of between 50 and 1000 nucleotides, such as a length between 50 and 500 nucleotides, or a length between 100 and 350 nucleotides. The specific primers may have a sequence which is between 80 and 100% identical to a sequence within the 5 or 3 flanking region, to a sequence within the mutation region, or to a sequence spanning the joining region between the 3 or 5 flanking and mutation regions of the specific mutant FAD2 allele, provided the mismatches still allow specific identification of the specific mutant FAD2 allele with these primers under optimized amplification conditions. The range of allowable mismatches however, can easily be determined experimentally and are known to a person skilled in the art.
[0200] Detection and/or identification of a mutant FAD2 specific fragment can occur in various ways, e.g., via size estimation after gel or capillary electrophoresis or via fluorescence-based detection methods. The mutant FAD2 specific fragments may also be directly sequenced. Other sequence specific methods for detection of amplified DNA fragments are also known in the art.
[0201] Standard nucleic acid amplification protocols, such as PCR protocols are described in the art, such as in PCR Applications Manual (Roche Molecular Biochemicals, 2nd Edition, 1999) and other references. The optimal conditions for the amplification, including the sequence of the specific primers, is specified in a PCR identification protocol for each specific mutant FAD2 allele. It is however understood that a number of parameters in the PCR identification protocol may need to be adjusted to specific laboratory conditions, and may be modified slightly to obtain similar results. For instance, use of a different method for preparation of DNA may require adjustment of, for instance, the amount of primers, polymerase, MgCl.sub.2 concentration or annealing conditions used. Similarly, the selection of other primers may dictate other optimal conditions for the PCR identification protocol. These adjustments will however be apparent to a person skilled in the art, and are furthermore detailed in current PCR application manuals such as the one cited above.
[0202] Alternatively, specific primers can be used to amplify a mutant FAD2 specific fragment that can be used as a specific probe for identifying a specific mutant FAD2 allele in biological samples. Contacting nucleic acid of a biological sample, with the probe, under conditions that allow hybridization of the probe with its corresponding fragment in the nucleic acid, results in the formation of a nucleic acid/probe hybrid. The formation of this hybrid can be detected (e.g. labeling of the nucleic acid or probe), whereby the formation of this hybrid indicates the presence of the specific mutant FAD2 allele. Such identification methods based on hybridization with a specific probe (either on a solid phase carrier or in solution) have been described in the art. The specific probe is preferably a sequence that, under optimized conditions, hybridizes specifically to a region within the 5 or 3 flanking region and/or within the mutation region of the specific mutant FAD2 allele (hereinafter referred to as mutant FAD2 specific region). Preferably, the specific probe comprises a sequence of between 10 and 1000 bp, 50 and 600 bp, between 100 to 500 bp, between 150 to 350 bp, which is at least 80%, preferably between 80 and 85%, more preferably between 85 and 90%, especially preferably between 90 and 95%, most preferably between 95% and 100% identical (or complementary) to the nucleotide sequence of a specific region. Preferably, the specific probe will comprise a sequence of about 13 to about 100 contiguous nucleotides identical (or complementary) to a specific region of the specific mutant FAD2 allele.
[0203] Specific probes suitable for the invention may be the following: [0204] oligonucleotides ranging in length from 13 nt to about 1000 nt, comprising a nucleotide sequence of at least 13 consecutive nucleotides selected from the 5 or 3 flanking sequence of a specific mutant FAD2 allele or the complement thereof (i.e., for example, the sequence 5 or 3 flanking the one or more nucleotides deleted, inserted or substituted in the mutant FAD2 alleles of the invention, such as the sequence 5 or 3 flanking the non-sense, mis-sense, frameshift or splice site mutations described above or the sequence 5 or 3 flanking the potential STOP codon mutations indicated in the above Tables or the substitution mutations indicated above), or a sequence having at least 80% sequence identity therewith (probes recognizing 5 flanking sequences); or [0205] oligonucleotides ranging in length from 13 nt to about 1000 nt, comprising a nucleotide sequence of at least 13 consecutive nucleotides selected from the mutation sequence of a specific mutant FAD2 allele or the complement thereof (i.e., for example, the sequence of nucleotides inserted or substituted in the FAD2 genes of the invention, or the complement thereof), or a sequence having at least 80% sequence identity therewith (probes recognizing mutation sequences).
[0206] The probes may entirely consist of nucleotide sequence selected from the mentioned nucleotide sequences of flanking and mutation sequences. However, the nucleotide sequence of the probes at their 5 or 3 ends is less critical. Thus, the 5 or 3 sequences of the probes may consist of a nucleotide sequence selected from the flanking or mutation sequences, as appropriate, but may consist of a nucleotide sequence unrelated to the flanking or mutation sequences. Such unrelated sequences should preferably be no longer than 50, more preferably not longer than 25 or even no longer than 20 or 15 nucleotides.
[0207] Moreover, suitable probes may comprise or consist of a nucleotide sequence spanning the joining region between flanking and mutation sequences (i.e., for example, the joining region between a sequence 5 or 3 flanking one or more nucleotides deleted, inserted or substituted in the mutant FAD2 alleles of the invention and the sequence of the one or more nucleotides inserted or substituted or the sequence 3 or 5, respectively, flanking the one or more nucleotides deleted, such as the joining region between a sequence 5 or 3 flanking non-sense, mis-sense, frameshift or splice site mutations in the FAD2 genes of the invention described above and the sequence of the non-sense, mis-sense, frameshift or splice site mutations, or the joining region between a sequence 5 or 3 flanking a potential STOP codon mutation as indicated in the above Tables or the substitution mutations indicated above and the sequence of the potential STOP codon or substitution mutation, respectively), provided the mentioned nucleotide sequence is not derived exclusively from either the mutation region or flanking regions.
[0208] Examples of specific probes suitable to identify specific mutant fad2 alleles are described in the Examples.
[0209] Detection and/or identification of a mutant FAD2 specific region hybridizing to a specific probe can occur in various ways, e.g., via size estimation after gel electrophoresis or via fluorescence-based detection methods. Other sequence specific methods for detection of a mutant FAD2 specific region hybridizing to a specific probe are also known in the art.
[0210] Alternatively, plants or plant parts comprising one or more mutant fad2 alleles can be generated and identified using other methods, such as the Delete-a-Gene method which uses PCR to screen for deletion mutants generated by fast neutron mutagenesis (reviewed by Li and Zhang, 2002, Funct Integr Genomics 2:254-258), by the TILLING (Targeting Induced Local Lesions IN Genomes) method which identifies EMS-induced point mutations using denaturing high-performance liquid chromatography (DHPLC) to detect base pair changes by heteroduplex analysis (McCallum et al., 2000, Nat Biotech 18:455, and McCallum et al. 2000, Plant Physiol. 123, 439-442), etc. As mentioned, TILLING uses high-throughput screening for mutations (e.g. using Cel 1 cleavage of mutant-wildtype DNA heteroduplexes and detection using a sequencing gel system). Thus, the use of TILLING to identify plants or plant parts comprising one or more mutant fad2 alleles and methods for generating and identifying such plants, plant organs, tissues and seeds is encompassed herein. Thus in one embodiment, the method according to the invention comprises the steps of mutagenizing plant seeds (e.g. EMS mutagenesis), pooling of plant individuals or DNA, PCR amplification of a region of interest, heteroduplex formation and high-throughput detection, identification of the mutant plant, sequencing of the mutant PCR product. It is understood that other mutagenesis and selection methods may equally be used to generate such mutant plants.
[0211] Instead of inducing mutations in FAD2 alleles, natural (spontaneous) mutant alleles may be identified by methods known in the art. For example, ECOTILLING may be used (Henikoff et al. 2004, Plant Physiology 135(2):630-6) to screen a plurality of plants or plant parts for the presence of natural mutant fad2 alleles. As for the mutagenesis techniques above, preferably Brassica species are screened which comprise an A and/or a C genome, so that the identified fad2 allele can subsequently be introduced into other Brassica species, such as Brassica napus, by crossing (inter- or intraspecific crosses) and selection. In ECOTILLING natural polymorphisms in breeding lines or related species are screened for by the TILLING methodology described above, in which individual or pools of plants are used for PCR amplification of the fad2 target, heteroduplex formation and high-throughput analysis. This can be followed by selecting individual plants having a required mutation that can be used subsequently in a breeding program to incorporate the desired mutant allele.
[0212] The identified mutant alleles can then be sequenced and the sequence can be compared to the wild type allele to identify the mutation(s). Optionally functionality can be tested as indicated above. Using this approach a plurality of mutant fad2 alleles (and Brassica plants comprising one or more of these) can be identified. The desired mutant alleles can then be combined with the desired wild type alleles by crossing and selection methods as described further below. Finally a single plant comprising the desired number of mutant fad2 and the desired number of wild type FAD2 alleles is generated.
[0213] Oligonucleotides suitable as PCR primers or specific probes for detection of a specific mutant FAD2 allele can also be used to develop methods to determine the zygosity status of the specific mutant FAD2 allele.
[0214] To determine the zygosity status of a specific mutant FAD2 allele, a nucleic acid amplification-based assay can be developed to determine the presence of a mutant and/or corresponding wild type FAD2 specific allele:
[0215] To determine the zygosity status of a specific mutant FAD2 allele, two primers specifically recognizing the wild-type FAD2 allele can be designed in such a way that they are directed towards each other and have the mutation region located in between the primers. These primers may be primers specifically recognizing the 5 and 3 flanking sequences, respectively. This set of primers allows simultaneous diagnostic amplification of the mutant, as well as of the corresponding wild type FAD2 allele.
[0216] Alternatively, to determine the zygosity status of a specific mutant FAD2 allele, two primers specifically recognizing the wild-type FAD2 allele can be designed in such a way that they are directed towards each other and that one of them specifically recognizes the mutation region. These primers may be primers specifically recognizing the sequence of the 5 or 3 flanking region and the mutation region of the wild type FAD2 allele, respectively. This set of primers, together with a third primer which specifically recognizes the sequence of the mutation region in the mutant FAD2 allele, allow simultaneous diagnostic amplification of the mutant FAD2 gene, as well as of the wild type FAD2 gene.
[0217] Alternatively, to determine the zygosity status of a specific mutant FAD2 allele, two primers specifically recognizing the wild-type FAD2 allele can be designed in such a way that they are directed towards each other and that one of them specifically recognizes the joining region between the 5 or 3 flanking region and the mutation region. These primers may be primers specifically recognizing the 5 or 3 flanking sequence and the joining region between the mutation region and the 3 or 5 flanking region of the wild type FAD2 allele, respectively. This set of primers, together with a third primer which specifically recognizes the joining region between the mutation region and the 3 or 5 flanking region of the mutant FAD2 allele, respectively, allow simultaneous diagnostic amplification of the mutant FAD2 gene, as well as of the wild type FAD2 gene.
[0218] Alternatively, the zygosity status of a specific mutant FAD2 allele can be determined by using alternative primer sets that specifically recognize mutant and wild type FAD2 alleles.
[0219] If the plant is homozygous for the mutant FAD2 gene or the corresponding wild type FAD2 gene, the diagnostic amplification assays described above will give rise to a single amplification product typical, preferably typical in length, for either the mutant or wild type FAD2 allele. If the plant is heterozygous for the mutant FAD2 allele, two specific amplification products will appear, reflecting both the amplification of the mutant and the wild type FAD2 allele.
[0220] Identification of the wild type and mutant FAD2 specific amplification products can occur e.g. by size estimation after gel or capillary electrophoresis (e.g. for mutant FAD2 alleles comprising a number of inserted or deleted nucleotides which results in a size difference between the fragments amplified from the wild type and the mutant FAD2 allele, such that said fragments can be visibly separated on a gel); by evaluating the presence or absence of the two different fragments after gel or capillary electrophoresis, whereby the diagnostic amplification of the mutant FAD2 allele can, optionally, be performed separately from the diagnostic amplification of the wild type FAD2 allele; by direct sequencing of the amplified fragments; or by fluorescence-based detection methods.
[0221] Examples of primers suitable to determine the zygosity of specific mutant FAD2 alleles are described in the Examples.
[0222] Alternatively, to determine the zygosity status of a specific mutant FAD2 allele, a hybridization-based assay can be developed to determine the presence of a mutant and/or corresponding wild type FAD2 specific allele:
[0223] To determine the zygosity status of a specific mutant FAD2 allele, two specific probes recognizing the wild-type FAD2 allele can be designed in such a way that each probe specifically recognizes a sequence within the FAD2 wild type allele and that the mutation region is located in between the sequences recognized by the probes. These probes may be probes specifically recognizing the 5 and 3 flanking sequences, respectively. The use of one or, preferably, both of these probes allows simultaneous diagnostic hybridization of the mutant, as well as of the corresponding wild type FAD2 allele.
[0224] Alternatively, to determine the zygosity status of a specific mutant FAD2 allele, two specific probes recognizing the wild-type FAD2 allele can be designed in such a way that one of them specifically recognizes a sequence within the FAD2 wild type allele upstream or downstream of the mutation region, preferably upstream of the mutation region, and that one of them specifically recognizes the mutation region. These probes may be probes specifically recognizing the sequence of the 5 or 3 flanking region, preferably the 5 flanking region, and the mutation region of the wild type FAD2 allele, respectively. The use of one or, preferably, both of these probes, optionally, together with a third probe which specifically recognizes the sequence of the mutation region in the mutant FAD2 allele, allow diagnostic hybridization of the mutant and of the wild type FAD2 gene.
[0225] Alternatively, to determine the zygosity status of a specific mutant FAD2 allele, a specific probe recognizing the wild-type FAD2 allele can be designed in such a way that the probe specifically recognizes the joining region between the 5 or 3 flanking region, preferably the 5 flanking region, and the mutation region of the wild type FAD2 allele. This probe, optionally, together with a second probe that specifically recognizes the joining region between the 5 or 3 flanking region, preferably the 5 flanking region, and the mutation region of the mutant FAD2 allele, allows diagnostic hybridization of the mutant and of the wild type FAD2 gene.
[0226] Alternatively, the zygosity status of a specific mutant FAD2 allele can be determined by using alternative sets of probes that specifically recognize mutant and wild type FAD2 alleles.
[0227] If the plant is homozygous for the mutant FAD2 gene or the corresponding wild type FAD2 gene, the diagnostic hybridization assays described above will give rise to a single specific hybridization product, such as one or more hybridizing DNA (restriction) fragments, typical, preferably typical in length, for either the mutant or wild type FAD2 allele. If the plant is heterozygous for the mutant FAD2 allele, two specific hybridization products will appear, reflecting both the hybridization of the mutant and the wild type FAD2 allele.
[0228] Identification of the wild type and mutant FAD2 specific hybridization products can occur e.g. by size estimation after gel or capillary electrophoresis (e.g. for mutant FAD2 alleles comprising a number of inserted or deleted nucleotides which results in a size difference between the hybridizing DNA (restriction) fragments from the wild type and the mutant FAD2 allele, such that said fragments can be visibly separated on a gel); by evaluating the presence or absence of the two different specific hybridization products after gel or capillary electrophoresis, whereby the diagnostic hybridization of the mutant FAD2 allele can, optionally, be performed separately from the diagnostic hybridization of the wild type FAD2 allele; by direct sequencing of the hybridizing DNA (restriction) fragments; or by fluorescence-based detection methods.
[0229] Furthermore, detection methods specific for a specific mutant FAD2 allele that differ from PCR- or hybridization-based amplification methods can also be developed using the specific mutant FAD2 allele specific sequence information provided herein. Such alternative detection methods include linear signal amplification detection methods based on invasive cleavage of particular nucleic acid structures, also known as Invader technology, (as described e.g. in U.S. Pat. No. 5,985,557 Invasive Cleavage of Nucleic Acids, U.S. Pat. No. 6,001,567 Detection of Nucleic Acid sequences by Invader Directed Cleavage, incorporated herein by reference), RT-PCR-based detection methods, such as Taqman, or other detection methods, such as SNPlex. Briefly, in the Invader technology, the target mutation sequence may e.g. be hybridized with a labeled first nucleic acid oligonucleotide comprising the nucleotide sequence of the mutation sequence or a sequence spanning the joining region between the 5 flanking region and the mutation region and with a second nucleic acid oligonucleotide comprising the 3 flanking sequence immediately downstream and adjacent to the mutation sequence, wherein the first and second oligonucleotide overlap by at least one nucleotide. The duplex or triplex structure that is produced by this hybridization allows selective probe cleavage with an enzyme (Cleavase) leaving the target sequence intact. The cleaved labeled probe is subsequently detected, potentially via an intermediate step resulting in further signal amplification.
[0230] A kit, as used herein, refers to a set of reagents for the purpose of performing the method of the invention, more particularly, the identification of a specific mutant FAD2 allele in biological samples or the determination of the zygosity status of plant material comprising a specific mutant FAD2 allele. More particularly, a preferred embodiment of the kit of the invention comprises at least two specific primers, as described above, for identification of a specific mutant FAD2 allele, or at least two or three specific primers for the determination of the zygosity status. Optionally, the kit can further comprise any other reagent described herein in the PCR identification protocol. Alternatively, according to another embodiment of this invention, the kit can comprise at least one specific probe, which specifically hybridizes with nucleic acid of biological samples to identify the presence of a specific mutant FAD2 allele therein, as described above, for identification of a specific mutant FAD2 allele, or at least two or three specific probes for the determination of the zygosity status. Optionally, the kit can further comprise any other reagent (such as but not limited to hybridizing buffer, label) for identification of a specific mutant FAD2 allele in biological samples, using the specific probe.
[0231] The kit of the invention can be used, and its components can be specifically adjusted, for purposes of quality control (e.g., purity of seed lots), detection of the presence or absence of a specific mutant FAD2 allele in plant material or material comprising or derived from plant material, such as but not limited to food or feed products.
[0232] The term primer as used herein encompasses any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process, such as PCR. Typically, primers are oligonucleotides from 10 to 30 nucleotides, but longer sequences can be employed. Primers may be provided in double-stranded form, though the single-stranded form is preferred. Probes can be used as primers, but are designed to bind to the target DNA or RNA and need not be used in an amplification process.
[0233] The term recognizing as used herein when referring to specific primers, refers to the fact that the specific primers specifically hybridize to a nucleic acid sequence in a specific mutant FAD2 allele under the conditions set forth in the method (such as the conditions of the PCR identification protocol), whereby the specificity is determined by the presence of positive and negative controls.
[0234] The term hybridizing, as used herein when referring to specific probes, refers to the fact that the probe binds to a specific region in the nucleic acid sequence of a specific mutant FAD2 allele under standard stringency conditions. Standard stringency conditions as used herein refers to the conditions for hybridization described herein or to the conventional hybridizing conditions as described by Sambrook et al., 1989 (Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbour Laboratory Press, NY) which for instance can comprise the following steps: 1) immobilizing plant genomic DNA fragments or BAC library DNA on a filter, 2) prehybridizing the filter for 1 to 2 hours at 65 C. in 6SSC, 5Denhardt's reagent, 0.5% SDS and 20 g/ml denaturated carrier DNA, 3) adding the hybridization probe which has been labeled, 4) incubating for 16 to 24 hours, 5) washing the filter once for 30 min. at 68 C. in 6SSC, 0.1% SDS, 6) washing the filter three times (two times for 30 min. in 30 ml and once for 10 min in 500 ml) at 68 C. in 2SSC, 0.1% SDS, and 7) exposing the filter for 4 to 48 hours to X-ray film at 70 C.
[0235] As used in herein, a biological sample is a sample of a plant, plant material or product comprising plant material. The term plant is intended to encompass plant tissues, at any stage of maturity, as well as any cells, tissues, or organs taken from or derived from any such plant, including without limitation, any seeds, leaves, stems, flowers, roots, single cells, gametes, cell cultures, tissue cultures or protoplasts. Plant material, as used herein refers to material that is obtained or derived from a plant. Products comprising plant material relate to food, feed or other products that are produced using plant material or can be contaminated by plant material. It is understood that, in the context of the present invention, such biological samples are tested for the presence of nucleic acids specific for a specific mutant FAD2 allele, implying the presence of nucleic acids in the samples. Thus the methods referred to herein for identifying a specific mutant FAD2 allele in biological samples, relate to the identification in biological samples of nucleic acids that comprise the specific mutant FAD2 allele.
[0236] In another embodiment, a method is provided for combining at least one knock-out fad2 allele of a FAD2 A1 gene, with at least one knock-out fad2 allele of a FAD2-C2 gene in a single Brassica napus plant, said method comprising a) generating and/or identifying two or more plants each comprising one or more selected knock-out fad2 alleles; b) crossing a first plant comprising one or more selected knockout fad2 alleles with a second plant comprising one or more other selected knockout fad2 alleles; c) collecting seeds from the cross, and, optionally, identifying a plant comprising at least one knock-out fad2 allele of a FAD2-A1 gene and at least one knock-out fad2 allele of a FAD2-C2 gene; and, optionally d) repeat steps b) and c) until a plant comprising at least one knock-out fad2 allele of a FAD2-A1 gene and at least one knock-out fad2 allele of a FAD2-C2 gene, is obtained. In another embodiment, said plant obtained in step d) comprising at least one knock-out fad2 allele of a FAD2-A1 gene and at least one knock-out fad2 allele of a FAD2-C2 gene, comprises a FAD2-C1 gene of which the fad2 alleles encode a functional FAD2 protein and comprises a FAD2-A2 gene of which the fad2 alleles are knock-out fad2 alleles.
[0237] Levels of C18:1 in seed of a Brassica plant can be increased by generating and/or selecting a Brassica napus plant comprising a FAD2-A1, a FAD2-A2, a FAD2-C1 and a FAD2-C2 gene, wherein said plant comprises knock-out fad2 alleles of the FAD2-A1 and of the FAD2-C2 genes, and wherein the fad2 alleles of said FAD2-C1 gene encode a functional FAD2 protein, as described above, and selecting a plant with increased levels of C18:1 in the seeds, while maintaining normal agronomic development.
[0238] A hybrid Brassica napus plant or seed comprising four FAD2 genes having increased levels of C18:1 while maintaining normal agronomic development, can be made by generating and/or identifying a first plant comprising a knockout fad2 allele of a FAD2-A1 gene, a knock-out allele of a FAD2-C2 gene, and a FAD2 allele of a FAD2-C1 gene which encodes a functional protein, in homozygous state and a second plant comprising a knockout fad2 allele of a FAD2 A1 gene, a knock-out allele of a FAD2-C2 gene, and a FAD2 allele of a FAD2-C1 gene which encodes a functional protein in homozygous state, as described above, crossing the first and the second plant and collecting F1 hybrid seeds from the cross comprising said fad2 alleles.
[0239] Knockout fad2 alleles according to the invention can be combined according to standard breeding techniques.
[0240] Knockout fad2 alleles can, for example, be transferred from one Brassica plant to another by a) generating and/or identifying a first plant comprising one or more selected knockout fad2 alleles, as described above, or generating the first plant by combining the one or more selected knockout fad2 alleles in one plant, as described above (wherein the first plant is homozygous or heterozygous for the one or more knockout fad2 alleles), b) crossing the first plant comprising the one or more knockout fad2 alleles with a second plant not comprising the one or more knockout fad2 alleles, collecting F1 seeds from the cross (wherein the seeds are heterozygous for a knockout fad2 allele if the first plant was homozygous for that knockout fad2 allele, and wherein half of the seeds are heterozygous and half of the seeds are azygous for, i.e. do not comprise, a knockout fad2 allele if the first plant was heterozygous for that knockout fad2 allele), and, optionally, identifying F1 plants comprising one or more selected knockout fad2 alleles, as described above, c) backcrossing F1 plants comprising one or more selected knockout fad2 alleles with the second plant not comprising the one or more selected knockout fad2 alleles for one or more generations (x), collecting BCx seeds from the crosses, and identifying in every generation BCx plants comprising the one or more selected knockout fad2 alleles, as described above, d) optionally, generating BCx plants which are homozygous for the one or more selected knockout fad2 alleles by performing one of the following steps: [0241] extracting doubled haploid plants from treated microspore or pollen cells of BCx plants comprising the one or more desired knockout fad2 allele(s), as described above, [0242] selfing the BCx plants comprising the one or more desired knockout fad2 allele(s) for one or more generations (y), collecting BCx Sy seeds from the selfings, and identifying BCx Sy plants, which are homozygous for the one or more desired knockout fad2 allele, as described above.
[0243] The first and the second Brassica plant can be Brassica napus plants. Alternatively, the first plant can be a Brassica napus plant, and the second plant can be a Brassica napus breeding line. Breeding line, as used herein, is a preferably homozygous plant line distinguishable from other plant lines by a preferred genotype and/or phenotype that is used to produce hybrid offspring.
[0244] In a further aspect of the invention, a knock-out fad2 allele of a FAD2 gene is provided, wherein the knock-out fad2 allele is a mutated version of the native FAD2 gene, wherein the native FAD2 gene is selected from the group consisting of: (a) a FAD2-A1 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 4, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 5, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 6; and (b) a FAD2-C2 gene comprising a sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 13, or having a cDNA sequence having at least 90% sequence identity to the sequence of SEQ ID NO: 14, or encoding a protein having at least 90% sequence identity to the sequence of SEQ ID NO: 15, such as a knock-out fad2 allele which is a mutant allele of said FAD2-A1 gene comprising a C to T substitution at a position corresponding to position 2371 of SEQ ID NO: 4; or which is a mutant allele of said FAD2-C2 gene comprising a G to A substitution at a position corresponding to position 2327 of SEQ ID NO: 52.
[0245] In a further embodiment, a method is provided for producing oil, comprising harvesting seeds from the plants according to the invention, i.e. plants comprising a the knock-out FAD2 genes of the invention, and extracting the oil from said seeds.
[0246] In yet a further embodiment, a method is provided of producing food or feed, such as oil, meal, grain, starch, flour or protein, or an industrial product, such as biofuel, fiber, industrial chemicals, a pharmaceutical or a neutraceutical, comprising obtaining the plant or a part thereof according to the invention, and preparing the food, feed or industrial product from the plant or part thereof.
[0247] Another embodiment provides the use of the knock-out fad2 allele according to the invention to increase the level of C18:1 in the seed oil of a Brassica napus plant while maintaining normal agronomic development. Yet another embodiment provides a method to produce a Brassica napus plant comprising an increased level of C18:1 in the seed oil and which maintains normal agronomic development, said method comprising sowing seeds according to the invention and growing plants from said seeds.
[0248] Plants according to the invention, such as plants comprising the knock-out FAD2 genes according to the invention can further be used to produce seeds, such as seeds with increased levels of C18:1, or to produce seed oil with increased levels of C18:1.
[0249] The plants according to the invention may additionally contain an endogenous or a transgene, which confers herbicide resistance, such as the bar or pat gene, which confer resistance to glufosinate ammonium (Liberty, Basta or Ignite) [EP 0 242 236 and EP 0 242 246 incorporated by reference]; or any modified EPSPS gene, such as the 2mEPSPS gene from maize [EP 0 508 909 and EP 0 507 698 incorporated by reference], or glyphosate acetyltransferase, or glyphosate oxidoreductase, which confer resistance to glyphosate (RoundupReady), or bromoxynitril nitrilase to confer bromoxynitril tolerance, or any modified AHAS gene, which confers tolerance to sulfonylureas, imidazolinones, sulfonylaminocarbonyltriazolinones, triazolopyrimidines or pyrimidyl(oxy/thio)benzoates, such as oilseed rape imidazolinone-tolerant mutants PM1 and PM2, currently marketed as Clearfield canola. Further, the plants according to the invention may additionally contain an endogenous or a transgene which confers increased oil content or improved oil composition, such as a 12:0 ACP thioesteraseincrease to obtain high laureate, which confers pollination control, such as barnase under control of an anther-specific promoter to obtain male sterility, or barstar under control of an anther-specific promoter to confer restoration of male sterility, or such as the Ogura cytoplasmic male sterility and nuclear restorer of fertility.
[0250] The plants and seeds according to the invention may be further treated with a chemical compound, such as a chemical compound selected from the following lists: Herbicides: Clethodim, Clopyralid, Diclofop, Ethametsulfuron, Fluazifop, Glufosinate, Glyphosate, Metazachlor, Quinmerac, Quizalofop, Tepraloxydim, Trifluralin. Fungicides/PGRs: Azoxystrobin, N-[9-(dichloromethylene)-1,2,3,4-tetrahydro-1,4-methanonaphthalen-5-yl]-3-(difluoromethyl)-1-methyl-1H-pyrazole-4-carboxamide (Benzovindiflupyr, Benzodiflupyr), Bixafen, Boscalid, Carbendazim, Carboxin, Chlormequat-chloride, Coniothryrium minitans, Cyproconazole, Cyprodinil, Difenoconazole, Dimethomorph, Dimoxystrobin, Epoxiconazole, Famoxadone, Fluazinam, Fludioxonil, Fluopicolide, Fluopyram, Fluoxastrobin, Fluquinconazole, Flusilazole, Fluthianil, Flutriafol, Fluxapyroxad, Iprodione, Isopyrazam, Mefenoxam, Mepiquat-chloride, Metalaxyl, Metconazole, Metominostrobin, Paclobutrazole, Penflufen, Penthiopyrad, Picoxystrobin, Prochloraz, Prothioconazole, Pyraclostrobin, Sedaxane, Tebuconazole, Tetraconazole, Thiophanate-methyl, Thiram, Triadimenol, Trifloxystrobin, Bacillus firmus, Bacillus firmus strain 1-1582, Bacillus subtilis, Bacillus subtilis strain GB03, Bacillus subtilis strain QST 713, Bacillus pumulis, Bacillus. pumulis strain GB34.
[0251] Insecticides: Acetamiprid, Aldicarb, Azadirachtin, Carbofuran, Chlorantraniliprole (Rynaxypyr), Clothianidin, Cyantraniliprole (Cyazypyr), (beta-)Cyfluthrin, gamma-Cyhalothrin, lambda-Cyhalothrin, Cypermethrin, Deltamethrin, Dimethoate, Dinetofuran, Ethiprole, Flonicamid, Flubendiamide, Fluensulfone, Fluopyram, Flupyradifurone, tau-Fluvalinate, Imicyafos, Imidacloprid, Metaflumizone, Methiocarb, Pymetrozine, Pyrifluquinazon, Spinetoram, Spinosad, Spirotetramate, Sulfoxaflor, Thiacloprid, Thiamethoxam, 1-(3-chloropyridin-2-yl)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3-{[5-(trifluoromethyl)-2H-tetrazol-2-yl]methyl}-1H-pyrazole-5-carboxamide, 1-(3-chloropyridin-2-yl)-N-[4-cyano-2-methyl-6-(methylcarbamoyl)phenyl]-3-{[5-(trifluoromethyl)-1H-tetrazol-1-yl]methyl}-1H-pyrazole-5-carboxamide, 1-{2-fluoro-4-methyl-5-[(2,2,2-trifluorethyl)sulfinyl]phenyl}-3-(trifluoromethyl)-1H-1,2,4-triazol-5-amine, (1E)-N-[(6-chloropyridin-3-yl)methyl]-N-cyano-N-(2,2-difluoroethyl)ethanimidamide, Bacillus firmus, Bacillus firmus strain I-1582, Bacillus subtilis, Bacillus subtilis strain GB03, Bacillus subtilis strain QST 713, Metarhizium anisopliae F52.
[0252] In some embodiments, the plant cells of the invention, i.e. a plant cell comprising a knock-out fad2 gene, as well as plant cells generated according to the methods of the invention, may be non-propagating cells.
[0253] The obtained plants according to the invention can be used in a conventional breeding scheme to produce more plants with the same characteristics or to introduce the characteristic according to the invention in other varieties of the same or related plant species, or in hybrid plants. The obtained plants can further be used for creating propagating material. Plants according to the invention can further be used to produce gametes, seeds (including crushed seeds and seed cakes), seed oil, embryos, either zygotic or somatic, progeny, or to produce food or feed, such as oil, meal, grain, starch, flour or protein, or an industrial product, such as biofuel, fiber, industrial chemicals, a pharmaceutical or a neutraceutical, or to produce hybrids of plants obtained by methods of the invention.
[0254] All patents, patent applications, and publications or public disclosures (including publications on internet) referred to or cited herein are incorporated by reference in their entirety.
[0255] The sequence listing contained in the file named BCS15-2004-WO1_ST25.txt, which is 198 kilobytes (size as measured in Microsoft Windows), contains 51 sequences SEQ ID NO: 1 through SEQ ID NO: 51 and is filed herewith by electronic submission and is incorporated by reference herein.
[0256] In the description and examples, reference is made to the following sequences:
SEQUENCES
[0257] SEQ ID No. 1: Genomic DNA sequence of FAD2 from Arabidopsis thaliana.
[0258] SEQ ID No. 2: cDNA sequence of FAD2 from Arabidopsis thaliana.
[0259] SEQ ID No. 3: protein sequence of FAD2 from Arabidopsis thaliana.
[0260] SEQ ID No. 4: Genomic DNA sequence of FAD2 A1 from Brassica napus.
[0261] SEQ ID No. 5: cDNA sequence of FAD2-A1 from Brassica napus.
[0262] SEQ ID No. 6: protein sequence of FAD2-A1 from Brassica napus.
[0263] SEQ ID No. 7: Genomic DNA sequence of FAD2-C1 from Brassica napus.
[0264] SEQ ID No. 8: cDNA sequence of FAD2-C1 from Brassica napus.
[0265] SEQ ID No. 9: protein sequence of FAD2-C1 from Brassica napus.
[0266] SEQ ID No. 10: Genomic DNA sequence of FAD2A2 from Brassica napus.
[0267] SEQ ID No. 11: cDNA sequence of FAD2-A2 from Brassica napus.
[0268] SEQ ID No. 12: protein sequence of FAD2-A2 from Brassica napus.
[0269] SEQ ID No. 13: Genomic DNA sequence of FAD2-C2 from Brassica napus.
[0270] SEQ ID No. 14: cDNA sequence of FAD2-C2 from Brassica napus.
[0271] SEQ ID No. 15: protein sequence of FAD2-C2 from Brassica napus.
[0272] SEQ ID No. 16: Genomic DNA sequence of FAD2-1 from Brassica rapa.
[0273] SEQ ID No. 17: cDNA sequence of FAD2-1 from Brassica rapa.
[0274] SEQ ID No. 18: protein sequence of FAD2-1 from Brassica rapa.
[0275] SEQ ID No. 19: Genomic DNA sequence of FAD2-2 from Brassica rapa.
[0276] SEQ ID No. 20: cDNA sequence of FAD2-2 from Brassica rapa.
[0277] SEQ ID No. 21: protein sequence of FAD2-2 from Brassica rapa.
[0278] SEQ ID No. 22: Genomic DNA sequence of FAD2-1 from Brassica oleracea.
[0279] SEQ ID No. 23: cDNA sequence of FAD2-1 from Brassica oleracea.
[0280] SEQ ID No. 24: protein sequence of FAD2-1 from Brassica oleracea.
[0281] SEQ ID No. 25: Genomic DNA sequence of FAD2-2 from Brassica oleracea.
[0282] SEQ ID No. 26: cDNA sequence of FAD2-2 from Brassica oleracea.
[0283] SEQ ID No. 27: protein sequence of FAD2-2 from Brassica oleracea.
[0284] SEQ ID No. 28: FAM primer HIOL101.
[0285] SEQ ID No. 29: VIC primer HIOL101.
[0286] SEQ ID No. 30: Reverse primer HIOL101.
[0287] SEQ ID No. 31: FAM primer HIOL103.
[0288] SEQ ID No. 32: VIC primer HIOL103.
[0289] SEQ ID No. 33: Reverse primer HIOL103.
[0290] SEQ ID No. 34: FAM primer HIOL109.
[0291] SEQ ID No. 35: VIC primer HIOL109.
[0292] SEQ ID No. 36: Reverse primer HIOL109.
[0293] SEQ ID No. 37: Genomic DNA sequence of FADS A1 from Brassica napus.
[0294] SEQ ID No. 38: protein sequence of FAD3-A1 from Brassica napus.
[0295] SEQ ID No. 39: cDNA sequence of FAD3-A1 from Brassica napus.
[0296] SEQ ID No. 40: Genomic DNA sequence of FAD3-A2 from Brassica napus.
[0297] SEQ ID No. 41: protein sequence of FAD3-A2 from Brassica napus.
[0298] SEQ ID No. 42: cDNA sequence of FAD3-A2 from Brassica napus.
[0299] SEQ ID No. 43: Genomic DNA sequence of FAD3A3 from Brassica napus.
[0300] SEQ ID No. 44: protein sequence of FAD3-A3 from Brassica napus.
[0301] SEQ ID No. 45: cDNA sequence of FAD3-A3 from Brassica napus.
[0302] SEQ ID No. 46: Genomic DNA sequence of FADS-C1 from Brassica napus.
[0303] SEQ ID No. 47: protein sequence of FAD3-C1 from Brassica napus.
[0304] SEQ ID No. 48: cDNA sequence of FADS-C1 from Brassica napus.
[0305] SEQ ID No. 49: Genomic DNA sequence of FADS-C2 from Brassica napus.
[0306] SEQ ID No. 50: protein sequence of FAD3-C2 from Brassica napus.
[0307] SEQ ID No. 51: cDNA sequence of FADS-C2 from Brassica napus.
EXAMPLES
[0308] Unless stated otherwise in the Examples, all recombinant DNA techniques are carried out according to standard protocols as described in Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY, in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA and in Volumes I and II of Brown (1998) Molecular Biology LabFax, Second Edition, Academic Press (UK). Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by R. D. D. Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK. Standard materials and methods for polymerase chain reactions can be found in Dieffenbach and Dveksler (1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, and in McPherson at al. (2000) PCRBasics: From Background to Bench, First Edition, Springer Verlag, Germany. Standard procedures for AFLP analysis are described in Vos et al. (1995, NAR 23:4407-4414) and in published EP patent application EP 534858.
Example 1Isolation of the DNA Sequences of Brassica FAD2 Genes
[0309] A TBLASTN homology search using the A. thaliana FAD2 gene sequence (At3G12120) was used as the query in a BLAST homology search of in-house databases of Brassica rapa sequences and of Brassica oleracea sequences. The BLAST analyses resulted in the identification of 2 FAD2 gene homologs for B. rapa (BrFAD2-1 (SEQ ID No. 16), BrFAD2-2 (SEQ ID No. 19), and 2 FAD2 gene homologs for B. oleracea (BoFAD2-1 (SEQ ID No. 22), BoFAD2-2 (SEQ ID No. 25). cDNAs corresponding to these sequences were predicted using FgeneSH software, and are depicted in SEQ ID No. 17, SEQ ID No. 20, SEQ ID No. 23, and SEQ ID No. 26, respectively. A BLAST homology search of an in-house database containing Brassica napus mRNA sequences using the B. rapa BrFAD2 gene sequences resulted in the identification of the cDNA sequences of B. napus BnFAD2-A1 (SEQ ID No. 5), and BnFAD2-A2 (SEQ ID No. 11). Based on gene structure predictions using the Fgenesh software or mRNA derived sequencing read abundance the corresponding coding sequences were identified. Similarly, a BLAST homology search of the in-house database containing Brassica napus mRNA sequences using the B. oleracea BoFAD2 gene sequences as a query resulted in the identification of the cDNA sequences of BnFAD2-C1 (SEQ ID No. 8), and BnFAD2-C2 (SEQ ID No. 14). The corresponding coding sequences were obtained following the above-mentioned gene structure prediction methods.
[0310] In order to retrieve the B. napus FAD2 gene sequences a BAC library was screened. Following standard GS-FLX sequencing of the positive library clones and de novo contig assembly using the 454 assembly software Newbler the gene sequences for BnFAD2-A1 (SEQ ID No. 4), BnFAD2-A2 (SEQ ID No. 10), BnFAD2-C1 (SEQ ID No. 7) and BnFAD2-C2 (SEQ ID No. 13) were identified.
[0311] The B. napus BnFAD2-A1, BnFAD2-C1, and BnFAD2-C2 genes, B. rapa BrFAD2-1 gene, and the B. oleracea BoFAD2-1 gene, encode FAD2 proteins of 384 amino acids (SEQ ID NOs: 6, 9, 15, 18, and 24, respectively).
[0312] The B. oleracea BoFAD2-2 gene contains a 1 nt deletion at a position corresponding to position 2608 of the BnFAD2-C2 gene (SEQ ID NO: 13) (i.e. the position after position 2726 of the BoFAD2-2 gene (SEQ ID NO: 25), resulting in a frameshift mutation, leading to a truncated protein of 290 amino acids (SEQ ID NO: 27).
[0313] The B. napus BnFAD2-A2 and B. rapa BrFAD2-2 genes contain missing nucleotides at a position corresponding to positions 2036-2042 of BnFAD2-C2 gene (SEQ ID NO: 13), leading to a frameshift and premature stopcodon in the coding sequence, resulting in truncated proteins of 136 amino acids (SEQ ID NO: 12 (BnFAD2-A2 protein and SEQ ID NO: 21 (BrFAD2-2 protein). The BnFAD2-A2 and BrFAD2-2 genes therefore represent nonfunctional pseudo-genes.
[0314] Alignment of the proteins encoded by the Brassica FAD2 genes as described herein are shown in
Example 2Expression Analysis of Brassica napus FAD2 Genes
[0315] The relative gene expression levels of Brassica napus FAD2 genes were determined through analysis of Illumina mRNAseq derived transcriptome databases obtained for multiple tissues and developmental stages. Gene expression levels were calculated taking into account a normalization step for the sequencing depth per database (target reads per million reads in the database) and for the target gene length (reads per kilobase per million reads in the database) [RPKM; Mortazavi A, Williams B A, McCue K, Schaeffer L, Wold B: Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods (2008), 5(7):621-628].
[0316] The result of the expression analysis is shown in
Example 3Generation and Isolation of Mutant Brassica napus Fad2 Alleles
[0317] Mutations in the FAD2 genes from Brassica napus identified in Example 1 were generated and identified as follows:
[0318] 30,000 seeds from an elite spring oilseed rape breeding line (M0 seeds) were preimbibed for two hours on wet filter paper in deionized or distilled water. Half of the seeds were exposed to 0.8% EMS and half to 1% EMS (Sigma: M0880) and incubated for 4 hours.
[0319] The mutagenized seeds (M1 seeds) were rinsed 3 times and dried in a fume hood overnight. 30,000 M1 plants were grown in soil and selfed to generate M2 seeds. M2 seeds were harvested for each individual M1 plant.
[0320] Two times 4800 M2 plants, derived from different M1 plants, were grown and DNA samples were prepared from leaf samples of each individual M2 plant according to the CTAB method (Doyle and Doyle, 1987, Phytochemistry Bulletin 19:11-15).
[0321] The DNA samples were screened for the presence of point mutations in the FAD2 genes causing the introduction of STOP codons in the protein-encoding regions of the FAD2 genes, or amino acid substitutions, by direct sequencing by standard sequencing techniques and analyzing the sequences for the presence of the point mutations using the NovoSNP software.
[0322] The following mutantfad2 alleles were thus identified:
TABLE-US-00007 TABLE2a mutationsinBnFAD2-A1 Ntpos Ntpos WT.fwdarw. WT.fwdarw. Plant Genomic cDNA AApos. mut mut name SEQID4 SEQID5 SEQID6 codon AA HIOL101* 2371 615 109 CAC.fwdarw. H.fwdarw.Y TAC
TABLE-US-00008 TABLE2b mutations in BnFAD2-C1 Ntpos Ntpos WT.fwdarw. WT.fwdarw. Plant Genomic cDNA AApos. mut mut name SEQID7 SEQID8 SEQID9 codon AA HIOL103 3223 620 101 TGG.fwdarw. W.fwdarw. TGA STOP
TABLE-US-00009 TABLE2c mutations in BnFAD-A2 Ntpos Ntpos WT.fwdarw. Wt.fwdarw. Plant Genomic cDNA AApos. mut mut name SEQID10 SEQID11 SEQID12 codon AA HIOL111 2057 798 CGA.fwdarw. STOP TGA
TABLE-US-00010 TABLE2d mutations in BnFAD-C2 Ntpos Ntpos WT.fwdarw. WT.fwdarw. Plant Genomic cDNA AApos. mut mut name SEQID13 SEQID14 SEQID15 codon AA HIOL109* 2327 721 109 TGG.fwdarw. W.fwdarw. TAG STOP
[0323] Footnotes*: Seeds comprising a mutant BnFAD1-A1 allele comprising the HIOL101 mutation, or a mutant BnFAD1-C2 allele comprising the HIOL109 mutation have been deposited at the NCIMB (NCIMB Ltd, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, Scotland, UK) on 26 Feb. 2015, under accession number NCIMB 42376, and NCIMB 42375, respectively.
Example 4Oil Composition in Seeds from Brassica napus Comprising BnFAD2-A1, BnFAD2-C1, BnFAD2-A2, and BnFAD2-C2 Knock-Out Alleles Grown in the Greenhouse
[0324] Brassica plants comprising mutant BnFAD2-A1, BnFAD2-C1, BnFAD2-A2, and BnFAD2-C2 alleles were crossed. Following selfing seeds from plants homozygous for BnFAD2-A1,Bn FAD2-C1, BnFAD2-A2 or BnFAD2-C2 mutations and combinations thereof, or wild type segregants (i.e. not comprising any mutant FAD2 allele that would impact the normal function of a FAD2 protein) were obtained based on molecular marker based selection of plants (see below).
[0325] The fatty acid composition of the seed oil of the above Brassica plants grown in the greenhouse was determined by extracting the fatty acyls from the seeds and analyzing their relative levels in the seed oil by capillary gas-liquid chromatography as described in WO09/007091.
[0326] Fatty acid composition was determined from plants grown in the greenhouse in seeds of the Brassica lines with mutant BnFAD2-A1, BnFAD2-C1, BnFAD2-A1, or BnFAD2-C2 alleles, and combinations thereof, and in wild-type segregants. Wild type check refers to a reference B. napus genotype that was not subject to EMS treatment.
[0327] Table 3 shows that the FAD2-A1 and the FAD2-C1 mutants have the highest effect on C18:1 levels in the seeds, and that addition of the FAD2-C2 mutant increases the levels of C18:1 even further. The FAD2-A2 mutant does not further contribute to the increase the levels of C18:1 in the seeds.
Example 5Oil Composition in Seeds from Brassica napus Comprising BnFAD2-A1, BnFAD2-C1, BnFAD2-A2, and BnFAD2-C2 Knock-Out Alleles Grown in the Field
[0328] Fatty acid composition and plant performance parameters were determined from plants grown in the field as described above in seeds of the Brassica lines with mutant BnFAD2 A1, BnFAD2-C1, BnFAD2 A2 or BnFAD2-C2 alleles, and combinations thereof, and in wild type segregants not comprising any of the mutant BnFAD2 alleles. The mutant genotypes were tested at three locations for two different geographic areas.
[0329] Fatty acid composition in the seed oil was determined as described above. In three locations of one of the geographic areas, the following plant performance parameters were determined: Vigor (VIG) at the 4-5 leaf stage on a scale 1-9, wherein 1=poor, 5=average, 9=vigorous; FloweringStart (DTF): the stage (in days after seeding) at which 10% is in flower; total level of saturated fatty acids (FASAT); Oil content (OIL) in the seed in % of whole seed; protein content (PROT) in the seed in % of whole seed; Glucosinolate content (GLU) in the seed in moles/gram seeds. Seed quality parameters were obtained through GC analysis. For the statistical analysis an ANOVA test was run. Contrasts between the mutant lines versus the corresponding null-segregants were subject to significance testing. Wild type check refers to a reference B. napus genotype that was not subject to EMS treatment.
[0330] Table 4 shows the plant performance parameters of the plants with the different combinations of the BnFAD2 mutant alleles for the three locations in geographical area A, and Table 5 shows the fatty acid composition in the seed oil of plants with the different combinations of the BnFAD2 mutant alleles in the field for the two different geographical areas A and B.
TABLE-US-00011 TABLE 5a Average C18:1 levels (% of oil weight in seed) and standard deviation (SD) in seeds of Brassica napus plants with different combinations of mutations in the BnFAD2-A1, BnFAD2-C1, BnFAD2-A2 and BnFAD2-C2 genes, grown in the field, bagselfed (BS) and open-pollinated (OP) in geographical area A. Bagselfed (BS) Open pollinated (OP) CI. CI. CI. CI. GENOTYPE C18:1 SE lower upper C18:1 SE lower upper HIOL101/HIOL103/HIOL109 (//) 57.85 0.48 56.90 58.80 58.61 0.50 57.63 59.60 HIOL101/HIOL103/HIOL109 (//C2) 59.57 0.48 58.62 60.52 61.10 0.48 60.17 62.03 HIOL101/HIOL103/HIOL109 (/C1/) 68.57 0.48 67.62 69.52 67.91 0.48 66.98 68.85 HIOL101/HIOL103/HIOL109 (/C1/C2) 65.60 0.48 64.65 66.55 66.82 0.48 65.89 67.75 HIOL101/HIOL103/HIOL109 (A1//) 68.78 0.48 67.84 69.73 67.99 0.48 67.06 68.92 HIOL101/HIOL103/HIOL109 (A1//C2) 71.78 0.48 70.83 72.73 71.83 0.48 70.90 72.76 HIOL101/HIOL103/HIOL109 (A1/C1/) 82.30 0.48 81.35 83.25 81.53 0.48 80.59 82.46 HIOL101/HIOL103/HIOL109 (A1/C1/C2) 84.59 0.48 83.64 85.54 83.07 0.48 82.13 84.00 HIOL101/HIOL111/HIOL103/HIOL109 (A1//C1/C2) 86.31 0.48 85.36 87.26 80.95 0.48 80.02 81.89 HIOL101/HIOL111/HIOL103/HIOL109 (A1///) 72.52 0.48 71.57 73.47 73.74 0.48 72.81 74.67 HIOL101/HIOL111/HIOL103/HIOL109 (A1///C2) 73.70 0.48 72.75 74.65 73.35 0.48 72.42 74.29 HIOL101/HIOL111/HIOL103/HIOL109 (A1//C1/) 85.38 0.48 84.43 86.33 81.79 0.48 80.86 82.73 HIOL101/HIOL111/HIOL103/HIOL109 (A1/A2//) 70.16 0.48 69.21 71.11 71.71 0.48 70.78 72.64 HIOL101/HIOL111/HIOL103/HIOL109 (A1/A2//C2) 72.64 0.48 71.69 73.59 71.93 0.48 71.00 72.86 HIOL101/HIOL111/HIOL103/HIOL109 (A1/A2/C1/) 83.81 0.48 82.86 84.76 81.80 0.48 80.87 82.73 HIOL101/HIOL111/HIOL103/HIOL109 (A1/A2/C1/C2) 85.86 0.48 84.91 86.81 82.22 0.48 81.28 83.15 Wild-type check 61.73 0.48 60.78 62.68 62.15 0.48 61.22 63.09 A1, A2 C1, C2 refers to presence of mutant alleles; refers to presence of wild-type alleles.
TABLE-US-00012 TABLE 5b Average C18:1 levels (% of oil weight in seed) and standard deviation (SD) in seeds of Brassica napus plants with different combinations of mutations in the BnFAD2-A1, BnFAD2-C1, BnFAD2-A2 and BnFAD2-C2 genes, grown in the field, caged and open-pollinated in geographical area B. Caged Open-pollinated CI. CI. CI. CI. GENOTYPE C18:1 SE lower upper C18:1 SE lower upper HIOL101/HIOL103/HIOL109 (//) 61.45 0.44 60.6 62.31 60.96 0.44 60.11 61.82 HIOL101/HIOL103/HIOL109 (//C2) 62.01 0.44 61.16 62.87 62.58 0.44 61.72 63.43 HIOL101/HIOL103/HIOL109 (/C1/) 66.18 0.45 65.3 67.06 66.19 0.44 65.34 67.05 HIOL101/HIOL103/HIOL109 (/C1/C2) 69.38 0.44 68.53 70.24 68.96 0.44 68.1 69.82 HIOL101/HIOL103/HIOL109 (A1//) 70.32 0.44 69.46 71.18 70.27 0.44 69.42 71.13 HIOL101/HIOL103/HIOL109 (A1//C2) 73.48 0.44 72.63 74.34 73.41 0.44 72.55 74.26 HIOL101/HIOL103/HIOL109 (A1/C1/) 81.99 0.47 81.07 82.92 79.31 0.44 78.45 80.16 HIOL101/HIOL103/HIOL109 (A1/C1/C2) NA NA NA NA 78.09 1.19 75.76 80.42 HIOL101/HIOL111/HIOL103/HIOL109 (A1//C1/C2) 85.08 0.65 83.8 86.36 79.83 0.58 78.7 80.97 HIOL101/HIOL111/HIOL103/HIOL109 (A1///) 74.74 0.44 73.88 75.6 73.97 0.44 73.12 74.83 HIOL101/HIOL111/HIOL103/HIOL109 (A1///C2) 74.96 0.44 74.1 75.81 74.67 0.44 73.82 75.53 HIOL101/HIOL111/HIOL103/HIOL109 (A1//C1/) 83.53 1.1 81.38 85.68 79.3 0.44 78.44 80.15 HIOL101/HIOL111/HIOL103/HIOL109 (A1/A2//) 71.64 0.44 70.78 72.5 72.44 0.44 71.58 73.29 HIOL101/HIOL111/HIOL103/HIOL109 (A1/A2//C2) 72.91 0.44 72.05 73.77 73.08 0.44 72.22 73.93 HIOL101/HIOL111/HIOL103/HIOL109 (A1/A2/C1/) 83.55 0.63 82.3 84.79 80.32 0.61 79.13 81.51 HIOL101/HIOL111/HIOL103/HIOL109 (A1/A2/C1/C2) 84.57 0.69 83.23 85.92 80.18 0.62 78.97 81.4 Wild-type check 65.51 0.44 64.65 66.37 65.52 0.44 64.66 66.37 A1, A2 C1, C2 refers to presence of mutant alleles; refers to presence of wild-type alleles. NA = not analyzed.
[0331] From Tables 5a and 5b, it can be seen that, similar to in the greenhouse, also in the field, the combination of the A1 and the C1 mutation leads to the highest levels of C18:1 in the seed oil. Addition of the C2 mutation further increases the levels of C18:1 in the seed oil, but addition of the A2 mutation has only a minor contribution, or does not contribute at all, to increased C18:1 levels in the seed oil.
[0332] From Table 4, however, it can be observed that the combination of the A1 and C1 mutations leads to a significantly reduced agronomic performance of the plants: the vigor levels are significantly reduced from a level of 6.5 for the wild-type segregant, to between 1.3 and 2.3 for the mutant plants comprising both the A1 and the C1 mutations. Also, the number of days to flowering (DTF) is increased, the oil content is decreased, the protein content is increased, and the levels of glucosinolates are increased of plants comprising the A1 and the C1 mutation.
[0333] The plants with high levels of C18:1 which do not show this reduced agronomic performance are the plants comprising the A1 and the C2 mutation.
[0334] In summary, these results show that combination of a mutant FAD2 allele of the BnFAD2-A1 gene and of the BnFAD2-C2 gene, results in plants with high levels of oleic acid without agronomic penalty. More specifically, this combination of mutations can lead to levels of oleic acid of about 73% to almost 75% without agronomic penalty.
Example 6Oil Composition in Seeds from Brassica napus Comprising Mutant FAD2 and Mutant FAD3 Alleles
[0335] Plants comprising the mutant FAD2 alleles of the BnFAD2-A1 gene and on the BnFAD2-C2 gene as described herein, were combined with mutant FAD3 alleles as described in WO2011/060946 (incorporated herein by reference). Therefore, Brassica plants comprising mutant BnFAD2-A1, BnFAD2-C2, BnFAD3-A1, BnFAD3-A2, BnFAD3-A3, BnFAD3-C1, and BnFAD3-C2 alleles were crossed. Following selfing seeds from plants homozygous for BnFAD2-A1, BnFAD2-A2, BnFAD3-A1, BnFAD3-A2, BnFAD3-A3, BnFAD3-C1, or BnFAD3-C2 mutations and combinations thereof, or wild type segregants (i.e. not comprising any mutant FAD2 or FAD3 allele that would impact the normal function of a FAD2 or FAD3 protein) were obtained based on molecular marker based selection of plants (see below and WO2011/060946).
[0336] The levels of fatty acids in the seed oil were determined from plants grown in the greenhouse and from plants grown in the field as described above and in WO2011/060946. Table 6 shows the fatty acid levels of the plants grown in the greenhouse, and Table 7 shows the fatty acid levels of the plants grown in the field.
[0337] For the plants grown in the field, the agronomic performance was determined by determining the following plant performance parameters: Establishment (EST1) at the 2-3 leaf stage on a scale 1-9, wherein 1=very thin, 5=average, 9=very thick; Vigor (VIG1) at the 5-6 leaf stage on a scale 1-9, wherein 1=poor, 5=average, 9=vigorous; FloweringStart (DTF): the stage (in days after seeding) at which 10% is in flower; FloweringEnd (EOF): the stage (in days after seeding) at which 10% remains in flower; Plant Height (HICM) at the stage of flowering end in cm; Maturity (MAT) on a scale 1-9 wherein 1=late, 5=average, 9=early; Days to maturity (DTM) in days after seeding; Lodging Resistance at Maturity (LOM) at the maturity stage on a scale 1-9 wherein 1=0 degrees (flat), 5=45 degrees, 9=90 degrees (upright); Yield (YLD) of the seeds in grams per plot at 8% moisture; Oil content (OILN) in the seed in % of whole seed; protein content (PRON) in the seed in % of whole seed; and Glucosinolate content (GLUN) in the seed in moles/gram seeds. The agronomic parameters are shown in Table 8.
[0338] These data show that, by combining the knock-out mutant FAD2 alleles of the BnFAD2-A1 and the BnFAD2-C2 genes with mutant alleles of five FAD3 genes, seed oil can be obtained with increased C18:1 levels up to about 73 to about 75% and with reduced C18:3 levels. Whereas the vigor levels of the plants in the field is slightly reduced, the seed yield of the plants in the field is not significantly changed.
Example 7Detection and/or Transfer of Mutant FAD2 Alleles into (Elite) Brassica Lines
[0339] The mutant FAD2 genes are transferred into (elite) Brassica breeding lines by the following method: A plant containing a mutant FAD2 gene (donor plant), is crossed with an (elite) Brassica line (elite parent/recurrent parent) or variety lacking the mutant FAD2 gene. The following introgression scheme is used (the mutant FAD2 allele is abbreviated to fad2 while the wild type is depicted as FAD2): [0340] BC1 cross: fad2/fad2 (donor plant)FAD2/FAD2 (elite parent) [0341] F1 plant: FAD2/fad2 [0342] BC2 cross: FAD2/fad2FAD2/FAD2 (recurrent parent) [0343] BC2 plants: 50% FAD2/fad2 and 50% FAD2/FAD2
[0344] The 50% FAD2/fad2 are selected using molecular markers (e.g. AFLP, PCR, Invader, TaqMan, KASP assay, and the like; see also below) for the mutant FAD2 allele (fad2). [0345] BC3 cross: FAD2/fad2 (BC1 plant)FAD2/FAD2 (recurrent parent) [0346] BC3 plants: 50% FAD2/fad2 and 50% FAD2/FAD2
[0347] The 50% FAD2/fad2 are selected using molecular markers for the mutant FAD2 allele (fad2). [0348] Backcrossing is repeated until BC4 to BC7. [0349] BC4-7 plants: 50% FAD2/fad2 and 50% FAD2/FAD2
[0350] The 50% FAD2/fad2 are selected using molecular markers for the mutant FAD2 allele (fad2). To reduce the number of backcrossings (e.g. until BC4 instead of BC7), molecular markers can be used specific for the genetic background of the elite parent. [0351] BC4-7 S1 cross: FAD2/fad2FAD2/fad2 [0352] BC4-7 S1 plants: 25% FAD2/FAD2 and 50% FAD2/fad2 and 25% fad2/fad2
[0353] Plants containing fad2 are selected using molecular markers for the mutant FAD2 allele (fad2). Individual BC4-7 S1 or BC4-7 S2 plants that are homozygous for the mutant FAD2 allele (fad2/fad2) are selected using molecular markers for the mutant and the wild-type FAD2 alleles. These plants are then used for seed production.
[0354] To select for plants comprising a point mutation in a FAD2 allele, direct sequencing by standard sequencing techniques known in the art can be used.
[0355] Alternatively, Invader technology (Third Wave Agbio) can be used to discriminate plants comprising a specific point mutation in an FAD2 allele from plants not comprising that specific point mutation. Discriminating Invader probes are thus developed to detect the presence or absence and the zygosity status of mutant alleles identified in Example 3, based on the single nucleotide difference between the mutant and wildtype allele. Briefly, probes specific for the mutant or corresponding wild-type target FAD2 gene and invading probes which can be used in combination with them are developed. Generally, each probe set consists of one probe specific for the mutant or the wild type target gene of which the first nucleotide after the 5 flap sequence matches with the nucleotide difference (the so-called primary probe) and one probe specific for the nucleotides upstream of the nucleotide difference (the so-called Invader oligo). The last nucleotide of the latter primer may match with the nucleotide difference in the mutant, but other nucleotides may be used as well for this last nucleotide as long as the primary probe and the Invader oligo are still able to form a single base overlap when hybridized to the target DNA to generate the specific invasive structure recognized by the Cleavase enzymes (Third Wave Agbio). The Invader assay procedure and interpretation of the data are performed as prescribed by the manufacturer (Third Wave Agbio). Briefly, 5 flap nucleotide sequences (flap1 for the mutant allele and flap2 for the wild-type allele) are cleaved from the primary probes in the primary phase of the Invader assay and are complementary to sequences in FRET cassette 1 and 2, respectively, and not complementary to the target mutant or wild type sequences. If the primary probes are cleaved in the primary phase and the flap1-probe and/or flap2-probe hybridise to FRET cassette 1 and 2, respectively, in the secondary phase, a signal is generated indicative of the presence in the sample of the mutant or corresponding wild-type target FAD2 gene, respectively.
[0356] Alternatively, KASP assays (KBioscience) can be used to discriminate plants comprising a specific point mutation in an FAD2 allele from plants not comprising that specific point mutation. Discriminating primers were developed to detect the presence or absence and the zygosity status of mutant alleles identified in Example 3. Briefly, forward primers specific for the mutant or corresponding wild-type target FAD2 gene and a reverse primer that can be used in combination with them were developed. The nucleotide at the 3 end of the forward primers corresponds to the nucleotide which differs between the mutant and the corresponding wild-type allele. The primers can be used in combination with fluorescent dyes, such as FAM and VIC according to the protocol as described by the manufacturer (KBioscience).
[0357] Primers to detect the presence or absence and the zygosity status of the mutant FAD2 alleles are shown in Table 9.
TABLE-US-00013 TABLE9 Forward(Fw)andreverse(Rv)primerstodetectmutant FAD2allelesandthecorrespondingwild-typealleles. FAMprobe:wild-typeallele,VICprobe:mutantallele Name Primer SEQID HIOL101 FwFAM GAAGGTGACCAAGTTCATGCTGTAGTCGCTGAAGGCGTGGTG 28 FwVIC GAAGGTCGGAGTCAACGGATTGTAGTCGCTGAAGGCGTGGTA 29 Rv TCTCTACTGGGCCTGCCAG 30 HIOL103 FwFAM GAAGGTGACCAAGTTCATGCTCGCACTCGTGGGCTATGACC 31 FwVIC GAAGGTCGGAGTCAACGGATTCCGCACTCGTGGGCTATGACT 32 Rv TCTACTGGGCCTGCCAAGGG 33 HIOL109 FwFAM GAAGGTGACCAAGTTCATGCTGTCCAGTTCACGCTCGGCTG 37 FwVIC GAAGGTCGGAGTCAACGGATTCGTCCAGTTCACGCTCGGCTA 38 Rv CCGTCGCTGTAAGGTCTTCCA 39